;doc

Федеральное государственное бюджетное учреждение
"Медико-генетический научный центр"
Российской академии медицинских наук
На правах рукописи
Омельченко Денис Олегович
ГЕНЕТИЧЕСКАЯ ХАРАКТЕРИСТИКА СПОНТАННО
ТРАНСФОРМИРОВАННЫХ МУЛЬТИПОТЕНТНЫХ МЕЗЕНХИМАЛЬНЫХ
СТРОМАЛЬНЫХ КЛЕТОК ЖИРОВОЙ ТКАНИ ЧЕЛОВЕКА
03.02.07 «генетика»
Диссертация на соискание ученой степени кандидата биологических наук
Научный руководитель:
д.б.н., проф. Д.В. Гольдштейн
Москва 2014
2
ОГЛАВЛЕНИЕ
ОГЛАВЛЕНИЕ ........................................................................................................................................2
ВВЕДЕНИЕ..............................................................................................................................................4
Актуальность темы исследования .....................................................................................................4
Цели и задачи.......................................................................................................................................7
Научная новизна и практическая значимость ..................................................................................7
Положения, выносимые на защиту ...................................................................................................8
Степень достоверности и апробация результатов ...........................................................................9
1. ОБЗОР ЛИТЕРАТУРЫ .....................................................................................................................12
1.1. Мультипотентные мезенхимальные стромальные клетки .....................................................12
1.2. Происхождение ММСК .............................................................................................................13
1.3. Цитогенетические исследования ММСК.................................................................................16
1.4. Роль ММСК из разных источников в возникновении сарком мягких тканей .....................20
1.5. Исследования профиля экспрессии ММСК ............................................................................28
1.6. Генная инженерия ММСК.........................................................................................................34
2. МАТЕРИАЛЫ И МЕТОДЫ .............................................................................................................41
2.1. Клеточные культуры и условия культивирования..................................................................41
2.2. Подсчет концентрации клеток в суспензии в камере Горяева ..............................................42
2.3. Криоконсервация и разморозка клеточных культур ММСК ЖТ ..........................................43
2.4. Получение моноклональных культур спонтанно трансформированных ММСК ЖТ.........44
2.5. Цитогенетическое исследование спонтанно трансформированных ММСК ЖТ человека 45
2.5.1. Приготовление препаратов рутинно окрашенных метафазных пластинок ..................45
2.5.2. Исследование рутинно окрашенных метафазных пластинок .........................................47
2.5.3. Статистический анализ данных цитогенетического исследования ...............................47
2.6. Сравнительный парный анализ транскриптома спонтанно трансформированных и
нормальных ММСК ЖТ человека ...................................................................................................48
2.6.1. Подготовка образцов клеточных культур трансформированных и нормальных ММСК
ЖТ человека для выделения тотальной РНК .............................................................................48
2.6.2. Выделение тотальной РНК из образцов клеточных культ ур..........................................49
2.6.3. Амплификация и измерение концентрации тотальной РНК ..........................................50
2.6.4. Гибридизация биотинилированной кРНК на микрочипе Illumina .................................50
2.6.5. Обработка первичных данных по интенсивности флуоресценции зондов перед
статистическим анализом .............................................................................................................51
2.6.6. Определение дифференциально экспрессированных транскриптов с помощью
алгоритма Significance analysis of microarrays (SAM)................................................................54
2.6.7. Функциональный анализ дифференциально экспрессированных между образцами
транскриптов..................................................................................................................................55
2.7. Исследование стабильной лентивирусной трансдукции спонтанно трансформированных
ММСК ЖТ человека .........................................................................................................................56
2.7.1. Отбор культуры клеток трансформированных ММСК ЖТ, способной к росту на
бессывороточной среде.................................................................................................................56
2.7.2. Лентивирусная трансдукция спонтанно трансформированных ММСК ЖТ человека 57
2.7.3. Селекция флуоресцентных клеток после трансдукции ...................................................59
2.7.4. Проточная цитометрия спонтанно трансформированных ММСК ЖТ человека .........59
2.7.5. Выделение ДНК из клеточных культур ............................................................................60
3
2.7.6. Точное определение концентрации выделенной ДНК ....................................................61
2.7.7. Измерение копийности трансгена в трансдуцированных клетках .................................62
2.7.8. Выделение белка TagGFP2 из трансдуцированных клеток ............................................64
2.7.9. Измерение концентрации белка TagGFP2 в трансдуцированных клетках....................65
3. РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ...................................................................................................66
3.1. Цитогенетическое исследование ..............................................................................................66
3.1.1. Хромосомный набор культур спонтанно трансформированных ММСК ЖТ человека
.........................................................................................................................................................66
3.1.2. Хромосомные аберрации в культурах спонтанно трансформированных ММСК ЖТ
человека..........................................................................................................................................74
3.2. Сравнительный парный анализ транскриптома нормальных и спонтанно
трансформированных ММСК ЖТ человека ...................................................................................77
3.2.1. Подготовка данных для анализа ........................................................................................77
3.2.2. Определение дифференциально экспрессированных транскриптов с помощью
алгоритма Significance analysis of microarrays (SAM)................................................................81
3.2.3. Связь дифференциальной экспрессии транскриптов с результатами
цитогенетического анализа ..........................................................................................................82
3.2.4. Функциональный анализ наиболее значимо изменившихся по экспрессии
транскриптов..................................................................................................................................85
3.2.5. Разнонаправленное изменение экспрессии транскриптов одного гена .........................93
3.2.6. Групповой функциональный анализ дифференциально экпрессированных генов ......94
3.3. Оценка потенциала спонтанно трансформированных ММСК ЖТ человека к стабильной
генетической модификации ...........................................................................................................101
3.3.1. Отбор культуры клеток трансформированных ММСК ЖТ, способной к росту на
бессывороточной среде...............................................................................................................102
3.3.2. Трансдукция культуры клеток спонтанно трансформированной культуры ММСК ЖТ
человека VA18_2 лентивирусным вектором с репортерным геном TagGFP2 ......................105
3.3.3. Анализ стабильности трансдукции и экспрессии трансгена при длительном
культивировании трансформированных ММСК ЖТ человека VA18_2 ...............................108
3.3.4. Селекция клеток трансформированных ММСК ЖТ человека VA18_2, стабильно
трансдуцированных лентивирусным вектором с репортерным геном TagGFP2 .................109
3.3.5. Количественная оценка копийности трансгена в клетках трансдуцированных
моноклональных культур VA2GFP_1k, VA2GFP_2k, VA2GFP_3k и VA2GFP_4k при
длительном пассировании ..........................................................................................................112
3.3.6. Количественное определение продукции трансгенного белка TagGFP2 в клетках
моноклональных культур VA2GFP_1k, VA2GFP_2k, VA2GFP_3k и VA2GFP_4k после
трансдукции лентивирусным вектором pLVT-TagGFP2-N при длительном
культивировании .........................................................................................................................115
4. ЗАКЛЮЧЕНИЕ ...............................................................................................................................119
5. ВЫВОДЫ ........................................................................................................................................123
СПИСОК СОКРАЩЕНИЙ И УСЛОВНЫХ ОБОЗНАЧЕНИЙ ......................................................125
СПИСОК ЛИТЕРАТУРЫ...................................................................................................................126
ПРИЛОЖЕНИЕ 1 ................................................................................................................................148
ПРИЛОЖЕНИЕ 2 ................................................................................................................................152
4
ВВЕДЕНИЕ
Актуальность темы исследования
Мультипотентные мезенхимальные стромальные клетки жировой ткани
(ММСК ЖТ) – это перспективный и популярный объект для генной инженерии и
клеточной терапии, благодаря наименее инвазивному способу получения в
достаточно больших для культивирования и трансплантации объемах.
Одним из важных вопросов при использовании стволовых клеток для
терапии является их безопасность в отношении риска неопластической
трансформации при выделении и ведении ex vivo. В процессе культивирования
ММСК претерпевают изменения, в результате которых наступает клеточное
старение и остановка деления. Неизбежно появляющиеся в ходе культивирования
мутации могут привести к неопластической трансформации клеток. Поэтому при
культивировании ММСК перед трансплантацией необходимо быть уверенным,
что клетки не изменили своего фенотипа и не накопили мутации, способные
инициировать неопластическую трансформацию и дать начало онкологическому
заболеванию в организме после трансплантации.
Многочисленные
исследования
ММСК
человека
показывают
противоречивую картину относительно вопроса оценки риска их спонтанной
трансформации in vitro [Bentivegna A. et al., 2013].
Большинство исследователей склоняются к мнению, что ММСК человека
гораздо больше генетически устойчивы ex vivo, чем например мышиные ММСК, и
в
культуре
без
дополнительной
серии
онкогенных
стимулов
не
трансформируются [Lund R.J. et al., 2012].
Описанные в литературе случаи, когда человеческие ММСК претерпевали
спонтанную трансформацию в культуре, приобретали свойства и фенотип
неопластических клеток и вызывали новообразования при трансплантации в
животных моделях, редки. Есть ряд работ, в которых описано явление спонтанной
5
трансформации ММСК человека, но процесс трансформации малоизучен [Rubio
D. et al., 2005; Røsland G.V. et al., 2009; Ning H. et al., 2009].
Возможной причиной противоречивости данных является отсутствие
специфических маркеров, отличающих истинно мезенхимальные стволовые
клетки. Из ткани при выделении получаются гетерогенные по фенотипу культуры
клеток мультипотентных мезенхимальных предшественников (ММСК), лишь
небольшой процент из них принадлежит к истинно стволовым клеткам. В связи с
этим узнать, из какой именно популяции клеток в гетерогенной культуре ММСК
возникли трансформированные клетки, часто не представляется возможным.
Общепринятым является мнение, что при соблюдении должной техники
безопасности, правильном выделении и культивировании ММСК человека,
полученные культуры и трансплантаты на их основе являются безопасными с
точки зрения риска туморогенеза [Centeno C.J. et al., 2010; Tarte K. et al., 2010;
Wang Y. et al., 2012].
В лаборатории генетики стволовых клеток ФГБУ «МГНЦ» РАМН из
первичных культур ММСК ЖТ человека, полученных от здоровых доноров, на
ранних пассажах после выделения были изолированы клетки с характерными
признаками неопластической трансформации - обладавших высокой скоростью
пролиферации, морфологическими изменениями и отсутствием контактного
ингибирования. Выделенные спонтанно трансформированные ММСК ЖТ
человека обладали фенотипом стволовых клеток-предшественников перицитов
CD146+. Результаты исследований морфо-функциональных характеристик таких
клеток [Ржанинова А.А. и др., 2010] позволили выдвинуть гипотезу о том, что
данные ММСК с неким комплексом мутаций присутствуют в нише нормальных
ММСК до выделения клеток из ткани, но в условиях давления организма в норме
их развитие подавляется присутствием нормального микроокружения. При
выделении в культуру и нарушении связей с нормальным микроокружением
клетки
с
аберрантным
фенотипом
выявляют
свою
функциональность.
Интересным является также тот факт, что ММСК считаются наиболее
6
вероятными клетками-инициаторами саркомогенеза – процесса, приводящего к
развитию опухолей мягких тканей [Xiao W. et al., 2013].
Современные
теории
саркомогенеза
и
накопленные
результаты
исследований свидетельствуют о том, что наиболее вероятными клеткамиинициаторами сарком (опухолей мезенхимального происхождения) являются
трансформированные ММСК [Mohseny A.B. & Hogendoorn P.C., 2011].
В связи с этим всестороннее изучение спонтанно трансформированных
ММСК ЖТ человека внесет вклад в изучение механизмов спонтанной
трансформации клеток мезенхимального происхождения в культуре, а также
безопасности применения ММСК в клинической практике.
Одной из основных характеристик для исследования неопластической
трансформации ММСК является их генетическая характеристика. Анализ
хромосомных аберраций и профиля экспрессии генов данных клеток позволит
охарактеризовать процесс спонтанной неопластической трансформации в данном
случае.
Также интересной областью практического применения спонтанно
трансформированных ММСК ЖТ является продукция рекомбинантных белков
человека. Полученные спонтанно трансформированные ММСК ЖТ человека
обладают необходимыми характеристиками неопластических клеточных линий,
применяемых для этих целей: высокая скорость пролиферации, отсутствие
контактного ингибирования, способность расти в минимальной среде, не
содержащей сыворотку крови. Данных о получении генно-модифицированных
неопластически трансформированных ММСК из тканей человека в литературе не
имеется. Это делает их привлекательным объектом для генной инженерии
несмотря на то, что на сегодняшний день создано множество генномодифицированных
нормальных
ММСК
человека,
экспрессирующих
терапевтические гены. Оценка способности спонтанно трансформированных
клеточных
культур
ММСК
ЖТ
модификации даст возможность
человека
к
постоянной
их использования
в
генетической
качестве нового
7
перспективного источника генетически-модифицированных клеток для нужд
биотехнологии и биомедицины.
Цели и задачи
Целью данной работы явилось исследование генетических характеристик
спонтанно трансформированных ММСК ЖТ человека.
Задачи исследования:
1.
С помощью цитогенетического анализа определить хромосомный
набор и аберрации исследуемых трансформированных клеток.
2.
Провести сравнительный парный анализ транскриптома образцов
спонтанно трансформированных и нормальных ММСК ЖТ человека для
определения характерного профиля экспрессии трансформированных клеток.
3.
Провести
функциональный
анализ
дифференциально
экспрессированных транскриптов для выявления генов и сигнальных путей,
затронутых трансформацией.
4.
Оценить
возможность
внесения
постоянной
генетической
модификации в геном спонтанно трансформированных ММСК ЖТ человека с
помощью лентивирусной трансдукции.
5.
Оценить
стабильность
трансгенной
системы
на
основе
трансформированных ММСК ЖТ человека.
Научная новизна и практическая значимость
В данной работе впервые проведен комплексный анализ генетических
характеристик нового объекта – спонтанно трансформированных ММСК ЖТ
человека. Показаны изменения, произошедшие с клетками в результате
трансформации, как на уровне хромосом, так и на уровне транскрипции.
Обнаружен высокий уровень структурных хромосомных аберраций, а также
показан
характерный
амплификацией
профиль
центросом
и
экспрессии
хромосомной
генов,
согласующихся
нестабильностью
с
спонтанно
8
трансформированных ММСК ЖТ человека. Впервые было показано, что профиль
экспрессии спонтанно трансформированных ММСК ЖТ человека ассоциируется с
нарушениями в сигнальных путях AKT и RHOA, а также RAS (RalA и RalB),
ATR/ATM и E2F, что позволило расширить представления о причинах
спонтанной трансформации ММСК человека в культуре.
Из 30-ти наиболее значимо изменивших экспрессию транскриптов впервые
показана аберрантная экспрессия 6 генов (HSPB6, PLAC9, FEZ1, DTWD1,
APH1A,
ATP5L),
которые ранее не ассоциировали с неопластической
трансформацией клеток. Возможно, аберрантная экспрессия этих генов является
маркерной для неопластической трансформации ММСК ЖТ человека.
Впервые была исследована эффективность лентивирусной трансдукции
спонтанно
трансформированных
ММСК
ЖТ
человека.
Спонтанно
трансформированные ММСК ЖТ человека эффективно трансдуцируются
лентивирусным вектором и, при селективном отборе клонов, стабильно
экспрессируют трансген при длительном пассировании. Получение на основе
данных клеток продуцентов рекомбинантных терапевтических белков будет
способствовать развитию биотехнологии и биомедицины.
Положения, выносимые на защиту
1. У спонтанно трансформированных ММСК ЖТ человека наблюдается
хромосомная нестабильность.
2. Хромосомная нестабильность и наблюдаемые аберрации появилась
вследствие амплификации центросом и последующего мультиполярного
митоза.
3. Спонтанная
трансформация
ММСК
ЖТ
человека
в
культуре
ассоциируется с нарушениями в сигнальных путях AKT и RHOA, а также
RAS (RalA и RalB), ATR/ATM и E2F.
4. 6 из 30-ти наиболее значимо изменившихся по экспрессии генов (HSPB6,
PLAC9, FEZ1, DTWD1, APH1A, ATP5L) ранее не упоминалась в
литературе в связи с неопластической трансформацией. Данные гены
9
являются новыми потенциальными маркерами трансформации ММСК
ЖТ человека.
5. Cпонтанно трансформированные ММСК ЖТ человека эффективно
трансдуцируются лентивирусом. После селекции трансдуцированные
клетки стабильно экспрессируют трансген и нарабатывают белок в
течение 25 пассажей.
Степень достоверности и апробация результатов
Результаты, отражающие основные этапы диссертационной работы были
представлены в виде устных докладов на ежегодных конференциях молодых
ученых ФГБУ «МГНЦ» РАМН в 2011-2013 г.г., а также опубликованы в виде
тезисов на IV международном конгрессе «Stem Cells and Tissue Formation.
Quantitative stem cell biology – From models to applications» в 2012 г. (Дрезден.
Германия), на конкурсной конференции молодых ученых ФГБУ «МГНЦ» РАМН
в 2011-2013 г.г. (г. Москва), на V-ом Ежегодном Международном Симпозиуме
«Актуальные вопросы генных и клеточных технологий» в 2012 г. (г. Москва).
Проект
разработки
клеток-продуцентов
на
основе
спонтанно
трансформированных ММСК ЖТ человека стал одним из победителей
конкурсной конференции У.М.Н.И.К.-2012.
Работа апробирована и рекомендована к защите на заседании научного
семинара ФГБУ «МГНЦ» РАМН 4 декабря 2013 года.
Основные результаты напечатаны в научных журналах, рекомендуемых
ВАК:
1.
Омельченко Д.О., Ржанинова А.А., Федюнина И.А., Ржанинова
Е.Е., Кириенко Е.Е., Гольдштейн Д.В. Анализ хромосомного набора и
аберраций в спонтанно иммортализованных мультипотентных мезенхимных
стромальных клетках из разных тканей человека // Медицинская генетика.
– 2012. – Т. 11, № 11. – С. 32-36.
10
2.
Ржанинова
Неопластическая
А.А.,
Омельченко
трансформация
Д.О.,
Федюнина
мультипотентных
И.А.
мезенхимальных
стромальных клеток в культуре in vitro // Медицинская генетика. – 2013. –
Т. 12, № 3. – С. 20-28.
3.
Омельченко
Сравнительный
Д.О.,
парный
Ржанинова
анализ
А.А.,
Гольдштейн
транскриптома
Д.В.
спонтанно
трансформированных мультипотентных стромальных клеток жировой ткани
человека // Генетика. – 2014. – Т. 50, № 1. – C.106-115.
4.
Омельченко Д.О., Ржанинова А.А., Федюнина И.А., Ратушный
А.Ю., Гольдштейн Д.В. Эффективность лентивирусной трансдукции
спонтанно
трансформированных
мультипотентных
мезенхимных
стромальных клеток жировой ткани (ММСК ЖТ) человека // Медицинская
генетика (тезисы конкурсной конференции молодых ученых ФГБУ «МГНЦ»
РАМН). – 2013. С. 6.
5.
A. Rzhaninova, D. Omelchenko, I. Fedyunina, D. Goldshtein
Spontaneous transformation of cultured MSCs is the result of cellular stress but not
replicative senescence // 4th International Congress on Stem Cells and Tissue
Formation. – 2012. С. 204.
6.
Омельченко Д.О., Ржанинова А.А., Федюнина И.А., Кириенко
Е.Е., Гольдштейн Д.В. Цитогенетическое исследование клеточных линий
спонтанно иммортализованных перицитов из ММСК разных тканей человека
// V Ежегодный Международный Симпозиум «Актуальные вопросы
генных и клеточных технологий» (тезисы). – 2012. С. 42.
7.
Омельченко Д.О., Ржанинова А.А., Федюнина И.А., Ржанинова
Е.Е., Гольдштейн Д.В. Сравнительный парный анализ профиля транскрипции
генов спонтанно иммортализованных ММСК жировой ткани человека //
Медицинская генетика (тезисы конкурсной конференции молодых ученых
ФГБУ «МГНЦ» РАМН). – 2012. С. 11.
11
8.
Е.Е.,
Омельченко Д.О., Ржанинова А.А., Федюнина И.А., Кириенко
Гольдштейн
Д.В.
Цитогенетическое
исследование
спонтанно
трансформированных периваскулярных ММСК из разных тканей человека //
Медицинская генетика (тезисы конкурсной конференции молодых ученых
ФГБУ «МГНЦ» РАМН). – 2011. С.16-17.
12
1. ОБЗОР ЛИТЕРАТУРЫ
1.1. Мультипотентные мезенхимальные стромальные клетки
Мезенхимальные
стволовые
клетки
(МСК)
–
это
группа
недифференцированных клеток-предшественников, которые могут быть найдены
во многих тканях взрослого организма. Они обладают широкой пластичностью и
способны дифференцироваться в различные клетки мезенхимального фенотипа,
включая те, что формируют костную, хрящевую, мышечную, жировую и другие
ткани [Kuhn N.Z. & Tuan R.S., 2010]. Впервые они были обнаружены в костном
мозге (КМ) в середине 60-х годов советскими учеными А. Фриденштейном и И.
Чертковым, а термин «мезенхимальные стволовые клетки» ввел Caplan A.I. в 1991
году. Размноженные в культуре, эти клетки сохраняют способность к
дифференцировке в клетки тканей мезенхимального происхождения [Caplan A.I.
et al., 1991].
Одной из особенностей данной группы клеток является то, что до сих пор
не найдено специфического маркера, однозначно определяющего популяцию
МСК.
Выделяют данные клетки обычно по минимальным критериям,
установленным международным обществом по клеточной терапии (ISCT –
International Society for Cellular Therapy), в состав которых входит способность к
дифференцировке
в
трех
направлениях
(остеогенном,
хондрогенном
и
адипогенном), адгезивность к пластику и набор неуникальных поверхностных
маркеров [Dominici M. et al., 2006], что в результате дает при выделении в
культуре гетерогенную популяцию из клеток-предшественников и их более-менее
коммитированных потомков. Поэтому МСК, выделенные в культуру, принято
объединять под названием мультипотентные мезенхимальные стромальные
клетки или ММСК [Horwitz E. M. et al., 2005].
Ученые активно исследуют ММСК из-за ряда полезных свойств, которыми
эти клетки обладают. Они способны выделять различные цитокины и факторы
роста лимфоцитов и макрофагов, мигрировать в места воспалений и опухолевого
13
роста, дифференцироваться в широком спектре направлений, что открыло
перспективу их применения в регенеративной медицине и клеточной терапии
[Caplan
A.I.
et
al.,
2007;
Caplan
A.I.
et
al.,
2005].
Используя
эти
иммунорегуляторные способности, ММСК были успешно применены в терапии
ряда
аутоиммунных
воспалительных
заболеваний,
например,
реакции
"трансплантат против хозяина" [Le Blanc K. et al., 2008; Kuzmina L.A. et al., 2012].
Вместе
с
тем
результаты
исследований
противовоспалительного
и
иммунорегуляторного действия ММСК в некоторых случаях противоречивы и
требуют более детального изучения [English K., 2013].
В целом научное сообщество сходится во мнении, что ММСК являются
перспективными клетками для разработки новых подходов к лечению самых
разных заболеваний, но вместе с тем противоречивые результаты терапий,
отсутствие достоверных данных о спонтанной неопластической трансформации
ММСК человека и, следовательно, безопасности применения этих клеток в
терапии, требует дальнейшего детального изучения данных клеток [Dimarino
A.M. et al., 2013; Casiraghi F. et al., 2013].
Одной из основных причин подобного разнообразия наблюдаемых
эффектов заключается в гетерогенности выделяемых для исследований культур
ММСК из-за отсутствия уникальных специфичных маркеров. Это поставило
перед учеными проблему определения исходной популяции мезенхимальных
стволовых клеток и индивидуальных различий между культурами, полученными
из разных источников.
1.2. Происхождение ММСК
ММСК были найдены во многих тканях человека и мышей [Da Silva M.L. et
al., 2006; Kuhn N.Z. & Tuan R.S., 2010]: пупочном канатике, ЖТ, печени,
селезенке, поджелудочной железе, синовиальных оболочках, легком, почках и
коже, пупочном канатике и других (рисунок 1). Одним из объединяющих все эти
ткани компонентов являются кровеносные сосуды. Таким образом, поиски
источника
ММСК
привели
ученых
к
наиболее
вероятным
клеткам-
14
предшественникам ММСК - периваскулярным клеткам эндотелия кровеносных
сосудов, перицитам или клеткам Руже, что делает периваскулярное пространство
специфической тканевой нишей ММСК [Kalinina N.I., et al., 2011].
Рисунок 1. Разнообразие источников ММСК объединяется перицитами. Эти клетки
экспрессируют характерные поверхностные маркеры ММСК - CD90, CD73 и CD105, а также
собственные маркеры CD146 и CD140β. Обладают широкой пластичностью и всеми свойствами
ММСК. Модифицированная схема [Kuhn N.Z. & Tuan R.S., 2010].
Считается, что перициты являются предшественниками различных типов
клеток
мезенхимы
[Bouacida
A.
et
al.,
2012].
При
соответствующем
микроокружении они могут дифференцироваться в хондроциты или адипоциты
[Farrington-Rock C. et al., 2004]. В обогащенной перицитами культуре клеток
пульпы человеческого зуба наблюдается появление дентин-экспрессирующих
клеток, что дает повод предполагать дифференцировку перицитов в одонтобласты
[Alliot-Licht B. et al., 2005]. Также перициты, отобранные из культур клеток
человеческих скелетных мышц по маркерной экспрессии в них щелочной
фосфотазы,
могут
регенерировать
скелетные
мышечные
волокна
дистрофических иммунодефицитных мышах [Dellavalle A. et al., 2007].
в
15
Некоторые исследования привели к открытию схожих с перицитами
клеточных популяций мезангиобластов или миогенных стволовых клеток в
скелетных мышцах (muscle-derived stem cells, или MDSCs) – клетки, способные
регенерировать мышечные волокна эффективнее известных клеток-спутников
[Péault B. et al., 2007]. Мезангиобласты и MDSCs могут быть связаны с ММСК
или мультипотентными клетками-предшественники (MAPCs) в КМ, или
клетками-предшественниками других таканей [Caplan A.I. et al., 2005].
Для
исследования
клеток-предшественников
периваскулярной ниши
выделяются специфические маркеры мультипотентных перицитов. Комбинацию
специфичных маркеров периваскулярных клеток из тканей скелетных мышц,
поджелудочной железы, плаценты, белой ЖТ, а также сердца, легких, кожи,
мозга, глаз, кишечника, КМ и доношенных пупочных канальцев составляют
протеогликан NG2 и CD146 (S-endo1, Mel-CAM, Muc18 или гицерин) – антиген
эндотелиальных клеток, также экспрессирующийся на поверхности перицитов
[Middleton J. et al., 2005; Sacchetti B. et al., 2007]. Кроме того, все периваскулярные
клетки экспрессируют молекулы, характерные для микроокружения венул и
артериол - PDGF-Rβ (CD140β, рецептор к тромбоциторному фактору роста) и αSMA (альфа-актин гладкомышечных клеток). Периваскулярные клетки не
экспрессируют маркеры эндотелиальных клеток, такие как CD144 (VE-cadherin),
von Willebrand фактор (vWF), CD34, CD31 и лектиновый лиганд.
С помощью метода FACS в культурах ММСК ЖТ человека были
обнаружены клетки фенотипа CD146+ CD34- CD45- CD56-, отличавшихся
высокой экспрессией CD146 и экспрессией щелочной фосфатазы [Dellavalle A. et
al., 2007]. Данные периваскулярные клетки продемонстрировали миогенный
потенциал на уровне, сравнимом с потенциалом CD56+ миогенных клеток. В
результате был определен фенотип предшественников ММСК перицитов: CD146+
NG2+ PDGFRβ+ ALP+ CD34- CD45- vWF- CD144-.
Дальнейшие
исследования
показали,
что
периваскулярные
клетки
сохраняют свой исходный фенотип и потенциал к дифференцировке даже после
изоляции из ткани и длительном культивировании. Клетки обладают устойчивым
16
хемотаксисом к продуктам деградации внеклеточного
матрикса клеток
млекопитающих, что свойственно всем клеткам-предшественникам in vivo и в
культуре [Reing J.E. et al., 2009].
Сравнение экспрессии специфических для ММСК из КМ и маркеров
перицитов показало, что периваскулярные клетки обладают хорошо узнаваемым
иммунофенотипом ММСК.
Внутри естественной периваскулярной ниши
перициты экспрессируют все типичные для ММСК маркеры [Caplan A.I. et al.,
2008]. Это говорит в пользу единства происхождения ММСК и перицитов. Также
периваскулярные
клетки
обладают типичным для
ММСК
потенциалом
дифференцировки в клетки тканей мезенхимального происхождения.
Наиболее предпочтительными для выделения и культивирования ММСК и
перицитов является ЖТ, так как в этой ткани концентрация стволовых клеток во
много раз превышает концентрацию в других источниках при одинаковых
объемах исходного материала. Получение данных стволовых клеток из ЖТ
приносит минимальный вред здоровью донора, в отличие от способа сбора клеток
из КМ. Перицитарная фракция ММСК ЖТ может быть подвергнута генетической
модификации
с
помощью
вирусной
трансдукции
(аденовирусные,
онкоретровирусные и лентивирусные вектора) с эффективностью от средней до
высокой [Kern S. et al., 2006; Strem B.M. et al., 2005; Wosnitza M. et al., 2007].
Таким образом, на настоящее время ЖТ является наиболее удобным и
перспективным источником ММСК для клеточной терапии, тканевой инженерии
и экспериментов с переносом генов [Nakagami H. et al., 2006; Strem B.M. et al.,
2005].
1.3. Цитогенетические исследования ММСК
В связи с растущей популярностью использования ММСК в биомедицине,
важным является факт подтверждения генетической стабильности полученных из
этой ткани культур клеток. Поскольку одним из главных условий клеточной
терапии является безопасность процедуры для пациента, в настоящее время
установлены четкие требования по проверке клеточных трансплантатов на
17
инфекционные
нестабильность
агенты,
токсичность
клеточных
и
туморогенность.
культур-трансплантатов
может
Генетическая
привести
к
нежелательным последствиям, обусловленным хромосомными аномалиями или
нарушением экспрессии генов.
Цитогенетические исследования в клеточной терапии первоначально
применялись лишь для определения доли клеток донора в тканях и органахмишенях реципиента [Владимирская Е.Б. и др., 2005]. При расширении
исследований по биологии стволовых клеток (СК) возник вопрос об их
генетической стабильности в процессе культивирования. Одним из основных
методов
анализа
генетической
изменчивости
культур
СК
является
кариотипирование и анализ хромосомных аберраций.
Культивирование ММСК проводится не только с целью увеличения их
количества, но и для освобождения от примеси клеток других фенотипов или
преддифференцировки в нужном направлении.
Однако при культивировании могут образовываться клетки с аберрантным
кариотипом и происходить отбор аномальных клеток с более высоким уровнем
пролиферации, чем у нормальных. Хромосомные перестройки в таких клетках
могут повлиять на предрасположенность к развитию онкологических заболеваний
у реципиента или являться прямой причиной злокачественной трансформации
[Duesberg P. et al., 2003; Tolar J. et al., 2007]. Так, согласно данным ряда
исследований, при увеличении объема клеточной массы методом пассирования в
культуре, появляются клетки с возникшими de novo нарушениями хромосомного
набора, дающие впоследствии аномальные клеточные линии. Среди аномалий
кариотипа ММСК одни авторы обнаруживают анеуплоидию — отличное от
нормального (46, XX или 46, XY) число хромосом, другие — выявляют
структурные аберрации хромосом. [Wang Y. et al., 2005; Tolar J. et al., 2007;
Lazennec G. & Jorgensen C. et al., 2008]. Также исследователи отмечают
сочетанные аномалии, при которых идентифицируют как анеуплоидный
хромосомный набор, так и структурно перестроенные хромосомы [Lazennec G. &
Jorgensen C. et al., 2008; Tolar J. et al., 2007]. Таким образом, отмечено, что
18
изменение количества генетического материала при пассировании может
привести к аномальному функционированию генома, что оказывает крайне
негативное влияние на клетку, вплоть до опухолевой трансформации [Burns J.S. et
al., 2008].
Несмотря на интенсивные исследования по биологии ММСК, результаты
исследований стабильности или кариотипических характеристик этих клеток не
однозначны. В научных трудах высказываются прямо противоположные точки
зрения на вероятность существования угрозы от кариотипических изменений в
культурах, применяемых для клеточной терапии. Большая часть авторов считает,
что
возникающие
хромосомные
аномалии
характеризуют
генетическую
нестабильность культуры, которая связана с потерей теломерной ДНК и может
вести к злокачественной трансформации [Shiras A. et al., 2007; Pathak S. et al.,
2002; Murnane J.P. et al., 2012]. Вместе с тем имеется мнение, что культуры с
кариотипическими изменениями не опасны для трансплантации, потому что их
доля в культуре незначительна [Buzzard J.J. et al., 2004].
Ряд работ по исследованию генетической стабильности ММСК в процессе
культивирования говорят в пользу длительного культивирования вплоть до 25
пассажа. При этом не наблюдается развития хромосомных нарушений или
нарушений в генетической стабильности клеток даже после преодоления лимита
Хейфлика (после 63 циклов удвоений). Есть рекомендации при потребности в
трансплантации культивированных ММСК применять их не позднее 6 пассажа,
при этом время культивирования не должно превышать 12 недель [Bernardo M.E.
et al., 2007; Lange C. et al., 2007; Mareschi K. et al., 2006; Soukup T. et al., 2006; Liu
L. et al., 2006].
Другие авторы в своих исследованиях указывают на возможность
спонтанной трансформации ММСК, выделенных из КМ и ЖТ [Meza-Zepeda L.A.
et al., 2008; Wang Y. et al., 2005], что доказывается индукцией и формированием
опухолей из этих клеток у животных in vivo [Serakinci N. et al., 2004].
Из-за противоречивости накопленных результатов, полученных рядом
авторов, единого мнения по вопросу сохранения СК нормального хромосомного
19
набора при пассировании до сих пор не существует [Baker D.E. et al., 2007;
Caisander G. et al., 2006; Suemori H. et al., 2006; Бочков Н.П. и др., 2007].
Противоречивость
литературных
данных может быть
обусловлена
несколькими причинами. Одной из них являются биологические свойства ММСК.
Другой
причиной может быть
применение авторами разных методик
культивирования и пассирования клеток. При длительном энзиматическом
пассировании клеток показано возникновение хромосомных аберраций в
культурах ММСК, а при механическом пассировании аномалий кариотипа в
клетках культур ММСК не наблюдается [Cowan C.A. et al., 2004; Mitalipova M.M.
et al., 2005; Shiras A. et al., 2007; Buzzard J.J. et al., 2004; Inzunza J. et al., 2004]. На
возникновение аномалий кариотипа культуры
СК
могут также влиять
индивидуальные особенности донора клеток. Так, известно, что употребление
донорами ряда сильнодействующих лекарственных средств, в значительной мере
повышает вероятность появления клеток с аберрантными кариотипами [Pilger A.
et al., 2000; Bajic V. et al., 2007]. Сходный эффект может наблюдаться, если на
момент получения биологического материала или незадолго до него донор
перенес острое инфекционное заболевание [Urazova O.I. et al., 2001; Giannelli F. et
al., 2003].
Даже при коротком культивировании вероятность злокачественной
трансформации может резко повыситься в результате как возникновения
геномных мутаций de novo, так и позитивной селекции существующих в
организме клонов клеток с аномальным кариотипом, которые получают
преимущество в размножении по сравнению с нормальными клетками [Бочков
Н.П. и др., 2009].
Вышесказанное
позволяет
предположить,
что
результаты
работ,
демонстрирующих аномальный кариотип в культурах ММСК, вероятно, могут
объясняться условиями культивирования или индивидуальными особенностями
доноров клеток. Клоны, несущие различные хромосомные аномалии, могут
различаться по своей потенциальной опасности. Так, трисомия по хромосоме 8 -
20
одна из наиболее частых аберраций при миелоидных злокачественных
заболеваниях.
По-видимому,
использование
стволовых
клеток,
в
частности,
мезенхимальных стволовых клеток, в клеточной терапии всегда сопровождается
определенным риском спонтанной или индуцированной трансформации, что
требует цитогенетического контроля стабильности клеток.
1.4. Роль ММСК из разных источников в возникновении сарком мягких
тканей
Сравнительно недавно была обнаружена связь между ММСК и онкозаболеваниями. Поскольку наиболее вероятным источником возникновения
опухолей мягких тканей является мезенхимальные стволовые клетки, будет
целесообразным осветить вопрос о том, какие опухоли могут произойти из ЖТ, и
в частности, из ММСК ЖТ.
Различные исследования показали способность ММСК ингибировать либо
наоборот поддерживать рост опухолей в зависимости от условий [Stagg J., 2008].
Также неопластически трансформированные в культуре ММСК мышей при
имплантации иммунодефицитным животным способны вызывать саркомы, в
частности, опухоли мягких тканей (СМТ) [Mohseny A.B. & Hogendoorn P.C.,
2011]. Саркомы относятся к большой группе злокачественных опухолей
мезенхимального происхождения [Nishio J., 2011], которые исторически
классифицируются на два основных типа: саркома мягких тканей (СМТ) и
первичная
остесаркома (ПОС) [Skubitz K.M. & D`Adamo D.R., 2007].
Альтернативная
особенностях
классификация
опухолей.
базируется
Согласно
на
молекулярно-генетических
этой классификации саркомы
также
разделяются на две большие группы. Одна группа включает в себя альвеолярную
рабдомиосаркому, миксоидную липомаркому, саркому Юинга и синовиальную
саркому, с характерными опухоле-специфичными транслокациями. Вторая группа
представлена лейомиосаркомой, злокачественной фиброзной гистоцитомой и
остеосаркомой
отличается
сложным кариотипом,
свидетельствующим о
21
серьезных генетических нарушениях и нестабильности [Helman L.J. & Meltzer P.,
2003].
На основе одной только гистологии есть более 50-ти различных типов
сарком [Fletcher C.D.M. et al., 2002]. Последние молекулярно-цитогенетические
исследования показали, что СМТ могут быть разделены на две главных категории
опухолей:
саркомы
с
определенными
генетическими
альтерациями,
характеризованными либо простыми хромосомными транслокациями, что
приводит к образованию фьюжн-генов (например, EWSR1-FLI1 в саркоме Юинга,
FUS-DDT3 в слизеподобной липосаркоме, и SS18-SSX в синовиальной саркоме),
либо определенными онкогенными мутациями (например, мутации KIT и
PDGFRA в желудочно-кишечных стромальных опухолях) [Iwasaki H. et al., 2009];
и саркомы, демонстрирующие множественные сложные кариотипические
нарушения без определенной структуры, включая злокачественную фиброзную
гистиоцитому (MFH), лейомиосаркому, и плеоморфную липосаркому [Iwasaki H.
et al., 2009]. К тому же, некоторые недифференцированные липосаркомы
обладают и специфичными хромосомными нарушениями и случайными
аберрациями. Известно также, что экспрессия химерных генов в ММСК человека,
таких как EWS-FLI-1, FUS-CHOP, PAX-FKHR и SYT-SSX может приводить к
формированию из этих клеток сарком, таких как саркомы Юинга [de Alava E. &
Gerald W.L., 2000], липосаркомы, альвеолярной рабдомиосаркомы [Charytonowicz
E. et al., 2009; Jain S. et al., 2010]. Данные фьюжн онкогены образуются в
результате множественных транслокаций в геноме [Pérez-Mancera P.A. & SánchezGarcía I., 2005].
Гистогенез СМТ – это спорный вопрос [Weiss S.W., 2002; Weiss S.W. et al.,
2007; Miettinen M., 2003]. Хотя определенные хромосомные транслокации и
получающиеся из этого фьюжн-гены могут играть важную роль в онкогенезе
многих СМТ, их клеточное происхождение остается неопределенным. Кроме
того, почти все плеоморфные саркомы не имеют какой-либо определенной
цитогенетической
аберрации,
они
обладают
сложными
кариотипами с
множественными генными нарушениями. MFH - типичная плеоморфная саркома,
22
которая, как полагали, была самой частой высокоуровневой опухолью среди СМТ
у взрослых [Iwasaki H. et al., 1982; Iwasaki H. et al., 1987]. Клеточное
происхождение MFH длительное время было неизвестно. Различные теории
утверждали, что опухоль может происходить из гистиоцитов, фибробластов, или
стволовых мезенхимальных клеток [Iwasaki H. et al., 1982, 1987, 1992; Yamate J. et
al.; 2007].
Было показано, что MFH делит иммунофенотип с периваскулярными
мезенхимальными клетками и фибробластами. MFH/плеоморфные саркомы могут
иметь общее происхождение из периваскулярных мезенхимальных стволовых
клеток, у которых есть потенциал для мультинаправленного дифференцирования
[Iwasaki H. et al., 1987, 1992].
В существующей теоретической модели возникновения и развития рака есть
гипотеза о том, что существует небольшая группа клеток, на основе которой
возникает и поддерживается опухоль. Этим клеткам дали название - стволовые
клетки рака (СКР). Такие клетки предположительно являются единственными
клетками во всей массе опухоли, способными реинициировать и поддерживать
рост опухоли [Vermeulen L. et al., 2008]. Также есть некоторые типы клеток более
предрасположенные, чем другие, к ракообразующим мутациям, что рано или
поздно приводит к образованию новой опухоли. Источником опухолеобразующих
клеток (ООК) не обязательно являются СКР, так как согласно теории первые
только инициируют новообразование опухоли, а вторые способствуют ее
развитию и распространению [Visvader J.E. et al., 2011]. Если применить эти
концепции к ММСК, то результаты разных исследований свидетельствуют о
возможной принадлежности ММСК к опухолеобразующим клеткам, способным
инициировать саркомогенез. Так несколько типов человеческих сарком были
воспроизведены in vivo с использованием мутантных ММСК с нарушением в
ключевых
сигнальных
путях,
или
гиперэкспрессирующих
некоторые
онкопротеины. Также ряд исследований направлен на то, чтобы выяснить
возможные специфические маркеры СКР сарком, отличающие их среди других
клеток опухоли [Dela Cruz F.S., 2013].
23
Модель возникновения сарком человека очень схожа с таковой как хорошие
модели образования СКР. Некоторые исследования показали, что СКР
демонстрируют характерные для ММСК свойства [Karsten U. & Goletz S., 2013].
СКР характеризуются экспрессией маркеров плюрипотентных стволовых клеток
OCT3/4, NANOG и SOX2 и способностью к самообновлению и поддержке
опухолевого роста в серии трансплантационных экспериментов на мышиных
моделях. Эти клетки также экспрессируют характерные маркеры ММСК [Naka N.
et al., 2010; Adhikari A.S. et al., 2010; Gibbs C.P. et al., 2005; Levings P.P. et al.,
2009] и сохраняют способность дифференцировки in vitro в адипогенном,
остеогенном и хондрогенном направлениях [Suva M.L. et al., 2009; Naka N. et al.,
2010; Gibbs C.P. et al., 2005]. Есть также исследования, в которых показано, что
некоторые свойства ММСК у СКР связаны с резистентностью к химиотерапии и
метастазировании опухолей [Adhikari A.S. et al., 2010; Fujii H. et al., 2009], и таким
образом могут быть ответственными за наблюдаемый рецедив опухоли [Honoki
K., 2010].
Саркомы иерархически организованы и поддерживаются субпопуляцией
стволовых клеток, способных генерировать весь спектр опухолевых клеток. СКР,
способные реиницировать опухоль, были найдены в остеосаркоме [Adhikari A.S.
et al., 2010; Gibbs C.P. et al., 2005; Levings P.P. et al., 2009], хондросаркоме [Gibbs
C.P. et al., 2005], саркоме Юинга [Suva M.L. et al., 2009] и синовиальной саркоме
[Naka N. et al., 2010]. Эти саркома-инициирующие клетки были определены по
способности образовывать сферические колонии (саркосферы) в жидком агаре и
при недостатке сыворотки в среде, а также по экспрессии маркеров "стволовости"
[Suva M.L. et al., 2009; Naka N. et al., 2010; Adhikari A.S. et al., 2010; Gibbs C.P. et
al., 2005; Levings P.P. et al., 2009; Fujii H. et al., 2009].
Мышиные ММСК особенно предрасположены к трансформации при
длительном культивировании in vitro и преимуществом клональной селекции у
трансформированных клеток [Li H. et al., 2007; Miura M. et al., 2006; Mohseny A.B.
et al., 2009; Tolar J. et al., 2007; Zhou Y.F. et al., 2006]. При инокуляции этих клеток
в иммунодефицитных мышей, происходит формирование сарком, по своим
24
гистопатологическим характеристикам напоминающим фибросаркомы [Li H. et
al., 2007; Miura M. et al., 2006] и остеосаркомы [Mohseny A.B. et al., 2009; Tolar J.
et al., 2007]. В этих работах трансформация мышиных ММСК ассоциируется с
аккумуляцией хромосомной нестабильности [Miura M. et al., 2006; Mohseny A.B.
et al., 2009; Tolar J. et al., 2007; Zhou Y.F. et al., 2006], мутаций p53 [Li H. et al.,
2007], или потерей CDKN2A/p16 [Mohseny A.B. et al., 2009]. Уделяется внимание
важности сторого контроля клеточного цикла в гомеостазе ММСК.
Сигнальный путь PI3K-AKT вовлечен в процессы клеточного выживания и
пролиферации, а также является нижерасположенным эффектором общим для
разных рецепторов факторов роста, аномально активированных в саркомах,
например, IGF1R, PDGFR или с-KIT [Helman L.J. & Meltzer P., 2003]. Также
сигнальный
путь
PI3K-AKT-mTOR
играет
важную
роль
в
развитии
леиомиосарком [Hernando E et al., 2007]. Мыши с гомозиготной делецией PTEN
(негативного регулятора PI3K-AKT пути) в гладкомышечных клетках развили
леиомиосаркому [Hernando E. et al., 2007]. Участие PTEN и PI3K-AKT в развитии
леиомиосаркомы также подтверждается дизрегуляцией этих сигнальных путей в
p53 дефицитных мышиных ММСК, способных формировать леиомиосаркому
[Rodriguez R. et al., 2011].
Контрольные точки клеточного
цикла играют ключевую роль в
поддержании клеточного гомеостаза. Мутации, затрагивающие процессы
регуляции клеточного цикла часто ассоциированы с развитием сарком [Helman
L.J. & Meltzer P., 2003].
Исследования
генетически
модифицированных
ММСК
мышей
продемонстрировали недостаток разных регуляторов клеточного цикла, например
p53, что запускает процесс трансформации клеток и образованию сарком
[Armesilla-Diaz A. et al., 2009; Rodriguez R. et al., 2009; Rubio R. et al., 2010]. В
сравнении с ММСК ЖТ дикого типа, дефицитные по p53 мышиные ММСК in vivo
дали начало опухоли, похожей на леиомиосаркому [Rubio R. et al., 2010]. Этот
результат затем подтвердился дифференциальным исследованием микроРНК, с
помощью которого было показано, что леиомиосаркома является злокачественной
25
опухолью, связанной с ММСК [Danielson L.S. et al., 2010]. В другом исследовании
было показано, что полная потеря экспрессии p53 в p21-/- p53+/- мышиными
ММСК ЖТ после длительного культивирования провоцирует клеточный рост,
нестабильность кариотипа, а потеря гена циклин зависимой киназы CDKN2A
(p16INK4A) предотвращает наступление физиологического старения,
что
приводит к формированию опухолей, подобных фибросаркомам, in vivo
[Rodriguez R. et al., 2009]. Схожим образом, изменения экспрессии генов циклин
зависимых киназ CDKN2A (p16INK4A) и p19 ARF были ассоциированы с
процессом трансформации ММСК [Rodriguez R. et al., 2009; Mohseny A.B. et al.,
2009]. Гиперэкспрессия c-MYC в p16 INK4A -/- p19 ARF -/- мышиных ММСК из
КМ приводила к образованию остеосаркомы, и потери способности к адипогенезу
[Shimizu T. et al., 2010]. Потеря генов циклин зависимого белка Rb и p53
усиливает развитие опухоли из мышиных ММСК в сторону формирования более
недифференцированной саркомы [Rubio R. et al., 2010].
Человеческие ММСК обладают большей генетической стабильностью.
Показано, что срок жизни человеческих ММСК зависит от донора и обычно на
15-25 пассаже наступает остановка деления [Bernardo M.E. et al., 2007;
Choumerianou D.M. et al., 2008; Gou S. et al., 2010; Grimes B.R. et al., 2009; Larson
B.L. et al., 2010; Tarte K. et al., 2010], при этом сравнительная геномная
гибридизация и цитогенетический анализ не показал наличие хромосомных
аберраций в клетках [Bernardo M.E. et al., 2007]. Иногда наблюдается
анеуплоидия, связанная с мозаицизмом клеток донора и не относящаяся к
следствию трансформации генома [Tarte K et al., 2010]. Вышеприведенные факты
дают основания предполагать, что ex vivo выращенные культуры ММСК человека
генетически стабильны.
Инактивация p53 или p53 вместе с Rb не провоцирует трансформацию
человеческих ММСК, хотя p53/Rb дефицитные ММСК человека демонстрируют
повышение скорости пролиферации и увеличенный срок жизни in vitro [Hung S.C. et al., 2004; Rodriguez R. et al., 2011]. Как правило, индуцированные опухоли
получают из искусственно трансформированных in vitro ММСK, редко из
26
спонтанно
трансформированных.
Опухоли,
полученные
in
vivo,
из
трансформированных искусственно ММСК человека, классифицированы как
недифференцированные веретеноклеточные саркомы [Funes J.M. et al., 2007; Li N.
et al., 2009; Shima Y. et al., 2007]. При трансфекции клеток плазмидами, несущими
гены малого Т или большого Т анитгена вируса SV40, или различного рода
онкогенов, какие как hTERT, H-RAS и BMI-1, удается трансформировать клетки.
Они теряют контактное ингибирование, приобретают способность к росту без
подложки и образуют опухоли в мышах после длительного культивирования in
vitro. Этот процесс связывают с делецией ink4a/ARF локуса и активационной
мутацией в K-RAS, инактивацией Rb и p53, стабилизацией c-MYC, что в свою
очередь приводит к постоянному митогенному сигналу [Serakinci N et al., 2004;
Funes J.M. et al., 2007; Li N. et al., 2009]. Также наблюдается постепенное
увеличение геномного метилирования, хотя этот феномен необязателен для
трансформации [Wild L. et al., 2010].
Помимо
инактивации
регуляторов
клеточного
цикла,
процесс
трансформации ММСК человека также связывают с изменениями в сигнальных
путях, таких как PI3K-AKT и WNT.
Сигнальный путь WNT/β-катенин играет ключевую роль в регулировании
баланса между самообновлением и дифференцировкой стволовых клеток и
клеток-предшественников [Fodde R. et al., 2007]. Путь WNT также регулирует
пролиферацию, дифференцировку и инвазивность ММСК человека [De Boer J. et
al., 2004; Neth P. et al., 2006]. В то время как эти функции могут быть полезны в
процессах регенерации тканей, аберрантная или неадекватная активация пути
WNT может нарушить баланс между пролиферацией, дифференцировкой и
апоптозом, приводя к злокачественной трансформации. Недавно проведенное
исследование подтверждает роль аберрантной стабилизации β-катенина в
усилении онкогенеза ММСК [Wu C. et al., 2010]. В этой работе разработка
мышиной модели с целевой мутацией онкогена APC показала связь между
агрессивным фиброматозом, мезенхимальной неоплазмой и ММСК. Нарушения в
сигнальном пути WNT пути у иммортализованных вирусом SV40 ММСК
27
человека
привела
к
злокачественной
трансформации
этих
ММСК
и
последующему формированию злокачественной фиброзной гистоцитомы (ЗФГ) in
vivo. Восстановление этого сигнального пути в клетках позволило остановить
трансформацию [Matushansky I. et al., 2007].
Также было показано, что экспрессия ключевых компонентов сигнального
пути WNT снижена в остеосаркоме по сравнению с нормальными человеческими
ММСК и ММСК, дифференцированными в остеобласты [Cleton-Jansen A.M . et
al., 2009]. Роль WNT сигналов в саркомах и карциномах отлична. Трансформация
ММСК человека и саркомогенез связаны с ингибированием WNT пути, тогда как
разные модели карцином связаны с мутационной активацией компонентов WNT
пути [Matushansky I. et al., 2007].
Большинство опубликованных работ по механизмам неопластической
трансформации сделаны на мышиных ММСК, однако мышиные модели не всегда
точно можно сопоставить с такого же рода процессами, идущими в человеческих
клетках. [Mestas J. & Hughes C.C.W., 2004]. Есть довольно много сведений о
расхождениях в свойствах клеток, профилей экспрессии и реакций на
молекулярные сигналы между клетками мыши и человека. Мышиные ММСК
гораздо
легче
подвергаются
как
спонтанной,
так
и
индуцированной
неопластической трансформации, тогда как человеческие ММСК редко
трансформируются спонтанно при тех же условиях.
Из вышенаписанного можно сделать следующие выводы: 1. ММСК
человека не предрасположены к спонтанной трансформации ex vivo; 2. мышиные
ММСК и животные-модели подчеркивают важность инактивации ключевых
регуляторов клеточного цикла и/или изменений других связанных с клеточным
циклом сигнальных путей для индукции развития сарком из ММСК или их
коммитированных
мезенхимальных
клеточных
линий;
3.
несколько
взаимосвязанных онкогенных мутаций должны работать совместно, чтобы
привести к развитию саркомы из человеческих ММСК и 4. Разные клеточные
популяции на разных стадиях развития в иерархии мезенхимальной череды
поколений клеток могут стать источником разных типов сарком.
28
1.5. Исследования профиля экспрессии ММСК
ДНК-микрочипы – это активно развивающаяся технология, позволяющая
провести анализ экспрессии одновременно нескольких тысяч генов или
генотипировать обширные участки генома. Определение профиля экспрессии
клеток с помощью данной технологии стало большим подспорьем в
исследованиях, Чаще всего для определения профиля экспрессии образца
требуется провести сравнительный анализ с заранее выбранным контрольным
образцом. Например, клетки прошедшие курс терапии различными веществами и
не прошедшие, или раковые и здоровые клетки. Единовременное определение
экспрессии
всех
транскриптов
позволяет
как
тестировать
заранее
предположенные исследователями гипотезы, так и давать исчерпывающую
информацию о состоянии процессов, протекающих в клетке, тем самым позволяя
выбирать наиболее интересные направления для дальнейших исследований.
Секвенирование человеческого генома предоставило базовую информацию
о местонахождении всех человеческих генов [Lander E.S. et al., 2001; Venter J.C. et
al., 2001]. Это знание вместе с появлением высокоплотной микрочиповой
технологии позволяет провести оценку глобальных паттернов экспрессии генов,
благодаря одновременному скринингу тысяч генов на микрочипе и сравнению
множества экспериментальных образцов. Применение микрочипового анализа
позволяет протестировать паттерны дифференциальной экспрессии генов между
множеством образцов для определения главных геномных различий и уникальных
биологических маркеров, специфичных для целевой популяции клеток [Menicanin
D. et al., 2009].
Скорость и направление биомедицинских исследований сейчас кардинально
меняется в связи с развитием техник высокопроизводительного скрининга.
Технологии микрочипов для определения экспрессии генов в настоящий момент
используются в исследованиях, изучающих сложные мультигенные процессы,
анализируя огромное количество взаимодействующих генов. Эти исследования
направлены на приобретение знаний кооперации множества семейств генов, и
29
природы их взаимодействий в различных биологических системах [Kallioniemi
O.P. et al., 2001; Han E. & Hilsenbeck S.G., 2001]. Достижения молекулярной
генетики и геномного профилирования привели к идентификации множества
потенциальных молекулярных биомаркеров или классифицирующих генов,
определяющих
уникальные
фенотипические
характеристики
исследуемой
популяции клеток [Takikita M. et al., 2007; Simon R., 2008]. Профилирование
генома также используется в крупномасштабных индустриальных проектах,
призванных
применить
геномные
исследования
для
открытия
новых
диагностических и терапевтических целей [Kallioniemi O.P. et al., 2001].
Технология микрочипов позволила проводить наблюдения, как экспрессии
отдельных генов, так и глобального профиля экспрессии клеток одновременно во
множестве различных популяций. Таким образом, возможность полногеномных
исследований экспрессии кардинально улучшила возможности по характеризации
ММСК, определению потенциальных биомаркеров и ключевых молекул,
вовлеченных в выживание, рост и развитие стволовых клеток.
Большинство опубликованных работ по исследованию транскриптома
ММСК
фокусируются
на
определении
профиля
экспрессии
генов,
характеризующих их «стволовость», их сравнения для ММСК из разных
источников, а также на изучении взаимосвязи биохимических путей и процессов,
контролирующих дифференцировку ММСК по разным направлениям.
Транскриптомный анализ также позволяет выявить ранее не изученные
гены, вовлеченные в процессы коммитирования и дифференцировки ММСК. [Liu
T.M. et al., 2007]. Например, уровень генов маркерных белков ZNF145 и FKBP5,
наиболее значимо увеличился в ММСК при коммитировании [Ikeda R. et al.,
2005], что свидетельствует об их важной роли в инициации и ускорении процесса
коммитирования
векторами,
предшественников.
несущими
гены
таких
Трансфекция
белков,
прогениторных
может
увеличить
клеток
выход
дифференцированных клеток. Это дает возможность управлять процессами
коммитирования клеток и их созреванием в нужном направлении.
30
Другим примером может служить масштабное профилирование экспрессии
генов при индукции остеогенной дифференцировки ММСК, которое показало
наличие определенных генных кластеров, управляющих разными стадиями
пролиферации, формирования и минерализации матрикса во время созревания
остеобластов [Kulterer B. et al., 2007]. Также с помощью микрочиповых анализов
были определены новые мишени для ядерного рецептора к витамину Д3 (VDR
receptor), связывающего основные остеогенные транскрипционные факторы,
которыми являются остеокальцин (OCN), спондин (SPN), дерматопонтин (DTP),
H1 гистаминовый рецептор (HRH1). [Christakos S. et al., 2003; Pochampally R.R. et
al., 2007]. Присутствие таких белков в микроокружении клеток или трансфекция
ММСК генами данных белков, например геном белка дерматопонтина,
увеличивает скорость остеогенной дифференцировки ММСК.
С помощью сравнения профилей экспрессии генов ММСК из КМ и ЖТ во
время их дифференцировки в остеогенном, адипогенном и хондрогенном
направлениях, ведется поиск ранее не изученных генов, экспрессия которых
повышается на ранних или поздних стадиях дифференцировки или влияет на
выбор направления дифференцировки. Так была обнаружена панель из 67 генов
молекулярного каскада реакций, связанных с адипогенезом ММСК человека и
задействованных в метаболизме углеводов и жиров [Sekiya I. et al., 2004]. Два гена
транскрипционных факторов из этой панели ранее не были ассоциированы в
адипогенезом, что дает возможность использовать их как новые мишени для
терапевтического вмешательства в процесс образования адипоцитов при
патологическом увеличении массы ЖТ.
Схожие исследования с помощью транскриптомного анализа выявили
паттерн генов, вовлеченных в хондрогенез человеческих ММСК [Goessler U.R. et
al., 2006]. Среди наиболее выраженных по измененной экспрессии гены таких
белков как интегрины, (интегрин α5β1), семейство белков ADAM и ADAMTS
(интегрин-связанные протеины) интегрин связанные протеогликаны [Djouad F. et
al., 2007], кадгерины и другие белки.
31
Еще одной важной задачей, которую можно решить с помощью
транскриптомного анализа, является оценка взаимодействия ММСК в очаге
воспаления или регенерации с резидентными клетками. Данный вопрос является
интересным при оценке терапевтического потенциала ММСК для регенерации
тканей. Например микрочиповый анализ позволил выявить экспрессию гена Tac1,
кодирующего
специфические
белки
нейротрансмитеры
(субстанция
Р,
нейрокинин А, нейропептиды), во время нейрональной индукции ММСК при их
имплантации в зону инсульта. Данные белки служат индикатором взаимодействия
между недифференцированными ММСК и микросредой поврежденных участков
ткани, что говорит об их выживаемости и функциональной активности в зоне
воспаления. [Greco S.J. & Rameshwar P., 2007].
Другие исследования с применением транскриптомного анализа в области
патологических состояний и регенерации центральной нервной системы,
посвященные терапевтическому потенциалу ММСК, выявили процесс слияния
ММСК и нейронов Пуркинье. Обнаруженные генные маркеры могут стать
терапевтическими мишенями при терапии нейродегенеративных заболеваний,
связанных с деградацией нейронов [Bae J.-S. et al., 2007; Woodbury D. et al., 2000;
Sanchez-Ramos J. et al., 2000].
Микрочиповый анализ является важным инструментом для развития
стратегий функциональной геномики и клинической практики применения
ММСК. Например были получены профили экспрессии хемокинов, цитокинов и
молекул адгезии при приживления стволовых клеток в инфарктный миокард,
которые потом сравнили с данными по соответствующим рецепторам и лигандам
для резидентных ММСК [Ip J.E. et al., 2007], а также мигрирующих в миокард
ММСК из КМ [Anversa P. & Nadal-Grinard B., 2002]. Эти данные могут пролить
свет
на
понимание
механизмов
регенерации,
идущих
с
участием
имплантированных клеток.
Микрочиповый анализ транскриптов используется для выявления общих
генных паттернов, характеризующих развитие и регенерацию сосудистой ткани,
опосредованную ММСК и профили экспрессии дифференцирующихся клеток
32
сердца и скелетных мышц. Сравнительный полногеномный анализ между
миобластами (кардиомиоцитами и клетками скелетных мышц) во время
миогенной дифференцировки и культурой ММСК [Akavia U.D. et al., 2008]
показал, что специфические факторы микроокружения сосудов способствуют
дифференцировке ММСК в гладкомышечные клетки (ГМК) [Park J.S. et al., 2004].
При
применение
исследовании
геномного
культивирования
потенциала
дифференцировки
профилирования
и состав
микросреды
помогает
для
ММСК
отработать
in
vitro
условия
индукции более глубокой
дифференцировки, в которой задействованы все потенциальные гены-мишени.
Использование таких протоколов культивирования и преддифференцировки
ММСК имеет важное значение в клинике [Tondreau T. et al., 2008].
Также одним из направлений исследований транскриптома является
переключение с одного пути коммитирования клеток-предшественников на
другой. Например,
Анализ с помощью микрочипов профиля экспрессии генов человеческих
ММСК ЖТ с нормальным кариотипом, хорошей способностью к самообновлению
и потенциалом дифференцировки в адипоциты и остеобласты, показал регуляцию
экспрессии генов на ранней стадии дифференцировки в обоих направлениях с
помощью микроРНК [Rodriguez A.-M. et al., 2004-2005; Zaragosi L.E. et al., 2006;
Elabd C. et al., 2007] МикроРНК задействованы в ранних механизмах регуляции
коммитирования, перед окончательным определением судьбы клетки [Scheideler
M. et al., 2008]. На сегодняшний момент профиль экспрессии микроРНК также
может служить характеристикой различной степени дифференцирования ММСК
и перицитов [Sorrentino A. et al., 2008].
Большим
направлением
исследований,
где
важную
роль
играет
транскриптомный анализ культур ММСК различного происхождения, является
идентификация стволовых клеток и прогениторов в гетерогенной культуре in
vitro. До сих пор это является трудной задачей, поскольку не найдены
абсолютные маркеры, однозначно определяющие стволовые клетки. Достоверно
можно утверждать, что иммунофенотип у ММСК из разных источников по
33
основным 22 маркерам существенно не различается [Wagner W. et al., 2005].
Однако внутри большой группы ММСК, выделенных из разных источников,
например из КМ, ЖТ и пупочного канатика, по профилю экспрессии генов могут
иметь различия. Кроме того, с помощью транскриптомного анализа удалось
идентифицировать панель из 25 генов, отличающих ММСК из разных источников
и одинаковых по иммунофенотипу, от немультипотентных фибробластов. Данная
панель маркеров в дополнении к иммунофенотипу может служить для более
точного определения мультипотентных предшественников по сравнению с
экспрессией отдельных маркерных генов. [Wagner W. et al., 2005]. Кроме того,
панель из 59 дифференциально экспрессированных генов характеризует некий
общий геномный профиль постнатальных популяций человеческих ММСК,
отличный от фетальных ММСК, выделенных из амниотической жидкости и
мембраны, крови пупочного канатика, фетальных тканей мозга, сердца, легкого,
почки и мышцы . [Tsai M.-S. et al., 2007]. Кроме того, каждая из популяции
ММСК имеет уникальный для свого источника геномный профиль. Данный
профиль экспрессии генов остается стабильным при росте и пассировании данных
популяций ММСК ex vivo.
Другим
перспективным
направлением
является
применение
транскриптомного анализа при идентификации происхождения резидентных
клеток какой либо ткани из различных популяций ММСК.
В качестве примера можно привести исследование профилей экспрессии
человеческих ММСК-подобных клеток, обнаруженных в пульпе зуба (СКПЗ), в
сравнении с ММСК, выделенными из КМ. Микрочиповый анализ около 4000
известных генов человека показал схожесть профиля экспрессии многих из этих
генов у ММСК КМ и популяции ММСК из пульпы зуба. Многие из этих генов
оказались задействованы в процессах дентиногенеза и минерализации. [Shi S. et
al., 2003].
Всесторонние знания о биологических процессах, участвующих в
репарации тканей жизненно необходимы при разработке подходов к тканевой
регенерации, основанных на использовании стволовых клеток. Чрезвычайно
34
важно знать природу и фенотип применяемых клеток, понимание регуляции
внутриклеточных процессов при репарации необходимо для получения
благоприятных клинических результатов. Знание функций генов, кодируемых
ими белков и связи этих белков с сетью белковых взаимодействий важно для
понимания молекулярных процессов, объясняющих потенциальную роль ММСК
в регенерации и репарации тканей. Исследования геномного профиля ММСК
позволяют
дать
генетическую
характеристику клеткам,
целенаправленно
манипулировать и модифицировать клетки или условия их роста, чтобы получить
наиболее оптимальную популяцию для выполнения поставленных задач. Сегодня
технологии геномного профилирования и развитие микрочиповых технологий
обеспечивают исследователям возможность быстро получить надежные сведения
о жизненных процессах роста, выживания и развития ММСК. Способность
ММСК к дифференцировке в разных направлениях делает из них идеальную
модель
для
определения
ключевых
молекулярных
переключателей
коммитирования клеток с помощью анализа профилей экспрессии генов.
1.6. Генная инженерия ММСК
Генная инженерия ММСК [Омельченко Д.О., 2013] предоставляет широкие
возможности
для
клеточной
трансфекции
ММСК
терапии.
интенсивно
Модифицированные с
исследуют
в
качестве
помощью
эффективных
транспортеров терапевтических белков зону повреждения при ткане-инженерной
заместительной терапии.
сохраняют
свои
После трансфекции модифицированные ММСК
иммунофенотипические,
пролиферативные
и
дифференцировочные свойства [McGinley L.М. et al., 2011; Payne N.L. et al., 2012;
Treacy O. et al., 2012; Park J.S. et al., 2013], а коммитированные потомки
трансдуцированных ретровирусами ММСК сохраняют стабильную экспрессию
трансгена [Lee K. et al., 2001; Lin P. et al., 2012]. Все вышеперечисленное делает
ММСК перспективным объектом для генной модификации с целью улучшения
собственных терапевтических свойств клеток, или для приобретения ими новых.
35
Для трансфекции ММСК применяют разные методы [Vargas A.E. et al.,
2012]. Их можно разделить на две больших группы – вирусные и невирусные
способы доставки трансгена. Невирусные методы трансфекции, основанные на
доставке плазмиды с трансгеном в целевую клетку c помощью химических
реагентов
или
электропорации
отличаются
безопасностью,
низкой
иммуногенностью и большой вместимостью плазмиды. Недостатком является
неспецифичность связывания и как следствие низкая эффективность доставки
трансгена.[L Santos J. et al., 2011; Madeira C. et al., 2010; L Santos J. et al., 2011;
Elsler S. et al., 2012; Flanagan M. et al., 2012; Hu Y. et al., 2013]. Нескольким
коллективам исследователей в недавно опубликованных работах удалось
преодолеть
недостаток низкой эффективности невирусной трансфекции,
оптимизировав ее условия [Helledie T. et al., 2008; Boura J.S. et al., 2013], что
позволяет повысить эффективность.
Вирусные методы трансфекции характеризуются высокой эффективностью,
возможностью получать как транзиентную, так и постоянную экспрессию
трансгена. При этом вирусные вектора имеют потенциальную патогенность, риск
онкогенной трансформации, способны вызывать иммунный ответ [Zhang X. &
Godbey W.T., 2006].
Трансдукцию
ММСК
проводят
разными
вирусными
векторами:
аденовирусными [Treacy O. et al., 2012; Li J.F. et al., 2013; Du Z. et al., 2013],
адено-ассоциированными
[Lu L.
et al., 2005; Locke M. et al., 2011],
онкоретровирусными и лентивирусными [Morizono K. et al., 2003; Schierling W. et
al.,
2008].
Наибольшую
рекомбинантными
популярность
лентивирусными
завоевал
векторами,
метод
благодаря
трансдукции
их
высокой
эффективности, широкому тропизму, способности интегрировать трансген в
геном целевой клетки и стабильно его экспрессировать на терапевтическом
уровне [McGinley L.M. et al., 2011; Moriyama H. et al., 2013]. Сейчас самыми
распространенными векторами являются лентивирусные вектора с сильными
промоторами
(например
цитомегаловирусный
промотор
CMV),
или
лентивирусные вектора с EF1-α промотором [Xia X. et al., 2007; Varma N.R.S. et
36
al., 2011; Škalamera D. et al., 2012]. Такой промотор обеспечивает стабильную и
эффективную экспрессию трансгена без подавления транскрипции в клетках при
длительном культивировании in vitro [Qin J.Y. et al., 2010; McGinley L. et al.,
2011]. Для усиления экспрессии также используется регуляторный элемент WPRE
[Real G. et al., 2011].
В литературе огромное количество сведений об успешной трансдукции
ММСК. Работы посвящены как оценке эффективности трансдукции ММСК из
разных источников разными вирусными векторами, так и практическому
применению модифицированных ММСК для изучения важных биологических
процессов клеток, саркомогенеза и самое главное для разработки новых стратегий
лечения на основе клеточной терапии модифицированными ММСК [Huang F. et
al., 2013Z; Cai T.Y. et al., 2013].
Трансдукция ММСК генами репортерных белков, например LacZ [Allay J.A.
et al., 1997], GFP [Zielske S.P. et al., 2009], репортерными радионуклидами [Zhang
G. et al., 2012] применяется для неинвазивного наблюдения за экспрессией
терапевтического белка in vivo, а также для наблюдения за перемещениями клеток
после трансплантации, и оценки эффективности трансфекции.
В работах, посвященных терапии заболеваний, генно-модифицированные
ММСК применялись к регенерации костной ткани [Cho S.W. et al., 2009; Lu C. H.
et al., 2013], мышечной репарации [Kocaefe Ç. et al., 2010], заболеваний ЦНС
[Payne N. L. et al., 2012], лечению диабета [Li Y. et al., 2007; Karnieli O. et al.,
2007], гемофилии A и B [Doering C.B., 2008; Coutu D.L. et al., 2011; Watanabe N. et
al., 2013], болезни Паркинсона [Lu L. et al., 2005; Li J.F. et al, 2013],
восстановлению инфаркта миокрада и ишемии [McGinley L.М. et al., 2011, 2013;
Madonna R. et al., 2013; Zhang L. et al., 2012].
Модифицированные ММСК пытаются применять в антираковой терапии,
как продуценты антираковых белков, но пока не было показано успешных
способов лечения в отношении людей [Porada C. D., Almeida-Porada G., 2010].
[Nakamura K. et al., 2004; Menon L.G. et al., 2009; Sasportas L.S. et al., 2009]. На
животных
показано
увеличение
выживаемости
при
применении
37
модифицированных ММСК, экспрессирующие интерферон-β, в случае с глиомой
[Nakamizo A. et al., 2005] и меланомой [Studeny M. et al., 2002].
Свойство ММСК мигрировать в места повреждений ткани также может
быть усилено генетической модификацией [Cheng Z. et al., 2008; Zhang D. et al.,
2008; Du Z. et al., 2013].
Среди опубликованных работ по применению модифицированных ММСК в
биомедицине почти нет исследований, посвященных применению таких клеток
для
белкового
производства.
Нет
работ
также
по
применению
иммортализованных ММСК, как клеточных линий с потенциалом продукции
терапевтических белков. Вместе с тем было бы интересно оценить способность
таких клеточных линий к генно-инженерной модификации с целью создания на
их основе эукариотической систем клеток-продуцентов рекомбинантных
терапевтических белков, наподобие клеток CHO.
Правильный выбор метода экспрессии рекомбинантных белков очень важен
для получения готового белкового продукта в заданный срок, в желаемом объеме
и качестве [Brondyk W.H., 2009]. Ошибка в выборе может привести к получению
неправильно собранных белков и/или слабой экспрессии. Также для правильной
работы каждого целевого белка необходима специфичная посттрансляционная
модификация, что осуществляется разными экспрессионными системами поразному и влияет на активность продукта. Есть много факторов, которые
необходимо учитывать при выборе системы экспрессии целевого белка: его масса,
количество
дисульфидных
связей,
тип
желаемой
посттрансляционной
модификации и назначение [Demain A.L. & Vaishnav P., 2009].
Первыми клетками, использованными для наработки рекомбинантных
белков, были бактерии E. coli. До сих пор они являются наиболее быстрым
способом получения простых рекомбинантных белков в больших количествах.
Белки, которые нарабатываются в цитоплазме клеток E. coli, продуцируются
эффективно и составляют в объеме до 30% биомассы бактерий [Jana S. & Deb
J.K., 2005]. Тем не менее, высокая экспрессия зачастую приводит к аккумуляции
агрегированного и нерастворимого белка, образующего тельца включения.
38
Скорость трансляции и сборки белков в E. coli почти в 10 раз выше наблюдаемой
скорости в эукариотичесих клетках, что предположительно сильно влияет на
образование телец включения из эукариотических белков [Andersson D.I. et al.,
1982; Goustin A.S. & Wilt F.H., 1982]. Тельца включения в некоторых случаях
могут создать существенные затруднения при получении чистого, растворимого и
активного белка. Хотя иногда получение агрегированных белков становится
преимуществом, так как они резистентны к протеолизу, легко концентрируются
центрифугированием, минимально загрязнены другими белками, и после
определенных усилий способны пересобираться в активные, растворимые формы
белков. Важно осознавать, что E. coli обладает ограниченными возможностями
посттрансляционной
модификации
белков
по
сравнению
с
клетками
эукариотических организмов. Они не имеют фермент-специфичного N-связанного
гликозилирования,
O-связанного
гидроксилирования,
ацилирования
гликозилирования,
остатками
аминирования,
миристиновой
кислоты,
пальмитирования или сульфатирования.
У дрожжей есть механизм посттрансляционной модификации добавляющий
гликаны к обоим аспарагиновым остаткам (N-связанное гликозилирование) и
серин/треониновым остаткам (О-связанное гликозилирование). Однако данные
полисахаридные
структуры
существенно
отличаются
от
модификаций
осуществляемых клетками насекомых и млекопитающих.
Системы экспрессии, основанные на клетках млекопитающих, обычно
считаются наименее эффективными для получения рекомбинантных белков по
сравнению с клетками из других источников. Стабильно трансфицированные
клетки яичника китайского хомяка (CHO) по данным литературы способны
экспрессировать рекомбинантные белки до нескольких грамм на литр и 50-90
пикограмм на клетку в день [Figueroa B. et al., 2007; Wurm F.M., 2004]. Но вместе
с тем, клетки млекопитающих содержат наиболее совершенные механизмы
сборки и образования дисульфидных связей по сравнению с другими клетками
для
экспрессии.
Получение
правильно
собранных
и
имеющих
все
соответствующие модификации белков является необходимым критерием для
39
изучения их активности in vitro и in vivo. Для гликопротеинов наличие
правильного N-гликозилирования и структуры полисахарида может оказать
существенное влияние на активность белка и потому должно учитываться при
выборе эукариотической системы экспрессии. N-гликозилирование положительно
влияет на структуру белка и повышает его стабильность и активность [Bhatia P.K.
& Mukhopadhyay A., 1999]. Если гликозилирование играет существенную роль в
функционировании белка, то предпочтительнее выбирать клетки-продуценты из
источника, сходного с источником рекомбинантного гена. Ни один другой
организм не справиться с правильной сборкой и посттрансляционной
модификацией рекомбинантных эукариотических белков человека также хорошо,
как клетки млекопитающих. CHO обычно используются для экспрессии
рекомбинантных белков в большом количестве. Например, большинство
представленных
в
данный
момент
на рынке терапевтических антител
производятся с помощью этих клеток. Стандартный метод получения клетокпродуцентов CHO заключается в трансфекции клеток CHO, дефицитных по
дигидрофолатредуктазе
(DHFR-deficient
CHO),
экспрессионной
кассетой,
содержащей ген DHFR и целевой ген [Wurm F.M., 2004].
К сожалению, весь процесс селекции и скрининга клеток занимает, по
меньшей мере, 2-3 месяца, тем самым образуя главный недостаток использования
CHO. Тем не менее, современные методы клеточной цитометрии и сортинга
увеличили скорость отбора и получения высокоэкспрессивных клонов [Browne
S.M. & Al-Rubeai M., 2009]. Другие способы усовершенстования метода также
были разработаны: например, использование специфичных цис-регуляторных
фрагментов ДНК фланкирующих кассету с рекомбинантным геном, что придает
свойство активной транскрипции сайтам интеграции кассеты [Kwaks T.H.J. & Otte
A.P., 2006]. К сожалению, большинство данных ДНК фрагментов запатентовано
биофармацевтическими кампаниями, и их использование требует покупку
лицензии. Даже не смотря на перечисленные усовершенствования эффективности
экспрессии в CHO, время получения стабильных высокоэкспрессивных клонов не
40
изменилось заметно с начала использования этих клеток в производстве
терапевтических белков.
В настоящее время разрабатываются новые клеточные системы экспрессии
на
основе
человеческих
клеточных линий.
Это
потенциально
лучшая
альтернатива так называемым «очеловеченным» клеточным системам экспрессии,
в которых специфические модификации и сборки рекомбинантных белков
человека, были добавлены генно-инженерным способом. Клеточные линиипродуценты на основе клеток человека, возможно, придут на смену мышиным
CHO, так как способны гликозилировать продуцируемые белки идентично
человеку, а не мыши. В литературе также не встречается сведений о прямом
сравнении продуктивности и качестве продукции между «очеловеченными» и
человеческими клетками-продуцентами [Swiech K. et al., 2012].
Так как в литературе не встречается работ, посвященных изучению
иммортализованных или трансформированных клеток ММСК как потенциальных
клеток-продуцентов для пролучения рекомбинантных терапевтических белков,
было
бы
интересно
изучить
этот
трансформированных ММСК человека.
вопрос
на
примере
спонтанно
41
2. МАТЕРИАЛЫ И МЕТОДЫ
2.1. Клеточные культуры и условия культивирования
Все культуры спонтанно трансформированных и нормальных ММСК ЖТ
человека, использованные в данной работе, были ранее получены по
оригинальному протоколу [Ржанинова А.А. и др., 2010] и депонированы в
криобанк лаборатории генетики стволовых клеток ФГБУ «МГНЦ» РАМН. Клетки
были выделены из липоаспирата 6-ти здоровых доноров разного пола (2 мужчин –
BL29, KR30 и 4 женщин - VA18, VO21, PU28, BB25) и возраста (39±13,97 лет).
В результате выделения клеток из липоаспирата по вышеуказанному
протоколу были получены культуры, обогащенные клетками с фенотипом
периваскулярных ММСК CD146+. В данных культурах на первых пассажах после
выделения из липоаспирата (2-3 пассаж) были замечены и выделены отдельные
колонии, отличавшиеся по морфологии и скорости пролиферации от общей
культуры. Клетки, полученные из этих необычных колоний, в культуре обладали
характерными чертами неопластически трансформированных. При этом имели
фенотип, сходный по основным маркерам с периваскулярными ММСК CD146+
(таблица 1) .
Таблица 1. Иммунофенотип ММСК ЖТ
Культуры ММСК ЖТ, доля
Неопластические культуры ММСК ЖТ,
Маркер
экспрессирующих клеток (%)
доля экспрессирующих клеток (%)
CD13
96,16±4,94
91,14±9,6
CD29
99,25±1,29
98,5±0,95
CD31
1,28±1,88
0
CD34
0,7±0,54
1,33±2.16
CD44
81,7±18,35
86,6±17,09
CD45
0
0
CD49a
73,18±17,76
26±18,56
CD63
57,6±31,49
2,42±3,15
CD73
93,5±7,36
58±29,95
CD90
100
95,75±2,16
CD105
67,2±14,4
15±10,98
CD140b
16,9±9,67
71,6±8,75
CD146
9,1±3,46
82,2±15,5
CD166
76±14,64
86,33±4,18
42
Все культуральные работы проводили в стерильных условиях под
ламинаром 2-го класса защиты LabGard ES NU-437-400 (NuAire, США).
Трансформированные и обычные клетки ММСК ЖТ человека культивировали в
стандартной ростовой среде для ММСК, содержащей DMEM с добавлением 10%
эмбриональной телячьей сыворотки (ЭТС) («ПанЭко», Россия), 4 мМ L-глутамина
(«ПанЭко», Россия), 10 нг/мл рекомбинантного основного фактора роста
фибробластов (ФРФ-2) («Prospec», США), 8 МЕ/мл гепарина-натрия («BRAUN»,
Испания), 100 мг/л амикацина («Красфарма», Россия). Среду заменяли каждые 2-3
дня.
Клетки инкубировали при стандартных условиях - в СO2 инкубаторе
IGO150 CELLlife (Jouan, Франция) при температуре 37°С, атмосфере 5% СO2 и
98% влажности, - до 80-90% конфлюентности в культуральных флаконах
CELLSTAR (Greiner bio-one, Германия, площадь поверхности 25, 75 или 175 см 2),
после чего пассировали. Старую среду сливали, монослой промывали раствором
Версена («ПанЭко», Россия), затем дезагрегировали клетки в суспензию
раствором трипсина-ЭДТА 0,05% с солями Хенкса («ПанЭко», Россия). Для этого
во флаконы вносили 1-3 мл раствора трипсина-ЭДТА, инкубировали флаконы в
СO2 инкубаторе при температуре 37°С до начала отслоения клеток от подложки.
Степень дезагрегации клеточного монослоя контролировали визуально с
помощью инвертированного микроскопа. Когда наблюдали открепление 90-100%
клеток (обычно через 2-3 минуты инкубации с трипсин-ЭДТА), во флакон
вносили 5-10 мл ростовой среды, содержащей ЭТС для инактивации трипсина.
Клетки хорошо ресуспендировали пипетированием, определяли концентрацию
клеток в суспензии в камере Горяева, после чего рассевали по новым флаконам в
плотности 6000-7000 клеток/см2.
2.2. Подсчет концентрации клеток в суспензии в камере Горяева
Тщательно протирали предметное и покровное стекло камеры Горяева 96%
этиловым спиртом. Покровное стекло притирали к предметному стеклу камеры
Горяева до плотной фиксации (образования радужных колец в местах контакта с
43
выступами предметного стекла). Клеточную суспензию хорошо перемешивали,
отбирали пипеткой небольшое количество суспензии и капали в щель под
покровное стекло до полного заполнения камеры, так чтобы в ней не
образовалось пузырьков воздуха. Клетки считали в инвертированном микроскопе
в 20-ти больших неразграфленных квадратах камеры Горяева по одной и 20-ти по
второй диагонали, по результатам подсчета вычисляли среднеарифметическое
количество клеток N. Клетку, расположенную на границе неразграфленного
квадрата считали расположенными внутри квадрата, если больше половины
клетки находилось внутри квадрата. Высота камеры 0,1 мм, площадь большого
2
квадрата 0,04 мм , следовательно клетки, посчитанные в одном большом
квадрате, находятся в объеме 0,004 мкл. Тогда число клеток в мл использованной
4
для подсчета суспензии равнялось Nx1,25х10 .
2.3. Криоконсервация и разморозка клеточных культур ММСК ЖТ
Для криоконсервации клетки предварительно культивировали в ростовой
среде DMEM с добавлением 10% ЭТС («ПанЭко», Россия), 4 мМ L-глутамина
(«ПанЭко», Россия), 10 нг/мл ФРФ-2 («Prospec», США), 8 МЕ/мл гепарина-натрия
(«BRAUN», Испания), 100 мг/л амикацина («Красфарма», Россия) в СO2
инкубаторе при температуре 37°С, атмосфере 5% СO2 и 90% влажности) на
2
культуральных флаконах 75 или 175 см CELLSTAR (Greiner bio-one, Германия)
до 90% конфлюентности. Клетки промывали раствором Версена («ПанЭко»,
Россия), затем дезагрегировали клетки в суспензию 2-3 мл раствора трипсинаЭДТА 0,05% с солями Хенкса («ПанЭко», Россия). Клеточную суспензию
смешивали с 10 мл ростовой среды для инактивации трипсина ЭТС. В ростовой
среде клетки переносили в центирфужные пробирки Falcon на 15 мл (Greiner bio one, Германия) и осаждали центрифугированием 10 минут при 1100 об./мин. на
центрифуге BR4i (Jouan, Франция). Надосадочную жидкость сливали, осадок
ресуспендировали в 1,8 мл ограждающего раствора (10% диметилсульфоксида
(DMSO) в ЭТС) и переносили в герметичные криопробирки c резиновыми
44
кольцами (Corning, США). Криопробирки замораживали сутки в пенопластовых
контейнерах в кельвинаторе на -80ºС со скоростью -1ºС в минуту, после чего
пробирки погружали в жидкий азот в дюары криобанка лаборатории.
Для выведения культур из заморозки криопробирки извлекали из дюара и
погружали на 1-2 минуты в водяную баню на 37ºС для быстрой разморозки. Для
промывки от ограждающего раствора суспензию из криобпробирок переносили в
центрифужные пробирки Falcon на 15 мл (Greiner bio-one, Германия), разбавляли
и перемешивали с 10 мл ростовой среды, затем осаждали центрифугированием 10
минут при 1100 об./мин. на центрифуге BR4i (Jouan, Франция). Надосадочную
жидкость сливали, клеточный осадок ресуспендировали в ростовой среде и
рассевали на новые культуральные флаконы.
2.4. Получение моноклональных культур спонтанно трансформированных
ММСК ЖТ
Для выделения отдельных клонов спонтанно трансформированных ММСК
ЖТ культуру клеток растили в стандартной культуральной среде для ММСК
клеток, содержащей DMEM с добавлением 10% ЭТС («ПанЭко», Россия), 4 мМ Lглутамина («ПанЭко», Россия), 10 нг/мл ФРФ-2 («Prospec», США), 8 МЕ/мл
гепарина-натрия («BRAUN», Испания), 100 мг/л амикацина («Красфарма»,
2
Россия) в культуральных флаконах 75 см CELLSTAR (Greiner bio-one, Германия)
в CO2 инкубаторе при 37ºС до 90% конфлюентности. Старую среду сливали,
монослой
промывали
раствором
Версена
(«ПанЭко»,
Россия),
затем
дезагрегировали клетки в суспензию добавляя к клеткам 2 мл раствора трипсинаЭДТА 0,05% с солями Хенкса («ПанЭко», Россия). Суспензию переносили в 15 мл
пробирки и добавляли 10 мл ростовой среды с ЭТС для инактивации трипсина,
хорошо пипетировали.
Концентрацию клеток в полученной суспензии
подсчитывали в камере Горяева, затем разводили суспензию ростовой средой до
концентрации 1 кл на 150 мкл и хорошо перемешивали, рассевали суспензию по
150 мкл/лунку в 96-луночные плашки (Greiner bio-one, Германия). Среду заменяли
45
каждые 2-3 дня. Рост колоний контролировали с помощью фазово-контрастной
микроскопии клеток, отмечали маркером на плашке лунки, в которых наблюдали
активную пролиферацию единичных колоний. В исследовании эффективности
стабильной лентивирусной трансдукции спонтанно трансформированных ММСК
ЖТ флуоресцентным белком дополнительно наблюдали за клетками с помощью
флуоресцентной микроскопии, отмечали единичные колонии с наиболее яркими
клетками и отсутствием не флуоресцирующих клеток.
2.5. Цитогенетическое исследование спонтанно трансформированных ММСК
ЖТ человека
2.5.1. Приготовление препаратов рутинно окрашенных метафазных пластинок
Культуры спонтанно трансформированных ММСК ЖТ (BL29, KR30, VA18,
VO21,
PU28,
BB25) и полученные из них моноклональные культуры
(VA18_1,2…5; PU28_1,2…5; KR30_1,2…5; BL29_1,2…5), прошли разное число
пассажей перед приготовлением препаратов, но все были исследованы до 14
пассажа
после
выделения.
Был подобран оптимальный протокол для
приготовления фиксированных препаратов спонтанно трансформированных
ММСК ЖТ [Омельченко Д.О. и др., 2012]:
1. Клеточные культуры предварительно культивировали в стандартной
культуральной среде для ММСК, содержащей DMEM с добавлением
10% ЭТС («ПанЭко», Россия), 4 мМ L-глутамина («ПанЭко», Россия), 10
нг/мл ФРФ-2 («Prospec», США), 8 МЕ/мл гепарина-натрия («BRAUN»,
Испания), 100 мг/л амикацина («Красфарма», Россия) в культуральных
флаконах 175 см
2
CELLSTAR (Greiner bio-one, Германия) в CO2
инкубаторе при 37ºС до 90% конфлюентности.
2. Колхицин («ПанЭко», Россия) в конечной концентрации 0,5 мкг/мл
внесли в культуральные флаконы и инкубировали 1 час 10 минут.
46
3. После инкубации среду из культуральных флаконов (20 мл) отбирали в
центрифужные пробирки Falcon на 50 мл (Greiner bio-one, Германия),
чтобы не потерять часть неприкрепившихся к подложке митотических
клеток. Прикрепленные клетки с флакона снимали с помощью 3 мл
раствора трипсина-ЭДТА, полученную суспензию клеток доливали в
центрифужные пробирки с отобранной средой из флаконов.
4. Суспензию клеток центрифугировали 10 минут при 1100 об./мин. на
центрифуге BR4i (Jouan, Франция), надосадочную жидкость сливали.
5. Осадок
осторожно
ресуспендировали
пипетированием
в
5 мл
предварительно прогретого 0,56% раствора KCl для гипотонизации,
переносили в центрифужные пробирки Falcon на 15 мл (Greiner bio-one,
Германия) и инкубировали 10-12 минут при 37°С. После инкубации
добавляли 3-5 капель свежеприготовленного ледяного фиксатора (смесь
метилового спирта и ледяной уксусной кислоты в соотношении 3:1) для
остановки гипотонизации.
6. Суспензию центрифугировали 10 минут при 1100 об./мин. на центрифуге
BR4i (Jouan, Франция), надосадочную жидкость слили.
7. Осадок клеток ресуспендировали в фиксаторе. Для этого к клеточному
осадку добавили по каплям 0,5 мл ледяного фиксатора, осторожно
ресуспендировали
клетки
пипетированием,
затем
довели
объем
суспензии фиксатором до 5 мл. Фиксатор всегда использовали только
свежеприготовленный и ледяной, т.е. предварительно охлажденный при
температуре -20°С в морозильной камере. Инкубировали суспензию в
холодильнике при температуре 4°С 10 минут
8. Центрифугировали 10 минут при 4°С и 1100 об./мин на центрифуге BR4i
(Jouan,
Франция).
Надосадочную жидкость
(фиксатор) удалили,
клеточный осадок ресуспендировали в новой порции ледяного фиксатора
указанным в
пункте 7 способом.
Инкубировали суспензию в
холодильнике при температуре 4°С уже 20 минут, после чего повторили
пункт 8.
47
9. Капали суспензию клеток на сильно охлажденные в морозильной камере
при -20°С влажные стекла на расстоянии ~1,5 см от стекла по 7 капель,
затем сушили сутки на столе при комнатной температуре. Оставшуюся
суспензию клеток в фиксаторе хранили в холодильнике при 4°С, при
необходимости повторного раскапывания стекол суспензию обязательно
осаждали, старый фиксатор сливали и ресуспендировали клетки в
свежеприготовленном ледяном фиксаторе.
10. Высушенные препараты красили, погружая стекла в краситель АзурЭозин на 7 минут, промывали в дистиллированной воде и высушивали,
обдувая воздухом из груши.
2.5.2. Исследование рутинно окрашенных метафазных пластинок
Исследование
окрашенных
метафазных
пластинок
спонтанно
трансформированных ММСК ЖТ проводили с помощью световой микроскопии
при малом (Х100) и большом (Х1000) увеличении с использованием
иммерсионного масла. Отбор метафазных пластинок осуществляли с учетом
четкости окраски, цельности метафазной пластинки, отсутствия или небольшого
числа
поперечных
наложений
хромосом,
степени
их
конденсации,
обособленности метафазных пластинок друг от друга [Захаров А.Ф. и др., 1982]. В
каждой метафазной пластинке проводили подсчет числа хромосом, а также
определяли наличие различных хромосомных аберраций. Всего для каждой
культуры клеток было проанализировано 30-50 метафазных пластинок.
2.5.3. Статистический анализ данных цитогенетического исследования
В работе были использованы следующие статистические методы: методы
описательной статистики, проверка соответствия распределений нормальному
закону с помощью W критерия Шапиро-Уилка, дисперсионный анализ и
множественные попарные сравнения для распределений, отличающихся от
нормального, с помощью специального варианта теста Краскела–Уоллиса.
48
Статистическая обработка данных проводилась с помощью программы Statistica 8
(«StatSoft», США). Различия считались статистически значимыми при рvalue<0,05.
2.6. Сравнительный парный анализ транскриптома спонтанно
трансформированных и нормальных ММСК ЖТ человека
2.6.1. Подготовка образцов клеточных культур трансформированных и
нормальных ММСК ЖТ человека для выделения тотальной РНК
Для исследования транскриптома были использованы культуры клеток
ММСК, выделенные их стромально-васкулярной фракции жировой ткани от 6-ти
разных доноров (2 мужчин и 4 женщин). Были сформированы 6 пар клеточных
культур - трансформированные и нормальные ММСК ЖТ человека, выделенные
из липоаспирата одного и того же донора. От 2 мужчин были вз яты в анализ
культуры трансформированных ММСК ЖТ – BL29, и KR30 и соответствующие
эти донорам культуры нормальных ММСК ЖТ. От 4 женщин в анализ были взяты
культуры трансформированных ММСК ЖТ - VA18, VO21, PU28, BB25 и
соответствующие эти донорам культуры нормальных ММСК ЖТ. Все образцы
клеток были выведены из заморозки на одинаковом пассаже (4 пассаж).
После разморозки и промывки от ограждающего раствора, клетки
высаживали в стандартную ростовую среду DMEM с добавлением 10% ЭТС
(«ПанЭко», Россия), 4 мМ L-глутамина («ПанЭко», Россия), 10 нг/мл ФРФ-2
(«Prospec», США), 8 МЕ/мл гепарина-натрия («BRAUN», Испания), 100 мг/л
2
амикацина («Красфарма», Россия) в культуральные флаконы 175 см CELLSTAR
(Greiner bio-one, Германия) и культивироали в CO2 инкубаторе при 37ºС до 90%
конфлюентности. Старую среду сливали, клетки промывали раствором Версена
(«ПанЭко», Россия), затем дезагрегировали в суспензию 3 мл раствора трипсинаЭДТА 0,05% с солями Хенкса («ПанЭко», Россия). После ингибирования
трипсина добавлением 10 мл ростовой среды, суспензии клеток переносили в
промаркированные центрифужные пробирки Falcon на 15 мл (Greiner bio-one,
49
Германия) и центрифугировали 10 минут при 1100 об./мин. на центрифуге BR4i
(Jouan, Франция). Надосадочную жидкость удаляли, а клеточный осадок (~910х106 клеток) использовали для выделения тотальной РНК с помощью TRIzol
reagent (Ambion, США). Процедуру выделения проводили согласно протоколу
производителя
[http://tools.lifetechnologies.com/content/sfs/manuals/trizol_reagent.pdf].
Выделение
тотальной РНК из культур клеток и гибридизация на РНК-микрочипе были
проведены в лаборатории компании ЗАО «Геноаналитика».
2.6.2. Выделение тотальной РНК из образцов клеточных культур
Для выделения тотальной РНК каждый осадок клеток лизировали в 1,5 мл
пробирках в 1 мл TRIzol reagent (Ambion, США) и многократным пипетированием
суспензии
доводили
до
полной
гомогенизации.
Затем
гомогенаты
центрифугировали 10 минут на скорости 12000×g при 4°C, чтобы избавиться от
избытка
жиров,
белков,
полисахаридов
и
высокомолекулярной
ДНК.
Надосадочную жидкость, содержащую РНК, переносили в новые 1,5 мл пробирки
и инкубировали 5 минут при комнатной температуре для полной диссоциации
нуклеопротеинового комплекса.
Затем добавляли по 200 мкл хлороформа в каждую пробирку и тщательно
перемешивали на вортексе и инкубировали смесь еще 3 минуты при комнатной
температуре. После этого центрифугировали 15 минут на скорости 12000×g при
4°C и отбирали верхнюю водную фазу с РНК в новую пробирку.
Для осаждения РНК добавляли 0,5 мл 100%-ого изопропанола и
инкубировали полученную смесь 10 минут при комнатной температуре. После
чего центрифугировали 10 минут на скорости 12000×g при 4°C.
Осторожно, не касаясь осадка РНК, удаляли надосадочную жидкость из
пробирки. Полученные осадки промывали 1 мл 75% этанола. Кратковременно
перемешивали на вортексе и центрифугировали 5 минут на скорости 7500×g при
4°С. После этого надосадочную жидкость удаляли и сушили осадки РНК 5-10
минут. Затем осадки РНК ресуспендировали в свободной от РНКаз воде и
50
инкубировали 10 минут при 55°С для полного растворения осадка РНК. Образцы
РНК хранили при температуре не выше -75°C.
2.6.3. Амплификация и измерение концентрации тотальной РНК
Концентрация образцов тотальной РНК, выделенной из спонтанно
трансформированных и нормальных ММСК ЖТ человека, измеряли в объеме 1
мкл каждого из 12-ти образцов на приборе Nanodrop (Thermo scientific, США) в
соответствии с протоколом производителя:
качество
[http://www.nanodrop.com/ND1/NucleicAcid-Booklet.html],
РНК
проверяли с помощью чипа Agilent Total RNA 6000 (Agilent Technologies, США)
[http://www.chem.agilent.com/library/usermanuals/Public/G293890034_RNA6000Nano_KG.pdf].
По 400 нг тотальной РНК каждого образца амплифицировали с помощью
Illumina®
TotalPrep™
RNA
Amplification
Kit
(Ambion,
[http://tools.lifetechnologies.com/content/sfs/manuals/IL1791ME.pdf]
чего
получили
образцы
меченой
биотином
кРНК,
в
США)
результате
соответствующей
полиаденилированной мРНК клеток и пригодной к использованию на микрочипах
Illumina.
2.6.4. Гибридизация биотинилированной кРНК на микрочипе Illumina
Микрочип HumanHT-12 v4 Expression BeadChip (Illumina, США) рассчитан
на 12 образцов биотинилированной кРНК. Для каждого образца чип содержал
47318 зондов, которые покрывали миллионами копий специальные силиконовые
«бусинки» (beads), расположенные случайным образом на чипе. Зонд представлял
собой олигонуклеотиды длинной 50 п.о., специфичные к определенным участкам
транскриптов (кРНК). На каждый зонд в микрочипе приходилось по 30-45
«бусинок» (т.е. по 30-45 технических повторов). Принадлежность каждой из
«бусинок»
к
определенному
зонду
определяли
с
помощью адресной
последовательности (29 п.о.), расположенной перед последовательностью зонда.
51
По 750 нг биотинилированной кРНК каждого из 12-ти образцов спонтанно
трансформированных и нормальных ММСК ЖТ гибридизовали с зондами на
микрочипе согласно протоколу производителя:
[http://supportres.illumina.com/documents/myillumina/3466bf71-78bd-4842-8bfc393a45d11874/wggex_direct_hybridization_assay_guide_11322355_a.pdf].
После сканирования сигналов флуоресценции с зондов микрочипа получали
первичные данные в виде таблицы с интенсивностями флуоресценции всех
зондов, достоверностью детекции сигнала (detection p-value) по каждому из 12
образцов и подробной аннотацией гибридизованных транскриптов. Таблицу
получали с помощью программного обеспечения GenomeStudio GX 1.7.0
(Illumina, США).
2.6.5. Обработка первичных данных по интенсивности флуоресценции зондов
перед статистическим анализом
Процесс обработки состоял из 5-ти этапов: трансформации данных,
нормализации данных между образцами, оценки качества гибридизации и
фильтрации проб по уровню детекции сигнала при заданном пороговом значении
detection p-value.
1) Первый этап трансформации значений интенсивности экспрессии
проводили методом VST (variance-stabilizing transformation). Этот алгоритм
рекомендован разработчиками пакета lumi для обработки данных микрочипов
Illumina. Поскольку первичные данные интенсивности сигнала проб всегда
показывают зависимость дисперсии измерений от величины интенсивности
сигнала, дисперсия измерений на микрочипе имеет склонность расти с
увеличением среднего значения сигнала (интенсивности). Сначала рассчитывали
интенсивность сигнала каждого образца по формуле:
52
где Y – измеренная интенсивность; α – среднее значение фонового шума; µ
- истинное значение интенсивности; η и ε – мультипликативная и аддитивная
ошибка соответственно. Значение среднего и дисперсии определяли по формуле:
( )
( )
где mη и s η2 – это среднее и дисперсия eη; σε – стандартное отклонение ε.
Приравнивая уравнения через µ, получали функцию зависимости дисперсии
интенсивности сигнала от среднего:
( )
(
) (
)
(
)
Затем проводили трансформацию этого уравнения по алгоритму VST с
помощью функции h(y), что позволяет сделать среднее и дисперсию
интенсивностей сигнала независимыми друг от друга. Согласно [Du P. et al., 2008]
уравнение этой функции выглядит так:
(
( )
{
(
√
√
)
)
При проведении трансформации алгоритмом
VST действовали в
следующей последовательности:
1.
Выбрали пробы с незначимым сигналом детекции как фоновые
(detection p-value>0,01)
2.
Оценили дисперсию фонового шума (c3), используя среднее по
дисперсии фоновых проб
3.
Оценили с 1 и с 2 линейным приближением √ ( )
4.
Вычислили
формуле h(y).
трансформированные
значения
интенсивности
по
53
2)
Второй этап после трансформации данных – это нормализация. Она
позволяет перейти к сравнению выборок данных. Трансформированные данные
нормализовали алгоритмом RSN (Robust Spline Normalization), основанном на
использовании монотонных сплайнов для нормализации и объединяющим
преимущества квантиль – (эфективность расчетов и сохранение рангового
порядка генов) и loess-нормализации (непрерывность преобразования данных)
[Du P. et al., 2008].
Метод позволил привести все данные по интенсивностям сигналов к
общему
базовому
уровню,
который
для
вышеописанным алгоритмом, ссылка для
всего
анализа
определяется
более подробной информации
представлена ниже:
http://www.bioconductor.org/packages/2.2/bioc/vignettes/lumi/inst/doc/Bioc2007_lumi
_presentation.pdf].
3)
lumi
Полученные преобразованные данные проверяли с помощью пакета
Bioconductor
и
статистического
языка
программирования
R
на
воспроизводимость среднего уровня сигнала зондов между образцами, а также на
сходное количество детектируемых зондов в каждом образце. Этот анализ
позволяет оценить качество гибридизации чипа.
4)
Для
повышения
достоверности
результатов
последующего
статистического анализа проводили фильтрацию проб с помощью программы
статистического языка программирования R 3.0.2. по уровню детекции сигнала
при пороговом значении detection p-value<0,01 в 50% образцов хотя бы одной из
двух групп (т.е. трансформированных и нормальных клетки). Данный подход
рекомендован для анализа микрочиповых данных при малом количестве
исследуемых образцов [McClintick J.N. & Edenberg H.J., 2006].
5)
В завершении обработанные данные переаннотировали согласно
последнему обновлению базы данных RefSeq (Release 52, март 2012) во
избежание использования устаревших сведений. Для этого использовали
программу lumiHumanIDMapping (R пакет lumi), предоставляющую сведения о
54
соответствии зондов Illumina различным версиям микрочипов Illumina, их
аннотации и определенным транскриптам из базы данных RefSeq. Зонды,
картированные по одинаковым транскриптам базы данных RefSeq сократили до
уникальных транскриптов рекомендуемым в литературе методом максимального
среднего (функция collapseRows R-пакета WGCNA [Miller J.A. et al., 2011]) для
того, чтобы избежать искажений результатов статистики за счет дублирования
сигналов от одних и тех же транскриптов.
2.6.6. Определение дифференциально экспрессированных транскриптов с
помощью алгоритма Significance analysis of microarrays (SAM)
Перед дифференциальным анализом проводили разведывательный анализ
соответствий с помощью программы j-Express Pro 2012, позволяющий оценить
разницу профилей экспрессии образцов по двумерной диаграмме, построенной на
основе таблицы данных экспрессии.
Дифференциально экспрессированные транскрипты между спонтанно
трансформированными и нормальными ММСК ЖТ определяли с помощью
программы Significance analysis of microarrays (SAM) 4.0 MS Excel add-in
[http://statweb.stanford.edu/~tibs/SAM/sam.pdf]. Это один из наиболее часто
применяемых алгоритмов для определения дифференциально экспрессированных
генов
при
микрочиповых
исследованиях,
основанный
на
методах
непараметрической статистики (модифицированный t-тест). SAM вычисляет
статистику d для каждого транскрипта, которая показывает силу взаимосвязи
между экспрессией этого транскрипта и экспериментом (группами нормальных и
трансформированных клеток в данном случае), а повторяющиеся перестановки
образцов в группах сравнения (пермутации) позволяют определить насколько
значимо это изменение. Пусть данные по экспрессии обозначаются xij, где i
=1,2…p – это транскрипты, а j = 1,2… n – это образцы, а группирующая
переменная yj.
55
Где ri – это показатель статистики SAM (score), si –среднеквадратичное
отклонение и s0 – фактор перестановки (процентиль значений s 0).
Для парных данных, где образец –
составляет пару образцу
, а zik –
разница между данными по экспрессии между парными образцами. Пусть j(d)
будет индексом образца
:
( )
(
)
∑
∑(
) { (
)}
В настоящей работе применяли вышеуказанный метод расчета для парных
образцов с 64 перестановками образцов (так как перестановки при парном анализе
осуществляются только внутри каждой пары). Полученный список транскриптов
с присвоенным рангом статистики SAM (Score), значимостью изменения (FDR qvalue) и кратностью изменения (fold change (FC)) использовали для последующего
функционального анализа транскриптов.
2.6.7. Функциональный анализ дифференциально экспрессированных между
образцами транскриптов
Для функционального анализа транскриптов применяли два подхода: с
использованием порога по значимости и кратности изменения и без порога.
При пороговом подходе устанавливали следующие ограничения: По
результатам статистических расчетов SAM устанавливали порог значимости
изменения Δ=2,09 (FDR=1,03% при данном значении Δ) и FDR q-value<0,05, а
также более строго при FDR q-value<0,01. Особое внимание уделяли
транскриптам с изменением экспрессии более чем в 2 раза (0,5≥FC≥2).
Функциональный анализ наиболее интересных транскриптов проводили
индивидуально с использованием информационных сервисов NCBI
[http://www.ncbi.nlm.nih.gov/gene/].
56
Функциональный анализ генов с FDR q-value<0,01 и 0,5≥FC≥2 проводили с
помощью интернет-сервиса GOrilla [Eden E. et al., 2009] (анализ представленности
генов по категориям в базе данных GeneOntology (GO)) с порогом значимости
результатов FDR q-value<0,01.
Беспороговый подход позволяет единовременно проанализировать весь
профиль экспрессии с учетом даже малых изменений, так как в некоторых
случаях незначительное, но согласованное изменение в экспрессии группы
функционально взаимосвязанных генов важнее многократного изменения
экспрессии
одного
гена.
Для
этого
подхода
применяли
групповой
функциональный анализ генов Gene Set Enrichment Analysis (GSEA) [Subramanian
A. et al., 2005] по базе данных MSigDB (канонические сигнальные пути,
химические и генетические пертурбации, онкосигналы). Была загружена и
установлена свободно распространяемая java-программа GSEA v2.0, в которую
загружали ранжированный по SAM (Score) список генов и анализировали с
параметрами по умолчанию и порогом значимости результатов FDR q-value<0,05.
Для проведения программного анализа генов (GOrilla и GSEA) объединяли
в ранжированном списке,
полученном алгоритмом SAM, транскрипты,
обозначенные одним символом гена базы данных HGNC (были оставлены
транскрипты с наиболее значимым изменением экспрессии), так как программы
функционального анализа рассчитаны на уникальные символы генов и
дублирование вносит искажения в результаты расчетов.
2.7. Исследование стабильной лентивирусной трансдукции спонтанно
трансформированных ММСК ЖТ человека
2.7.1. Отбор культуры клеток трансформированных ММСК ЖТ, способной к
росту на бессывороточной среде
Для процедуры отбора были взяты культуры трансформированных ММСК
ЖТ человека: BL29, KR30, VA18, VO21, PU28, BB25 и полученные из них
моноклональные культуры. Клетки растили при стандартных условиях в базовой
57
культуральной среде (среда DMEM («ПанЭко», Россия) с 5% содержанием ЭТС
(«ПанЭко», Россия), 4 mM L-глутамина («ПанЭко», Россия), амикацина 100 мг/л
(«Красфарма», Россия) до 80% конфлюентности в культуральных флаконах
CELLSTAR (Greiner bio-one, Германия, площадь поверхности 25, 75 или 175 см 2),
после чего пассировали. Клетки снимали с подложки как указано в разделе 3.1
главы «Материалы и методы» и ресуспендировали в культуральной среде, не
содержащей сыворотки крови. Затем рассаживали клетки по 50 тыс. клеток на
маленький флакон (25 см2) в минимальной ростовой среде (DMEM с добавлением
4 мМ L-глутамина, 100 мг/л амикацина) со сниженными концентрациями ЭТС –
5%, 1%, 0,1%, и 0% (при этом ЭТС заменяли 0,1% желатином). В качестве
контроля были выбраны культуры клеточной линии мезенхимальной опухоли –
рабдомиосаркомы, - A204, растущей только при адгезии. Срок культивирования
клеток тестируемых культур составлял 20 дней.
2.7.2. Лентивирусная трансдукция спонтанно трансформированных ММСК ЖТ
человека
Для исследования эффективности лентивирусной трансдукции была
выбрана одна из моноклональных культур спонтанно трансформированных
ММСК
–
VA18_2,
показавшая
наиболее
высокие
пролиферативные
характеристики и способность к росту на бессывороточной среде. Культуру
неопластических
клеток
VA18_2
для
отработки
условий
трансдукции
культивировали в базовой культуральной среде, содержащей DMEM с
добавлением 5% ЭТС («ПанЭко», Россия), 4 мМ L-глутамина («ПанЭко», Россия),
100 мг/л амикацина («Красфарма», Россия).
Данную культуру трансдуцировали лентивирусными частицами c геном
зеленого флуоресцентного белка TagGFP2 (Евроген, Россия). TagGFP2 был
клонирован под контролем универсального промотора гена фактора элонгации 1α
(EF1α) в
лентивектор
pLVT-TagGFP2-N. Карта лентивирусного вектора
представлена ниже (рисунок 2)
58
Рисунок 2. Карта лентивектора pLVT-TagGFP2-N.
Лентивирусные частицы были получены с помощью упаковочной системы
3-го поколения и имели заявленный инфекционный титр не менее 5х10
5
инфекционных единиц на миллилитр вирусной суспензии (T.E./ml). Данный титр
учитывали при определении MOI в дальнейшей работе по трансдукции.
Трансдукцию осуществляли в 24-х луночных плашках. Клетки рассевали в
плотности 2000 клеток на лунку в поддерживающей культуральной среде,
содержащей DMEM («ПанЭко», Россия) с 1% содержанием ЭТС («ПанЭко»,
Россия),
4 mM L-глутамина («ПанЭко», Россия), амикацина 100 мг/л
(«Красфарма», Россия). Через 2 часа, после прикрепления клеток к подложке, в
среду добавляли стоковый раствор лентивирусных частиц (5*10 5 Т.Е./мл) для
достижения множественности инфекции (MOI) равной 5, 10, 20, 40 и 50. Затем
инкубировали клетки с вирусными частицами сутки при 37ºС в атмосфере 5%
59
СО2. В каждый эксперимент брали по три повторности. По истечении времени
инкубации, среду, содержащую вирусные частицы, отбирали и заменяли свежую
порцию базовой культуральной среды, содержащую 5% ЭТС. Трансдуцированные
культуры спонтанно трансформированных ММСК ЖТ человека в течение
культивирования регулярно наблюдали при помощи фазово-контрастной,
флуоресцентной микроскопии и проточной цитометрией (FACS). На 5-м, 15-м и
25-м пассажах часть клеток каждой культуры подвергали криоконсервации,
лизированию для измерения продукции белка TagGFP2 и выделению ДНК для
определения копийности трансгена, а также цитометрическому анализу (FACS).
Все измерения проводили в трех повторностях.
2.7.3. Селекция флуоресцентных клеток после трансдукции
Для
отбора
стабильных
флуоресцентных
клонов
спонтанно
трансформированные ММСК ЖТ человека после трансдукции рассевали в
предельном разведении в 96-луночных плашках для получения отдельных
флуоресцентных клонов. Впоследствии при наблюдении фазово-контрастной и
флуоресцентной микроскопией из лунок были выделены 4 моноклональных
культуры
флуоресцентных
клеток,
обладающих
наиболее
высокими
пролиферативными характеристиками и интенсивностью флуоресценции по
результатам наблюдений. Найденные колонии переносили на отдельные
культуральные флаконы под номерами 1, 2, 3 и 4. Данные культуры
культивировали и исследовали в течение 25 пассажей (~6 месяцев).
2.7.4. Проточная цитометрия спонтанно трансформированных ММСК ЖТ
человека
Анализ трансдуцированных спонтанно трансформированных ММСК ЖТ
человека проводили на проточном цитофлуориметре CyFlow® Space (Partec,
2
Германия). Для этого перед анализом клетки пересевали на 25 см культуральные
флаконы CELLSTAR (Greiner bio-one, Германия) и культивировали до 90%
60
конфлюентности. Затем клетки снимали, промывали физиологическим раствором
(«ПанЭко», Россия), считали на камере Горяева и ресуспендировали в растворе
6
Хенкса («ПанЭко», Россия) в концентрации 1х10 кл/мл. По 1 мл клеточных
суспензий каждого образца анализировали на приборе. Определение количества
флуоресцентных клеток в культуре проводили при помощи программного
обеспечения FCS Express 4 Flow Cytometry - RUO (De Novo Software, США),
процент флуоресцентных клеток рассчитывали в программе относительно
нетрансдуцированных спонтанно трансформированных ММСК ЖТ человека
(негативный контроль).
2.7.5. Выделение ДНК из клеточных культур
Выделение ДНК из спонтанно трансформированных ММСК ЖТ человека
проводили набором «К-сорб-100» (СИНТОЛ, Россия) согласно протоколу
производителя. Для этого при пассировании трансдуцированных клеток отбирали
1х106 клеток, посчитанных на камере Горяева, и осаждали на микроцентрифуге
minispin (Eppendorf, Германия) 3 минуты при 12000 об./мин., промывали осадок
физиологическим раствором («ПанЭко», Россия), затем снова центрифугировали
и ресуспендировали клеточный осадок в 100 мкл физиологического раствора.
Затем в 1,5 мл пробирки (Eppendorf, Германия) последовательно вносили 10 мкл
протеиназы К (СИНТОЛ, Россия), 100 мкл физиологического раствора с 1х10
6
клеток, 200 мкл лизирующего раствора (СИНТОЛ, Россия). Тщательно
перемешивали смесь на вортексе microspin FV-2400 (BioSan, Латвия) и
инкубировали 15 минут при 65ºС в термостате «Гном» (ДНК-технология, Россия)
до полного лизиса клеток.
Капли с крышек после инкубирования сбрасывали краткосрочным
центрифугированием, и добавляли 200 мкл осаждающего раствора (СИНТОЛ,
Россия). Тщательно перемешивали содержимое на вортексе. Сбрасывали капли с
крышек краткосрочным центрифугированием, и переносили весь объем пробирки
61
на колонку (СИНТОЛ, Россия). Далее центрифугировали в течение 1 мин при
8000 об./мин. Жидкость из коллектора колонки удаляли в слив.
Для промывки вносили в колонку 400 мкл промывочного раствора 1
(СИНТОЛ, Россия) и центрифугировали в течение 1 мин при 8000 об./мин. После
центрифугирования жидкость из коллектора колонки удаляли в слив. Повторяли
промывку колонки с 400 мкл промывочного раствора 2 (СИНТОЛ, Россия).
Вносили в колонку 200 мкл промывочного раствора 2 и центрифугировали 2
минуты при 13000 об./мин. В это время элюирующий раствор (СИНТОЛ, Россия)
ставили на прогрев в термостат при 70ºС.
После завершения центрифугирования переносили колонки из коллекторов
в новые чистые 1,5 мл пробирки (Eppendorf, Германия). Добавляли по 150 мкл
предварительно прогретого элюирующего раствора. Ждали 2 минуты, после чего
центрифугировали 1 мин при 8000 об./мин. Полученные растворы ДНК хранили в
морозилке при -20ºС.
2.7.6. Точное определение концентрации выделенной ДНК
Точную концентрацию выделенной ДНК спонтанно трансформированных
ММСК ЖТ человека определяли флуоресцентным методом с помощью прибора
Qubit v2.0. Использовали набор Qubit™ dsDNA HS assay kit (Invitrogen, США)
согласно протоколу производителя:
[http://tools.lifetechnologies.com/content/sfs/manuals/mp32851.pdf].
Измерение точной концентрации ДНК необходимо для проведения корректных
расчетов числа копий трансгена, встроенных а геном трансдуцированных клеток.
Предварительно была проведена калибровка прибора по стандартам,
идущим в комплекте набора Qubit™ dsDNA HS Assay Kit. Для работы
использовали 0,5 мл тонкостенные пробирки Qubit™ assay tubes (Invitrogen,
США). Готовили рабочий раствор реагента и буфера Qubit™ dsDNA HS в
соотношении 1:200. По 10 мкл каждого из двух стандартов ДНК, идущих в
комплекте набора, были разведены в 190 мкл рабочего раствора и кратковременно
перемешаны на вортексе так, чтобы не образовалось воздушных пузырьков.
62
Растворы с опытными образцами ДНК готовили следующим образом: 2 мкл
стоковых растворов выделенной ДНК перемешивались кратковременно на
вортексе в 198 мкл рабочего раствора. Готовые пробирки с 200 мкл рабочего
раствора и ДНК инкубировали 2 мин при комнатной температуре перед анализом.
Пробирки со стандартом были установлены и проанализированы в приборе для
калибровки. Затем опытные образцы ДНК последовательно анализировали в
троекратном повторении измерений и были получены значения концентрации
ДНК в стоковых растворах в нг/мл. Коэффициент вариации составил ≤2%, что
показывает высокую точность измерения концентрации ДНК.
Количество ДНК на спонтанно трансформированную клетку ММСК
VA18_2 в среднем составляет 12,581±1,002 пг, что было измерено по 6
выделенным
образцам
нетрансфицированной
VA18_2,
и
соответствует
теоретическим расчетам, так как обычная человеческая диплоидная клетка
содержит 6,6 пг ДНК:
9
3х10
(размер генома человека в п.о.) * 2 (диплоидная клетка) * 660
(молекулярная масса одной п.о.) * 1,67х10
-12
пг (вес 1 Да) = 6,6 пг
В клетках VA18_2 модальное число хромосом 87, что должно давать
примерно в два раза большее количество ДНК на клетку.
2.7.7. Измерение копийности трансгена в трансдуцированных клетках
Для определения количества интегрированных в геном копий трансгена в
одной клетке использовали метод количественной ПЦР в реальном времени,
описанный в статье [Joshi M.U. et al., 2008]. Для этого абсолютное количество
копий трансгена на клетку устанавливали по линейной аппроксимации
десятикратных разведений лентивирусной плазмиды pLVT-TagGFP2-N в каждом
эксперименте. Для ее построения использовали серию разведений pLVTTagGFP2-N (таблица 2) в 10 нг/мкл ДНК нетрансфицированных клеток в качестве
ДНК-носителя. Массу одной копии плазмиды рассчитывали по формуле m=M/NA,
63
6
где M- молекулярная масса лентивирусной плазмиды (M=4,45*10 Да), а NA 23
число Авагадро (NA=6,02x10
копий (или молекул)/моль). Таким образом, вес
одной копии плазмиды равен 7,39 аг, т.е. 1 нг pLVT-TagGFP2-N содержит
8
≈1,35х10 копий TagGFP2. По полученному соотношению Log10(число копий)/Ct
определяли
число
копий
TagGFP2
в
исследуемых
образцах
ДНК
трансфицированных клеток.
Таблица 2. Разведения плазмиды с учетом ее молекулярной массы.
Масса плазмиды на реакцию
Число копий
Log10 Копий
15 пг
2000000
6,301
1,5 пг
200000
5,301
150 фг
20000
4,301
15 фг
2000
3,301
1,5 фг
200
2,301
Эксперименты ПЦР в реальном времени проводили на амплификаторе
CFX96 (Bio-Rad, США). Для ПЦР реакции использовали реагенты SmarTaq ДНКполимеразу и соответствующий ей буфер (166 мМ (NH4)2SO4; 670 мМ Tris-HCL
(pH 8.8 at 25ºC); 0,1% Tween-20) (Диалат Лтд., Россия). Состав ПЦР реакции
приведен в таблице 3. Праймеры и зонды были предоставлены фирмой «ДНКсинтез», Россия. Использованные праймеры универсальны и подходят для всех
лентивекторов на основе ВИЧ-1 (5`- конец GAG, продукт 85 п.о.), TaqMan-зонд
повышает специфичность ПЦР, обеспечивая сигнал только при разделении
красителя VIC и гасителя BHQ1 вследствие 5`->3` экзонуклеазной активности
полимеразы (таблица 4, рисунок 2). Все измерения проводили в минимум трех
повторностях.
Таблица 3. Состав ПЦР реакции.
Реактивы
10x Ampli буфер
на 25 мкл реакции (мкл)
2,5
MgCl2 2,5 М
2
Lenti-F+R 10мкМ каждого
2
64
TaqMan-зонд 10мкМ
1
dNTP 200 мкмоль каждого
2
SmarTaq 5 ед./мкл
1
H2O
12,5
ДНК (или ДНК+pLVT) 5 нг/мкл
2
Таблица 4. Последовательность праймеров и TaqMan-зонда.
t°C
Название
Последовательность 5`->3`
Lenti-F
GGAGCTAGAACGATTCGCAGTTA
61,9
Lenti-R
GGTTGTAGCTGTCCCAGTATTTGTC
62,5
Lenti-probe
VIC-ACAGCCTTCTGATGTTTCTAACAGGCCAGG-BHQ1
72,6
отжига
Параметры ПЦР реакции использовали следующие:
1. Первичная денатурация – 95°C, 5 мин;
2. Денатурация – 95°C, 15 с;
3. Отжиг праймеров и элонгация – 60°C, 1 мин;
4. Снятие показаний флуоресценции проб.
Этапы 2-4 – 45 циклов.
Анализ проводили с помощью программного обеспечения Bio-Rad CFX
Manager 3.0 (Bio-Rad, США). Данные рассчитывались с 4-го цикла, чтобы убрать
первичные помехи, расчет Ct проводился по единому пороговому значению,
автоматически рассчитываемому программой.
2.7.8. Выделение белка TagGFP2 из трансдуцированных клеток
Белок выделяли с помощью GFP quantitation kit (Biovision, США) из 1х10 6
клеток.
Все
манипуляции
проводили
в
соответствии
производителей [http://www.biovision.com/manuals/K815.pdf].
с
протоколом
Для
этого при
пассировании трансдуцированных клеток отбирали 1х106 клеток, посчитанных на
камере Горяева, осаждали центрифугированием, промывали физиологическим
раствором («ПанЭко», Россия) и снова осаждали. Отбирали надосадочную
жидкость, а клеточный осадок лизировали в 250 мкл GFP assay buffer (Biovision,
США), инкубируя смесь в течение 10 минут на льду. Затем центрифугировали
65
лизат 5 минут при 13400 об./мин. на центрифуге minispin (Eppendorf, Германия), и
переносили чистую надосадочную жидкость с белком TagGFP2 в новые 1,5 мл
пробирки. Образцы белка хранились в буфере GFP assay buffer (Biovision, США)
при -20ºС.
2.7.9. Измерение концентрации белка TagGFP2 в трансдуцированных клетках
Для измерения концентрации белка TagGFP2 была построена стандартная
кривая по разведениям стандарта GFP standard (Biovision, США) в буфере GFP
assay buffer (Biovision, США). Линейная аппроксимация была проведена по 6-ти
точкам измеренным в 3-х повторностях. Были использованы концентрации
стандарта 0, 24, 32, 40, 80 и 100 нг/лунка. Измерение интенсивности
флуоресценции разведений стандарта и лизатов образцов с TagGFP2 проводили в
объеме 100 мкл на лунку на флуоресцентном планшетном ридере The Wallac 1420
VICTOR2 (PerkinElmer, США) по предустановленному протоколу для измерения
флуоресцентных образцов Fluorescein (Ex/Em = 485nm/535nm). Концентрацию
белка на 1 млн. клеток считали относительно линейной апроксимации разведений
стандарта по формуле:
GFP Concentration = A/V (нг/мкл)
где А – количество GFP в нг по линейной аппроксимации, V – объем
образца добавленный в лунку.
66
3. РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ
3.1. Цитогенетическое исследование
3.1.1. Хромосомный набор культур спонтанно трансформированных ММСК ЖТ
человека
Так как неопластическая трансформация часто связана с повреждениями
генетического материала клетки, было решено провести цитогенетическое
исследование спонтанно трансформированных ММСК ЖТ с рутинной окраской
хромосом. Рутинное (полное) окрашивание хромосом позволяет определить число
хромосом в клетке и их общую морфологию: наличие первичных и вторичных
перетяжек, число и размер хромосомных плеч, соотношение длин коротких и
длинных плеч. Полное окрашивание хромосом также позволяет обнаружить
хромосомные аберрации.
Цитогенетическое исследование проводили на 26 культурах спонтанно
трансформированных
ММСК
ЖТ
человека,
полученных
коллективом
лаборатории генетики стволовых клеток ФГБУ «МГНЦ» РАМН. Из них шесть
первичных культур спонтанно трансформированных ММСК ЖТ – VA18, PU28,
KR30, BL29, BB25 – были выделенны из культур нормальных ММСК ЖТ шести
разных доноров, - и по пять моноклональных культур, выделенные из культур
VA18, PU28, KR30, BL29.
При
подготовке
фиксированных
препаратов
хромосом
спонтанно
трансформированных ММСК ЖТ человека по стандартному протоколу,
разработанному для нормальных ММСК [Бочков Н.П. и соавт., 2009], выяснилось,
что
хромосомы
из-за
их
большого
числа
получаются
слишком
конденсированными и плохо распластываются. Анализ препаратов таких
хромосом был невозможен. Поэтому для цитогенетического анализа каждые
стадии стандартного протокола фиксирования и окрашивания хромосом были
оптимизированы для получения наилучшего результата для исследуемых культур
(пункт 2.5.1. главы «материалы и методы»).
67
С помощью оптимизированного протокола были получены фиксированные
препараты хорошо распластанных и окрашенных хромосом. На данных
препаратах было предварительно исследовано по 15 метафаз каждой из 6-ти
культур неопластических клеток VA18, PU28, KR30, BL29, BB25 и VO21.
Выяснилось, что число хромосом в клетках одной и той же культуры варьирует.
Для того, чтобы понять, чем вызвана такая гетерогенность клеток по числу
хромосом – хромосомной нестабильностью (неравным распределением хромосом
при
делении)
или
гетерогенностью
исходных
культур
спонтанно
трансформированных ММСК ЖТ человека, – из шести культур взятых в
исследование, случайным образом были отобраны 4 культуры: VA18, PU28
(выделенных из ММСК ЖТ двух женщин) и культуры KR30, BL29 (выделенных
из ММСК ЖТ двух мужчин). Из них с помощью посева клеток в низкой
плотности в стандартной ростовой среде были выделены по пять моноклональных
культур. Хромосомный набор каждой моноклональной культуры также был
определен. В каждой культуре спонтанно трансформированных клеток –
первичных и моноклональных, – было исследовано от 30 до 50 метафазных
пластинок. Цитогенетический анализ культур проводили на разных пассажах
вплоть до 15-го пассажа после выделения.
Полученные значения хромосомного набора у всех исследованных культур
трансформированных ММСК ЖТ различались между культурами. Для выявления
связи количества хромосом между первичными культурами VA18, PU28, KR30,
BL29, BB25, а также между моноклональными и исходными культурами,
проводили статистический анализ данных. Для этого данные по количеству
хромосом на клетку у всех исследованных культур были сформированы в 26
выборок и проанализированы с помощью программы Statistica 8.
Сначала выборки данных по хромосомным наборам культур были
проверены на соответствие нормальному распределению с помощью W критерия
Шапиро-Уилка. Данный критерий является наиболее мощным среди аналогичных
(например, тестов Колмагорова-Смирнова и Лилиефорса) как для малых, так и
больших выборок [Razali N.M. & Wah Y.B., 2011]. В большинстве случаев
68
распределение значений в выборках не соответствовало нормальному (при
p<0,05), кроме культур клеток PU28_1 (W=0,981, p=0,602), KR30_общ (W=0,959,
p=0,082), KR30_2 (W=0,961, p=0,331), KR30_4 (W=0,932, p=0,057), BL29_общ
(W=0,949, p=0,161). Так как только 5 из 26-ти культур имели нормальное
распределение значений хромосомного набора, а число наблюдений было
небольшим,
для
сравнения
выборок
было
решено
использовать
непараметрические методы статистики.
Таким образом, были получены сведения описательной статистики по
хромосомному набору всех культур. Коэффициент вариации хромосомного
набора в большинстве случаев не превышает 10%, а относительная ошибка
среднего значения не превышает 5%, что говорит об однородности хромосомного
набора внутри культур спонтанно трансформированных ММСК ЖТ (таблица 5).
Таблица 5. Описательная статистика хромосомного набора культур спонтанно
трансформированных ММСК ЖТ человека.
Культура
VA18_общ
VA18_1
VA18_2
VA18_3
VA18_4
VA18_5
PU28_общ
PU28_1
PU28_2
PU28_3
PU28_4
PU28_5
KR30_общ
KR30_1
KR30_2
KR30_3
KR30_4
KR30_5
BL29_общ
BL29_1
BL29_2
BL29_3
BL29_4
BL29_5
BB25_общ
VO21_общ
Число
метафаз
50
50
50
52
49
50
50
50
50
50
50
50
50
30
30
30
30
36
30
30
30
30
30
30
30
50
Медиана
Стандартная
Стандартное Коэффициент
хромосомного
Мода
Минимум Максимум Дисперсия
ошибка
отклонение
вариации
набора
среднего
81
84
62
85
27,006
5,197
6,506
0,735
85
84, 86
63
91
35,202
5,933
7,121
0,839
86
87
73
112
35,832
5,986
6,911
0,847
82
82
59
128
104,412
10,218
12,386
1,417
80
80
72
87
8,380
2,895
3,642
0,414
84
84, 85
71
135
63,641
7,978
9,436
1,128
91
91
67
102
27,469
5,241
5,836
0,741
89
88, 89
82
96
8,531
2,921
3,260
0,413
91
91
74
107
23,724
4,871
5,406
0,689
90
90, 91
62
101
32,031
5,660
6,314
0,800
91
91
76
94
15,061
3,881
4,341
0,549
91
91
74
134
85,762
9,261
10,128
1,310
91
93
84
101
11,388
3,375
3,700
0,477
92
93
83
95
9,237
3,039
3,337
0,555
86 81, 84, 86, 87, 88
77
94
18,631
4,316
5,037
0,788
91
91
66
95
44,120
6,642
7,452
1,213
84
88
66
93
44,534
6,673
8,089
1,218
134
134, 135
67
151
368,847
19,205
15,040
3,201
86
87
77
94
22,869
4,782
5,587
0,873
86
86
68
91
27,834
5,276
6,163
0,963
85
85, 90
77
90
15,126
3,889
4,612
0,710
84
86
72
87
17,959
4,238
5,093
0,774
85
85
79
137
128,792
11,349
12,891
2,072
74
73
71
117
182,920
13,525
17,048
2,469
91
91
85
175
463,283
21,524
22,099
3,930
73
73
64
104
28,893
5,375
7,301
0,760
Модальное число хромосом на клетку в исследуемых культурах спонтанно
трансформированных ММСК ЖТ человека, попадает в диапазон между
69
триплоидным (69 хромосом на клетку) и тетраплоидным (92 хромосомы на
клетку) хромосомным набором. При этом встречаются клетки со значительным
отличием по хромосомному набору от модального значения своей культуры.
Наблюдаемое число хромосом на клетку варьирует в переделах от 59 до 175. В
13-ти из 26-ти исследованных культур встречались единичные отклонения по
числу хромосом в виде гигантских многоядерных клеток. Хромосомный набор
таких клеток значительно отличался от основной клеточной популяции культуры.
В некоторых случаях он достигал до 175 хромосом на клетку. Одна из
исследованных дочерних клональных культур (KR30_5) была в основном
представлена клетками, имеющими подобный хромосомный набор. В клетках
спонтанно трансформированных ММСК ЖТ человека наблюдается анеуплоидия
(рисунок 3).
Рисунок
3.
Диаграмма
вариабельности
хромосомного
набора
культур
спонтанно
трансформированных ММСК ЖТ человека. N_общ – культура, полученная из клеток ММСК
ЖТ донора N; N_1,2,3,4,5. – моноклональные культуры, полученные из культуры N. Выбросами
обозначены значения количества хромосом на клетку на расстоянии более 1,5х(25%-75%) от
медианы, а экстремальные значения на расстоянии более 3х(25%-75%). Синим цветом отмечена
зона между триплоидным и тетраплоидным числом хромосом.
70
Для
сравнения
непараметрический
хромосомного
набора
дисперсионный анализ
культур
применяли
(тест Краскела–Уоллиса).
По
результатам статистического анализа был сделан вывод о том, что хромосомный
набор культур спонтанно трансформированных ММСК ЖТ, полученных от
разных доноров статистически значимо различается (р=0,000).
Исходные культуры трансформированных клеток VA18, PU28 KR30, BL29
и полученные из них моноклональные культуры различны между собой по
хромосомному набору (р=0,000), что подтверждает предположение о наличии
хромосомной нестабильности. Наиболее стабильный хромосомный набор
показали культуры PU28, которые отличались наименьшим разбросом и близким
значением
медианы
числа
хромосом
между
исходной
культурой
и
моноклональными культурами (Kruskal-Wallis test: H (5, N=300)=2,531, p=0,772).
Анеуплоидия как свидетельство хромосомной нестабильности в клетках
является характерным признаком неопластической трансформации клеток.
Механизм взаимосвязи неопластической трансформации и анеуплоидии до конца
не изучен, хотя есть много свидетельств в пользу того, что анеуплоидия может
провоцировать развитие злокачественной трансформации. Но анеуплоидия
связана не только с раком - она присутствует и в норме, например, в клетках
печени и мозга при развитии тканей, а также играет важную роль при старении
клеток [Ricke R.M.
& van Deursen J.M., 2013]. В случае спонтанно
трансформированных ММСК ЖТ анеуплоидия не является этапом нормального
развития клеток или их репликативного старения, поскольку наблюдаются также
дополнительные
признаки
неопластической
трансформации,
такие
как
иммортализация (преодоление лимита Хейфлика), морфологические изменения,
отсутствие контактного ингибирования и формирование онкосфер в полужидкой
среде.
Согласно литературным данным существует несколько механизмов
анеуплоидизации клеток [King R.W., 2008]. Два основных – это прямая
анеуплоидизация из нормальных диплоидных клеток, и развитие анеуплоидии
через предварительную тетраплоидизацию. Причинами анеуплоидии в первом
71
случае могут быть меротелическое прикрепление кинетохоров (merotelic
kinetochore attachment), частичная инактивация генов регуляции клеточного
деления, амплификация центросом или различные повреждения хромосом.
Второй путь предполагает предварительное обретение тетраплоидного кариотипа
вследствие незавершенного деления с последующим дисбалансом генетического
материала клетки и нарушений сегрегации хромосом.
Анеуплоидия исследуемых спонтанно трансформированных ММСК ЖТ
человека, по-видимому, была ими приобретена либо через тетраплоидизацию
клеток, либо через амплификацию центросом, так как по результатам
цитогенетического исследования видно, что число хромосом на клетку
значительно отличается от диплоидного по всем культурам и близко к 4n [King
R.W., 2008].
Анеуплоидизация вследствие внедрения одной клетки в другую (энтоз) еще
один
из
недавно
исследованных
механизмов
приобретения
клетками
тетраплоидного и анеуплоидного кариотипа [Krajcovic M. et al., 2011]. Но так как
чаще всего такой процесс происходит при культивировании клеток в суспензии, и
в ходе наблюдений за спонтанно трансформированными ММСК ЖТ человека
явного слияния клеток замечено не было, данный механизм как причина
анеуплоидии в этом случае маловероятен.
Известно, что большинство опухолей - как карцином, так и сарком, - имеют
анеуплоидные клетки, хромосомный набор которых полиплоиден (особенно у
неоплазий высокой степени злокачественности) [Nicholson J. M. & Cimini D.,
2013; Collin F. et al. 1997]. В опухолях встречаются большие многоядерные клетки
с числом хромосом более 200, как например, в клетках остеобластокластомы или
опухоли сосудистого сплетения. В норме нарушение клеточного деления и
приобретение тетраплоидного кариотипа приводит к остановке деления,
ускоренному клеточному старению и апоптозу (G1 tetraploidy checkpoint). Одними
из ключевых факторов защиты от полиплоидии и анеуплоидии является
активация генов p53 и p73. Отсутствие их активности приводит к допуску
тетраплоидных клеток для дальнейшего деления, что в дальнейшем приводит к
72
анеуплоидии и неопластической трансформации (рисунок 4) [Aylon Y. & Oren M.,
2011].
Онкогенный
митотический
центросомальный
стресс
Plk1
BRCA1
Ошибки
клеточного
деления
Контроль
повреждений
веретена деления
(Mad2, Bub1 и т.д)
Fbw7
BRCA2
Выход из
митотического
ареста (mitotic
slippage)
E2F1
Aurora А
Инактивация
pRb и p53
G1
тетраплоидия
Сбой
блокировки
редупликации
хромосом
P38
Lats
2
Активация
p53 в норме
Lats
BubR1
2
Bax
P21
P21
P73
Пролиферация
тетраплоидов
Клеточное
старение
Анеуплоидия
Арест клеточного
цикла (“G1 tetraploidy
checkpoint”)
Апоптоз
Элиминация тетраплоидов
из популяции
Инициация
трансформации
Рисунок
4.
Схематичное
изображение
способов
клетки
избежать
анеуплоидный кариотип. Адаптировано из [Aylon Y. & Oren M., 2011].
или
приобрести
73
Чтобы проверить возможный механизм возникновения анеуплоидии
спонтанно трансформированных ММСК ЖТ человека следует исследовать
экспрессию ключевых генов регуляции клеточного деления, что было сделано в
разделе
диссертации,
посвященном
сравнительному
парному
анализу
транскриптома нормальных и спонтанно трансформированных ММСК ЖТ
человека [Омельченко Д.О. и др., 2014].
Известно, что скорость пролиферации клеток снижается при появлении
дополнительных хромосом или копий генов в неопластических клетках [Cetin B.
& Cleveland D.W., 2010]. Кроме того, анеуплоидия негативно сказывается на
пролиферации клеток из-за возрастающей нагрузки на клетку дополнительных
копий генов и хромосом. Клетка подвергается протеотоксичному стрессу, однако ,
предположительно, из-за мутаций появляются клоны, способные выживать и
восстанавливать нормальные ростовые характеристики. При этом клетки
восстанавливают свои пролиферативные характеристики за счет усиления
убикветинилирования и деградации лишних белков [Cetin B. & Cleveland D.W.,
2010; Torres E.M. et al., 2010]. Это один из способ адаптации и выживания
анеуплоидных неопластически трансформированных клеток.
Коллективом лаборатории генетики стволовых клеток также были
определены периоды удвоения культур при росте в стандартной ростовой среде
на первых пассажах после выделения. Культуры спонтанно трансформированных
ММСК ЖТ человека характеризовались высокой скоростью пролиферации
(период удвоения до 18 ч), в то время как нормальные ММСК ЖТ человека
делились медленно (32-45 ч) [Ржанинова А.А. и др., 2010].
По-видимому, в данном случае клетки достаточно быстро восстановили
протеобаланс после трансформации, и вышли на оптимальную для них скорость
пролиферации.
74
3.1.2. Хромосомные аберрации в культурах спонтанно трансформированных
ММСК ЖТ человека
Во всех 26 проанализированных культурах спонтанно трансформированных
ММСК ЖТ наблюдалось множество хромосомных и хроматидных аберраций
(рисунок 5). Из всех хромосомных аномалий 46,41% составляют полицентрики
(дицентрики, трицентрики и т.д.), 30,94% двойные микрохромосомы, 3,38%
кольцевые хромосомы, 18,77% другие хромосомные аберрации (одно- и двухроматидные разрывы, межхромосомные хроматидные обмены и др.).
Рисунок 5. Две фотографии метафазных пластинок с характерными аберрациями. 1 –
дицентрик, 2 – полицентрик, 3 – кольцевая хромосома, 4 – двойная микрохромосома. Фазовоконтрастная микроскопия (Х1000), обработка программой BandView by Applied Spectral
Imaging.
В среднем в каждой культуре наблюдается 47,4% клеток, несущих
аберрантные хромосомы (таблица 6). Учитывая, что в нормальной культуре
ММСК процент клеток с хромосомными аберрациями может составлять ~4%
[Tarte K. et al., 2010], а у исследованных культур процент аберрантных клеток в
среднем составляет 47,4% по всем культурам (от 11,4 % до 86,7%), то данные
клетки
можно
охарактеризовать
как
протекающими мутационными процессами.
трансформированные
с
активно
75
Таблица 6. Статистика хромосомных аберраций исходных популяций спонтанно
трансформированных ММСК ЖТ человека и их моноклональных культур.
Метафаз
исследовано
Полицентрики
Двойные
микрохромосомы
Кольца
50
35
35
35
35
35
4
6
12
9
8
2
0
1
2
0
3
1
0
0
2
0
3
0
Другие
хромосомные
аберрации
5
1
11
7
3
2
85
50
35
35
35
35
17
3
1
10
9
3
9
9
3
0
11
14
0
0
0
0
0
1
50
30
30
30
30
30
17
14
5
18
16
16
18
18
10
15
4
21
BL29_1
BL29_2
BL29_3
BL29_4
BL29_5
30
30
30
30
30
30
14
25
20
52
39
11
BB25_общ
30
VO21_общ
50
Популяция
VA18_общ
VA18_1
VA18_2
VA18_3
VA18_4
VA18_5
PU28_общ
PU28_1
PU28_2
PU28_3
PU28_4
PU28_5
KR30_общ
KR30_1
KR30_2
KR30_3
KR30_4
KR30_5
BL29_общ
9
8
27
16
17
5
Число
аберрантных
метафаз
6
7
19
13
13
4
2
1
3
1
1
8
28
13
7
11
21
26
17
10
6
10
15
15
20,0
0
1
0
1
0
1
3
5
3
10
2
6
40
38
18
44
22
44
21
16
24
16
16
19
42,0
25
33
18
14
11
7
5
4
2
6
1
4
1
8
5
10
7
2
45
70
44
82
58
24
16
26
24
22
23
18
53,3
32
9
4
9
54
23
76,5
15
7
0
6
28
19
38,0
Всего аберраций
% аберрантных
клеток
12,0
20,0
54,3
37,1
37,1
11,4
20,0
17,1
28,6
42,9
42,9
53,3
80,0
53,3
52,9
63,3
86,7
80,0
73,3
77,8
58,8
Наиболее часто встречающиеся хромосомные аномалии в данных
популяциях – дицентрики и двойные микрохромосомы. Согласно данным
литературы, накопление подобных хромосомных аберраций характерно для
клеток, в которых протекает цикл из разрыва хромосомы, слияния и создания
перемычки («breakage-fusion-bridge», цикл BFB), который является основной
причиной сильного генетического разнообразия клеток во многих видах
неоплазий [Murnane J.P., 2012]. Нарушения нормальной структуры хромосом и
повышенный уровень рекомбинации в опухолевых клетках приводит к
образованию данных типов аберраций [Colnaghi R. et al., 2011; Gascoigne K.E. &
Cheeseman I.M., 2013].
Цикл BFB может быть инициирован хромосомным разрывом. В результате
прогрессии цикла каждый раз при делении клеток появляются различные
мутации и образование аберрантных хромосом, таких как хромосомы с двумя
центромерами (дицентрики) или частично укороченных, дуплицированных
аберрантных хромосом в дочерних ядрах. Цикл повторяется при дополнительной
76
репликации по разрыву (слияние сестринских хроматид), что приводит к
накоплению на одной хромосоме гомологичных геномных сегментов в обратной
ориентации - палиндромов (рисунок 6а). Накопление палиндромов может
привести
к
микрохромосом)
выпетливанию
или
внехромосомных
неравному
обмену
ампликонов
сестринских
(двойных
хроматид,
при
присоединении теломеры на место разрыва (рисунок 6б) [Tanaka H. & Yao M.C.,
2009]. В результате этого процесса амплифицируются определенные онкогены,
накапливаются структурные и численные хромосомные аберрации, наблюдаемые
в культурах клеток, исследованных в данной работе.
Рисунок 6. Схема BFB цикла. Описание в тексте. Переведенная схема из статьи [Tanaka H. &
Yao M.C., 2009].
77
Дифференциальный
цитогенетический
анализ
(G-окраска) исходных
нормальных ММСК ЖТ человека на ранних (3-5 пассаж) и поздних пассажах (10+
пассаж) после выделения из ткани, проведенный ранее коллективом лаборатории,
показал лишь незначительные изменения в некоторых культурах (трисомии по 18ой хромосоме, моносомия по 6-ой, робертсоновская транслокация между 21-ой и
22-ой хромосомой). Такие клетки благополучно вступили в фазу старения,
наблюдаемые хромосомные аберрации не привели к трансформации, что
согласуется с данными литературы по этому вопросу. Дифференциальный
цитогенетический анализ спонтанно трансформированных ММСК ЖТ провести
не удалось из-за большого количества хромосом на метафазную пластинку и
множества хромосомных аберраций. Для более подробного анализа в дальнейшем
требуется использование методов молекулярного анализа FISH или SKY.
Таким образом, цитогенетический анализ показал, что данные клетки
претерпели
генетические
изменения,
характерные
для
неопластической
трансформации. Наблюдаемая вариабельность хромосомных аберраций и
анеуплоидия говорит о хромосомной нестабильности клеток. Наиболее вероятный
механизм трансформации данных клеток связан с нарушениями аппарата деления,
прошедшим через образование тетраплоидных клеток или амплификацию
центросом с последующим накоплением хромосомных аберраций, связанных с
циклом BFB.
3.2. Сравнительный парный анализ транскриптома нормальных и
спонтанно трансформированных ММСК ЖТ человека
3.2.1. Подготовка данных для анализа
После цитогенетического анализа клеток был проведен сравнительный
парный анализ транскриптома нормальных и трансформированных ММСК ЖТ
человека для оценки изменений на уровне транскрипции генов, произошедших с
клетками в результате процесса трансформации. Исследование транскриптома
было сфокусировано на анализе результатов эксперимента по данным о
78
дифференциальной экспрессии генов при неопластической трансформации
клеток.
Для исследования были использованы культуры нормальных ММСК,
выделенные из ЖТ 6-ти здоровых доноров, и образцы клеточных культур
спонтанно трансформированных ММСК, выделенные из культур нормальных
ММСК ЖТ тех же доноров. Образцы клеточных культур были отправлены в
компанию «Геноаналитика» для проведения гибридизации тотальной РНК на
микрочипе Illumina HT-12 v4 (47318 зондов, 30-40 силиконовых «бусинок» на
каждый зонд). В результате гибридизации и анализа флуоресценции «бусинок»
микрочипа были получены первичные данные в виде таблицы интенсивностей
флуоресценции по каждому гибридизованному транскрипту в 12-ти образцах.
Средняя интенсивность флуоресценции каждой «бусинок» отражает
представленность каждого транскрипта в клетках образца. Но в таком виде
данные непригодны для функционального анализа и сравнения. Поэтому
первичные данные были обработаны с помощью пакета lumi Bioconductor [Du P.
et
al.,
2008]
статистического
языка программирования
R,
специально
разработанного для обработки данных Illumina. Процесс обработки состоял из
трансформации данных и нормализации данных между образцами.
Первичная
обработка
включала
этап
трансформации
значений
интенсивности флуоресценции зондов для стабилизации дисперсии уровня
сигнала, а также нормализацию интенсивностей сигналов и приведение их к
одному уровню (раздел 2.6.5 главы «Материалы и методы»). После первичной
обработки данные стали пригодны для дальнейшего статистического анализа и
сравнения (рисунок 7). Первичные и обработанные данные затем были
депонированы
в
базу
данных
Gene
идентификационным номером GSE42809.
Expression
Omnibus
(GEO)
под
79
А
В
Б
Рисунок 7. Графики плотности интенсивностей сигналов флуоресценции, отражающие
алгоритм обработки первичных данных. А – Первичные данные до обработки, Б – первичные
данные после стабилизации дисперсии (трансформации) В – первичные данные после
трансформации и нормализации. Индексом Т обозначены образцы трансформированных
клеток, N – образцы нормальных клеток. Уменьшение дисперсии и нормализация данных
характеризуются согласованностью сигналов и уменьшением площади пика.
Графики
получены с помощью программы R 3.0.2.
После обработки данных также был проведен анализ качества (QC)
гибридизации. Анализ показал воспроизводимость сигнала зондов между
образцами и равную долю детектируемых зондов в образцах, что свидетельствует
о хорошем качестве гибридизации (таблица 7).
80
Таблица 7. Суммарные результаты проверки качества гибридизации (QC) после обработки
первичных данных. T-трансформированные, N-нормальные. Получено с помощью R 3.0.2.,
пакет lumi.
Образец
Средний сигнал
по образцу
Среднеквадратичное
отклонение
BB25-N
BB25-T
BL29-N
BL29-T
KR30-N
KR30-T
PU28-N
PU28-T
VA18-N
VA18-T
VO21-N
VO21-T
7,8050
7,8040
7,8020
7,8020
7,8040
7,8030
7,8020
7,8020
7,8020
7,8020
7,8020
7,8010
0,7253
0,7255
0,7278
0,7249
0,7289
0,7265
0,7287
0,7259
0,7285
0,7251
0,7287
0,7258
Доля
детектируемых
проб (p<0,01)
0,3166
0,3021
0,3011
0,2919
0,2975
0,3086
0,3096
0,2922
0,2921
0,3034
0,3048
0,2930
Расстояние
до среднего
по образцу
32,1600
36,5500
43,6300
35,9300
38,7800
36,6500
35,7200
39,1500
52,7700
40,1600
33,1800
38,3600
На сегодняшний день нет «золотого стандарта» для обработки и анализа
данных, полученных с помощью микрочипов. По данным литературы и форумов,
связанных с
анализом транскриптома,
наилучшим подходом считается
максимальное сохранение полученных данных по экспрессии с минимальной
фильтрацией по различным пороговым значениям во избежание потери
информации. Поэтому в данном исследовании был использован компромиссный
подход. Для повышения достоверности результатов была проведена фильтрация
зондов по уровню детекции сигнала при пороговом значении detection pvalue<0,01
в
50%
образцов
хотя
бы
одной
из
двух
групп
(т.е.
трансформированных или нормальных), а затем зонды были переаннотированы
согласно последнему обновлению базы данных транскриптов RefSeq во
избежание
использования
устаревших
сведений.
Сигналы
от
зондов,
картированных к одним и тем же транскриптам объединили методом
макимального среднего (см. раздел 2.6.5 главы «Материалы и методы»).
В результате обработки и фильтрации данных от 47318 зондов было
получено 14246 транскриптов пригодных для анализа.
81
3.2.2. Определение дифференциально экспрессированных транскриптов с
помощью алгоритма Significance analysis of microarrays (SAM)
Перед дифференциальным и функциональным анализом данных было
проведено разведывательное исследование методом анализа соответствий
(рисунок 8). Видно, что образцы нормальных клеток значительно отличаются
друг от друга по профилю экспрессии, что связано с гетерогенностью первичных
культур ММСК ЖТ. Образцы трансформированных клеток сгруппированы
близко друг к другу и, следовательно, очень близки по профилю экспрессии. Это
может свидетельствовать о том, что из изначально гетерогенной популяции
ММСК in vitro трансформацию претерпевает определенная субпопуляция клеток
и/или процесс трансформации гетерогенной культуры ММСК приводит к
унифицированному профилю экспрессии генов.
Рисунок
8.
Анализ
соответствия
профилей
экспрессии
генов
нормальных
(●)
и
трансформированных (♦) образцов. Линии векторов показывают средний профиль экспрессии
по каждой группе образцов. Кумулятивный процент инерции равен 45.825%. Получено с
помощью программы J-Express Pro 2012.
82
Далее с помощью модифицированной t-статистики для парных образцов,
входящей в программу Significance analysis of microarrays (SAM), был проведен
статистический анализ экспрессии транскриптов. В ходе данного анализа
учитывается
не
только
величина
изменения
экспрессии
в
паре
нормальный/трансформированный образец, но и дисперсия этого изменения
между
парами.
Результатом этого
анализа стал список транскриптов,
ранжированный по значимости и стабильности изменения экспрессии между
всеми парами исследуемых образцов. Данный ранжированный список затем
использовался
для
определения
дифференциально
экспрессированных
транскриптов и функционального анализа профилей экспрессии групп генов с
учетом порога по базе данных Gene Ontology (GO) и беспороговому алгоритму
GSEA (gene set enrichment analysis).
3.2.3. Связь дифференциальной экспрессии транскриптов с результатами
цитогенетического анализа
По
результатам цитогенетического
анализа был сделан вывод о
хромосомной нестабильности спонтанно трансформированных ММСК ЖТ
человека. Для того чтобы подтвердить это на уровне транскрипции был
проанализирован профиль экспрессии 70 генов - 70CIN [Carter S.L. et al., 2006],
изменение экспрессии которых высоко коррелирует с наличием хромосомной
нестабильности в клетках. В результате анализа было обнаружено, что 64 из 70
генов значимо повысили экспрессию в спонтанно трансформированных ММСК
ЖТ человека по сравнению с нормальными при уровне значимости q-value<0,05
(приложение 1). В списке также присутствуют 29 генов, аберрантная экспрессия
которых
функционально
связана
с
анеуплоидией
и
хромосомной
нестабильностью согласно опубликованным исследованиям. Экспрессия всех
этих генов также значимо повышена, при этом 9 из них повысили экспрессию
более чем в 2 раза (рисунок 9).
83
0
1
2
3
4
TPX2*
PRC1
FOXM1
CDC2 (CDK1)
TOP2A*
CNAP1 (NCAPD2)
KIF20A
MAD2L1
ESPL1
CCNB2*
TTK
RFC4
ch-TOG (CKAP5)*
CDC20*
CCNB1
AURKB*
CDCA8
PTTG1*
CEP55
H2AFX
BRRN1 (NCAPH2)
MTB (NCAPG2)
ZWINT
FLJ10036 (ZWILCH)*
ECT2
RAD21
NEK2
STK6 (AURKA)*
KIF4A
Рисунок 9. 29 генов, ассоциация которых с хромосомной нестабильностью достоверно
показана по данным литературы и кратность изменения их экспрессии (FC) между
трансформированными и нормальными ММСК ЖТ человека при q<0,05. * - FC≥2.
Ген TPX2 необходим для нормальной морфологии веретена деления и
интактности центросом, а также для нацеливания Aurora-A киназы на аппарат
веретена деления. Его гиперэкспрессия вызывает полиплоидизацию.
Ген TOP2A каталитизирует сегрегацию хромосом.
Ген CCNB2 кодирует белки семейства циклинов. Его гиперэкспрессия
приводит к хромосомной нестабильности.
84
Белки гена ch-TOG (CKAP5) имеют несколько функций во время митоза: в
фокусировке (-)-концов микротрубочек на полюсах веретена деления, поддержке
цельности центросом и биполярности веретена.
Ген CDC20 играет важную роль в разделении хромосом.
Ген PTTG1 предотвращает разделение сестринских хроматид белками
сепаринами. Продукт гена имеет трансформирующую активность in vitro и
туморогенную
in
vivo.
Его
гиперэкспрессия
наблюдается
при многих
онкозаболеваниях, вызывает анеуплоидию.
Продукт гена FLJ10036 (ZWILCH) – белок, связанный с кинетохорами. Его
аберрантная экспрессия также приводит к хромосомной нестабильности.
Наблюдается гиперэкспрессия генов AURKA (NM_198436 и NM_198434,
кодирующих один белок) и AURKB (увеличение в 3,6 и в 2,7 раз соответственно),
которые по данным литературы присутствуют при разных онкологических
заболеваниях и ассоциируются с амплификацией центросом и тетраплоидизацией
клеток [Meraldi P. et al., 2002]. Кроме того AURKA может быть инициатором
трансформации клеток.
Также была рассмотрена экспрессия генов, которые могут быть связаны с
тетраплоидизацией и последующей анеуплоидией, обсужденных в разделе,
посвященном анализу цитогенетических данных. Из этих генов наблюдается
увеличение BIRC5 (Survivin; FC=1,96 q=0,002), BUB1 (FC=1,42 q=0,001), BUB3
(FC=1,51 q=0,006) и PLK1 (FC=1,26 q=0,000), а также снижение экспрессии p21
(CDKN1A; FC=0,1 q=0,000), что связывают с хромосомной нестабильностью и
амплификацией центросом,
а также
способностью аберрантных клеток
продолжать деление [Duensing A. et al., 2006; Yamamoto Y. et al., 2006; Vitale I. et
al., 2010; Ricke R.M. et al., 2011]. Также наблюдается изменения в экспрессии
других
генов,
которые
связывают
с
амплификацией
центросом,
тетраплоидизацией клеток и хромосомной нестабильностью - YBX1 (FC=1,83
q=0,002), LMO4 (FC=0,36 q=0,000) и SCYL1, снижение экспрессии которого
характерно для опухолей мягких тканей (FC=0,48 q=0,003) [Chan J.Y., 2011].
85
Экспрессия ключевого фактора защиты клеток от тетраплоидизации - TP53,
- практически не изменилась (FC=1,13 q=0,004). Однако сохранение экспрессии
p53 не означает, что продуцируемый белок активен. Есть данные, что продукт
гена AURKA инактивирует p53 фосфорилированием Ser-215, что позволяет
клеткам избежать клеточного ареста и апоптоза при нарушениях деления [Liu Q.
et al., 2004; Katayama H. et al., 2003].
Таким образом, амплификация центросом с последующим мультиполярным
митозом является наиболее вероятным механизмом, приводящим к хромосомной
нестабильности, анеуплоидии и наблюдаемому хромосомному набору, близкому к
тетраплоидному, спонтанно трансформированных ММСК ЖТ человека.
3.2.4. Функциональный анализ наиболее значимо изменившихся по экспрессии
транскриптов
Для
анализа
наиболее
значимо
изменившихся
дифференциально
экспрессированных транскриптов были использованы следующие критерии
отбора: пороговая значимость для алгоритма SAM по достоверности изменения
экспрессии Δ=2,09 (FDR=1,03%) и q-value<0,01. В результате такого отбора было
определено, что из 14246 транскриптов достоверно изменили экспрессию 6355
транскриптов - 3317 транскриптов (3058 генов) с повышенной экспрессией и 3038
транскриптов (2808 генов) с пониженной экспрессией в трансформированных
образцах по сравнению с нормальными. Из них более чем в два раза повысилась
экспрессия у 334 транскриптов (324 генов) и понизилась у 469 транскриптов (449
генов).
Самый высокий ранг в списке соответствовал наиболее значимым
изменениям
в
экспрессии
генов
по
всем образцам между группами
трансформированных и нормальных клеток. В данную группу вошли 30 наиболее
значимо измененных транскриптов по всей совокупности 6-ти исследуемых
образцов трансформированных клеток по сравнению с 6-ю образцами
нормальных ММСК. При анализе функциональных характеристик этой группы
транскриптов по базе данных NCBI [http://www.ncbi.nlm.nih.gov/gene] было
86
обнаружено, что выявленный профиль экспрессии этих генов в опытных образцах
ассоциируется по данным литературы с неопластической трансформацией клеток
(таблица 8, 9). Интересно, что 6 генов из этого списка (HSPB6, PLAC9, FEZ1,
DTWD1, APH1A, ATP5L) ранее не описывались в качестве генов, экспрессия
которых
связана
с
трансформацией
клеток и онкологией.
Изменения
транскрипции по этим генам высоко достоверны и характерны для всех 6 линий
трансформированных ММСК.
Таблица 8. Транскрипты с наиболее значимым снижением экспрессии согласно SAM
Ген
HTRA1
HSPB6
PLAC9
CTSL
CTSL
PRRX1
ADAMTSL1
IL13RA2
PPAP2B
DCN
FEZ1
ENG
SH3BGRL3
KLF12
DTWD1
Изоформа (RefSeq)
serine protease HTRA1
precursor
heat shock protein beta-6
placenta-specific protein
9 precursor
cathepsin L1 isoform 1
preproprotein
cathepsin L1 isoform 1
preproprotein
paired mesoderm
homeobox protein 1
isoform pmx-1a
ADAMTS-like protein 1
isoform 4 precursor
interleukin-13 receptor
subunit alpha-2 precursor
lipid phosphate
phosphohydrolase 3
decorin isoform c
precursor
fasciculation and
elongation protein zeta-1
isoform 2
endoglin isoform 2
precursor
SH3 domain-binding
glutamic acid-rich-like
protein 3
Krueppel-like factor 12
DTW domain-containing
protein 1
Ранг
изменения
Кратность
изменения
экспрессии (FC)
NM_002775
-44,66
0,04
NM_144617
-38,70
0,08
NM_001012973
-33,58
0,19
NM_145918
-33,25
0,05
NM_001912
-32,95
0,04
NM_006902
-30,81
0,10
NM_001040272
-29,66
0,70
NM_000640
-29,63
0,07
NM_003713
-29,39
0,05
NM_133505
-29,18
0,02
NM_022549
-28,72
0,72
NM_000118
-28,32
0,25
NM_031286
-27,96
0,25
NM_007249
-27,60
0,80
NM_020234
-25,88
0,70
Транскрипт
(RefSeq)
Cниженная экспрессия HTRA1 замечена во многих злокачественных
новообразованиях, где способствует росту и инвазивности опухоли. По данным
87
литературы сильно сниженная экспрессия этого транскрипта активирует
эпителиально-мезенхимальную транзицию (EMT) и ATM/ATR сигнальный путь
ответа на повреждения ДНК [Xia J. et al., 2013; Wang N. et al., 2012].
Функция белка HSPB6 и других белков этого семейства (экспрессия
которых тоже снижена, но с низкой статистической значимостью) связана с
защитой клеток от окислительного стресса с усилением AKT сигнального пути,
предотвращая формирование F-актина и ингибируя RHOA ГТФ-азу [Wang X. et
al., 2009; Ke L. et al., 2011].
О гене PLAC9 мало что известно, кроме того, что он экспрессируется
преимущественно в плаценте.
Ингибирование цистеиновой протеиназы CTSL приводит к стабилизации
экспрессии p53BP1, повышению генетической нестабильности и нарушениям
пролиферации клеток [Grotsky D.A. et al., 2013].
Экспрессия PRRX1 индуцирует EMT, а потеря его экспрессии индуцирует
обратный процесс, который способствует метастазированию [Ocaña O.H. et al.,
2012].
ADAMTSL1 относится к семейству металлопротеазоподобных белков.
Возможно, имеет важную функцию в организации внеклеточного матрикса и
регуляции EMT [Hirohata S. et al., 2002; Du J. et al., 2010].
Повышенная экспрессия IL13RA2 ассоциируется со многими видами
злокачественных неоплазий, однако есть данные исследований по клеточным
линиям рака молочной железы, в которых экспрессия данного гена значительно
снижена, как и в клетках спонтанно трансформированных ММСК ЖТ человека.
PPAP2B играет ключевую роль в управлении сигнального пути бетакатенин/LEF-1
посредством
PTEN,
регулируя
процессы
эндотелиальной
клеточной миграции и клеточной адгезии [Humtsoe J.O. et al., 2010].
DCN – это маленький протеогликан, взаимодействующий с компонентами
внеклеточного матрикса и модулирующий формирование коллаген-фибрилл, а
также регулирующий активность TGFβ1 (все эти компоненты достоверно снизили
экспрессию в результате трансформации ММСК ЖТ человека). Потеря
88
экспрессии DCN по данным литературы ассоциируется со злокачественной
трансформацией клеток и является надежным биомаркером агрессивности
опухолей мягких тканей [Matsumine A. et al., 2007; Goldoni S. & Iozzo R.V., 2008].
FEZ1 отвечает за подвижность клетки.
ENG (CD105) – поверхностный белок адгезии и ко-рецептор TGFβ, который
в норме экспрессируется и является одним из характерных маркеров ММСК. Его
гиперэкспрессия замечена в клетках саркомы Юинга и меланоме, тогда как
сниженная экспрессия наблюдается в карциноме молочной железы [Pardali E. et
al., 2011].
Супрессия SH3BGRL3 связана с трансформацией клеток, индуцируемой
экспрессией
онкогена
REL
аберрантной
регуляцией экспрессии генов,
контролируемых семейством Rel/NF-κB белков [Majid S.M. et al., 2006].
KLF12 (AP2REP) – специфический репрессор транскрипционного фактора
развития организма TFAP2A. Изменение экспрессии TFAP2A в случае
онкогенной трансформации регулирует адгезию, миграцию, и апоптоз раковых
клеток [Orso F. et al., 2008].
DTWD1 – малоизученный ген.
Таблица 9. Гены с наиболее значимым повышением экспрессии согласно SAM
Ген
PRAME
FOXR1
TUBB2B
APH1A
GMPS
GART
PTPN2
Изоформа (RefSeq)
melanoma antigen
preferentially expressed
in tumors
forkhead box protein
R1
tubulin beta-2B chain
gamma-secretase
subunit APH-1A
isoform 1
GMP synthase
[glutaminehydrolyzing]
trifunctional purine
biosynthetic protein
adenosine-3 isoform 1
tyrosine-protein
phosphatase non-
Ранг
изменения
Кратность
изменения
экспрессии (FC)
NM_206955
42,55
3,90
NM_181721
31,57
3,72
NM_178012
31,11
27,22
NM_001077628
24,14
3,45
NM_003875
23,94
1,83
NM_000819
23,92
2,40
NM_080422
23,84
1,42
Транскрипт
(RefSeq)
89
PPP3R1
LAPTM4B
NET1
EEF1A2
CGN
HSP90AB1
CDC42SE1
ATP5L
receptor type 2 isoform
2
calcineurin subunit B
type 1
lysosomal-associated
transmembrane protein
4B
neuroepithelial celltransforming gene 1
protein isoform 2
elongation factor 1alpha 2
cingulin
heat shock protein HSP
90-beta isoform a
CDC42 small effector
protein 1
ATP synthase subunit
g, mitochondrial
NM_000945
22,87
1,64
NM_018407
21,10
3,65
NM_005863
20,68
2,51
NM_001958
20,25
16,79
NM_020770
20,06
1,45
NM_007355
19,97
2,67
NM_001038707
19,34
1,95
NM_006476
19,29
3,34
PRAME в норме экспрессируется только в семенниках, а также в клетках
меланомы как основной антиген. Гиперэкспрессия этого гена также была
обнаружена в нескольких видах сарком мягких тканей [Skubitz K.M. et al., 2008].
На данный момент есть лишь одно исследование аберрантной повышенной
экспрессии FOXR1. Экспрессия данного гена в норме наблюдается только на
ранних
стадиях
эмбриогенеза,
однако
возникновение
определенных
микроделеций в промоторной области гена, приводит к его аберрантной
экспрессии в клетках нейробластомы, а также клеточных линиях остеосаркомы
HOS [Santo E.E. et al., 2012].
В исследуемых клетках наблюдалась повышенная экспрессия генов TUBB,
TUBB4, TUBB4Q, TUBB6, TUBB2A, TUBB2B, TUBB2C изоформ тубулина
(наиболее сильная разница в экспрессии у TUBB2B), кроме TUBB3, экспрессия
которого сильно снизилась. Исследования экспрессии генов тубулинов в
нормальных и опухолевых тканях показали сильный разброс в соотношении
представленности транскриптов [Leandro-García L.J. et al., 2010]. Повышенная
экспрессия тубулинов, по-видимому, связана с повышенной нагрузкой на аппарат
деления, вследствие амплификации центросом.
90
По результатам анализа также в клетках наблюдается почти 4-х кратное
повышение экспрессии APH1A (изоформа L), и в то же время почти 2-х кратное
падение экспрессии APH1B. Белки данных генов участвуют в формировании
комплекса гамма секретазы.
Есть данные, что уровень экспрессии GMPS значительно повышен в
пролиферирующих
и
трансформированных
клетках,
по
сравнению
с
нетрансформированными [Hirst M. et al., 1994].
GART играет ключевую роль в процессе биосинтеза пуринов de novo, и
является одной из целей раковой химиотерапии. Его повышенная экспрессия
может быть связана с увеличением интенсивности процессов синтеза ДНК и РНК,
проходящих в активно пролиферирующих трансформированных клетках.
Обычно с различными заболеваниями и онкогенной трансформацией
связано падение экспрессии PTPN2 [Carnero A. et al., 2008], а не повышение, как в
случае с трансформацией ММСК ЖТ человека. Данный ген кодирует тирозин
фосфатазу белков, которая принимает участие в регуляции процессов клеточного
роста, дифференцировки и митотического цикла. Основными известными
субстратами этого белка являются EGFR и SHC [Tiganis T. et al., 1998]. В
трансформированных ММСК ЖТ человека наблюдается падение более чем в 2
раза одного из вариантов транскрипта SHC1, связанного с процессами регуляции
жизненного цикла клетки и ответом на воздействие активных форм кислорода.
При этом экспрессия гена SHCBP1, взаимодействующего с SHC белками
достоверно повышена в 1,8 раз. Также с низкой достоверностью наблюдается
небольшое снижение уровня экспрессии EGFR.
Гипреэкспрессия PTPN2 ассоциируется с активацией p53 и каспаза-1зависимого апоптоза [Gupta S. et al., 2002]. Согласно полученным данным
экспрессия p53, а также p53BP-1 и -2 немного повышена, вместе с тем
наблюдается снижение экспрессии генов белков, индуцируемых p53, а также
TP53RK – киназы, регулирующей активность p53. Активность TP53RK напрямую
зависит от активности AKT биохимического пути [Facchin S. et al., 2007]. Так как
PTPN2 также является потенциальным негативным регулятором AKT пути
91
[Omerovic J. et al., 2010], связанным со многими онкогенными трансформациями
[Carnero A., 2010], экспрессия АКТ1 и AKTIP достоверно снижена в
трансформированных ММСК ЖТ человека, что и привело к сниженной
экспрессии TP53RK.
PPP3R1 (CALNB) – B регуляторная субъединица кальциневрина, которая
вместе с каталитически активной А субъединицей образуют Ca(2+)/кальмодулинстимулируемую фосфатазу белков. Данные об экспрессии в трансформированных
ММСК ЖТ человека согласуются с результатами, полученными в исследовании
трансфицированных HEK293 с приобретенной гиперэкспрессией CALNB. В
трансформированных ММСК ЖТ человека также наблюдается повышенная
экспрессия PPP3R1 и практически не изменившаяся экспрессия PPP3CA
(CALNA). Экспрессия PPP3R1 способствует росту онкогенного потенциала
клеток – миграции, пролиферации и росту в мягком агаре [Wang Y.-L. et al., 2008].
Повышенная экспрессия LAPTM4B достоверно наблюдается в карциномах
разного типа [Kasper G. et al., 2005]. Помимо этого в трансформированных ММСК
ЖТ человека наблюдается сниженная почти в 2 раза экспрессия LAPTM4A.
В трансформированных ММСК ЖТ человека достоверно наблюдается
сильно повышенная экспрессия обеих изоформ NET1. Белок, кодируемый данным
геном, взаимодействует с RHOA в ядре и может играть важную роль в репарации
ДНК после ионизирующего излучения [Dubash A.D. et al., 2011]. Его
гиперэкспрессия в онкологических клетках способствует миграции и инвазии
опухоли [Bennett G. et al., 2011; Chen L. et al., 2007], однако согласно данным о
регулируемых им генах в онкологических клетках, падение его экспрессии
вызывает и их падение, а в трансформированных ММСК ЖТ человека данные
гены потеряли экспрессию, несмотря на высокую экспрессию NET1. В
трансформированных ММСК ЖТ достоверно увеличена экспрессия SMAD3 в 1,5
раза, что может влиять на активность RHOA и EMT трансформацию, путем
активации экспрессии NET1 [Lee J. et al., 2010]. Экспрессия NET1 сама по себе
может являться инициатором онкогенной трансформации, но только в том случае,
92
если ген экспрессируется в своей онкогенной форме, характеризующийся
отсутствием первых аминокислот нормальной белковой цепи [Qin H. et al., 2005].
Повышенная экспрессия второй изоформы альфа субъединицы фактора
элонгации-2 EEF1A2 наблюдается во многих видах карицином [Lee M.H. & Surh
Y.J., 2009]. Также есть сведения о его связи с AKT сигнальным путем и
онкогенной экспрессией ZNF217 (экспрессия которого также повышена в
трансформированных ММСК ЖТ человека) в карциноме яичников [Amiri A. et al.,
2007; Sun Y. et al., 2008].
Цингулин (CGN) кодирует белок, регулирующий экспрессию многих генов
и активность RHOA сигнального пути, его экспрессия характерна для
эпителиальных клеток. Согласно проведенным исследованиям, повышение
экспрессии CGN не влияет на экспрессию и активность регулируемых им генов,
однако потеря его экспрессии сильно сказывается на экспрессии по дчиненных
ему белков [Citi S. et al., 2009], меняя фенотип клеток, что является одной из
составляющих
EMT.
Соответственно,
возобновление его
экспрессии в
подвергнувшихся EMT клетках приводит к обратному процессу и приобретению
клетками эпителиального фенотипа, как было показано на мезенхимальном раке
молочной железы [Papageorgis P. et al., 2010].
Экспрессия шаперона HSP90AB1, также как и HSP90AA1 повышена почти
в 3 раза в трансформированных ММСК ЖТ человека по сравнению с
нормальными. Бета-изоформа шаперона 90 (HSP90AB1) является одним из
характерных
маркеров
мезенхимальных
стволовых
клеток
и
в
норме
экспрессируется на поверхности этой клетки. Согласно данным исследований
наблюдается повышенная экспрессия альфа и бета изоформ шаперонов в разных
типах карцином, а также фибросаркомы и меланомы. В данных случаях они
способствуют
метастазированию
опухолей,
а
также
выполняют
роль
стабилизаторов важных для онкогенной трансформации белков [McDowell C.L. et
al., 2009; Gronthos S. et al., 2009].
CDC42SE1 – один из малых эффекторов киназы CDC42. Его повышенная
экспрессия ингибирует Cdc42-активацию JNK сигнала [Pirone D.M. et al., 2000].
93
ATP5L – субъединица митохондриально й ATP-синтазы, нет данных о его
связи с онкозаболеваниями.
3.2.5. Разнонаправленное изменение экспрессии транскриптов одного гена
Среди значимо изменившихся по экспрессии транскриптов (FDR qvalue<0,01) 706 представляли по два транскрипта одного гена, 42 представляли по
три транскрипта одного гена. Все найденные варианты транскриптов показали
согласованную экспрессию по генам, кроме 12-ти (таблица 10). Данные различия
могут являться характерной чертой трансформированных ММСК в сравнении с
нормальными, так как по литературным данным некоторые стадии развития
неоплазий и прогноз их развития различаются по уровню представленности
вариантов транскриптов одного гена [Gotoda T. et al., 2000].
Таблица 10. Гены с несогласованной экспрессией транскриптов согласно SAM анализу
Ген
AK2
AK2
HNRNPK
HNRNPK
LARP6
LARP6
PAOX
PAOX
SMARCC2
SMARCC2
WTAP
WTAP
Изоформа
adenylate kinase 2,
mitochondrial isoform a
(longest)
adenylate kinase 2,
mitochondrial isoform b
heterogeneous nuclear
ribonucleoprotein K isoform
b
heterogeneous nuclear
ribonucleoprotein K isoform a
la-related protein 6 isoform 1
la-related protein 6 isoform 2
peroxisomal N(1)-acetylspermine/spermidine oxidase
isoform 4
peroxisomal N(1)-acetylspermine/spermidine oxidase
isoform 1
SWI/SNF complex subunit
SMARCC2 isoform b
SWI/SNF complex subunit
SMARCC2 isoform a
(longest)
pre-mRNA-splicing regulator
WTAP isoform 2
pre-mRNA-splicing regulator
WTAP isoform 1 (longest)
Транскрипт
(RefSeq)
Ранг
изменения
Кратность
изменения
экспрессии (FC)
NM_001625
-3,68
0,63
NM_013411
3,57
1,13
NM_031262
-3,44
0,94
NM_031263
7,20
2,91
NM_018357
NM_197958
-3,19
3,18
0,76
1,55
NM_207128
-8,32
0,83
NM_152911
3,08
1,06
NM_139067
-8,85
0,74
NM_003075
3,55
1,06
NM_152858
-3,07
0,95
NM_004906
8,76
1,31
94
3.2.6. Групповой функциональный анализ дифференциально экпрессированных
генов
Ранжированный список транскриптов, отражающий профиль экспрессии
трансформированных ММСК ЖТ человека, после обработки был сведен в
итоговый
список,
содержащий
12977
уникальных
символов
генов.
Функциональный анализ по группам генов c порогом по значимости и кратности
изменения экспрессии проводился с помощью программы Gorilla по базе данных
Gene Ontology (GO), анализ без порога проводился с помощью программы Gene
set enrichment analysis (GSEA) по базе данных MSigDB.
Из списка для анализа в базе данных GO были взяты наиболее сильно и
достоверно изменившиеся по экспрессии гены с FDR q-value<0,01 и 0,5≥FC≥2.
Результаты анализа показали (при FDR q-value<0,01), что гены с повышенной
экспрессией принадлежат по своей молекулярной функции к структурным
компонентам рибосом (рибосомным белкам) и РНК-связывающимся белкам, по
клеточным
компонентам
к
рибонуклеопротеиновым
комплексам
и
макромолекулярным комплексам. Гены с пониженной экспрессией принадлежат к
генам, исполняющим функции структурных элементов внеклеточного матрикса,
связывания
с
различными
соединениями
(глюкозаминогликанами,
серосодержащими, гепарином и др.), связанных с передачей сигналов в клетках, и
принадлежат к компонентам внеклеточного матрикса клетки и коллагенам.
Результаты анализа по биологическим процессам практически идентичны
групповому функциональному анализу GSEA по базе данных канонических
сигнальных путей MSigDB, поэтому далее приведены общие выводы по
сигнальным путям из результатов по двум этим базам данных.
Список из 12977 ранжированных уникальных символов генов без введения
порога по значимости или кратности изменения экспрессии анализировали в
GSEA по разным разделам базы данных MSigDB. Значимые результаты анализа
GSEA в виде таблиц (при FDR q-value<0,05) представлены в приложении 2.
95
Анализ по каноническим сигнальным путям базы данных MSigDB (как и по
биологическим процессам базы данных GO) показал, что основная часть
значимых
совпадений
трансформированных
по
ММСК
генам
ЖТ
с
повышенной
человека
экспрессией
относятся
к
в
процессам
транскрипции/трансляции (процессинг РНК, транскрипционная регуляция,
экспрессия генов и др.) и регуляции клеточного цикла и митотического деления, а
также синтезу и репарации ДНК (рисунок 10). Это согласуется с данными
цитогенетического анализа, так как данные процессы действительно занимают
важное место в жизнедеятельности трансформированных клеток.
Рисунок 10. Диаграмма значимых совпадений (q<0,05) в процентном соотношении по генам с
повышенной экспрессией в базе данных канонических сигнальных путей MSigDB.
Среди значимых совпадений по генам с пониженной экспрессией в
трансформированных ММСК примерно в равном соотношении представлены
гены, задействованные в процессах межклеточного взаимодействия и изменения
цитоскелета, а также генами поверхностных рецепторов и передачи сигналов в
клетку (рисунок 11). Снижение экспрессии генов цитоскелета, адгезии и
внеклеточного матрикса связано с изменением морфологии клеток в процессе
трансформации и приобретением новых ростовых характеристик, таких как
отсутствие контактного ингибирования и способность расти в полужидких
средах.
96
Рисунок 11. Диаграмма значимых совпадений (q<0,05) в процентном соотношении по генам с
пониженной экспрессией в базе данных канонических сигнальных путей MSigDB.
Дальнейший анализ проводился по наиболее крупной базе данных MSigDB
– базе данных химических и генетических пертурбаций. Результаты этого анализа
представлены ниже. При анализе внимание обращалось не только на уровень
значимости совпадения, но и на направление изменения экспрессии генов в
найденном совпадении. Также учитывали гены, внесшие наибольший вклад в
статистику («leading edge») и на сопровождающее описание эксперимента в базе
данных.
Повышенная экспрессия:
В трансформированных клетках наблюдалась повышенная экспрессия
генов, запускающих сигнальный каскад киназы ATR в ответ на репликативный
стресс [Smith J. et al., 2010]. Нарушения работы этого пути связаны с отсутствием
кэпирования хромосом и аберрантным вхождением в митоз, что приводит к циклу
break-fusion-bridge (BFB) [Chang S., 2012], наличие которого в исследуемых
клетках было предположено по результатам цитогенетического анализа
[Омельченко Д.О. и др., 2012]. Также наблюдалась повышенная экспрессия у
генов, отвечающих за активацию пререпликативного комплекса, репликацию и
элонгацию цепи ДНК, G2-M переход (что также является частью сигнального
пути ATR/ATM) и репарацию ДНК (например, гены семейства белков FAN,
BRCA и RAD51C).
Кроме того, повышенной экспрессией обладали гены транскрипционных
факторов, ответственных за активацию и контроль транскрипции TERT.
Повышена экспрессия генов, отвечающих за процессинг и сплайсинг мРНК (smn
97
комплекс, отвечающий за биогенез малых ядерных рибонуклепротеиновых частиц
сплайсосомы), а также ее ядерный транспорт.
Есть сигналы от генов с повышенной и пониженной экспрессией, которые
связанны с нарушениями E2F сигнального пути. Например, повышенная
экспрессия наблюдалась у генов транскрипционных регуляторов пролиферации
E2F семейства [Müller H. & Helin K., 2000] (два сигнала), среди которых
присутствует ген транскрипционного фактора E2F1, что часто связано с
нарушениями деления клеток при трансформации. Экспрессия активаторов из
семейства E2F – E2F3a, E2F2 и TFDP1 повышена в трансформированных ММСК
ЖТ человека (в 1,47, 1,44 и 1,58 раз соответственно), что, по-видимому, связано с
наблюдаемыми результатами анализа.
Также были получены результаты, связанные с HCF1 комплексом,
отвечающим за регуляцию транскрипции через изменения структуры хроматина,
с целями и партнерами фермента EZH2 (его повышенная экспрессия замечена во
многих
злокачественных
новообразованиях,
где
он
исполняет
роль
эпигенетического регулятора модификации гистонов, поддерживая стволовые
клетки рака и помогая им преодолевать репликативный стресс [van Vlerken L.E.,
2013]).
Многие из генов с повышенной экспрессией оказались связаны с
различными онкологическими заболеваниями, не ограничиваясь при этом только
саркомами, что было бы логично предположить, принимая во внимание
происхождение и свойства трансформированных клеток. Был обнаружен ряд
генов с повышенной экспрессией, связанный с нарушением экспрессии факторов
пролиферации E2F семейства и характерного кластера генов шейной карциномы
[Ishida S. et al., 2001]. Данный кластер генов пролиферации раковых клеток также
коррелирует с нарушениями в TP53 и RB (retinoblastoma) путях трансформации
клеток.
Среди ярко выраженных онкосигналов повышенной экспрессией обладали
гены репрессоров сигнального пути RAS - RALA и RALB [Oxford G. et al., 2007],
а также гены NME1-NME2, про которые известно, что они снижают потенциал
98
метастазирования во многих раковых клеточных линиях. Экспрессия NME1NME2
связана
с
увеличением
интенсивности
мРНК
процессинга
и
альтернативного сплайсинга, и соответствующим повышением экспрессии генов
ACIN1, PABP, HNRPA2B1, BOP1 и GEMIN [Lee J.H. et al., 2008].
Также изменения экспрессии генов, анеуплоидию и эпителиальномезенхимальный переход (EMT) клеток можно связать с гиперэкспрессией
известных онкомаркеров YBX1 [Annette L. et al., 2013] и ZNF217 [Thollet A. et al.,
2010;
Vendrell
J.A.
et
al.,
трансформированных ММСК.
2012],
обнаруженной
в
исследуемых
Также повышена экспрессия ряда генов,
регулируемая с-MYC, экспрессия которого в трансформированных ММСК ЖТ
человека снижена [Zeller K.I. et al., 2003; Kaur M. & Cole M.D., 2013; Okuyama H.
et al., 2010]. Это может быть связано с тем, что в некоторых случаях снижение его
экспрессии увеличивает выживаемость раковых клеток в неблагоприятных
условиях. Например, гипоксия и гипогликемия при расположении опухоли вдали
от кровеносных сосудов.
Были также найдены гены, повышенная экспрессия которых характерна для
нестабильного типа саркомы Юинга [Ferreira B.I. et al., 2008] и синовиальной
саркомы [Nielsen T.O. et al., 2002]. Найдено соответствие профиля повышенной
экспрессии генов с нарушениями репликации и репарации ДНК в клетках
меланомы с плохим прогнозом, а также с кластерами генов рака молочной железы
и стволовых клеток рака.
Пониженная экспрессия:
Среди генов с пониженной экспрессией в трансформированных клетках
можно выделить группу, связанную с экспрессией ДНК-репаративного белка
ERCC6 (CSB) и короткой сплайс формы ATF2 - транскрипционного фактора,
связанного с поддержкой и структурным ремоделированием хроматина. Также
есть сильный сигнал, связанный с пониженной экспрессией генов кластера
иммортализации [Fridman A.L. & Tainsky M.A., 2008] и генов, индуцируемых
гиперэкспрессией FOXA2 [Huang G. et al., 2008].
99
Также сниженная экспрессия наблюдалась среди генов сигнальных путей,
связанных с трансформацией клеток через пути RHOA [Berenjeno I.M. et al., 2007;
Lindvall C. et al., 2003] и KRAS [Chiaradonna F. et al., 2006].
Наблюдалось падение экспрессии генов молекул клеточной адгезии, ECMрецепторов, интегринов и синдеканов, внеклеточного матрикса. Данные сигналы
дополняет сниженная экспрессия NFkB-индуцируемых генов матрикса, адгезии и
цитоскелета, а также сигналы, наблюдаемые в клеточных линиях глиобластомы,
которые способны формировать сфероиды без прикрепления к подложке.
Проведенные ранее эксперименты с использованием мягкого агара показали
сходную особенность у спонтанно трансформированных ММСК ЖТ человека
(данные не представлены).
Были обнаружены сигналы напрямую или косвенно связанные с EMT.
Наблюдается сниженная экспрессия связанных с EMT генов, характерная для
инвазивных типов рака [Anastassiou D. et al., 2011]. Обратный процесс
мезенхимально-эпителиального
преобразования
(MET)
может
объяснить
наблюдения того, что спонтанно трансформированные ММСК, в отличие от
нормальных клеток, имеют в культуре смешанный состав клеток эпителиальной и
мезенхимальной морфологии [Ржанинова А.А. и др., 2010].
Обнаружена сниженная экспрессия генов, связанных с мутациями в ММСКпредшественниках саркомы Юинга (экспрессия химерного гена EWS-FLI1) [Riggi
N. et al., 2008]. Также с высоким уровнем значимости и хорошим сигналом
обнаружен
профиль
экспрессии,
характерный
для
альвеолярной
рабдомиосаркомы [Ren Y.X. et al., 2008].
Объединяя результаты сравнительного парного анализа транскриптома
спонтанно трансформированных ММСК ЖТ человека можно сказать, что
профиль экспрессии генов характеризует неопластическую трансформацию и
иммортализацию клеток в основном вследствие нарушений в структуре
хроматина и геноме (мутационный процесс, нарушения в аппарате деления,
нарушения сегрегации хромосом в ответ на репликативный стресс и т.д.).
100
Трансформация ММСК ассоциируется с нарушениями в сигнальных путях
АКТ и RHOA. Также в ходе трансформации были затронуты и другие известные
сигнальные
пути,
нарушения
в
которых
связаны
с
неопластической
трансформацией, как например, RAS (RalA и RalB), ATR/ATM и E2F.
В клетках наблюдается высокая представленность генов, связанных с
нарушениями в процессах репликации, репарации ДНК, профиль экспрессии
которых коррелирует с наблюдаемыми профилями экспрессии многих раковых
линий. Есть совпадения с профилями экспрессии как клеток опухолей мягкой
ткани (рабдомиосаркома, синовиальная саркома, саркома Юинга), так и карцином
(в основном рак молочной железы).
Изменение экспрессии генов EMT говорит о том, что при трансформации
клетки претерпели мезенхимально-эпителиальный переход, что наблюдается в
виде смешанной морфологии клеток в культуре. Снижение экспрессии генов
внеклеточного матрикса и адгезии свидетельствует о снижении потребности
клеток в прикреплении к подложке и отсутствии контактного ингибирования,
характерного для неопластических клеток. Согласно функциональному анализу
способности к туморогенности, клеточной миграции и инвазии в них
малоактивны,
что
подтверждается
отсутсвием
опухолеобразования
в
исследовании, проведенным с данными образцами на иммунодефицитных мышах
[Новикова Н.И. и др., 2011].
Характерное изменение экспрессии генов, связанных с регуляцией
клеточного цикла и аппарата деления клеток, позволяет сделать вывод, что
хромосомная нестабильность и хромосомный набор, близкий к тетраплоидному
числу хромосом, был приобретен клетками в результате амплификации
центросом с последующим мультиполярным митозом. Амплификация центросом
является наиболее вероятным механизмом, приводящим к хромосомной
нестабильности, анеуплоидии и наблюдаемому хромосомному набору, близкому к
тетраплоидному, в спонтанно трансформированных ММСК ЖТ человека.
Из 30 наиболее значимо изменившиеся по экспрессии транскриптов
изменение экспрессии большинства связано либо напрямую с неопластической
101
трансформацией
клеток,
либо
с
процессами
эту
трансформацию
сопровождающими. Аберрантная экспрессия 6 генов из этой группы (HSPB6,
PLAC9, FEZ1, DTWD1, APH1A, ATP5L) ранее не упоминалась в литературе в
связи с онкологическими исследованиями. Их экспрессия может быть маркерной
для определения трансформации ММСК ЖТ человека. Шесть генов из
исследованных также имеют разнонаправленную экспрессию по транскриптам,
что также может являться характерной чертой трансформации клеток.
3.3. Оценка потенциала спонтанно трансформированных ММСК ЖТ
человека к стабильной генетической модификации
Рекомбинантные терапевтические белки являются одним из самых
востребованных продуктов биотехнологического производства. Некоторым из
них
требуются
специфические
посттрансляционные
модификации,
осуществление которых возможно только при экспрессии данных белков в
эукариотических системах. Иммортализованные экуариотические клетки в этом
случае обладают рядом преимуществ, основными из которых является
способность к бесконечной пролиферации, высокая адаптационная способность к
росту в разных средах, правильная сборка и модификация целевого белка.
Использование
иммортализованных
клеточных
линий
человека
–
это
перспективное направление развития биотехнологии сегодня.
Трансформированные клетки ММСК обладают всеми необходимыми
базовыми характеристиками для применения в этой области, поэтому была
исследована потенциальная возможность их практического применения в области
производства рекомбинантных терапевтических белков на примере постоянной
генетической модификации клеток лентивирусным конструктом с репортерным
флуоресцентным белком TagGFP2. Такое исследование необходимо, так как
реакция на трансдукцию и последующая экспрессия трансгена индивидуальны
для разных клеток.
102
3.3.1. Отбор культуры клеток трансформированных ММСК ЖТ, способной к
росту на бессывороточной среде
Перед проведением лентивирусной трансдукции был проведен скрининг на
способность шести исследуемых клеточных линий трансформированных ММСК
ЖТ человека расти на культуральной среде с низким содержанием сыворотки.
Высокая концентрация сыворотки позволяет культурам легче прикрепляться к
подложке, поскольку богата микроэлементами и ростовыми факторами,
необходимыми для пролиферации, поддержания и формирования цитоскелета и
межклеточных контактов. При культивировании прикрепленных клеточных
линий в ростовой среде без сыворотки клетки образуют конгломераты, слабо
адгезированные на подложке. При этом полного перехода клеток в суспензию не
происходит. Способность клеток расти в суспензии на минимальном количестве
сыворотки крови или ее заменителях является важной характеристикой для
последующего их применения в биотехнологии, поскольку позволяет экономить
ресурсы биореактора и производить большее количество биомассы при меньших
затратах. Также снижается риск переноса в получаемый терапевтический
препарат трансфузионных патогенов, которые потенциально содержит любая
сыворотка крови. Известно, что неопластические клеточные линии возможно
адаптировать к росту на бессывороточной среде, а также перевести из
адгезионного типа роста к суспензионному [Sinacore M.S. et al., 2000].
Для отбора культуры трансформированных ММСК ЖТ человека (BL29,
KR30, VA18, VO21, PU28, BB25 и полученные из них моноклональные культуры)
растили в минимальной ростовой среде (DMEM с добавлением 4 мМ Lглутамина, 100 мг/л амикацина) со сниженными концентрациями ЭТС – 5%, 1%,
0,1%, и 0% (при этом ЭТС заменяли 0,1% желатином). В качестве контроля были
выбраны
культуры
клеточной
линии
мезенхимальной
опухоли
–
рабдомиосаркомы, - A204, растущей только при адгезии. Срок культивирования
клеток тестируемых культур составлял 20 дней, в течение которого наблюдали за
адгезией клеток и их пролиферацией. Наблюдения показали, что при посадке
103
клеток
для
их
адгезии
и
сохранения
нормальных
пролиферативных
характеристик, концентрация сыворотки крови в ростовой среде не до лжна быть
ниже 5%. Также наблюдения показали, что клетки трансформированных ММСК в
большинстве случаев плохо адаптируются к концентрации ЭТС в ростовой среде
менее 1%. Из всех культур трансформированных ММСК ЖТ человека только
клетки культур VA18_2 и VA18_5 показали высокую скорость пролиферации при
содержании ЭТС в культуральной среде 0,1% и 0% по сравнению с контролем и
другими культурами спонтанно трансформированных ММСК ЖТ человека.
Клетки линии A204 при 0,1% и 0% сыворотки остаются ошаренными, плохо
прикрепляются к подложке и практически не пролиферируют. Клетки VA18_2 и
VA18_5 в отсутствие сыворотки также c трудом прикрепляются к подложке, но
при этом активно делятся. Остальные культуры либо прекращали пролиферацию
после снижения концентрации сыворотки, либо она значительно замедлялась. Для
клеток VA18_2 наблюдается снижение скорости пролиферации по сравнению с
нормальными условиями роста (5-10% ЭТС в среде), но в меньшей степени, чем
для
клеток
VA18_5.
В
подобранных
условиях
эксперимента
клетки
моноклональной культуры VA18_2 обладали наилучшими пролиферативными
характеристиками по сравнению с контролем (таблица 11) и остальными
исследованными культурами спонтанно трансформированных ММСК ЖТ
человека (данные не представлены).
104
Таблица 11. Рост культуры спонтанно трансформированных ММСК ЖТ человека VA18_2 и
клеток линии A204 при разных концентрациях ЭТС в культуральной среде.
Тестируемые культуры*
% ЭТС в среде
VA18_2
5%
1%
0,1%
0%
(0,1% желатин)
*Срок культивирования на фотографиях – 72 часа.
A204 (контроль)
105
Таким
образом,
для
лентивирусной
трансдукции
была
выбрана
моноклональная культура спонтанно трансформированных ММСК ЖТ человека –
VA18_2, – показавшая наиболее высокие пролиферативные характеристики среди
всех культур спонтанно трансформированных ММСК ЖТ человека, а также
способность к росту на бессывороточной среде.
3.3.2. Трансдукция культуры клеток спонтанно трансформированной культуры
ММСК ЖТ человека VA18_2 лентивирусным вектором с репортерным геном
TagGFP2
Для введения постоянной генетической модификации в геном спонтанно
трансформированных ММСК ЖТ человека был выбран лентивирусный вектор c
геном зеленого флуоресцентного белка TagGFP2. Такой способ трансдукции
позволяет получить стабильные трансфицированные клоны, и в настоящее время
метод хорошо зарекомендовал себя как высокоэффективный для создания генно модифицированных клеточных линий.
Культуру неопластических клеток VA18_2 перед трансдукцией растили в
базовой ростовой среде, содержащей среду DMEM с добавлением 5% ЭТС, 4 мМ
L-глутамина 100 мг/л амикацина с тем, чтобы перед экспериментом получить
высокий выход жизнеспособной культуры.
Для трансдукции был выбран лентивирусный вектор c геном зеленого
флуоресцентного белка TagGFP2, который был клонирован под контролем
универсального промотора гена фактора элонгации 1α (EF1α) в лентивектор
pLVT-TagGFP2-N. Карта лентивирусного вектора представлена в разделе 2.7.2.
главы «Материалы и методы»
По 2000 клеток выбранной культуры VA18_2 были трансдуцированы в
поддерживающей культуральной среде (среда DMEM, 1% ЭТС, 4 mM Lглутамина, 100 мг/л амикацина) в диапазоне концентраций лентивируса (MOI)
равной 5, 10, 20, 40 и 50 в трех повторностях, что по данным литературы в
106
большинстве случаев достаточно для эффективной трансдукции нормальных
ММСК человека.
Оценка результативности трансдукции культуры проводилась визуально с
помощью флуоресцентной микроскопии, при этом оценивали количество зеленых
флуоресцирующих клеток в видимом поле микроскопа. Результаты наблюдений
показали, что флуоресценция проявляется медленно, и появляется на 3-4 день
после трансдукции клеток. Максимум флуоресценции клеток наблюдается на 7-ой
день, что связано с активацией транскрипции гена зеленого флуоресцентного
белка (рисунок 12). Цитотоксического воздействия на клетки при трансдукции не
наблюдалось даже при высокой концентрации лентивируса. Это подтверждает
данные литературы об отсутствии цитотоксичности при трансдукции клеток
лентивирусным вектором [McGinley L.M. et al., 2011] по сравнению с
аденовирусной трансфекцией или невирусными методами доставки гена, такими
как липофекция или электропорация [McMahon J.M. et al., 2006].
Рисунок 12. Экспрессия трансгена TagGFP2 после трансдукции клеточной культуры спонтанно
трансформированных ММСК ЖТ человека - VA18_2. Использованные концентрации вирусных
частиц: 5 MOI, 10 MOI, 20 MOI, 40 MOI, 50 MOI. Флуоресцентная и фазово-контрастная
микроскопия, увеличение x100. Срок детекции – 7 суток после трансдукции.
107
Эффективность трансдукции культуры при разных MOI, а также
интенсивность зеленой флуоресценции по сравнению с нетрансдуцированной
контрольной
группой
активированной
клеток
проточной
оценивали
цитометрии
с
помощью
(FACS).
С
флуоресцентно
увеличением
MOI
пропорционально растет интенсивность флуоресценции клеток (рисунок 13а), что
соответствует бóльшему количеству интегрированных копий трансгена в геном.
При 50 MOI достигается максимальная эффективность, а также максимальная
интенсивность флуоресценции, что должно соответствовать максимальной
экспрессии трансгена (рисунок 13б).
а
б
)
Рисунок 13. Гистограмма цитометрического анализа (а) и график (б) эффективности
трансдукции культуры трансформированных ММСК ЖТ человека - VA18_2 лентивирусным
вектором с репортерным геном TagGFP2. На графике (б) указаны средние значения
эффективности трансдукции ± стандартная ошибка. Средняя эффективность трансдукции в
эксперименте составляла: при 5 MOI — 77,25%, при 10 MOI — 83,81%, при 20 MOI — 91,68%,
при 40 MOI — 92,28%, при 50 MOI — 94,01%.
Дальнейшее увеличение MOI (выше значения 50) не приводит к
значительному увеличению процента флуоресцентных клеток, так как график
эффективности выходит на плато. Таким образом, концентрация лентивируса в 50
MOI является оптимальной для поставленной задачи, так как позволяет получить
максимально высокий уровень наработки потенциального терапевтического белка
при сохранении жизнеспособности и пролиферативных свойств клеток. Эта
108
концентрация
лентивируса
была
использована
во
всех
последующих
экспериментах.
3.3.3. Анализ стабильности трансдукции и экспрессии трансгена при длительном
культивировании трансформированных ММСК ЖТ человека VA18_2
Известно, что при пассировании трансгенных клеток может происходить
дивергенция
клонированных
популяций
на
субпопуляции
с
разными
экспрессионными характеристиками, которую отчасти можно объяснить потерей
разными клонами с течением времени функциональных копий трансгена.
Количество
встроенных копий трансгена не коррелирует напрямую с
эффективностью его экспрессии, но наблюдаемое снижение копийности может
привести к снижению общего уровня экспрессии трансгена и падению
продуктивности клеток [O'Callaghan P.M. & James D.C., 2008; Barnes L.M. et al.,
2003] вплоть до полной потери экспрессии трансгена [Reisinger H. et al., 2008].
Поэтому культуру клеток VA18_2, трансдуцированных концентрацией
лентивируса в 50 MOI культивировали в течение 20 пассажей в базовой ростовой
среде (среда DMEM, 5% ЭТС, 4 мМ L-глутамин, 100 мг/л амикацин) и проводили
регулярные
наблюдения
за
пролиферацией
клеток
и
интенсивностью
флуоресценции с помощью фазово-контрастной и флуоресцентной микроскопии.
Было замечено, что при культивировании и стандартной процедуре пассирования
со временем (~20 пассажей) процент флуоресцентных клеток в культуре падает. С
помощью
флуоресцентно
обнаружено,
что
активированной
проточной
процент флуоресцентных клеток из
цитометрии
было
всей популяции
трансфицированных клеток на 5-пассаже составляет – 80,89±3,05%, на 10-м
пассаже – 77,48±3,08%, на 20-м пассаже – 59,64±4,12%.
Потеря копий трансгена может происходить вследствие генетической
нестабильности трансформированных линий, а также из-за транскрипционной
репрессии, которая предположительно имеет место при любой трансдукции или
трансфекции [Kim M. et al., 2011]. Возможно также, что клетки, потерявшие
активно экспрессирующийся трансген или не трансфицировавшиеся изначально,
109
обладают пролиферативным преимуществом и вытесняют при культивировании
клетки, обремененные экспрессией трансгена. Для решения проблемы падения
процента флуоресцентных клеток в культуре был введен этап селекции клеток
после трансдукции.
3.3.4. Селекция клеток трансформированных ММСК ЖТ человека VA18_2,
стабильно трансдуцированных лентивирусным вектором с репортерным геном
TagGFP2
Основная задача селекции – это отбор клонов, стабильно экспрессирующих
трансген на высоком уровне на постоянной основе. Этот подход является
наиболее простым и распространенным при разработке новой клеточной линии
продуцентов для производства рекомбинантных белков [Brondyk W.H., 2009].
Для селекции клеток был применен метод посадки трансдуцированных
клеток в низкой плотности с последующим отбором хорошо флуоресцирующих
клонов. Таким образом, после трансдукции лентивирусным вектором в
концентрации 50 MOI, как уже было описано выше, клетки культуры VA18_2
растили в базовой ростовой среде (DMEM с добавлением 5% сыворотки, 4 мМ Lглутамина, 100 мг/л амикацина) до 70% монослоя в лунке. Затем клетки снимали
с подложки стандартным способом и рассаживали в низкой плотности на три 96луночных плашки (см. пункт 2.4. главы «Материалы и методы»). Клетки затем
культивировали в течение 7 суток до появления крупных флуоресцентных
колоний, которые оценивали визуально с помощью флуоресцентной микроскопии
по яркости флуоресценции клеток, скорости роста колонии и отсутствию
несветящихся клеток (рисунок 14).
110
а)
б)
Рисунок 14. Отбор клонов трансдуцированной при 50 MOI pLVT-TagGFP2-N культуры
спонтанно-трансформированных ММСК ЖТ человека - VA18_2. a – пример плохой колонии,
где наблюдается пролиферация несветящихся клеток, б – пример хорошей колонии, где все
клетки хорошо светятся. Срок культивирования на фото - 7 суток. Флуоресцентная и фазовоконтрастная микроскопия, увеличение x100.
Всего было выделено 4 трансдуцированных хорошо флуоресцирующих
культуры, которые обозначили как VA2GFP_1k, VA2GFP_2k, VA2GFP_3k,
VA2GFP_4k. В дальнейшем их культивировали в базовой ростовой среде в
течение 25 пассажей (рисунок 15).
111
VA18_2
Рисунок 15. Схема селекции трансдуцированных клеток культуры VA18_2.
С помощью флуоресцентно активированной проточной цитометрии было
показано, что отобранные культуры сохраняют стабильную экспрессию
трансгена. Процент флуоресцентных клеток в исследуемых моноклональных
культурах остается высоким при сроке культивирования продолжительностью до
25 пассажей (рисунок 16).
В
культурах
спонтанно
трансформированных клеток наблюдаются
колебания интенсивности флуоресценции. Наблюдаемые колебания в экспрессии
флуоресцентного белка в клетках может быть связано с их генетической
нестабильностью и изменением в количестве интактных копий трансгена в геноме
клетки.
112
А
Б
В
Г
Рисунок 16. Гистограмма цитометрического анализа моноклональных культур, полученных из
VA18_2
спонтанно-трансформированных
ММСК
ЖТ
человека,
трансдуцированных
концентрацией лентивируса pLVT-TagGFP2-N в 50 MOI. Срок культивирования – 25 пассажей
в базовой ростовой среде. Эффективность трансдукции составила: 5 пассаж – A (98,19%), Б
(96,71%), В (96,89%), Г (96,09%); 15 пассаж - A (98,3%), Б (98,84%), В (98,97%), Г (98,72%); 25
пассаж - A (99,5%), Б (99,37%), В (99,35%), Г (98,54%).
В дальнейшем выделенные моноклональные культуры VA2GFP_1k,
VA2GFP_2k, VA2GFP_3k, VA2GFP_4k использовали в экспериментах по
количественной оценке копийности трансгена в клетках и соответствующего
уровня продукции белка при длительном культивировании.
3.3.5. Количественная оценка копийности трансгена в клетках
трансдуцированных моноклональных культур VA2GFP_1k, VA2GFP_2k,
VA2GFP_3k и VA2GFP_4k при длительном пассировании
Так как одной из возможных причин потери клеток, экспрессирующих
трансген, является потеря копий трансгена, был проведен анализ копийности
клеток на 5-м, 15-м и 25-м пассаже. Анализ копийности трансгена в клетках
113
проводили с помощью количественной ПЦР в реальном времени. Количество
встроившихся копий трансгена на клетку определяли по методу построения
калибровочной кривой по десятикратным разведениям лентивирусной плазмиды
и подсчета соответсвующего числа копий относительно концентрации вектора в
ПЦР реакции. Подготовительные этапы, такие как снятие флуоресцентных клеток
с подложки, подсчет клеток в камере Горяева, выделение ДНК, постановка ПЦР
реакции и методы расчета подробно представлены в соответсвующих разделах
главы «Материалы и методы». Копийность оценивали на 5-м, 15-м и 25-м
пассажах для всех четырех моноклональных культур VA2GFP_1k, VA2GFP_2k,
VA2GFP_3k и VA2GFP_4k.
Для исследования копийности трансгена при длительном пассировании
культур была построена прямая разведений лентивирусного вектора в трех
повторностях в каждом эксперименте по определению копийности, относительно
которой рассчитывали среднее число копий на клетку в каждой культуре. Средняя
эффективность ПЦР реакций составила 98,1% (рисунок 17).
Рисунок 17. Калибровочная кривая, построенная на основании реакции ПЦР в реальном
времени с десятикратными разведениями лентивирусного вектора pLVT-TagGFP2-N, каждая
точка является средним по 3-м повторностям ПЦР реакции ± ошибка среднего каждого
разведения.
114
По результатам анализа копийности было показано, что в среднем при
выбранных условиях трансдукции лентивирусным вектором в 50 MOI по всем
моноклональным культурам число копий на клетку составляет на 5-м пассаже
24,96±3,62, на 15-м пассаже 27,09±3,77, на 25-м пассаже 46,37±6,04 (рисунок 18).
Рисунок 18. Диаграмма анализа копийности трансгена TagGFP2-N в моноклональных
культурах VA2GFP_1k, VA2GFP_2k, VA2GFP_3k и VA2GFP_4k, полученных из VA18_2
спонтанно трансформированных ММСК ЖТ человека, трансдуцированных концентрацией
лентивируса pLVT-TagGFP2-N в 50 MOI. Срок культивирования – 25 пассажей в базовой
ростовой среде. Бар – среднее число копий на клетку ± ошибка среднего.
Таким образом, анализ копийности показал общую тенденцию к
увеличению копий трансгена на клетку с пассированием в моноклональных
культурах, несмотря на колебания в отдельных случаях. Увеличение копийности
предположительно происходит в результате амплификации участка трансгена
вследствие хромосомной нестабильности клеток.
На сегодняшний день для получения высокоэкспрессивных трансгенных
клеток, способных продуцировать большое количество белка, исследователи
используют методы индуцированной амплификации вставки трансгена в геноме
клеток. Два основных метода – это введение в последовательность вирусного
вектора, содержащего трансген, специальных последовательностей инициации
115
репликации генов млекопитающих (IR/MAR-амплификация), либо интеграция
трансгена в геном клеток под промотором гена дигидрофолат редуктазы (Dhfr),
амплификация которого вызывается метотрексатом (Mtx) [Noguchi C. et al., 2012].
Результаты анализа копийности показали, что подобная амплификация
трансгена может происходить спонтанно в трансформированных ММСК ЖТ
человека. Эффект естественной амплификации трансгена является положительной
характеристикой данных клеток для их применения в биотехнологии, поскольку
это может решить проблему потери интактных копий трансгена в клетках при
длительном пассировании, что однако не избавляет от необходимости
предварительного селективного отбора стабильных флуоресцентных клонов.
3.3.6. Количественное определение продукции трансгенного белка TagGFP2 в
клетках моноклональных культур VA2GFP_1k, VA2GFP_2k, VA2GFP_3k и
VA2GFP_4k после трансдукции лентивирусным вектором pLVT-TagGFP2-N при
длительном культивировании
При культивировании также определялась продуктивность трансгена для
того, чтобы проследить за уровенем экспрессии трансгена и возможную
корреляцию между копийностью и продуктивностью трансгена. Продуктивность
трансгенного белка TagGFP2 была оценена с помощью количественного
определения
белка
в
лизате
трансдуцированных
клеток всех четырех
моноклональных культур VA2GFP_1k, VA2GFP_2k, VA2GFP_3k и VA2GFP_4k в
условиях длительного культивирования на 5-м, 15-м и 25-м пассажах. Количество
белка определяли флуориметрией лизатов с последующим вычислением
концентрации белка в лизате по кривой разведений стандарта белка GFP. Для
этого в эксперименте была построена калибровочная кривая зависимости
концентрации белка GFP от флуоресцении (рисунок 19).
116
Рисунок 19. Калибровочная кривая зависимости концентрации стандарта белка GFP от
флуоресцении. Каждая точка – среднее по трем повторностям разведения ± стандартная
ошибка.
Количество белка TagGFP2 во фракциях лизата клеток моноклональных
культур
VA2GFP_1k, VA2GFP_2k, VA2GFP_3k, VA2GFP_4k по данной
калибровочной кривой было измерено в 3-х повторностях на 5-м, 15-м и 25-м
пассажах.
Подробно подготовительные этапы, такие как снятие флуоресцентных
клеток с подложки, подсчет клеток в камере Горяева, подготовка клеточных
лизатов для измерения флуоресценции белка TagGFP2 и определения его
количества представлены в соответсвующих разделах главы «Материалы и
методы». Измеренное количество белка нормировали по количеству в
6
нанограммах на 1x10
клеток.
Затем строили зависимость
количества
продуцируемого клетками белка TagGFP2 от срока культивирования (пассажа).
По результатам анализа продуктивности трансгена было показано, что в среднем
при выбранных условиях трансдукции лентивирусным вектором в 50 MOI по
6
всем моноклональным культурам продукция TagGFP2 в нг/1x10
клеток
117
составляет на 5-м пассаже 657,65±91,56, на 15-м пассаже 970,47±67,43, на 25-м
пассаже 973,67±54,63 (рисунок 20).
Рисунок
20.
Количественная
оценка
продукции
трансгенного
белка
TagGFP2
в
моноклональных культурах VA2GFP_1k, VA2GFP_2k, VA2GFP_3k и VA2GFP_4k, полученных
из VA18_2 спонтанно-трансформированных ММСК ЖТ человека, трансдуцированных
концентрацией лентивируса pLVT-TagGFP2-N в 50 MOI. Срок культивирования – 25 пассажей
6
в базовой ростовой среде. Бар – среднее количество белка TagGFP2 в нг на 1x10 клеток ±
ошибка среднего.
Количественный анализ показал общую тенденцию к росту продукции
белка с пассированием. Уже к 15 пассажу по всем трансдуцированным культурам
наблюдается выход на средний уровень продукции белка TagGFP2 ~970 нг/1x10
6
клеток. Так как трансгенный белок TagGFP2 не является секретируемым белком,
при наработке клетками в высоких концентрациях он может быть токсичен для
них. Результат анализа продуктивности трансгена при длительном пассировании
показал, что в клетках трансдуцированных моноклональных культур VA2GFP_1k,
VA2GFP_2k, VA2GFP_3k и VA2GFP_4k наблюдается постепенный выход на
оптимальный сбалансированный уровень продукции TagGFP2, который не
оказывает влияния на рост и жизнеспособность культур. В связи с этим также не
наблюдается корреляция между копийностью и продуктивностью копий
118
трансгена, так как клетки, скорее всего, достигли максимума в продуктивности.
Для анализа подобной корреляции предполагается в перспективе исследовать
продуктивность клеток уже с секретируемым терапевтическим белком.
Таким
образом,
из
клеток
культуры
VA18_2
спонтанно-
трансформированных ММСК ЖТ человека при трансдукции лентивирусным
вектором pLVT-TagGFP2-N в концентрациии 50 MOI и последующей селекции
была получена трансгенная клеточная система, которая способна нарабатывать
трансгенный белок без потери пролиферации и жизнеспособности. Можно
сделать
вывод,
что
клетки
способны
эффективно
трансдуцироваться
лентивирусными частицами и сохранять высокий процент флуоресцентных
клеток в культуре при предварительном отборе стабильно флуоресцирующих
клонов.
119
4. ЗАКЛЮЧЕНИЕ
Мультипотентные мезенхимальные стромальные клетки жировой ткани
(ММСК ЖТ) – это перспективный и популярный объект для генной инженерии и
клеточной терапии. Одним из важных вопросов при использовании стволовых
клеток для терапии является их безопасность в отношении риска неоплатической
трансформации при выделении и ведении ex vivo. Описанные в литературе
случаи, когда человеческие ММСК претерпевали спонтанную трансформацию в
культуре, приобретали свойства и фенотип неопластических клеток и вызывали
новообразования при трансплантации в животных моделях, редки. Есть ряд работ,
в которых описано явление спонтанной трансформации ММСК человека, но до
сих пор возможные причины этого явления не выявлены [Rubio D. et al., 2005;
Zhou Y.F. et al., 2006; Røsland G.V. et al., 2009; Ning H. et al., 2009].
В лаборатории генетики стволовых клеток ФГБУ «МГНЦ» РАМН из
липоаспирата здоровых доноров (39±13,97 лет) было выделено в культуру и
изучено 36 культур клеток, обладавших характеристиками ММСК. При
выделении клеток в 6 культурах ММСК из 36 на первых пассажах после
выделения из липоаспирата (2-3 пассаж) были замечены отдельные колонии,
отличавшиеся по морфологии и скорости пролиферации от общей культуры.
Полученные из этих колоний клетки в культуре обладали характерными чертами
неопластической трансформации и отличались от основной популяции ММСК
почти 100% представленностью поверхностного маркера CD146, характерного
для перицитов.
В настоящей работе было впервые проведено комплексное исследование
генетических характеристик нового объекта - спонтанно трансформированных
ММСК из жировой ткани человека.
В
работе
анализировали
6
первичных
культур
спонтанно
трансформированных ММСК ЖТ, полученных от 6-ти здоровых доноров и
обозначенных как BL29, KR30, VA18, VO21, PU28, BB25; и 20 моноклональных
культур, полученных с помощью культивирования клеток VA18, PU28, KR30 и
120
BL29 в ростовой среде в низкой плотности и обозначенных как (VA18_1,2…5;
PU28_1,2…5; KR30_1,2…5; BL29_1,2…5)
Проведенный цитогенетический анализ показал, что клетки спонтанно
трансформированных ММСК ЖТ человека анеуплоидны. Более того наблюдается
хромосомная нестабильность – одна из характерных черт неопластической
трансформации. Модальное число хромосом в культурах попадает в диапазон
между триплоидным (69 хромосом на клетку) и тетраплоидным (92 хромосомы на
клетку) хромосомным набором, что свидетельствует о возможной стадии
тетраплоидизации в процессе трансформации клеток. Во всех исследованных
культурах с разной частотой встречаются гигантские многоядерные клетки,
хромосомный набор которых превышает 100 хромосом на клетку. Одним из
механизмов образования подобных клеток является амплификация центросом и
последующий мультиполярный митоз. Амплификация центросом также является
одной из самых распространенных причин хромосомной нестабильности
неопластических клеток.
Характерные хромосомные аберрации дополняют картину неопластической
трансформации.
полицентрики
Из
всех
хромосомных
(дицентрики,
трицентрики
аномалий
и
46,41%
т.д.),
составляют
30,94%
двойные
микрохромосомы, 3,38% кольцевые хромосомы, 18,77% другие хромосомные
аберрации (одно- и дву-хроматидные разрывы, межхромосомные хроматидные
обмены и др.). Процент аберрантных клеток в среднем составляет 47,4% по всем
культурам (от 11,4 до 86,7). Дицентрики и двойные микрохромосомы характерны
для
цикла
разрыва-слияния-перемычки
распространенного
процесса
при
(breakage-fusion-bridge)
неопластической
–
трансформации,
обеспечивающего структурную нестабильность хромосом.
Анализ соответствий по данным транскриптома культур показал, что
образцы нормальных клеток значительно отличаются друг от друга по профилю
экспрессии, что возможно связано с известной гетерогенностью культур ММСК.
Образцы трансформированных клеток сгруппированы близко друг к другу и,
следовательно,
очень
близки
по
профилю
экспрессии.
Это
может
121
свидетельствовать о том, что из изначально гетерогенной популяции ММСК in
vitro трансформацию претерпевает определенная субпопуляция клеток и/или
процесс
трансформации
гетерогенной
культуры
ММСК
приводит
к
унифицированному профилю экспрессии.
Дифференциальный и функциональный анализ транскриптома подтвердил
выводы цитогенетического анализа. В спонтанно трансформированных ММСК
ЖТ человека достоверно наблюдается повышение экспрессии генов 70CIN (гены,
ассоциированные с хромосомной нестабильностью), а также аберрантная
экпрессия
генов,
ассоциированных
с
амплификацией
центросом
и
мультиполярным митозом (AURKA, AURKB, p21, TPX2 и др).
Также было показано, что большинство из 30-ти наиболее значимо
изменившихся
по
экспрессии
генов
представляют
собой
маркеры
неопластической трансформации. Из них 6 генов (HSPB6, PLAC9, FEZ1, DTWD1,
APH1A, ATP5L) являются либо малоизученными, либо ранее не упоминались в
связи с неопластической трансформации клеток. Групповой функциональный
анализ GSEA по базам данных MSigDB показал, что в результате трансформации
повысилась экспрессия генов задействованных в регуляции клеточного цикла и
митотического деления, процессинга РНК, синтезе и репарации ДНК. Снизилась
экспрессия генов адгезии, межклеточных взаимодействий и цитоскелета, а также
поверхностных рецепторов и генов передачи внутриклеточных сигналов. Данные
результаты отражают произошедшие изменения в морфологии и ростовых
характеристиках клеток, а также изменения в генетическом аппарате в результате
трансформации.
По результатам данного анализа также были найдены возможные
механизмы трансформации. Трансформация ММСК наиболее вероятно связана с
нарушениями в AKT и RHOA сигнальных путях. Также в ходе трансформации
были затронуты и другие онкологические сигнальные пути, как например, RAS
(RalA и RalB), ATR/ATM и E2F.
Впервые на основе клеток спонтанно трансформированных ММСК ЖТ
человека
была
исследована
эффективность
постоянной
генетической
122
модификации лентивирусным вектором и получена трансгенная клеточная
система, сохраняющая стабильную экспрессию трансгена при длительном
культивировании. Подобраны оптимальные условия трансдукции и последующей
селекции трансдуцированных клонов, обеспечивающих высокий выход культур
клеток, сохраняющих высокую экспрессию длительное время. Созданная
трансгенная система способна продуцировать в среднем до 1 мкг потенциального
терапевического белка на каждые 1x106 клеток.
123
5. ВЫВОДЫ
1. Трансформированные ММСК ЖТ человека характеризуются высокой
хромосомной нестабильностью. Модальное число хромосом на клетку варьирует
от 73 до 91. Встречаются гигантские многоядерные клетки с числом хромосом
больше 100.
2. В трансформированных ММСК ЖТ наблюдается множество хромосомных
аберраций. Процент клеток с аберрантными хромосомами в среднем составляет
47,4% по всем культурам (от 11,4% до 86,7%). Из всех хромосомных аномалий
46,41% составляют полицентрики, 30,94% двойные микрохромосомы, 3,38%
кольцевые хромосомы, 18,77% другие хромосомные аберрации (одно- и двухроматидные разрывы, межхромосомные хроматидные обмены и др.).
3. Сравнительный анализ транскриптома показал статистически значимое
повышение экспрессии генов 70 CIN (гены, ассоциированные с хромосомной
нестабильностью), а также гиперэкспрессию генов, связанных с амплификацией
центросом и мультиполярным митозом (AURKA, AURKB и др.).
4. Спонтанная трансформация ММСК ЖТ человека ассоциируется с
нарушениями в сигнальных путях AKT и RHOA, а также RAS (RalA и RalB),
ATR/ATM и E2F.
5. Изменение
экспрессии
большинства
из
30-ти
наиболее
значимо
изменившихся по экспрессии транскриптов (согласно статистике SAM)
ассоциировано по данным литературы с неопластической трансформацией
клеток. Аберрантная экспрессия 6 генов из этой группы (HSPB6, PLAC9, FEZ1,
DTWD1, APH1A, ATP5L) ранее не упоминалась в литературе в связи с
неопластической
трансформацией.
Данные
гены
являются
новыми
потенциальными маркерами трансформации ММСК ЖТ человека
6. Анализ эффективности трансдукции культур лентивирусными частицами
показал, что при использовании 50 MOI эффективно трансдуцируется ~95%
трансформированных ММСК ЖТ человека.
7. После селективного отбора трансдуцированных при 50 MOI лентивируса
клонов трансформированных ММСК ЖТ можно получить культуры, стабильно
124
сохраняющие продуктивность трансгена на уровне ~1 мг внутриклеточного белка
на 1х106 клеток в течение 25 пассажей (~6 месяцев).
125
СПИСОК СОКРАЩЕНИЙ И УСЛОВНЫХ ОБОЗНАЧЕНИЙ
ММСК – мультипотентные мезенхимальные стромальные клетки
ЖТ – жировая ткань
КМ – костный мозг
СМТ – саркома мягких тканей
CКР – стволовые клетки рака
Break-fusion-bridge (BFB) cycle – цикл разрыва-слияния-создания
перемычки хромосом
Epithelial-mesenchymal transition (EMT) – эпителиально-мезенхимальный
переход
Mesenchymal-epithelial transition (MET) – обратный процесс EMT
Significance analysis of microarrays (SAM) – статистический анализ
микрочиповых данных для определения дифференциально экспрессированных
транскриптов
False discovery rate (FDR) – процент ложных находок при множественном
сравнении
Fold change (FC) – кратность изменения экспрессии
Normalized enrichment score (NES) – нормализованная по всем совпадениям
величина статистики GSEA
Score – величина статистики SAM
Gene set enrichment analysis (GSEA) – статистический анализ
представленности групп дифференциально экспрессированных генов,
соответствующих коллекциям базы данных MSigDB
Gene Ontology (GO) overrepresentation analysis – анализ представленности
дифференциально экспрессированных генов по категориям в базе данных GO
Variance-stabilizing transformation (VST) – трансформация,
стабилизирующая дисперсию данных
Robust spline normalization (RSN) – робастная нормализация сплайна
126
СПИСОК ЛИТЕРАТУРЫ
Бочков Н.П. и др. Хромосомная изменчивость мультипотентных
мезенхимальных стромальных клеток человека // Клеточные технологии в
биологии и медицине. 2007. № 1. С. 11–15.
Бочков Н.П. и др. Цитогенетическое исследование мультипотентных
мезенхимных стромальных клеток человека в процессе культивирования //
Медицинская генетика. 2009. Т. 8. № 12.
Владимирская Е.Б. и др. Биологические основы и перспективы терапии
стволовыми клетками // М.: ИД МЕДПРАКТИКА-М. 2005.
Захаров А.Ф., Бенюш В.А., Кулешов Н.П. Хромосомы человека: Атлас.
Медицина, 1982.
Новикова Н.И. и др. Исследование биобезопасности клеточных культур
мезенхимальных стромальных клеток на иммунодефицитных мышах линии
Nu/Nu B/C // Токсикологический вестник. 2011. № 2. С. 13–19.
Омельченко Д.О. Генная инженерия мультипотентных мезенхимальных
стромальных клеток// ФГБУ «МГНЦ» РАМН [Электронный ресурс]. URL:
http://www.med-gen.ru/docs/genetic-engineering.pdf (дата обращения: 11.02.2014).
Омельченко Д.О. и др. Анализ хромосомного набора и аберраций в
спонтанно иммортализованных мультипотентных мезенхимных стромальных
клетках из разных тканей человека // Медицинская генетика. 2012. Т. 11. № 11. С.
32–36.
Омельченко Д.О., Ржанинова А.А., Гольдштейн Д.В. Сравнительный
парный анализ транскриптома спонтанно трансформированных мультипотентных
стромальных клеток жировой ткани человека // Генетика. 2014. Т. 50. № 1. С. 106–
115.
Ржанинова А.А. и др. Получение и характеристика культуры CD146+клеток из жировой ткани человека // Клеточные технологии в биологии и
медицине. 2010. № 1. С. 3–9.
Adhikari A.S. et al. CD117 and Stro-1 identify osteosarcoma tumor-initiating
cells associated with metastasis and drug resistance // Cancer Res. 2010. Т. 70. № 11. С.
4602–4612.
Akavia U.D., Veinblat O., Benayahu D. Comparing the transcriptional profile of
mesenchymal cells to cardiac and skeletal muscle cells // J. Cell. Physiol. 2008. Т. 216.
№ 3. С. 663–672.
Alava E. de, Gerald W.L. Molecular biology of the Ewing’s sarcoma/primitive
neuroectodermal tumor family // J. Clin. Oncol. 2000. Т. 18. № 1. С. 204–213.
127
Allay J.A. et al. LacZ and interleukin-3 expression in vivo after retroviral
transduction of marrow-derived human osteogenic mesenchymal progenitors // Hum.
Gene Ther. 1997. Т. 8. № 12. С. 1417–1427.
Alliot-Licht B. et al. Dexamethasone stimulates differentiation of odontoblast-like
cells in human dental pulp cultures // Cell Tissue Res. 2005. Т. 321. № 3. С. 391–400.
Amiri A. et al. eEF1A2 activates Akt and stimulates Akt-dependent actin
remodeling, invasion and migration // Oncogene. 2007. Т. 26. № 21. С. 3027–3040.
Anastassiou D. et al. Human cancer cells express Slug-based epithelialmesenchymal transition gene expression signature obtained in vivo // BMC Cancer.
2011. Т. 11. С. 529.
Andersson D.I. et al. Translation rates and misreading characteristics of rpsD
mutants in Escherichia coli // Mol. Gen. Genet. 1982. Т. 187. № 3. С. 467–472.
Anversa P., Nadal-Ginard B. Myocyte renewal and ventricular remodelling //
Nature. 2002. Т. 415. № 6868. С. 240–243.
Armesilla-Diaz A., Elvira G., Silva A. p53 regulates the proliferation,
differentiation and spontaneous transformation of mesenchymal stem cells // Exp. Cell
Res. 2009. Т. 315. № 20. С. 3598–3610.
Aylon Y., Oren M. p53: guardian of ploidy // Mol Oncol. 2011. Т. 5. № 4. С.
315–323.
Bae J.-S. et al. Bone marrow-derived mesenchymal stem cells promote neuronal
networks with functional synaptic transmission after transplantation into mice with
neurodegeneration // Stem Cells. 2007. Т. 25. № 5. С. 1307–1316.
Bajic V. et al. Deregulated sequential motion of centromeres induced by
antitumor agents may lead to genome instability in human peripheral blood
lymphocytes // J BUON. 2007. Т. 12. № 1. С. 77–83.
Baker D.E.C. et al. Adaptation to culture of human embryonic stem cells and
oncogenesis in vivo // Nat. Biotechnol. 2007. Т. 25. № 2. С. 207–215.
Barnes L.M., Bentley C.M., Dickson A.J. Stability of protein production from
recombinant mammalian cells // Biotechnol. Bioeng. 2003. Т. 81. № 6. С. 631–639.
Bennett G. et al. A functional and transcriptomic analysis of NET1 bioactivity in
gastric cancer // BMC Cancer. 2011. Т. 11. С. 50.
Bentivegna A. et al. DNA Methylation Changes during In Vitro Propagation of
Human Mesenchymal Stem Cells: Implications for Their Genomic Stability? // Stem
Cells Int. 2013. Т. 2013. С. 192425.
Berenjeno I.M., Núñez F., Bustelo X.R. Transcriptomal profiling of the cellular
transformation induced by Rho subfamily GTPases // Oncogene. 2007. Т. 26. № 29. С.
4295–4305.
Bernardo M.E. et al. Human bone marrow derived mesenchymal stem cells do
not undergo transformation after long-term in vitro culture and do not exhibit telomere
maintenance mechanisms // Cancer Res. 2007. Т. 67. № 19. С. 9142–9149.
128
Bhatia P.K., Mukhopadhyay A. Protein glycosylation: implications for in vivo
functions and therapeutic applications // Adv. Biochem. Eng. Biotechnol. 1999. Т. 64.
С. 155–201.
Blanc K. Le et al. Mesenchymal stem cells for treatment of steroid-resistant,
severe, acute graft-versus-host disease: a phase II study // Lancet. 2008. Т. 371. №
9624. С. 1579–1586.
Boer J. De, Wang H.J., Blitterswijk C. Van. Effects of Wnt signaling on
proliferation and differentiation of human mesenchymal stem cells // Tissue Eng. 2004.
Т. 10. № 3-4. С. 393–401.
Bouacida A. et al. Pericyte-like progenitors show high immaturity and
engraftment potential as compared with mesenchymal stem cells // PLoS ONE. 2012. Т.
7. № 11. С. e48648.
Boura J.S. et al. Direct head-to-head comparison of cationic liposome-mediated
gene delivery to mesenchymal stem/stromal cells of different human sources: a
comprehensive study // Hum Gene Ther Methods. 2013. Т. 24. № 1. С. 38–48.
Brondyk W.H. Selecting an appropriate method for expressing a recombinant
protein // Meth. Enzymol. 2009. Т. 463. С. 131–147.
Browne S.M., Al-Rubeai M. Selection Methods for High-Producing Mammalian
Cell Lines // Cell Line Development Cell Engineering. / под ред. M. Al-Rubeai.
Springer Netherlands, 2009. С. 127–151.
Burns J.S. et al. The histopathology of a human mesenchymal stem cell
experimental tumor model: support for an hMSC origin for Ewing’s sarcoma? // Histol.
Histopathol. 2008. Т. 23. № 10. С. 1229–1240.
Buzzard J.J. et al. Karyotype of human ES cells during extended culture // Nat.
Biotechnol. 2004. Т. 22. № 4. С. 381–382; author reply 382.
Cai T.-Y. et al. Fibroblast growth factor 2 induces mesenchymal stem cells to
differentiate into tenocytes through the MAPK pathway // Mol Med Rep. 2013. Т. 8. №
5. С. 1323–1328.
Caisander G. et al. Chromosomal integrity maintained in five human embryonic
stem cell lines after prolonged in vitro culture // Chromosome Res. 2006. Т. 14. № 2. С.
131–137.
Caplan A.I. Adult mesenchymal stem cells for tissue engineering versus
regenerative medicine // J. Cell. Physiol. 2007. Т. 213. № 2. С. 341–347.
Caplan A.I. All MSCs are pericytes? // Cell Stem Cell. 2008. Т. 3. № 3. С. 229–
230.
Caplan A.I. Mesenchymal stem cells // J. Orthop. Res. 1991. Т. 9. № 5. С. 641–
650.
Caplan A.I. Review: mesenchymal stem cells: cell-based reconstructive therapy
in orthopedics // Tissue Eng. 2005. Т. 11. № 7-8. С. 1198–1211.
129
Carnero A. et al. The PTEN/PI3K/AKT signalling pathway in cancer, therapeutic
implications // Curr Cancer Drug Targets. 2008. Т. 8. № 3. С. 187–198.
Carnero A. The PKB/AKT pathway in cancer // Curr. Pharm. Des. 2010. Т. 16.
№ 1. С. 34–44.
Carter S.L. et al. A signature of chromosomal instability inferred from gene
expression profiles predicts clinical outcome in multiple human cancers // Nat. Genet.
2006. Т. 38. № 9. С. 1043–1048.
Casiraghi F. et al. Multipotent mesenchymal stromal cell therapy and risk of
malignancies // Stem Cell Rev. 2013. Т. 9. № 1. С. 65–79.
Centeno C.J. et al. Safety and complications reporting on the re-implantation of
culture-expanded mesenchymal stem cells using autologous platelet lysate technique //
Curr Stem Cell Res Ther. 2010. Т. 5. № 1. С. 81–93.
Cetin B., Cleveland D.W. How to survive aneuploidy // Cell. 2010. Т. 143. № 1.
С. 27–29.
Chan J.Y. A clinical overview of centrosome amplification in human cancers //
Int. J. Biol. Sci. 2011. Т. 7. № 8. С. 1122–1144.
Chang S. Chromosome ends teach unexpected lessons on DNA damage
signalling // EMBO J. 2012. Т. 31. № 16. С. 3380–3381.
Charytonowicz E. et al. Alveolar rhabdomyosarcoma: is the cell of origin a
mesenchymal stem cell? // Cancer Lett. 2009. Т. 279. № 2. С. 126–136.
Chen L. et al. [Expression and significance of NET-1 protein in hepatocellular
carcinoma] // Zhonghua Zhong Liu Za Zhi. 2007. Т. 29. № 12. С. 917–921.
Cheng Z. et al. Targeted migration of mesenchymal stem cells modified with
CXCR4 gene to infarcted myocardium improves cardiac performance // Mol. Ther.
2008. Т. 16. № 3. С. 571–579.
Chiaradonna F. et al. Ras-dependent carbon metabolism and transformation in
mouse fibroblasts // Oncogene. 2006. Т. 25. № 39. С. 5391–5404.
Cho S.W. et al. Transplantation of mesenchymal stem cells overexpressing
RANK-Fc or CXCR4 prevents bone loss in ovariectomized mice // Mol. Ther. 2009. Т.
17. № 11. С. 1979–1987.
Choumerianou D.M. et al. Study of oncogenic transformation in ex vivo
expanded mesenchymal cells, from paediatric bone marrow // Cell Prolif. 2008. Т. 41.
№ 6. С. 909–922.
Christakos S. et al. New insights into the mechanisms of vitamin D action // J.
Cell. Biochem. 2003. Т. 88. № 4. С. 695–705.
Citi S. et al. The tight junction protein cingulin regulates gene expression and
RhoA signaling // Ann. N. Y. Acad. Sci. 2009. Т. 1165. С. 88–98.
Cleton-Jansen A.M. et al. Profiling of high-grade central osteosarcoma and its
putative progenitor cells identifies tumourigenic pathways // Br. J. Cancer. 2009. Т.
101. № 11. С. 1909-1918
130
Collin F. et al. Flow cytometric DNA content analysis of 185 soft tissue
neoplasms indicates that S-phase fraction is a prognostic factor for sarcomas. French
Federation of Cancer Centers (FNCLCC) Sarcoma Group // Cancer. 1997. Т. 79. № 12.
С. 2371–2379.
Colnaghi R. et al. The consequences of structural genomic alterations in humans:
genomic disorders, genomic instability and cancer // Semin. Cell Dev. Biol. 2011. Т. 22.
№ 8. С. 875–885.
Coutu D.L. et al. Hierarchical scaffold design for mesenchymal stem cell-based
gene therapy of hemophilia B // Biomaterials. 2011. Т. 32. № 1. С. 295–305.
Cowan C.A. et al. Derivation of embryonic stem-cell lines from human
blastocysts // N. Engl. J. Med. 2004. Т. 350. № 13. С. 1353–1356.
Crisan M. et al. Multilineage stem cells in the adult: a perivascular legacy? //
Organogenesis. 2011. Т. 7. № 2. С. 101–104.
Danielson L.S. et al. A differentiation-based microRNA signature identifies
leiomyosarcoma as a mesenchymal stem cell-related malignancy // Am. J. Pathol. 2010.
Т. 177. № 2. С. 908–917.
Dela Cruz F.S. Cancer stem cells in pediatric sarcomas // Front Oncol. 2013. Т. 3.
С. 168.
Dellavalle A. et al. Pericytes of human skeletal muscle are myogenic precursors
distinct from satellite cells // Nat. Cell Biol. 2007. Т. 9. № 3. С. 255–267.
Demain A.L., Vaishnav P. Production of recombinant proteins by microbes and
higher organisms // Biotechnol. Adv. 2009. Т. 27. № 3. С. 297–306.
Dimarino A.M., Caplan A.I., Bonfield T.L. Mesenchymal Stem Cells in Tissue
Repair // Front Immunol. 2013. Т. 4. С. 201.
Djouad F. et al. Microenvironmental changes during differentiation of
mesenchymal stem cells towards chondrocytes // Arthritis Res. Ther. 2007. Т. 9. № 2.
С. R33.
Doering C.B. Retroviral modification of mesenchymal stem cells for gene therapy
of hemophilia // Methods Mol. Biol. 2008. Т. 433. С. 203–212.
Dominici M. et al. Minimal criteria for defining multipotent mesenchymal
stromal cells. The International Society for Cellular Therapy position statement //
Cytotherapy. 2006. Т. 8. № 4. С. 315–317.
Du J. et al. O-fucosylation of thrombospondin type 1 repeats restricts epithelial to
mesenchymal transition (EMT) and maintains epiblast pluripotency during mouse
gastrulation // Dev. Biol. 2010. Т. 346. № 1. С. 25–38.
Du P., Kibbe W.A., Lin S.M. lumi: a pipeline for processing Illumina microarray
// Bioinformatics. 2008. Т. 24. № 13. С. 1547–1548.
Du Z. et al. Mesenchymal stem cells overexpressing C-X-C chemokine receptor
type 4 improve early liver regeneration of small-for-size liver grafts // Liver Transpl.
2013. Т. 19. № 2. С. 215–225.
131
Duan H.-F. et al. Treatment of myocardial ischemia with bone marrow-derived
mesenchymal stem cells overexpressing hepatocyte growth factor // Mol. Ther. 2003. Т.
8. № 3. С. 467–474.
Dubash A.D. et al. The small GTPase RhoA localizes to the nucleus and is
activated by Net1 and DNA damage signals // PLoS ONE. 2011. Т. 6. № 2. С. e17380.
Duensing A. et al. p21(Waf1/Cip1) deficiency stimulates centriole
overduplication // Cell Cycle. 2006. Т. 5. № 24. С. 2899–2902.
Duesberg P., Li R. Multistep carcinogenesis: a chain reaction of
aneuploidizations // Cell Cycle. 2003. Т. 2. № 3. С. 202–210.
Eden E. et al. GOrilla: a tool for discovery and visualization of enriched GO
terms in ranked gene lists // BMC Bioinformatics. 2009. Т. 10. С. 48.
Elabd C. et al. Human adipose tissue-derived multipotent stem cells differentiate
in vitro and in vivo into osteocyte-like cells // Biochem. Biophys. Res. Commun. 2007.
Т. 361. № 2. С. 342–348.
Elsler S. et al. Effective, safe nonviral gene transfer to preserve the chondrogenic
differentiation potential of human mesenchymal stem cells // J Gene Med. 2012. Т. 14.
№ 7. С. 501–511.
English K. Mechanisms of mesenchymal stromal cell immunomodulation //
Immunol. Cell Biol. 2013. Т. 91. № 1. С. 19–26.
Ewing J. The Classic: Diffuse endothelioma of bone. Proceedings of the New
York Pathological Society. 1921;12:17 // Clin. Orthop. Relat. Res. 2006. Т. 450. С. 25–
27.
Facchin S. et al. Phosphorylation and activation of the atypical kinase p53-related
protein kinase (PRPK) by Akt/PKB // Cell. Mol. Life Sci. 2007. Т. 64. № 19-20. С.
2680–2689.
Farrington-Rock C. et al. Chondrogenic and adipogenic potential of
microvascular pericytes // Circulation. 2004. Т. 110. № 15. С. 2226–2232.
Ferreira B.I. et al. Array CGH and gene-expression profiling reveals distinct
genomic instability patterns associated with DNA repair and cell-cycle checkpoint
pathways in Ewing’s sarcoma // Oncogene. 2008. Т. 27. № 14. С. 2084–2090.
Figueroa B. Jr et al. Enhanced cell culture performance using inducible antiapoptotic genes E1B-19K and Aven in the production of a monoclonal antibody with
Chinese hamster ovary cells // Biotechnol. Bioeng. 2007. Т. 97. № 4. С. 877–892.
Flanagan M. et al. Competitive DNA transfection formulation via electroporation
for human adipose stem cells and mesenchymal stem cells // Biol Proced Online. 2012.
Т. 14. № 1. С. 7.
Fletcher C.D.M., Unni K.K., Mertens F. Pathology and Genetics of Tumours of
Soft Tissue and Bone. IARC, 2002. 416 С.
Fodde R., Brabletz T. Wnt/beta-catenin signaling in cancer stemness and
malignant behavior // Curr. Opin. Cell Biol. 2007. Т. 19. № 2. С. 150–158.
132
Fridman A.L., Tainsky M.A. Critical pathways in cellular senescence and
immortalization revealed by gene expression profiling // Oncogene. 2008. Т. 27. № 46.
С. 5975–5987.
Fujii H. et al. Sphere-forming stem-like cell populations with drug resistance in
human sarcoma cell lines // Int. J. Oncol. 2009. Т. 34. № 5. С. 1381–1386.
Funes J.M. et al. Transformation of human mesenchymal stem cells increases
their dependency on oxidative phosphorylation for energy production // Proc. Natl.
Acad. Sci. U.S.A. 2007. Т. 104. № 15. С. 6223–6228.
Gascoigne K.E., Cheeseman I.M. Induced dicentric chromosome formation
promotes genomic rearrangements and tumorigenesis // Chromosome Res. 2013. Т. 21.
№ 4. С. 407–418.
Giannelli F. et al. Effect of antiviral treatment in patients with chronic HCV
infection and t(14;18) translocation // Blood. 2003. Т. 102. № 4. С. 1196–1201.
Gibbs C.P. et al. Stem-like cells in bone sarcomas: implications for tumorigenesis
// Neoplasia. 2005. Т. 7. № 11. С. 967–976.
Goessler U.R. et al. In vitro analysis of integrin expression during chondrogenic
differentiation of mesenchymal stem cells and chondrocytes upon dedifferentiation in
cell culture // Int. J. Mol. Med. 2006. Т. 17. № 2. С. 301–307.
Goldoni S., Iozzo R.V. Tumor microenvironment: Modulation by decorin and
related molecules harboring leucine-rich tandem motifs // Int. J. Cancer. 2008. Т. 123.
№ 11. С. 2473–2479.
Gotoda T. et al. Expression of CD44 variants and prognosis in oesophageal
squamous cell carcinoma // Gut. 2000. Т. 46. № 1. С. 14–19.
Gou S. et al. Spontaneous differentiation of murine bone marrow-derived
mesenchymal stem cells into adipocytes without malignant transformation after longterm culture // Cells Tissues Organs (Print). 2010. Т. 191. № 3. С. 185–192.
Goustin A.S., Wilt F.H. Direct measurement of histone peptide elongation rate in
cleaving sea urchin embryos // Biochim. Biophys. Acta. 1982. Т. 699. № 1. С. 22–27.
Greco S.J., Rameshwar P. Enhancing effect of IL-1alpha on neurogenesis from
adult human mesenchymal stem cells: implication for inflammatory mediators in
regenerative medicine // J. Immunol. 2007. Т. 179. № 5. С. 3342–3350.
Grimes B.R. et al. Interphase FISH demonstrates that human adipose stromal
cells maintain a high level of genomic stability in long-term culture // Stem Cells Dev.
2009. Т. 18. № 5. С. 717–724.
Gronthos S. et al. Heat shock protein-90 beta is expressed at the surface of
multipotential mesenchymal precursor cells: generation of a novel monoclonal
antibody, STRO-4, with specificity for mesenchymal precursor cells from human and
ovine tissues // Stem Cells Dev. 2009. Т. 18. № 9. С. 1253–1262.
Grotsky D.A. et al. BRCA1 loss activates cathepsin L-mediated degradation of
53BP1 in breast cancer cells // J. Cell Biol. 2013. Т. 200. № 2. С. 187–202.
133
Gupta S. et al. A nuclear protein tyrosine phosphatase activates p53 and induces
caspase-1-dependent apoptosis // FEBS Lett. 2002. Т. 532. № 1-2. С. 61–66.
Hajdu S.I. Soft tissue sarcomas // Cancer. 2007. Т. 109. № 9. С. 1697–1704.
Han E., Hilsenbeck S.G. Array-based gene expression profiling to study aging //
Mech. Ageing Dev. 2001. Т. 122. № 10. С. 999–1018.
Helledie T., Nurcombe V., Cool S.M. A simple and reliable electroporation
method for human bone marrow mesenchymal stem cells // Stem Cells Dev. 2008. Т.
17. № 4. С. 837–848.
Helman L.J., Meltzer P. Mechanisms of sarcoma development // Nat. Rev.
Cancer. 2003. Т. 3. № 9. С. 685–694.
Hernando E. et al. The AKT-mTOR pathway plays a critical role in the
development of leiomyosarcomas // Nat. Med. 2007. Т. 13. № 6. С. 748–753.
Hirohata S. et al. Punctin, a novel ADAMTS-like molecule, ADAMTSL-1, in
extracellular matrix // J. Biol. Chem. 2002. Т. 277. № 14. С. 12182–12189.
Hirst M. et al. Human GMP synthetase. Protein purification, cloning, and
functional expression of cDNA // J. Biol. Chem. 1994. Т. 269. № 38. С. 23830–23837.
Honoki K. Do stem-like cells play a role in drug resistance of sarcomas? // Expert
Rev Anticancer Ther. 2010. Т. 10. № 2. С. 261–270.
Horwitz E.M. et al. Clarification of the nomenclature for MSC: The International
Society for Cellular Therapy position statement // Cytotherapy. 2005. Т. 7. № 5. С.
393–395.
Hu Y. et al. Nonviral gene targeting at rDNA locus of human mesenchymal stem
cells // Biomed Res Int. 2013. Т. 2013. С. 135189.
Huang F. et al. Overexpression of miR-126 promotes the differentiation of
mesenchymal stem cells toward endothelial cells via activation of PI3K/Akt and
MAPK/ERK pathways and release of paracrine factors // Biol. Chem. 2013. Т. 394. №
9. С. 1223–1233.
Huang G. et al. 15-Hydroxyprostaglandin dehydrogenase is a target of hepatocyte
nuclear factor 3beta and a tumor suppressor in lung cancer // Cancer Res. 2008. Т. 68.
№ 13. С. 5040–5048.
Humtsoe J.O. et al. Lipid phosphate phosphatase 3 stabilization of beta-catenin
induces endothelial cell migration and formation of branching point structures // Mol.
Cell. Biol. 2010. Т. 30. № 7. С. 1593–1606.
Hung S.-C. et al. Immortalization without neoplastic transformation of human
mesenchymal stem cells by transduction with HPV16 E6/E7 genes // Int. J. Cancer.
2004. Т. 110. № 3. С. 313–319.
Ikeda R. et al. The promyelotic leukemia zinc finger promotes osteoblastic
differentiation of human mesenchymal stem cells as an upstream regulator of CBFA1 //
J. Biol. Chem. 2005. Т. 280. № 9. С. 8523–8530.
134
Inzunza J. et al. Comparative genomic hybridization and karyotyping of human
embryonic stem cells reveals the occurrence of an isodicentric X chromosome after
long-term cultivation // Mol. Hum. Reprod. 2004. Т. 10. № 6. С. 461–466.
Ip J.E. et al. Mesenchymal stem cells use integrin beta1 not CXC chemokine
receptor 4 for myocardial migration and engraftment // Mol. Biol. Cell. 2007. Т. 18. №
8. С. 2873–2882.
Ishida S. et al. Role for E2F in control of both DNA replication and mitotic
functions as revealed from DNA microarray analysis // Mol. Cell. Biol. 2001. Т. 21. №
14. С. 4684–4699.
Iswaran V. Seed pelleting with systemic insecticide (Aldicarb) for the control of
pests of mungo (Phaseolus aureus L.) // Zentralbl Bakteriol Parasitenkd Infektionskr
Hyg. 1975. Т. 130. № 4. С. 365–366.
Iwasaki H. et al. Benign and malignant fibrous histiocytomas of the soft tissues:
functional characterization of the cultured cells // Cancer. 1982. Т. 50. № 3. С. 520–
530.
Iwasaki H. et al. Malignant fibrous histiocytoma. A tumor of facultative
histiocytes showing mesenchymal differentiation in cultured cell lines // Cancer. 1992.
Т. 69. № 2. С. 437–447.
Iwasaki H. et al. Malignant fibrous histiocytoma. Evidence of perivascular
mesenchymal cell origin immunocytochemical studies with monoclonal anti-MFH
antibodies // Am. J. Pathol. 1987. Т. 128. № 3. С. 528–537.
Iwasaki H. et al. Pathology of soft-tissue tumors: daily diagnosis, molecular
cytogenetics and experimental approach // Pathol. Int. 2009. Т. 59. № 8. С. 501–521.
Jain S. et al. Molecular classification of soft tissue sarcomas and its clinical
applications // Int J Clin Exp Pathol. 2010. Т. 3. № 4. С. 416–428.
Jana S., Deb J.K. Strategies for efficient production of heterologous proteins in
Escherichia coli // Appl. Microbiol. Biotechnol. 2005. Т. 67. № 3. С. 289–298.
Joshi M. et al. Real-time PCR to determine transgene copy number and to
quantitate the biolocalization of adoptively transferred cells from EGFP-transgenic mice
// BioTechniques. 2008. Т. 45. № 3. С. 247–258.
Kalinina N.I. et al. Mesenchymal stem cells in tissue growth and repair // Acta
Naturae. 2011. Т. 3. № 4. С. 30–37.
Kallioniemi O.P. et al. Tissue microarray technology for high-throughput
molecular profiling of cancer // Hum. Mol. Genet. 2001. Т. 10. № 7. С. 657–662.
Karnieli O. et al. Generation of insulin-producing cells from human bone marrow
mesenchymal stem cells by genetic manipulation // Stem Cells. 2007. Т. 25. № 11. С.
2837–2844.
Karsten U., Goletz S. What makes cancer stem cell markers different? //
Springerplus. 2013. Т. 2. № 1. С. 301.
135
Kasper G. et al. The human LAPTM4b transcript is upregulated in various types
of solid tumours and seems to play a dual functional role during tumour progression //
Cancer Lett. 2005. Т. 224. № 1. С. 93–103.
Katayama H. et al. Phosphorylation by aurora kinase A induces Mdm2-mediated
destabilization and inhibition of p53 // Nat. Genet. 2004. Т. 36. № 1. С. 55–62.
Kaur M., Cole M.D. MYC acts via the PTEN tumor suppressor to elicit
autoregulation and genome-wide gene repression by activation of the Ezh2
methyltransferase // Cancer Res. 2013. Т. 73. № 2. С. 695–705.
Ke L. et al. HSPB1, HSPB6, HSPB7 and HSPB8 protect against RhoA GTPaseinduced remodeling in tachypaced atrial myocytes // PLoS ONE. 2011. Т. 6. № 6. С.
e20395.
Kern S. et al. Comparative analysis of mesenchymal stem cells from bone
marrow, umbilical cord blood, or adipose tissue // Stem Cells. 2006. Т. 24. № 5. С.
1294–1301.
Kim M. et al. A mechanistic understanding of production instability in CHO cell
lines expressing recombinant monoclonal antibodies // Biotechnol. Bioeng. 2011. Т.
108. № 10. С. 2434–2446.
King R.W. When 2+2=5: the origins and fates of aneuploid and tetraploid cells //
Biochim. Biophys. Acta. 2008. Т. 1786. № 1. С. 4–14.
Kocaefe C. et al. Reprogramming of human umbilical cord stromal mesenchymal
stem cells for myogenic differentiation and muscle repair // Stem Cell Rev. 2010. Т. 6.
№ 4. С. 512–522.
Krajcovic M. et al. A non-genetic route to aneuploidy in human cancers // Nat.
Cell Biol. 2011. Т. 13. № 3. С. 324–330.
Kuhn N.Z., Tuan R.S. Regulation of stemness and stem cell niche of
mesenchymal stem cells: implications in tumorigenesis and metastasis // J. Cell.
Physiol. 2010. Т. 222. № 2. С. 268–277.
Kulterer B. et al. Gene expression profiling of human mesenchymal stem cells
derived from bone marrow during expansion and osteoblast differentiation // BMC
Genomics. 2007. Т. 8. С. 70.
Kuzmina L.A. et al. Multipotent Mesenchymal Stromal Cells for the Prophylaxis
of Acute Graft-versus-Host Disease-A Phase II Study // Stem Cells Int. 2012. Т. 2012.
С. 968213.
Kwaks T.H.J., Otte A.P. Employing epigenetics to augment the expression of
therapeutic proteins in mammalian cells // Trends Biotechnol. 2006. Т. 24. № 3. С.
137–142.
Lander E.S. et al. Initial sequencing and analysis of the human genome // Nature.
2001. Т. 409. № 6822. С. 860–921.
136
Lange C. et al. Accelerated and safe expansion of human mesenchymal stromal
cells in animal serum-free medium for transplantation and regenerative medicine // J.
Cell. Physiol. 2007. Т. 213. № 1. С. 18–26.
Larson B.L. et al. Sox11 is expressed in early progenitor human multipotent
stromal cells and decreases with extensive expansion of the cells // Tissue Eng Part A.
2010. Т. 16. № 11. С. 3385–3394.
Lasham A. et al. YB-1: oncoprotein, prognostic marker and therapeutic target? //
Biochem. J. 2013. Т. 449. № 1. С. 11–23.
Lazennec G., Jorgensen C. Concise review: adult multipotent stromal cells and
cancer: risk or benefit? // Stem Cells. 2008. Т. 26. № 6. С. 1387–1394.
Leandro-García L.J. et al. Tumoral and tissue-specific expression of the major
human beta-tubulin isotypes // Cytoskeleton (Hoboken). 2010. Т. 67. № 4. С. 214–223.
Lee J. et al. Smad3 regulates Rho signaling via NET1 in the transforming growth
factor-beta-induced epithelial-mesenchymal transition of human retinal pigment
epithelial cells // J. Biol. Chem. 2010. Т. 285. № 34. С. 26618–26627.
Lee J.H. et al. Alterations in Gemin5 expression contribute to alternative mRNA
splicing patterns and tumor cell motility // Cancer Res. 2008. Т. 68. № 3. С. 639–644.
Lee K. et al. Human mesenchymal stem cells maintain transgene expression
during expansion and differentiation // Mol. Ther. 2001. Т. 3. № 6. С. 857–866.
Lee M.-H., Surh Y.-J. eEF1A2 as a putative oncogene // Ann. N. Y. Acad. Sci.
2009. Т. 1171. С. 87–93.
Levings P.P. et al. Expression of an exogenous human Oct-4 promoter identifies
tumor-initiating cells in osteosarcoma // Cancer Res. 2009. Т. 69. № 14. С. 5648–5655.
Li H. et al. Spontaneous expression of embryonic factors and p53 point mutations
in aged mesenchymal stem cells: a model of age-related tumorigenesis in mice // Cancer
Res. 2007. Т. 67. № 22. С. 10889–10898.
Li J.-F. et al. Differentiation of hUC-MSC into dopaminergic-like cells after
transduction with hepatocyte growth factor // Mol. Cell. Biochem. 2013. Т. 381. № 1-2.
С. 183–190.
Li N. et al. Genetically transforming human mesenchymal stem cells to sarcomas:
changes in cellular phenotype and multilineage differentiation potential // Cancer. 2009.
Т. 115. № 20. С. 4795–4806.
Li Q. et al. Differential expression of CD146 in tissues and endothelial cells
derived from infantile haemangioma and normal human skin // J. Pathol. 2003. Т. 201.
№ 2. С. 296–302.
Li Y. et al. Generation of insulin-producing cells from PDX-1 gene-modified
human mesenchymal stem cells // J. Cell. Physiol. 2007. Т. 211. № 1. С. 36–44.
Lin P. et al. Efficient lentiviral transduction of human mesenchymal stem cells
that preserves proliferation and differentiation capabilities // Stem Cells Transl Med.
2012. Т. 1. № 12. С. 886–897.
137
Lindvall C. et al. Molecular characterization of human telomerase reverse
transcriptase-immortalized human fibroblasts by gene expression profiling: activation of
the epiregulin gene // Cancer Res. 2003. Т. 63. № 8. С. 1743–1747.
Liu L. et al. Ex vivo expansion and in vivo infusion of bone marrow-derived Flk1+CD31-CD34- mesenchymal stem cells: feasibility and safety from monkey to human
// Stem Cells Dev. 2006. Т. 15. № 3. С. 349–357.
Liu Q. et al. Aurora-A abrogation of p53 DNA binding and transactivation
activity by phosphorylation of serine 215 // J. Biol. Chem. 2004. Т. 279. № 50. С.
52175–52182.
Liu T.M. et al. Identification of common pathways mediating differentiation of
bone marrow- and adipose tissue-derived human mesenchymal stem cells into three
mesenchymal lineages // Stem Cells. 2007. Т. 25. № 3. С. 750–760.
Locke M. et al. Transduction of human adipose-derived mesenchymal stem cells
by recombinant adeno-associated virus vectors // Tissue Eng Part C Methods. 2011. Т.
17. № 9. С. 949–959.
Lu C.-H. et al. Recent progresses in gene delivery-based bone tissue engineering
// Biotechnol. Adv. 2013. Т. 31. № 8. С. 1695–1706.
Lu L. et al. Therapeutic benefit of TH-engineered mesenchymal stem cells for
Parkinson’s disease // Brain Res. Brain Res. Protoc. 2005. Т. 15. № 1. С. 46–51.
Lund R.J., Närvä E., Lahesmaa R. Genetic and epigenetic stability of human
pluripotent stem cells // Nat. Rev. Genet. 2012. Т. 13. № 10. С. 732–744.
Madeira C. et al. Nonviral gene delivery to mesenchymal stem cells using
cationic liposomes for gene and cell therapy // J. Biomed. Biotechnol. 2010. Т. 2010. С.
735349.
Madonna R. et al. Transplantation of mesenchymal cells rejuvenated by the
overexpression of telomerase and myocardin promotes revascularization and tissue
repair in a murine model of hindlimb ischemia // Circ. Res. 2013. Т. 113. № 7. С. 902–
914.
Majid S.M. et al. The suppression of SH3BGRL is important for v-Rel-mediated
transformation // Oncogene. 2006. Т. 25. № 5. С. 756–768.
Mareschi K. et al. Expansion of mesenchymal stem cells isolated from pediatric
and adult donor bone marrow // J. Cell. Biochem. 2006. Т. 97. № 4. С. 744–754.
Matsumine A. et al. Expression of decorin, a small leucine-rich proteoglycan, as a
prognostic factor in soft tissue tumors // J Surg Oncol. 2007. Т. 96. № 5. С. 411–418.
Matushansky I. et al. Derivation of sarcomas from mesenchymal stem cells via
inactivation of the Wnt pathway // J. Clin. Invest. 2007. Т. 117. № 11. С. 3248–3257.
McClintick J.N., Edenberg H.J. Effects of filtering by Present call on analysis of
microarray experiments // BMC Bioinformatics. 2006. Т. 7. С. 49.
138
McDowell C.L., Bryan Sutton R., Obermann W.M.J. Expression of Hsp90
chaperone [corrected] proteins in human tumor tissue // Int. J. Biol. Macromol. 2009. Т.
45. № 3. С. 310–314.
McGinley L. et al. Lentiviral vector mediated modification of mesenchymal stem
cells & enhanced survival in an in vitro model of ischaemia // Stem Cell Res Ther.
2011. Т. 2. № 2. С. 12.
McGinley L.M. et al. Mesenchymal stem cell survival in the infarcted heart is
enhanced by lentivirus vector-mediated heat shock protein 27 expression // Hum. Gene
Ther. 2013. Т. 24. № 10. С. 840–851.
McMahon J.M. et al. Gene transfer into rat mesenchymal stem cells: a
comparative study of viral and nonviral vectors // Stem Cells Dev. 2006. Т. 15. № 1. С.
87–96.
Menicanin D. et al. Genomic profiling of mesenchymal stem cells // Stem Cell
Rev. 2009. Т. 5. № 1. С. 36–50.
Menon L.G. et al. Human bone marrow-derived mesenchymal stromal cells
expressing S-TRAIL as a cellular delivery vehicle for human glioma therapy // Stem
Cells. 2009. Т. 27. № 9. С. 2320–2330.
Meraldi P., Honda R., Nigg E.A. Aurora-A overexpression reveals
tetraploidization as a major route to centrosome amplification in p53-/- cells // EMBO J.
2002. Т. 21. № 4. С. 483–492.
Mestas J., Hughes C.C.W. Of mice and not men: differences between mouse and
human immunology // J. Immunol. 2004. Т. 172. № 5. С. 2731–2738.
Meza-Zepeda L.A. et al. High-resolution analysis of genetic stability of human
adipose tissue stem cells cultured to senescence // J. Cell. Mol. Med. 2008. Т. 12. № 2.
С. 553–563.
Middleton J. et al. A comparative study of endothelial cell markers expressed in
chronically inflamed human tissues: MECA-79, Duffy antigen receptor for chemokines,
von Willebrand factor, CD31, CD34, CD105 and CD146 // J. Pathol. 2005. Т. 206. № 3.
С. 260–268.
Miettinen M.M. Diagnostic soft tissue pathology. New York: Churchill
Livingstone, 2003.
Miller J.A. et al. Strategies for aggregating gene expression data: the
collapseRows R function // BMC Bioinformatics. 2011. Т. 12. С. 322.
Mitalipova M.M. et al. Preserving the genetic integrity of human embryonic stem
cells // Nat. Biotechnol. 2005. Т. 23. № 1. С. 19–20.
Miura M. et al. Accumulated chromosomal instability in murine bone marrow
mesenchymal stem cells leads to malignant transformation // Stem Cells. 2006. Т. 24. №
4. С. 1095–1103.
139
Mohseny A.B. et al. Osteosarcoma originates from mesenchymal stem cells in
consequence of aneuploidization and genomic loss of Cdkn2 // J. Pathol. 2009. Т. 219.
№ 3. С. 294–305.
Mohseny A.B., Hogendoorn P.C.W. Concise review: mesenchymal tumors: when
stem cells go mad // Stem Cells. 2011. Т. 29. № 3. С. 397–403.
Moriyama H. et al. Tightly regulated and homogeneous transgene expression in
human adipose-derived mesenchymal stem cells by lentivirus with tet-off system //
PLoS ONE. 2013. Т. 8. № 6. С. e66274.
Morizono K. et al. Multilineage cells from adipose tissue as gene delivery
vehicles // Hum. Gene Ther. 2003. Т. 14. № 1. С. 59–66.
Müller H., Helin K. The E2F transcription factors: key regulators of cell
proliferation // Biochim. Biophys. Acta. 2000. Т. 1470. № 1. С. M1–12.
Murnane J.P. Telomere dysfunction and chromosome instability // Mutat. Res.
2012. Т. 730. № 1-2. С. 28–36.
Naka N. et al. Synovial sarcoma is a stem cell malignancy // Stem Cells. 2010. Т.
28. № 7. С. 1119–1131.
Nakagami H. et al. Adipose tissue-derived stromal cells as a novel option for
regenerative cell therapy // J. Atheroscler. Thromb. 2006. Т. 13. № 2. С. 77–81.
Nakamizo A. et al. Human bone marrow-derived mesenchymal stem cells in the
treatment of gliomas // Cancer Res. 2005. Т. 65. № 8. С. 3307–3318.
Nakamura K. et al. Antitumor effect of genetically engineered mesenchymal stem
cells in a rat glioma model // Gene Ther. 2004. Т. 11. № 14. С. 1155–1164.
Neth P. et al. Wnt signaling regulates the invasion capacity of human
mesenchymal stem cells // Stem Cells. 2006. Т. 24. № 8. С. 1892–1903.
Nicholson J.M., Cimini D. Cancer karyotypes: survival of the fittest // Front
Oncol. 2013. Т. 3. С. 148.
Nielsen T.O. et al. Molecular characterisation of soft tissue tumours: a gene
expression study // Lancet. 2002. Т. 359. № 9314. С. 1301–1307.
Ning H. et al. Identification of an aberrant cell line among human adipose tissuederived stem cell isolates // Differentiation. 2009. Т. 77. № 2. С. 172–180.
Nishio J. Contributions of cytogenetics and molecular cytogenetics to the
diagnosis of adipocytic tumors // J. Biomed. Biotechnol. 2011. Т. 2011. С. 524067.
Noguchi C. et al. Fusion of the Dhfr/Mtx and IR/MAR gene amplification
methods produces a rapid and efficient method for stable recombinant protein
production // PLoS ONE. 2012. Т. 7. № 12. С. e52990.
O’Callaghan P.M., James D.C. Systems biotechnology of mammalian cell
factories // Brief Funct Genomic Proteomic. 2008. Т. 7. № 2. С. 95–110.
Oberlin E. et al. Blood-forming potential of vascular endothelium in the human
embryo // Development. 2002. Т. 129. № 17. С. 4147–4157.
140
Ocaña O.H. et al. Metastatic colonization requires the repression of the epithelialmesenchymal transition inducer Prrx1 // Cancer Cell. 2012. Т. 22. № 6. С. 709–724.
Okuyama H. et al. Downregulation of c-MYC protein levels contributes to cancer
cell survival under dual deficiency of oxygen and glucose // Cancer Res. 2010. Т. 70. №
24. С. 10213–10223.
Omerovic J., Clague M.J., Prior I.A. Phosphatome profiling reveals PTPN2,
PTPRJ and PTEN as potent negative regulators of PKB/Akt activation in Ras-mutated
cancer cells // Biochem. J. 2010. Т. 426. № 1. С. 65–72.
Orso F. et al. AP-2alpha and AP-2gamma regulate tumor progression via specific
genetic programs // FASEB J. 2008. Т. 22. № 8. С. 2702–2714.
Oxford G. et al. Expression profiling of Ral-depleted bladder cancer cells
identifies RREB-1 as a novel transcriptional Ral effector // Oncogene. 2007. Т. 26. №
50. С. 7143–7152.
Papageorgis P. et al. Smad signaling is required to maintain epigenetic silencing
during breast cancer progression // Cancer Res. 2010. Т. 70. № 3. С. 968–978.
Pardali E. et al. Critical role of endoglin in tumor cell plasticity of Ewing sarcoma
and melanoma // Oncogene. 2011. Т. 30. № 3. С. 334–345.
Park J.S. et al. Differential effects of equiaxial and uniaxial strain on
mesenchymal stem cells // Biotechnol. Bioeng. 2004. Т. 88. № 3. С. 359–368.
Park J.S. et al. Retrovirus-mediated transduction of a cytosine deaminase gene
preserves the stemness of mesenchymal stem cells // Exp. Mol. Med. 2013. Т. 45. С.
e10.
Pathak S. et al. Telomere dynamics, aneuploidy, stem cells, and cancer (review) //
Int. J. Oncol. 2002. Т. 20. № 3. С. 637–641.
Payne N.L. et al. Early intervention with gene-modified mesenchymal stem cells
overexpressing interleukin-4 enhances anti-inflammatory responses and functional
recovery in experimental autoimmune demyelination // Cell Adh Migr. 2012. Т. 6. № 3.
С. 179–189.
Péault B. et al. Stem and progenitor cells in skeletal muscle development,
maintenance, and therapy // Mol. Ther. 2007. Т. 15. № 5. С. 867–877.
Pérez-Mancera P.A., Sánchez-García I. Understanding mesenchymal cancer: the
liposarcoma-associated FUS-DDIT3 fusion gene as a model // Semin. Cancer Biol.
2005. Т. 15. № 3. С. 206–214.
Phinney D.G., Sensebé L. Mesenchymal stromal cells: misconceptions and
evolving concepts // Cytotherapy. 2013. Т. 15. № 2. С. 140–145.
Pilger A. et al. Long-term monitoring of sister chromatid exchanges and
micronucleus frequencies in pharmacy personnel occupationally exposed to cytostatic
drugs // Int Arch Occup Environ Health. 2000. Т. 73. № 7. С. 442–448.
Pirone D.M. et al. SPECs, small binding proteins for Cdc42 // J. Biol. Chem.
2000. Т. 275. № 30. С. 22650–22656.
141
Pochampally R.R. et al. Histamine receptor H1 and dermatopontin: new
downstream targets of the vitamin D receptor // J. Bone Miner. Res. 2007. Т. 22. № 9.
С. 1338–1349.
Porada C.D., Almeida-Porada G. Mesenchymal stem cells as therapeutics and
vehicles for gene and drug delivery // Adv. Drug Deliv. Rev. 2010. Т. 62. № 12. С.
1156–1166.
Qin H. et al. Characterization of the biochemical and transforming properties of
the neuroepithelial transforming protein 1 // J. Biol. Chem. 2005. Т. 280. № 9. С. 7603–
7613.
Qin J.Y. et al. Systematic comparison of constitutive promoters and the
doxycycline-inducible promoter // PLoS ONE. 2010. Т. 5. № 5. С. e10611.
Razali N.M., Wah Y.B. Power comparisons of Shapiro-Wilk, KolmogorovSmirnov, Lilliefors and Anderson-Darling tests // Journal of Statistical Modeling and
Analytics Vol. 2011. Т. 2. № 1. С. 21–33.
Real G. et al. Improvement of lentiviral transfer vectors using cis-acting
regulatory elements for increased gene expression // Appl. Microbiol. Biotechnol. 2011.
Т. 91. № 6. С. 1581–1591.
Reing J.E. et al. Degradation products of extracellular matrix affect cell migration
and proliferation // Tissue Eng Part A. 2009. Т. 15. № 3. С. 605–614.
Reisinger H. et al. The absence of effect of gene copy number and mRNA level
on the amount of mAb secretion from mammalian cells // Appl. Microbiol. Biotechnol.
2008. Т. 81. № 4. С. 701–710.
Ren Y.-X. et al. Mouse mesenchymal stem cells expressing PAX-FKHR form
alveolar rhabdomyosarcomas by cooperating with secondary mutations // Cancer Res.
2008. Т. 68. № 16. С. 6587–6597.
Ricke R.M., Deursen J.M. van. Aneuploidy in health, disease, and aging // J. Cell
Biol. 2013. Т. 201. № 1. С. 11–21.
Ricke R.M., Jeganathan K.B., Deursen J.M. van. Bub1 overexpression induces
aneuploidy and tumor formation through Aurora B kinase hyperactivation // J. Cell
Biol. 2011. Т. 193. № 6. С. 1049–1064.
Riggi N. et al. EWS-FLI-1 expression triggers a Ewing’s sarcoma initiation
program in primary human mesenchymal stem cells // Cancer Res. 2008. Т. 68. № 7. С.
2176–2185.
Rodriguez A.-M. et al. Adipocyte differentiation of multipotent cells established
from human adipose tissue // Biochem. Biophys. Res. Commun. 2004. Т. 315. № 2. С.
255–263.
Rodriguez A.-M. et al. Transplantation of a multipotent cell population from
human adipose tissue induces dystrophin expression in the immunocompetent mdx
mouse // J. Exp. Med. 2005. Т. 201. № 9. С. 1397–1405.
142
Rodriguez R. et al. FUS-CHOP fusion protein expression coupled to p53
deficiency induces liposarcoma in mouse but not in human adipose-derived
mesenchymal stem/stromal cells // Stem Cells. 2011. Т. 29. № 2. С. 179–192.
Rodriguez R. et al. Loss of p53 induces tumorigenesis in p21-deficient
mesenchymal stem cells // Neoplasia. 2009. Т. 11. № 4. С. 397–407.
Røsland G.V. et al. Long-term cultures of bone marrow-derived human
mesenchymal stem cells frequently undergo spontaneous malignant transformation //
Cancer Res. 2009. Т. 69. № 13. С. 5331–5339.
Rubio D. et al. Spontaneous human adult stem cell transformation // Cancer Res.
2005. Т. 65. № 8. С. 3035–3039.
Rubio R. et al. Deficiency in p53 but not retinoblastoma induces the
transformation of mesenchymal stem cells in vitro and initiates leiomyosarcoma in vivo
// Cancer Res. 2010. Т. 70. № 10. С. 4185–4194.
Sacchetti B. et al. Self-renewing osteoprogenitors in bone marrow sinusoids can
organize a hematopoietic microenvironment // Cell. 2007. Т. 131. № 2. С. 324–336.
Sanchez-Ramos J. et al. Adult bone marrow stromal cells differentiate into neural
cells in vitro // Exp. Neurol. 2000. Т. 164. № 2. С. 247–256.
Santo E.E. et al. Oncogenic activation of FOXR1 by 11q23 intrachromosomal
deletion-fusions in neuroblastoma // Oncogene. 2012. Т. 31. № 12. С. 1571–1581.
Santos J.L. et al. Non-viral gene delivery to mesenchymal stem cells: methods,
strategies and application in bone tissue engineering and regeneration // Curr Gene
Ther. 2011. Т. 11. № 1. С. 46–57.
Sasportas L.S. et al. Assessment of therapeutic efficacy and fate of engineered
human mesenchymal stem cells for cancer therapy // Proc. Natl. Acad. Sci. U.S.A.
2009. Т. 106. № 12. С. 4822–4827.
Scheideler M. et al. Comparative transcriptomics of human multipotent stem cells
during adipogenesis and osteoblastogenesis // BMC Genomics. 2008. Т. 9. С. 340.
Schierling W. et al. Fates of genetically engineered haematopoietic and
mesenchymal stem cell grafts in normal and injured rat hearts // J Tissue Eng Regen
Med. 2008. Т. 2. № 6. С. 354–364.
Sekiya I. et al. Adipogenic differentiation of human adult stem cells from bone
marrow stroma (MSCs) // J. Bone Miner. Res. 2004. Т. 19. № 2. С. 256–264.
Serakinci N. et al. Adult human mesenchymal stem cell as a target for neoplastic
transformation // Oncogene. 2004. Т. 23. № 29. С. 5095–5098.
Shi S., Gronthos S. Perivascular niche of postnatal mesenchymal stem cells in
human bone marrow and dental pulp // J. Bone Miner. Res. 2003. Т. 18. № 4. С. 696–
704.
Shih D.T. et al. Isolation and characterization of neurogenic mesenchymal stem
cells in human scalp tissue // Stem Cells. 2005. Т. 23. № 7. С. 1012–1020.
143
Shima Y. et al. In vitro transformation of mesenchymal stem cells by oncogenic
H-rasVal12 // Biochem. Biophys. Res. Commun. 2007. Т. 353. № 1. С. 60–66.
Shimizu T. et al. c-MYC overexpression with loss of Ink4a/Arf transforms bone
marrow stromal cells into osteosarcoma accompanied by loss of adipogenesis //
Oncogene. 2010. Т. 29. № 42. С. 5687–5699.
Shiras A. et al. Spontaneous transformation of human adult nontumorigenic stem
cells to cancer stem cells is driven by genomic instability in a human model of
glioblastoma // Stem Cells. 2007. Т. 25. № 6. С. 1478–1489.
Silva Meirelles L. da, Chagastelles P.C., Nardi N.B. Mesenchymal stem cells
reside in virtually all post-natal organs and tissues // J. Cell. Sci. 2006. Т. 119. № Pt 11.
С. 2204–2213.
Simon R. Microarray-based expression profiling and informatics // Curr. Opin.
Biotechnol. 2008. Т. 19. № 1. С. 26–29.
Sinacore M.S., Drapeau D., Adamson S.R. Adaptation of mammalian cells to
growth in serum-free media // Mol. Biotechnol. 2000. Т. 15. № 3. С. 249–257.
Škalamera D. et al. Generation of a genome scale lentiviral vector library for
EF1α promoter-driven expression of human ORFs and identification of human genes
affecting viral titer // PLoS ONE. 2012. Т. 7. № 12. С. e51733.
Skubitz K.M. et al. Identification of heterogeneity among soft tissue sarcomas by
gene expression profiles from different tumors // J Transl Med. 2008. Т. 6. С. 23.
Skubitz K.M., D’Adamo D.R. Sarcoma // Mayo Clin. Proc. 2007. Т. 82. № 11. С.
1409–1432.
Smith J. et al. The ATM-Chk2 and ATR-Chk1 pathways in DNA damage
signaling and cancer // Adv. Cancer Res. 2010. Т. 108. С. 73–112.
Sorrentino A. et al. Isolation and characterization of CD146+ multipotent
mesenchymal stromal cells // Exp. Hematol. 2008. Т. 36. № 8. С. 1035–1046.
Soukup T. et al. Mesenchymal stem cells isolated from the human bone marrow:
cultivation, phenotypic analysis and changes in proliferation kinetics // Acta Medica
(Hradec Kralove). 2006. Т. 49. № 1. С. 27–33.
Stagg J. Mesenchymal stem cells in cancer // Stem Cell Rev. 2008. Т. 4. № 2. С.
119–124.
Strem B.M. et al. Multipotential differentiation of adipose tissue-derived stem
cells // Keio J Med. 2005. Т. 54. № 3. С. 132–141.
Studeny M. et al. Bone marrow-derived mesenchymal stem cells as vehicles for
interferon-beta delivery into tumors // Cancer Res. 2002. Т. 62. № 13. С. 3603–3608.
Subramanian A. et al. Gene set enrichment analysis: a knowledge-based approach
for interpreting genome-wide expression profiles // Proc. Natl. Acad. Sci. U.S.A. 2005.
Т. 102. № 43. С. 15545–15550.
144
Suemori H. et al. Efficient establishment of human embryonic stem cell lines and
long-term maintenance with stable karyotype by enzymatic bulk passage // Biochem.
Biophys. Res. Commun. 2006. Т. 345. № 3. С. 926–932.
Sun Y. et al. The eukaryotic translation elongation factor eEF1A2 induces
neoplastic properties and mediates tumorigenic effects of ZNF217 in precursor cells of
human ovarian carcinomas // Int. J. Cancer. 2008. Т. 123. № 8. С. 1761–1769.
Suvà M.-L. et al. Identification of cancer stem cells in Ewing’s sarcoma // Cancer
Res. 2009. Т. 69. № 5. С. 1776–1781.
Swiech K., Picanço-Castro V., Covas D.T. Human cells: new platform for
recombinant therapeutic protein production // Protein Expr. Purif. 2012. Т. 84. № 1. С.
147–153.
Takikita M., Chung J.-Y., Hewitt S.M. Tissue microarrays enabling highthroughput molecular pathology // Curr. Opin. Biotechnol. 2007. Т. 18. № 4. С. 318–
325.
Tanaka H., Yao M.-C. Palindromic gene amplification--an evolutionarily
conserved role for DNA inverted repeats in the genome // Nat. Rev. Cancer. 2009. Т. 9.
№ 3. С. 216–224.
Tarte K. et al. Clinical-grade production of human mesenchymal stromal cells:
occurrence of aneuploidy without transformation // Blood. 2010. Т. 115. № 8. С. 1549–
1553.
Thollet A. et al. ZNF217 confers resistance to the pro-apoptotic signals of
paclitaxel and aberrant expression of Aurora-A in breast cancer cells // Mol. Cancer.
2010. Т. 9. С. 291.
Tiganis T. et al. Epidermal growth factor receptor and the adaptor protein p52Shc
are specific substrates of T-cell protein tyrosine phosphatase // Mol. Cell. Biol. 1998. Т.
18. № 3. С. 1622–1634.
Tolar J. et al. Sarcoma derived from cultured mesenchymal stem cells // Stem
Cells. 2007. Т. 25. № 2. С. 371–379.
Toma J.G. et al. Isolation of multipotent adult stem cells from the dermis of
mammalian skin // Nat. Cell Biol. 2001. Т. 3. № 9. С. 778–784.
Tondreau T. et al. Gene expression pattern of functional neuronal cells derived
from human bone marrow mesenchymal stromal cells // BMC Genomics. 2008. Т. 9. С.
166.
Treacy O. et al. Adenoviral transduction of mesenchymal stem cells: in vitro
responses and in vivo immune responses after cell transplantation // PLoS ONE. 2012.
Т. 7. № 8. С. e42662.
Tsai M.-S. et al. Functional network analysis of the transcriptomes of
mesenchymal stem cells derived from amniotic fluid, amniotic membrane, cord blood,
and bone marrow // Stem Cells. 2007. Т. 25. № 10. С. 2511–2523.
145
Turc-Carel C. et al. Cytogenetic studies of adipose tissue tumors. I. A benign
lipoma with reciprocal translocation t(3;12)(q28;q14) // Cancer Genet. Cytogenet. 1986.
Т. 23. № 4. С. 283–289.
Urazova O.I. et al. Cytogenetic impairments of peripheral blood lymphocytes
during infectious mononucleosis // Bull. Exp. Biol. Med. 2001. Т. 131. № 4. С. 392–
393.
Vargas A.E. et al. Genetic modification of mesenchymal stem cells // Methods
Mol. Biol. 2012. Т. 879. С. 479–490.
Varma N.R.S. et al. Lentiviral Based Gene Transduction and Promoter Studies in
Human Hematopoietic Stem Cells (hHSCs) // J Stem Cells Regen Med. 2011. Т. 7. №
1. С. 41–53.
Vendrell J.A. et al. ZNF217 is a marker of poor prognosis in breast cancer that
drives epithelial-mesenchymal transition and invasion // Cancer Res. 2012. Т. 72. № 14.
С. 3593–3606.
Venter J.C. et al. The sequence of the human genome // Science. 2001. Т. 291. №
5507. С. 1304–1351.
Vermeulen L. et al. Cancer stem cells--old concepts, new insights // Cell Death
Differ. 2008. Т. 15. № 6. С. 947–958.
Visvader J.E. Cells of origin in cancer // Nature. 2011. Т. 469. № 7330. С. 314–
322.
Vitale I. et al. Illicit survival of cancer cells during polyploidization and
depolyploidization // Cell Death Differ. 2011. Т. 18. № 9. С. 1403–1413.
Vlerken L.E. van et al. EZH2 is required for breast and pancreatic cancer stem
cell maintenance and can be used as a functional cancer stem cell reporter // Stem Cells
Transl Med. 2013. Т. 2. № 1. С. 43–52.
Wagner W. et al. Comparative characteristics of mesenchymal stem cells from
human bone marrow, adipose tissue, and umbilical cord blood // Exp. Hematol. 2005. Т.
33. № 11. С. 1402–1416.
Wang N. et al. Down-regulation of HtrA1 activates the epithelial-mesenchymal
transition and ATM DNA damage response pathways // PLoS ONE. 2012. Т. 7. № 6. С.
e39446.
Wang X. et al. Hsp20-engineered mesenchymal stem cells are resistant to
oxidative stress via enhanced activation of Akt and increased secretion of growth factors
// Stem Cells. 2009. Т. 27. № 12. С. 3021–3031.
Wang Y. et al. A toxicity study of multiple-administration human umbilical cord
mesenchymal stem cells in cynomolgus monkeys // Stem Cells Dev. 2012. Т. 21. № 9.
С. 1401–1408.
Wang Y. et al. Outgrowth of a transformed cell population derived from normal
human BM mesenchymal stem cell culture // Cytotherapy. 2005. Т. 7. № 6. С. 509–519.
146
Wang Y.-L. et al. Overexpression of calcineurin B subunit (CnB) enhances the
oncogenic potential of HEK293 cells // Cancer Sci. 2008. Т. 99. № 6. С. 1100–1108.
Watanabe N. et al. Genetically modified adipose tissue-derived stem/stromal
cells, using simian immunodeficiency virus-based lentiviral vectors, in the treatment of
hemophilia B // Hum. Gene Ther. 2013. Т. 24. № 3. С. 283–294.
Weiss S.W. 44th Maude Abbott Lecture. Soft tissue sarcomas: lessons from the
past, challenges for the future // Mod. Pathol. 2002. Т. 15. № 1. С. 77–86.
Weiss S.W., Goldblum J.R., Folpe A.L. Enzinger and Weiss’s Soft Tissue
Tumors. Elsevier Health Sciences, 2007. Вып. 5. 4348 С.
Wild L. et al. In vitro transformation of mesenchymal stem cells induces gradual
genomic hypomethylation // Carcinogenesis. 2010. Т. 31. № 10. С. 1854–1862.
Woodbury D. et al. Adult rat and human bone marrow stromal cells differentiate
into neurons // J. Neurosci. Res. 2000. Т. 61. № 4. С. 364–370.
Wosnitza M. et al. Plasticity of human adipose stem cells to perform adipogenic
and endothelial differentiation // Differentiation. 2007. Т. 75. № 1. С. 12–23.
Wu B. et al. Lentiviral delivery of biglycan promotes proliferation and increases
osteogenic potential of bone marrow-derived mesenchymal stem cells in vitro // J. Mol.
Histol. 2013. Т. 44. № 4. С. 423–431.
Wu C. et al. Aggressive fibromatosis (desmoid tumor) is derived from
mesenchymal progenitor cells // Cancer Res. 2010. Т. 70. № 19. С. 7690–7698.
Wurm F.M. Production of recombinant protein therapeutics in cultivated
mammalian cells // Nat. Biotechnol. 2004. Т. 22. № 11. С. 1393–1398.
Xia J. et al. Elevated serine protease HtrA1 inhibits cell proliferation, reduces
invasion, and induces apoptosis in esophageal squamous cell carcinoma by blocking the
nuclear factor-κB signaling pathway // Tumour Biol. 2013. Т. 34. № 1. С. 317–328.
Xia X. et al. Transgenes delivered by lentiviral vector are suppressed in human
embryonic stem cells in a promoter-dependent manner // Stem Cells Dev. 2007. Т. 16.
№ 1. С. 167–176.
Xiao W. et al. Mesenchymal stem cell transformation and sarcoma genesis // Clin
Sarcoma Res. 2013. Т. 3. № 1. С. 10.
Yamamoto Y. et al. Overexpression of polo-like kinase 1 (PLK1) and
chromosomal instability in bladder cancer // Oncology. 2006. Т. 70. № 3. С. 231–237.
Yamate J. et al. Adipogenic, osteogenic and myofibrogenic differentiations of a
rat malignant fibrous histiocytoma (MFH)-derived cell line, and a relationship of MFH
cells with embryonal mesenchymal, perivascular and bone marrow stem cells // Eur. J.
Cancer. 2007. Т. 43. № 18. С. 2747–2756.
Zaragosi L.-E., Ailhaud G., Dani C. Autocrine fibroblast growth factor 2
signaling is critical for self-renewal of human multipotent adipose-derived stem cells //
Stem Cells. 2006. Т. 24. № 11. С. 2412–2419.
147
Zeller K.I. et al. An integrated database of genes responsive to the Myc oncogenic
transcription factor: identification of direct genomic targets // Genome Biol. 2003. Т. 4.
№ 10. С. R69.
Zhang D. et al. Over-expression of CXCR4 on mesenchymal stem cells augments
myoangiogenesis in the infarcted myocardium // J. Mol. Cell. Cardiol. 2008. Т. 44. № 2.
С. 281–292.
Zhang G. et al. Therapeutic gene expression in transduced mesenchymal stem
cells can be monitored using a reporter gene // Nucl. Med. Biol. 2012. Т. 39. № 8. С.
1243–1250.
Zhang L. et al. PEP-1-CAT-transduced mesenchymal stem cells acquire an
enhanced viability and promote ischemia-induced angiogenesis // PLoS ONE. 2012. Т.
7. № 12. С. e52537.
Zhang X., Godbey W.T. Viral vectors for gene delivery in tissue engineering //
Adv. Drug Deliv. Rev. 2006. Т. 58. № 4. С. 515–534.
Zhang Z.-X. et al. Cytogenetic analysis of human bone marrow-derived
mesenchymal stem cells passaged in vitro // Cell Biol. Int. 2007. Т. 31. № 6. С. 645–
648.
Zhou Y.F. et al. Spontaneous transformation of cultured mouse bone marrowderived stromal cells // Cancer Res. 2006. Т. 66. № 22. С. 10849–10854.
Zielske S.P., Livant D.L., Lawrence T.S. Radiation increases invasion of genemodified mesenchymal stem cells into tumors // Int. J. Radiat. Oncol. Biol. Phys. 2009.
Т. 75. № 3. С. 843–853.
148
ПРИЛОЖЕНИЕ 1
Гены
70 CIN в
порядке убывания
корреляции с
хромосомной
нестабильностью и их экспрессия в спонтанно трансформированных ММСК ЖТ
человека. Модифицировано из [Carter S.L. et al., 2006].
Ген 70CIN
TPX2**
PRC1*
FOXM1*
CDC2 (CDK1)*
TGIF2*
MCM2*
H2AFZ*
TOP2A**
PCNA
UBE2C**
MELK*
TRIP13*
Описание гена
Необходим для нормальной
морфологии веретена деления и
интактности центросом. Его
гиперэкспрессия вызывает
полиплоидизацию. Он необходим для
нацеливания Aurora-A киназы на
аппарат веретена деления.
Критичен для формирования
центрального веретена деления. Вносит
вклад в правильное формирование
веретена во время метафазы.
Ключевой регулятор транскрипции
генов, вовлеченных в сегрегацию
хромосом и цитокинез.
Играет важные регуляторные роли в
контроле клеточного цикла, а также
важную роль в регуляции времени
формирования митотического веретена.
ДНК-связывающийся гомеобокс белок
и репрессор транскрипции.
Вовлечен в инициацию репликации
генома эукариот.
Этот гистон необходим для
эмбрионального развития.
Играет существенную каталитическую
роль в сегрегации хромосом.
Вовлечен в RAD6-зависимый путь
репарации ДНК.
Необходим для разрушения
митотических циклинов.
Потенциальный регулятор развития
G2/M перехода и может действовать
как антогонист CDC25B фосфатазы.
Кодирует белок, связывающийся с
рецепторами гормонов щитовидной
железы, так называемый гормонзависимый транскрипционный фактор.
Один из немногих белков потенциально
играющих важную роль на ранней
стадии немелкоклеточного рака легких.
Кратность
изменения
экспрессии (FC)
q-value
2,354
0,000
1,498
0,030
1,214
0,002
1,356
0,006
1,496
0,000
1,611
0,000
1,763
0,008
2,508
0,008
1,073
0,137
2,426
0,000
1,447
0,039
1,668
0,010
149
CNAP1
(NCAPD2)*
MCM7*
RNASEH2A*
RAD51AP1*
KIF20A*
CDC45L*
MAD2L1*
ESPL1*
CCNB2**
FEN1*
TTK*
CCT5*
Ответственен за нацеливание CNAP1 и,
возможно, конденсина к митотическим
хромосомам.
Вовлечен в инициацию репликации
генома эукариот
Показывает повышенную активность во
время репликации ДНК.
Играет ключевую роль в репарации
хромосомных повреждений с помощью
гомологичной рекомбинации.
Необходим для цитокинеза. Также
нужен для релокации Aurora
B/INCENP/survivin хромосомного
белкового комплекса.
Необходим для инициации репликации
ДНК.
Компонент точки контроля сборки
митотического веретена, который
задерживает наступление анафазы пока
все хромосомы не выравняются
правильно на метафазной пластинке.
p31 (ранее известный как Cmt2)
противостоит по функции Mad2 и
необходим для сайленсинга
восстановления точки контроля
веретена с помощью Mad2 в Brca1клетках, частично восстановивших
точку контроля веретена.
Непосредственно взаимодействует с
CDC20.
Необходим для сегрегации сстринских
хроматид во время митоза в клетках
чловека.
Член семейства циклинов и его
гиперэкспрессия приводит к
хромосомной нестабильности.
Гиперэкспрессия вызывает
нестабильность повторов и
аберрантную репарацию ДНК.
Необходим для дупликации центросом
и нормального развития митоза.
Критический регулятор генетической
стабильности, он необходим для точки
контроля сборки веретена.
Молекулярный шаперон, член
шаперонин-содержащего комплекса
TCP1 (TRiC). Его гиперэкспрессия
наблюдается в опухолевых клетках с
мутантным p53.
1,760
0,001
1,989
0,001
1,112
0,001
1,292
0,018
1,772
0,006
1,797
0,002
1,596
0,018
1,066
0,030
2,320
0,001
1,664
0,006
1,246
0,030
1,420
0,000
150
RFC4*
ATAD2*
ch-TOG
(CKAP5)**
NUP205*
CDC20**
CKS2*
RRM2*
ELAVL1
CCNB1*
RRM1*
AURKB**
MSH6**
EZH2*
CTPS1**
Мутации в этом факторе репликации
приводят к аберрантному контролю
деления в ответ на повреждения
хромосом или ДНК.
Член семейства ААА АТФаз, кофактор
MYC и коактиватор андрогенового
рецептора. Его амплификация и
гиперэкспрессия наблюдается в
агрессивных опухолях, так как играет
важную роль в выживании и
пролиферации клеток.
Имеет несколько функций во время
митоза: в фокусировке (-)-концов
микротрубочек на полюсах веретена
деления, поддержке цельности
центросом и биполярности веретена.
Нуклеопорин.
1,517
0,002
1,601
0,002
2,106
0,001
1,513
0,002
Играет роль в разделении хромосом.
3,828
0,001
Связывается с каталитической
субъединицей циклин зависимых киназ.
Фермент важный для производства
дезоксирибонуклеотидов перед ДНК
синтезом в S фазе деления.
РНК-связывающийся белок, играет
роль в стабилизации ARE-содержащих
мРНК, т.е. участвует в регуляции
экспрессии. Вовлечен во многие
биологические процессы,
гиперэкспрессия наблюдается во
многих типах рака.
Член семейства циклинов и его
гиперэкспрессия приводит к
хромосомной нестабильности.
Важен для производства
дезоксирибонуклеотидов перед ДНК
синтезом в S фазе деления.
Аберрантная экспрессия этого гена
приводит к хромосомной
нестабильности.
Член семейства MutS белков репарации
несовпадений нуклетоидов в ДНК.
Дерегулированная экспрессия EZH2
ассоциируется с потерей
дифференцировки и развитием
низкодифференцированного рака
молочной железы.
Важен для биосинтеза фосфолипидов и
нуклеиновых кислот и играет
ключевую роль в росте клеток.
1,676
0,023
1,245
0,039
не детектирован
1,269
0,004
1,643
0,014
2,687
0,000
2,169
0,000
1,288
0,002
2,138
0,000
151
DKC1**
OIP5**
CDCA8*
PTTG1**
CEP55*
H2AFX*
Белок связывается с H/ACA участками
малых ядерных РНК и играет важную
роль в стабилизации и поддрежки
работы теломеразы.
Один из белков комплекса важного для
структурирования и функционирования
центромер/кинетохор. Гиперэкспрессия
наблюдается в раковых клетках.
Связывает Survivin и INCENP in vitro,
нобходим для стабильности
биполярного митотичского веретена.
Гиперэкпрсессия вызывает
анеуплоидию.
Регулятор необходимый для
завершения цитокинеза.
Аберрантная экспрессия приводит к
хромосомной нестабильности.
2,375
0,001
2,097
0,001
1,716
0,001
2,502
0,001
1,598
0,030
1,380
0,008
0,926
0,081
1,117
0,004
1,415
0,001
1,648
0,003
1,238
0,006
1,091
0,051
1,421
0,001
1,628
0,008
2,202
0,001
1,078
0,099
Играет критичную роль в цитокинезе
1,067
0,030
Регулятор ранних этапов репликации
ДНК.
Урацил-ДНК гликозилаза. Одна из
важных функций этого белка предотвращение мутагенеза путем
1,037
0,023
1,167
0,010
CMAS
BRRN1
(NCAPH2)*
MCM10*
LSM4*
MTB (NCAPG2)*
ASF1B
ZWINT*
TOPK (PBK)*
FLJ10036
(ZWILCH)**
CDCA3
ECT2*
CDC6*
UNG*
Необходим для конверсии
интерфазного хроматина в
конденсированные хромосомы.
Необходим для правильной
конденсации хромосом.
Член семейства LSm белков,
связывающихся с РНК. Участвует в
процессинге РНК.
Субъединица комплекса конденсина II,
вовлеченного в сборку и сегрегацию
хромосом.
Член семейства белков шаперонов
гистонов H3/H4, является субстратом
для киназ клеточного цикла и играют
важную роль в изменении структуры
нуклеосомного хроматина.
Важен для проведения сигналов
митотических точек контроля.
Серин/треонин киназа, относящийся к
семейству MAPKK. Гиперэкспрессия
этого гена наблюдается при
туморогенезе.
Аберрантная экспрессия приводит к
хромосомной нестабильности.
ген регуляции клеточного цикла.
152
удаления урацила из ДНК.
0,918
0,001
1,429
0,001
1,222
0,014
1,366
0,001
Необходим для сплайсинга РНК.
1,772
0,001
Белок имеет митогенную и ДНКсвязывающую активность.
0,909
0,157
1,524
0,001
1,119
0,014
1,139
0,081
3,638
0,000
1,404
0,010
MTCH2*
RAD21*
ACTL6A*
Важен для ассоциации кинетохор с
микротрубочками.
Член семейства актин-связанных
белков (ARPs). Вовлечен во многие
клеточные процессы включая
мезикулярный транспорт, ориентацию
веретен деления, ядерную миграцию и
ремоделирование хроматина.
PDCD2L*
SRSF2*
HDGF
NXT1*
Кинетохор-ассоциированная протеин
киназа важная для равномерной
сегрегации хромосом.
NEK2*
DHCR7
Играет роль в стабилизации полюсов
веретена деления во время сегрегации
STK6 (AURKA)**
хромосом. Гиперэкспрессия приводит к
тетраплоидизации.
NDUFAB1*
не детектирован
KIAA0286
Кинезин, играющий сцущественную
1,369
0,001
роль в организации сентральных
веретен.
* - изменение значимо при q<0,05;** - кратность изменения >2; Подчеркнуты 29 генов, связь
которых с хромосомной нестабильностью доказана.
KIF4A*
ПРИЛОЖЕНИЕ 2
Результаты GSEA для генов с повышенной экспрессией, база данных
канонических сигнальных путей
NAME
SIZE
NES
FDR q-val
RANK
AT
MAX
KEGG_SPLICEOSOME
114
NES
0,000000
3250
REACTOME_PROCESSING_OF_
124
2,71037
0,000000
2225
LEADING EDGE
tags=68%,
list=25%,
signal=90%
tags=55%,
153
CAPPED_INTRON_CONTAININ
G_PRE_MRNA
REACTOME_MRNA_PROCESSI
NG
140
2,68974
0,000000
2264
REACTOME_MRNA_SPLICING
99
2,62618
0,000000
2225
REACTOME_METABOLISM_OF
_RNA
241
2,53061
0,000000
3042
REACTOME_METABOLISM_OF
_NON_CODING_RNA
41
2,49244
0,000000
1795
47
2,48752
0,000000
2073
39
2,43618
0,000000
2690
108
2,39821
0,000000
4359
REACTOME_INFLUENZA_LIFE
_CYCLE
133
2,36766
0,000000
2908
REACTOME_MRNA_3_END_PR
OCESSING
31
2,29506
0,000015
2690
REACTOME_3_UTR_MEDIATE
D_TRANSLATIONAL_REGULA
TION
107
2,26041
0,000054
3948
REACTOME_METABOLISM_OF
_MRNA
203
2,20668
0,000075
3042
REACTOME_MITOTIC_M_M_G
1_PHASES
160
2,20028
0,000070
4475
REACTOME_DNA_REPLICATI
ON
178
2,19129
0,000107
3732
KEGG_RIBOSOME
84
2,18469
0,000130
2908
REACTOME_RESPIRATORY_E
LECTRON_TRANSPORT_ATP_S
YNTHESIS_BY_CHEMIOSMOTI
C_COUPLING_AND_HEAT_PR
ODUCTION_BY_UNCOUPLING
_PROTEINS_
72
2,17846
0,000170
2148
REACTOME_TRANSPORT_OF_
MATURE_TRANSCRIPT_TO_C
YTOPLASM
REACTOME_CLEAVAGE_OF_G
ROWING_TRANSCRIPT_IN_TH
E_TERMINATION_REGION
REACTOME_NONSENSE_MEDI
ATED_DECAY_ENHANCED_B
Y_THE_EXON_JUNCTION_CO
MPLEX
REACTOME_PEPTIDE_CHAIN_
ELONGATION
88
2,16933
0,000241
4359
REACTOME_REGULATION_OF
_GLUCOKINASE_BY_GLUCOK
22
2,15528
0,000245
2073
list=17%,
signal=66%
tags=52%,
list=17%,
signal=62%
tags=54%,
list=17%,
signal=64%
tags=51%,
list=23%,
signal=65%
tags=63%,
list=14%,
signal=73%
tags=57%,
list=16%,
signal=68%
tags=64%,
list=21%,
signal=81%
tags=70%,
list=34%,
signal=105%
tags=50%,
list=22%,
signal=64%
tags=65%,
list=21%,
signal=81%
tags=62%,
list=30%,
signal=88%
tags=46%,
list=23%,
signal=60%
tags=69%,
list=34%,
signal=105%
tags=58%,
list=29%,
signal=81%
tags=55%,
list=22%,
signal=70%
tags=42%,
list=17%,
signal=50%
tags=67%,
list=34%,
signal=100%
tags=68%,
list=16%,
154
INASE_REGULATORY_PROTEI
N
REACTOME_NEP_NS2_INTERA
CTS_WITH_THE_CELLULAR_E
XPORT_MACHINERY
REACTOME_TRANSPORT_OF_
RIBONUCLEOPROTEINS_INTO
_THE_HOST_NUCLEUS
24
2,15392
0,000241
2073
24
2,15039
0,000574
2073
REACTOME_RNA_POL_II_TRA
NSCRIPTION
87
2,11320
0,000804
3325
REACTOME_INTERACTIONS_
OF_VPR_WITH_HOST_CELLUL
AR_PROTEINS
29
2,09340
0,000908
2073
REACTOME_DNA_STRAND_EL
ONGATION
29
2,08759
0,000957
3850
REACTOME_MRNA_SPLICING
_MINOR_PATHWAY
39
2,08387
0,000970
1641
49
2,08168
0,001121
2002
tags=45%,
list=15%,
signal=53%
tags=57%,
list=16%,
signal=68%
REACTOME_FORMATION_OF_
THE_TERNARY_COMPLEX_AN
D_SUBSEQUENTLY_THE_43S_
COMPLEX
REACTOME_TRANSPORT_OF_
MATURE_MRNA_DERIVED_FR
OM_AN_INTRONLESS_TRANS
CRIPT
REACTOME_TCA_CYCLE_AND
_RESPIRATORY_ELECTRON_T
RANSPORT
REACTOME_INFLUENZA_VIR
AL_RNA_TRANSCRIPTION_AN
D_REPLICATION
signal=81%
28
2,07236
0,001080
2073
104
2,07231
0,001349
2148
103
2,05840
0,001413
2908
PID_ATR_PATHWAY
33
2,05369
0,001382
4475
REACTOME_EXTENSION_OF_
TELOMERES
26
2,05279
0,001442
3732
REACTOME_TRANSCRIPTION
147
2,04791
0,001696
3459
REACTOME_RESPIRATORY_E
LECTRON_TRANSPORT
58
2,03597
0,002168
2148
REACTOME_HIV_LIFE_CYCLE
99
2,01665
0,002528
3280
REACTOME_MITOTIC_PROME
TAPHASE
80
2,00650
0,003197
2861
KEGG_DNA_REPLICATION
34
1,98969
0,003356
3850
tags=67%,
list=16%,
signal=79%
tags=63%,
list=16%,
signal=74%
tags=52%,
list=26%,
signal=69%
tags=59%,
list=16%,
signal=70%
tags=79%,
list=30%,
signal=113%
tags=49%,
list=13%,
signal=56%
tags=33%,
list=17%,
signal=39%
tags=47%,
list=22%,
signal=60%
tags=85%,
list=34%,
signal=129%
tags=77%,
list=29%,
signal=108%
tags=48%,
list=27%,
signal=65%
tags=41%,
list=17%,
signal=49%
tags=49%,
list=25%,
signal=66%
tags=51%,
list=22%,
signal=65%
tags=71%,
list=30%,
signal=100%
155
KEGG_RNA_DEGRADATION
51
1,98459
0,003624
2027
21
1,97767
0,003860
3048
33
1,97055
0,003777
4210
REACTOME_GLUCOSE_TRANS
PORT
28
1,97045
0,004156
2319
PID_FANCONI_PATHWAY
38
1,96137
0,004187
3351
KEGG_CARDIAC_MUSCLE_CO
NTRACTION
37
1,95981
0,004770
1841
REACTOME_CELL_CYCLE_MI
TOTIC
284
1,94829
0,005184
3852
REACTOME_G2_M_CHECKPOI
NTS
39
1,94046
0,005222
4210
REACTOME_CELL_CYCLE
334
1,93836
0,005370
3732
REACTOME_ACTIVATION_OF_
THE_MRNA_UPON_BINDING_
OF_THE_CAP_BINDING_COMP
LEX_AND_EIFS_AND_SUBSEQ
UENT_BINDING_TO_43S
57
1,93426
0,005320
4359
REACTOME_M_G1_TRANSITIO
N
76
1,93299
0,006184
3117
29
1,92078
0,006318
3553
11
1,91730
0,006268
1988
111
1,91641
0,006425
2908
REACTOME_SYNTHESIS_OF_D
NA
88
1,91302
0,006368
3732
REACTOME_CELL_CYCLE_CH
ECKPOINTS
105
1,91234
0,006310
3145
REACTOME_LATE_PHASE_OF
_HIV_LIFE_CYCLE
87
1,91143
0,007008
3280
REACTOME_LAGGING_STRAN
D_SYNTHESIS
19
1,90196
0,008721
3732
REACTOME_PROCESSING_OF_
CAPPED_INTRONLESS_PRE_M
RNA
REACTOME_ACTIVATION_OF_
ATR_IN_RESPONSE_TO_REPLI
CATION_STRESS
REACTOME_ACTIVATION_OF_
THE_PRE_REPLICATIVE_COM
PLEX
REACTOME_PURINE_RIBONU
CLEOSIDE_MONOPHOSPHATE
_BIOSYNTHESIS
REACTOME_SRP_DEPENDENT
_COTRANSLATIONAL_PROTEI
N_TARGETING_TO_MEMBRAN
E
tags=35%,
list=16%,
signal=42%
tags=67%,
list=23%,
signal=87%
tags=79%,
list=32%,
signal=116%
tags=61%,
list=18%,
signal=74%
tags=66%,
list=26%,
signal=88%
tags=51%,
list=14%,
signal=60%
tags=53%,
list=30%,
signal=74%
tags=77%,
list=32%,
signal=114%
tags=51%,
list=29%,
signal=70%
tags=68%,
list=34%,
signal=103%
tags=49%,
list=24%,
signal=64%
tags=66%,
list=27%,
signal=90%
tags=64%,
list=15%,
signal=75%
tags=43%,
list=22%,
signal=55%
tags=58%,
list=29%,
signal=81%
tags=50%,
list=24%,
signal=65%
tags=48%,
list=25%,
signal=64%
tags=74%,
list=29%,
156
REACTOME_DNA_REPAIR
92
1,88375
0,008942
2685
REACTOME_CHROMOSOME_
MAINTENANCE
77
1,88042
0,010286
3815
14
1,86701
0,012172
3608
19
1,85218
0,013402
827
148
1,84215
0,013531
3948
16
1,83997
0,014106
1535
33
1,83499
0,014661
4454
REACTOME_CYCLIN_A_B1_AS
SOCIATED_EVENTS_DURING_
G2_M_TRANSITION
REACTOME_FORMATION_OF_
TUBULIN_FOLDING_INTERME
DIATES_BY_CCT_TRIC
REACTOME_TRANSLATION
REACTOME_DOWNREGULATI
ON_OF_SMAD2_3_SMAD4_TR
ANSCRIPTIONAL_ACTIVITY
REACTOME_DEPOSITION_OF_
NEW_CENPA_CONTAINING_N
UCLEOSOMES_AT_THE_CENT
ROMERE
KEGG_MISMATCH_REPAIR
20
1,83010
0,014453
3732
PID_MYC_ACTIVPATHWAY
67
1,82995
0,016224
2917
REACTOME_APC_C_CDH1_ME
DIATED_DEGRADATION_OF_C
DC20_AND_OTHER_APC_C_CD
H1_TARGETED_PROTEINS_IN_
LATE_MITOSIS_EARLY_G1
61
1,81851
0,016661
3018
REACTOME_MEIOTIC_RECOM
BINATION
38
1,81466
0,016741
3553
REACTOME_TELOMERE_MAI
NTENANCE
47
1,81272
0,017098
3553
REACTOME_S_PHASE
105
1,80983
0,017798
3117
REACTOME_PREFOLDIN_MED
IATED_TRANSFER_OF_SUBST
RATE_TO_CCT_TRIC
24
1,80463
0,018346
827
PID_BARD1PATHWAY
24
1,80018
0,018904
2872
REACTOME_ANTIVIRAL_MEC
HANISM_BY_IFN_STIMULATE
D_GENES
59
1,79578
0,021172
2073
KEGG_HOMOLOGOUS_RECOM
BINATION
24
1,78427
0,023807
2575
PID_AURORA_B_PATHWAY
32
1,77103
0,025899
3148
signal=103%
tags=41%,
list=21%,
signal=52%
tags=61%,
list=29%,
signal=86%
tags=79%,
list=28%,
signal=109%
tags=32%, list=6%,
signal=34%
tags=53%,
list=30%,
signal=75%
tags=50%,
list=12%,
signal=57%
tags=70%,
list=34%,
signal=106%
tags=60%,
list=29%,
signal=84%
tags=48%,
list=22%,
signal=61%
tags=48%,
list=23%,
signal=62%
tags=58%,
list=27%,
signal=79%
tags=57%,
list=27%,
signal=79%
tags=48%,
list=24%,
signal=62%
tags=29%, list=6%,
signal=31%
tags=54%,
list=22%,
signal=69%
tags=39%,
list=16%,
signal=46%
tags=50%,
list=20%,
signal=62%
tags=59%,
157
list=24%,
signal=78%
tags=48%,
list=24%,
signal=63%
tags=37%,
list=17%,
signal=43%
tags=44%,
list=12%,
signal=50%
tags=40%,
list=14%,
signal=47%
tags=67%,
list=27%,
signal=92%
tags=46%,
list=24%,
signal=60%
tags=36%,
list=19%,
signal=44%
tags=55%,
list=32%,
signal=81%
REACTOME_ASSEMBLY_OF_T
HE_PRE_REPLICATIVE_COMP
LEX
62
1,76168
0,026003
3117
KEGG_PARKINSONS_DISEASE
93
1,75968
0,026777
2148
REACTOME_DESTABILIZATIO
N_OF_MRNA_BY_KSRP
16
1,75542
0,030349
1556
PID_HDAC_CLASSII_PATHWA
Y
25
1,74189
0,034726
1873
REACTOME_PROCESSIVE_SY
NTHESIS_ON_THE_LAGGING_
STRAND
15
1,72645
0,035322
3553
REACTOME_REGULATION_OF
_MITOTIC_CELL_CYCLE
72
1,72347
0,037494
3145
KEGG_HUNTINGTONS_DISEAS
E
134
1,71616
0,038868
2525
REACTOME_GLUCONEOGENE
SIS
22
1,71113
0,039582
4216
77
1,70797
0,041011
3018
tags=44%,
list=23%,
signal=57%
10
1,70297
0,040630
3048
tags=70%,
list=23%,
signal=91%
REACTOME_PURINE_METABO
LISM
26
1,70265
0,046570
1988
KEGG_OXIDATIVE_PHOSPHO
RYLATION
98
1,68609
0,048872
2148
REACTOME_REGULATION_OF
_MRNA_STABILITY_BY_PROT
EINS_THAT_BIND_AU_RICH_E
LEMENTS
REACTOME_SLBP_DEPENDEN
T_PROCESSING_OF_REPLICAT
ION_DEPENDENT_HISTONE_P
RE_MRNAS
tags=38%,
list=15%,
signal=45%
tags=32%,
list=17%,
signal=38%
Результаты GSEA для генов с пониженной экспрессией, база данных
канонических сигнальных путей
NAME
SIZ
E
NES
FDR q-val
RANK
AT
MAX
REACTOME_EXTRACELLUL
AR_MATRIX_ORGANIZATIO
N
43
-2,35227
0,000000
1755
PID_INTEGRIN1_PATHWAY
49
-2,24158
0,000826
1776
REACTOME_COLLAGEN_FO
35
-2,20055
0,001588
1615
LEADING EDGE
tags=56%,
list=14%,
signal=64%
tags=41%,
list=14%,
signal=47%
tags=54%,
158
RMATION
PID_INTEGRIN3_PATHWAY
29
-2,18559
0,001670
1658
PID_SYNDECAN_1_PATHW
AY
33
-2,14886
0,002799
1658
REACTOME_RESPONSE_TO
_ELEVATED_PLATELET_CY
TOSOLIC_CA2_
55
-2,12259
0,003679
1473
PID_ANGIOPOIETINRECEPT
OR_PATHWAY
39
-2,10339
0,004536
1259
KEGG_COMPLEMENT_AND
_COAGULATION_CASCADE
S
26
-2,10310
0,004028
3519
KEGG_FOCAL_ADHESION
136
-2,08295
0,005013
1646
KEGG_LEISHMANIA_INFEC
TION
42
-2,07354
0,005485
949
KEGG_LYSOSOME
97
-2,07179
0,005266
2939
20
-2,07099
0,004906
911
26
-2,06154
0,005293
911
KEGG_ECM_RECEPTOR_INT
ERACTION
54
-2,05008
0,005791
1776
KEGG_CELL_ADHESION_M
OLECULES_CAMS
58
-2,03634
0,006548
1658
REACTOME_IRON_UPTAKE
_AND_TRANSPORT
27
-2,02880
0,007060
2992
PID_IL4_2PATHWAY
39
-2,01347
0,008278
2678
REACTOME_GLYCOSAMIN
OGLYCAN_METABOLISM
69
-1,99976
0,009413
3373
BIOCARTA_CDMAC_PATH
WAY
11
-1,99614
0,009356
315
KEGG_ARACHIDONIC_ACID
_METABOLISM
21
-1,97615
0,012182
2131
KEGG_SPHINGOLIPID_MET
ABOLISM
26
-1,97268
0,012294
1576
PID_FRA_PATHWAY
30
-1,97065
0,011995
1300
PID_LYMPHANGIOGENESIS
_PATHWAY
PID_SYNDECAN_4_PATHW
AY
list=12%,
signal=62%
tags=45%,
list=13%,
signal=51%
tags=48%,
list=13%,
signal=55%
tags=36%,
list=11%,
signal=41%
tags=36%,
list=10%,
signal=40%
tags=88%,
list=27%,
signal=121%
tags=31%,
list=13%,
signal=35%
tags=29%, list=7%,
signal=31%
tags=55%,
list=23%,
signal=70%
tags=45%, list=7%,
signal=48%
tags=38%, list=7%,
signal=41%
tags=41%,
list=14%,
signal=47%
tags=38%,
list=13%,
signal=43%
tags=59%,
list=23%,
signal=77%
tags=46%,
list=21%,
signal=58%
tags=55%,
list=26%,
signal=74%
tags=27%, list=2%,
signal=28%
tags=52%,
list=16%,
signal=63%
tags=38%,
list=12%,
signal=44%
tags=33%,
list=10%,
signal=37%
159
REACTOME_PLATELET_AC
TIVATION_SIGNALING_AN
D_AGGREGATION
125
-1,94853
0,015917
1740
BIOCARTA_BIOPEPTIDES_P
ATHWAY
31
-1,93905
0,017403
1340
15
-1,93586
0,017361
1071
24
-1,93300
0,017375
2327
44
-1,90333
0,023990
1961
KEGG_GRAFT_VERSUS_HO
ST_DISEASE
18
-1,89402
0,025722
1459
KEGG_CYTOKINE_CYTOKI
NE_RECEPTOR_INTERACTI
ON
99
-1,89285
0,025296
3204
KEGG_ALLOGRAFT_REJEC
TION
19
-1,89272
0,024492
1459
-1,88925
0,024704
2953
-1,88323
0,025693
1776
-1,88261
0,025159
3394
REACTOME_CHONDROITIN
_SULFATE_BIOSYNTHESIS
KEGG_METABOLISM_OF_X
ENOBIOTICS_BY_CYTOCHR
OME_P450
REACTOME_ACTIVATION_
OF_CHAPERONE_GENES_B
Y_XBP1S
REACTOME_CHONDROITIN
_SULFATE_DERMATAN_SU 36
LFATE_METABOLISM
REACTOME_INTEGRIN_CEL
L_SURFACE_INTERACTION 49
S
REACTOME_POST_TRANSL
ATIONAL_PROTEIN_MODIFI 123
CATION
REACTOME_PEPTIDE_LIGA
ND_BINDING_RECEPTORS
48
-1,87423
0,026764
3110
KEGG_AUTOIMMUNE_THY
ROID_DISEASE
18
-1,87101
0,027060
1459
KEGG_INTESTINAL_IMMUN
E_NETWORK_FOR_IGA_PR
ODUCTION
23
-1,87037
0,026497
1459
BIOCARTA_INTEGRIN_PAT
HWAY
31
-1,86381
0,027942
1776
PID_ANTHRAXPATHWAY
12
-1,86274
0,027555
561
REACTOME_SIGNALING_B
Y_PDGF
93
-1,86062
0,027457
1570
14
-1,86023
0,026889
542
23
-1,84955
0,030000
1168
33
-1,84774
0,029926
1465
BIOCARTA_SPPA_PATHWA
Y
ST_ERK1_ERK2_MAPK_PAT
HWAY
KEGG_BLADDER_CANCER
tags=33%,
list=13%,
signal=38%
tags=32%,
list=10%,
signal=36%
tags=40%, list=8%,
signal=44%
tags=54%,
list=18%,
signal=66%
tags=39%,
list=15%,
signal=45%
tags=39%,
list=11%,
signal=44%
tags=44%,
list=25%,
signal=59%
tags=37%,
list=11%,
signal=41%
tags=53%,
list=23%,
signal=68%
tags=35%,
list=14%,
signal=40%
tags=46%,
list=26%,
signal=62%
tags=48%,
list=24%,
signal=63%
tags=39%,
list=11%,
signal=44%
tags=35%,
list=11%,
signal=39%
tags=42%,
list=14%,
signal=48%
tags=42%, list=4%,
signal=44%
tags=26%,
list=12%,
signal=29%
tags=29%, list=4%,
signal=30%
tags=30%, list=9%,
signal=33%
tags=30%,
list=11%,
160
PID_INTEGRIN2_PATHWAY
13
-1,84426
0,030566
1398
REACTOME_CLASS_A1_RH
ODOPSIN_LIKE_RECEPTOR
S
75
-1,83741
0,032338
3110
PID_INTEGRIN_A9B1_PATH
WAY
18
-1,83183
0,033841
1637
31
-1,82150
0,037109
2355
44
-1,81152
0,040670
1265
14
-1,80954
0,040687
2710
REACTOME_COMPLEMENT
_CASCADE
11
-1,80215
0,043018
3519
KEGG_JAK_STAT_SIGNALI
NG_PATHWAY
70
-1,79880
0,043520
2078
PID_PRLSIGNALINGEVENTS
PATHWAY
20
-1,79708
0,043453
923
BIOCARTA_ECM_PATHWA
Y
19
-1,79239
0,044844
3800
REACTOME_N_GLYCAN_TR
IMMING_IN_THE_ER_AND_
CALNEXIN_CALRETICULIN
_CYCLE
12
-1,79078
0,044676
3117
PID_AVB3_INTEGRIN_PATH
WAY
58
-1,78730
0,045392
1658
REACTOME_SPHINGOLIPID
_METABOLISM
44
-1,78508
0,045562
1576
11
-1,78271
0,045918
1354
14
-1,77660
0,048000
907
REACTOME_CALNEXIN_CA
LRETICULIN_CYCLE
10
-1,77327
0,048834
3117
REACTOME_TRANSFERRIN
_ENDOCYTOSIS_AND_REC
YCLING
20
-1,76933
0,050060
3311
KEGG_PEROXISOME
55
-1,76786
0,049993
2984
REACTOME_HEPARAN_SUL
FATE_HEPARIN_HS_GAG_M
ETABOLISM
REACTOME_NCAM_SIGNAL
ING_FOR_NEURITE_OUT_G
ROWTH
REACTOME_CHEMOKINE_R
ECEPTORS_BIND_CHEMOKI
NES
REACTOME_SEMA3A_PLEX
IN_REPULSION_SIGNALING
_BY_INHIBITING_INTEGRIN
_ADHESION
BIOCARTA_SPRY_PATHWA
Y
signal=34%
tags=54%,
list=11%,
signal=60%
tags=48%,
list=24%,
signal=63%
tags=50%,
list=13%,
signal=57%
tags=45%,
list=18%,
signal=55%
tags=27%,
list=10%,
signal=30%
tags=57%,
list=21%,
signal=72%
tags=100%,
list=27%,
signal=137%
tags=30%,
list=16%,
signal=36%
tags=35%, list=7%,
signal=38%
tags=68%,
list=29%,
signal=97%
tags=75%,
list=24%,
signal=99%
tags=33%,
list=13%,
signal=37%
tags=36%,
list=12%,
signal=41%
tags=55%,
list=10%,
signal=61%
tags=36%, list=7%,
signal=38%
tags=80%,
list=24%,
signal=105%
tags=60%,
list=26%,
signal=80%
tags=44%,
list=23%,
signal=56%
161
Результаты GSEA для генов с пониженной экспрессией, база данных
химических и генетических пертурбаций
NAME
SIZE
NES
FDR q-val
RANK
AT
MAX
BOQUEST_STEM_CELL_UP
211
-3,16404
0
2319
REN_ALVEOLAR_RHABDOMYOS
ARCOMA_DN
385
-3,02865
0
2308
SCHUETZ_BREAST_CANCER_DU
CTAL_INVASIVE_UP
264
-2,96692
0
2577
PICCALUGA_ANGIOIMMUNOBLA
STIC_LYMPHOMA_UP
157
-2,8901
0
2413
ANASTASSIOU_CANCER_MESEN
CHYMAL_TRANSITION_SIGNATU
RE
54
-2,87339
0
911
BERENJENO_TRANSFORMED_BY
_RHOA_DN
329
-2,70924
0
2508
WONG_ENDMETRIUM_CANCER_
DN
57
-2,67132
0
2075
BROWNE_HCMV_INFECTION_18
HR_DN
132
-2,64763
0
2469
ONDER_CDH1_TARGETS_2_UP
213
-2,62832
0
1837
RODWELL_AGING_KIDNEY_NO_
BLOOD_UP
156
-2,61713
0
2276
KINSEY_TARGETS_OF_EWSR1_F
LII_FUSION_DN
254
-2,58783
0
2132
SERVITJA_ISLET_HNF1A_TARGE
TS_UP
103
-2,57079
0
2827
FARMER_BREAST_CANCER_CLU
STER_5
17
-2,56464
0
657
NAKAYAMA_SOFT_TISSUE_TUM
ORS_PCA1_UP
44
-2,56092
0
1464
BERTUCCI_MEDULLARY_VS_DU
CTAL_BREAST_CANCER_DN
123
-2,55709
0
1589
ZHU_CMV_24_HR_DN
77
-2,55393
0
1841
LIM_MAMMARY_STEM_CELL_U
343
-2,54092
0
2204
LEADING
EDGE
tags=63%,
list=18%,
signal=75%
tags=50%,
list=18%,
signal=59%
tags=58%,
list=20%,
signal=71%
tags=55%,
list=19%,
signal=66%
tags=59%,
list=7%,
signal=63%
tags=49%,
list=19%,
signal=59%
tags=67%,
list=16%,
signal=79%
tags=55%,
list=19%,
signal=68%
tags=43%,
list=14%,
signal=49%
tags=50%,
list=18%,
signal=60%
tags=43%,
list=16%,
signal=51%
tags=58%,
list=22%,
signal=74%
tags=82%,
list=5%,
signal=87%
tags=50%,
list=11%,
signal=56%
tags=46%,
list=12%,
signal=51%
tags=53%,
list=14%,
signal=62%
tags=43%,
162
P
RIGGI_EWING_SARCOMA_PROG
ENITOR_DN
152
-2,53284
0
2018
KIM_GLIS2_TARGETS_UP
63
-2,52506
0
2075
LIU_PROSTATE_CANCER_DN
325
-2,51544
0
2076
CHANG_CORE_SERUM_RESPONS
E_DN
168
-2,50631
0
3121
LANDIS_BREAST_CANCER_PROG
RESSION_DN
59
-2,48965
0
2132
LINDVALL_IMMORTALIZED_BY_
TERT_DN
65
-2,48876
0
2843
TURASHVILI_BREAST_LOBULAR
_CARCINOMA_VS_DUCTAL_NOR
MAL_UP
47
-2,46377
0
1414
CLASPER_LYMPHATIC_VESSELS
_DURING_METASTASIS_DN
34
-2,4535
0
1823
LIM_MAMMARY_LUMINAL_MAT
URE_DN
75
-2,45193
0
914
CAIRO_HEPATOBLASTOMA_CLA
SSES_DN
135
-2,44682
0
2278
DURAND_STROMA_MAX_UP
183
-2,42402
0
2234
CHANDRAN_METASTASIS_DN
202
-2,41509
0
3046
JECHLINGER_EPITHELIAL_TO_M
ESENCHYMAL_TRANSITION_UP
56
-2,39883
0
2814
DANG_REGULATED_BY_MYC_D
N
193
-2,39724
0
1650
SABATES_COLORECTAL_ADENO
MA_DN
98
-2,39376
0
2344
IGLESIAS_E2F_TARGETS_UP
123
-2,39028
0
2413
GAUSSMANN_MLL_AF4_FUSION
_TARGETS_F_UP
131
-2,38746
0
2385
ZHU_CMV_ALL_DN
107
-2,38274
0
1841
list=17%,
signal=50%
tags=48%,
list=16%,
signal=56%
tags=52%,
list=16%,
signal=62%
tags=40%,
list=16%,
signal=46%
tags=58%,
list=24%,
signal=76%
tags=51%,
list=16%,
signal=61%
tags=65%,
list=22%,
signal=82%
tags=45%,
list=11%,
signal=50%
tags=65%,
list=14%,
signal=75%
tags=41%,
list=7%,
signal=44%
tags=44%,
list=18%,
signal=52%
tags=44%,
list=17%,
signal=53%
tags=50%,
list=23%,
signal=64%
tags=64%,
list=22%,
signal=82%
tags=36%,
list=13%,
signal=40%
tags=53%,
list=18%,
signal=64%
tags=44%,
list=19%,
signal=53%
tags=43%,
list=18%,
signal=52%
tags=46%,
list=14%,
signal=53%
163
CHIARADONNA_NEOPLASTIC_T
RANSFORMATION_KRAS_DN
119
-2,37807
0
2521
WONG_ADULT_TISSUE_STEM_M
ODULE
468
-2,37731
0
2460
BAELDE_DIABETIC_NEPHROPAT
HY_UP
52
-2,37112
0
1840
RODWELL_AGING_KIDNEY_UP
328
-2,36549
0
2851
MIYAGAWA_TARGETS_OF_EWS
R1_ETS_FUSIONS_DN
178
-2,34082
6,54E-06
2534
TURASHVILI_BREAST_DUCTAL_
CARCINOMA_VS_DUCTAL_NOR
MAL_UP
33
-2,33479
6,38E-06
911
MIKKELSEN_MEF_LCP_WITH_H3
K4ME3
77
-2,32819
6,23E-06
2505
FUJII_YBX1_TARGETS_UP
26
-2,32687
6,09E-06
1056
WANG_SMARCE1_TARGETS_UP
200
-2,31663
5,95E-06
1723
SIMBULAN_PARP1_TARGETS_UP
27
-2,30703
1,72E-05
2847
BROWNE_HCMV_INFECTION_48
HR_DN
337
-2,29965
1,68E-05
2843
HOSHIDA_LIVER_CANCER_SUBC
LASS_S1
190
-2,29741
1,64E-05
2869
YAO_TEMPORAL_RESPONSE_TO
_PROGESTERONE_CLUSTER_16
59
-2,29727
1,61E-05
1222
SWEET_LUNG_CANCER_KRAS_D
N
274
-2,29524
1,58E-05
2075
LEE_BMP2_TARGETS_UP
488
-2,2882
2,06E-05
2948
NEWMAN_ERCC6_TARGETS_DN
27
-2,28796
2,02E-05
3075
ZHANG_TLX_TARGETS_60HR_UP
230
-2,28607
1,98E-05
2828
JOHNSTONE_PARVB_TARGETS_3
_UP
348
-2,2852
2,43E-05
2312
HORIUCHI_WTAP_TARGETS_UP
220
-2,28148
3,33E-05
2630
tags=49%,
list=19%,
signal=60%
tags=38%,
list=19%,
signal=45%
tags=44%,
list=14%,
signal=51%
tags=47%,
list=22%,
signal=58%
tags=49%,
list=20%,
signal=60%
tags=39%,
list=7%,
signal=42%
tags=53%,
list=19%,
signal=66%
tags=50%,
list=8%,
signal=54%
tags=34%,
list=13%,
signal=39%
tags=78%,
list=22%,
signal=99%
tags=45%,
list=22%,
signal=56%
tags=49%,
list=22%,
signal=63%
tags=41%,
list=9%,
signal=45%
tags=38%,
list=16%,
signal=45%
tags=45%,
list=23%,
signal=56%
tags=85%,
list=24%,
signal=111%
tags=47%,
list=22%,
signal=58%
tags=37%,
list=18%,
signal=44%
tags=42%,
list=20%,
164
WEST_ADRENOCORTICAL_TUM
OR_DN
381
-2,27974
3,73E-05
2100
BROWN_MYELOID_CELL_DEVEL
OPMENT_UP
95
-2,27894
3,67E-05
3277
RUIZ_TNC_TARGETS_UP
129
-2,27531
3,6E-05
2996
CHICAS_RB1_TARGETS_CONFLU
ENT
454
-2,27274
3,54E-05
2132
FRIDMAN_IMMORTALIZATION_
DN
30
-2,27005
4,78E-05
1942
KAAB_HEART_ATRIUM_VS_VEN
TRICLE_UP
181
-2,26954
4,7E-05
2533
KOBAYASHI_EGFR_SIGNALING_
24HR_UP
71
-2,26343
5,04E-05
3434
SENESE_HDAC1_AND_HDAC2_T
ARGETS_DN
157
-2,25447
5,38E-05
2431
YAN_ESCAPE_FROM_ANOIKIS
15
-2,2397
6,1E-05
999
KERLEY_RESPONSE_TO_CISPLA
TIN_UP
32
-2,23778
6,01E-05
1511
LINDGREN_BLADDER_CANCER_
CLUSTER_2B
285
-2,23695
5,92E-05
1890
TURASHVILI_BREAST_LOBULAR
_CARCINOMA_VS_LOBULAR_NO
RMAL_DN
59
-2,2316
6,21E-05
1260
STEGER_ADIPOGENESIS_DN
21
-2,22986
6,89E-05
2353
DEMAGALHAES_AGING_UP
36
-2,22826
6,79E-05
1978
VECCHI_GASTRIC_CANCER_ADV
ANCED_VS_EARLY_UP
123
-2,22579
6,69E-05
3615
MIKKELSEN_ES_ICP_WITH_H3K4
ME3_AND_H3K27ME3
38
-2,2216
6,97E-05
2807
BURTON_ADIPOGENESIS_9
73
-2,21047
9,05E-05
2319
BEIER_GLIOMA_STEM_CELL_DN
51
-2,2
0,000121
1571
TSENG_IRS1_TARGETS_DN
94
-2,19573
0,000137
1876
signal=52%
tags=34%,
list=16%,
signal=40%
tags=59%,
list=25%,
signal=78%
tags=53%,
list=23%,
signal=68%
tags=37%,
list=16%,
signal=43%
tags=57%,
list=15%,
signal=66%
tags=46%,
list=20%,
signal=57%
tags=68%,
list=26%,
signal=91%
tags=46%,
list=19%,
signal=57%
tags=47%,
list=8%,
signal=51%
tags=47%,
list=12%,
signal=53%
tags=34%,
list=15%,
signal=39%
tags=34%,
list=10%,
signal=37%
tags=71%,
list=18%,
signal=87%
tags=47%,
list=15%,
signal=56%
tags=63%,
list=28%,
signal=86%
tags=66%,
list=22%,
signal=84%
tags=47%,
list=18%,
signal=56%
tags=41%,
list=12%,
signal=47%
tags=38%,
165
NAKAMURA_ADIPOGENESIS_EA
RLY_DN
31
-2,19573
0,000135
1986
RUTELLA_RESPONSE_TO_HGF_V
S_CSF2RB_AND_IL4_UP
297
-2,19386
0,000134
3279
LI_INDUCED_T_TO_NATURAL_KI
LLER_UP
206
-2,19312
0,000132
2661
DAVICIONI_TARGETS_OF_PAX_F
OXO1_FUSIONS_UP
188
-2,18258
0,00017
2249
GAUSSMANN_MLL_AF4_FUSION
_TARGETS_E_UP
58
-2,17968
0,000174
2898
HUANG_FOXA2_TARGETS_DN
27
-2,17773
0,000182
2577
NIELSEN_MALIGNAT_FIBROUS_
HISTIOCYTOMA_UP
16
-2,17694
0,00018
1538
LIU_SMARCA4_TARGETS
37
-2,17271
0,000184
2891
PETRETTO_CARDIAC_HYPERTR
OPHY
28
-2,17259
0,000182
1441
BROWNE_HCMV_INFECTION_24
HR_DN
124
-2,17198
0,000183
3106
WU_SILENCED_BY_METHYLATI
ON_IN_BLADDER_CANCER
28
-2,17103
0,000187
2046
LEE_NEURAL_CREST_STEM_CEL
L_UP
94
-2,17055
0,000184
1483
CROONQUIST_STROMAL_STIMU
LATION_UP
49
-2,16819
0,000185
2218
HOELZEL_NF1_TARGETS_DN
59
-2,16781
0,000186
1589
COWLING_MYCN_TARGETS
33
-2,16581
0,00019
2618
FEVR_CTNNB1_TARGETS_UP
400
-2,16369
0,000208
3034
YAMASHITA_METHYLATED_IN_
PROSTATE_CANCER
24
-2,16336
0,000206
1935
URS_ADIPOCYTE_DIFFERENTIAT
ION_DN
25
-2,15624
0,000226
1171
list=14%,
signal=44%
tags=58%,
list=15%,
signal=68%
tags=47%,
list=25%,
signal=61%
tags=42%,
list=21%,
signal=52%
tags=39%,
list=17%,
signal=47%
tags=64%,
list=22%,
signal=82%
tags=70%,
list=20%,
signal=88%
tags=69%,
list=12%,
signal=78%
tags=65%,
list=22%,
signal=83%
tags=50%,
list=11%,
signal=56%
tags=50%,
list=24%,
signal=65%
tags=61%,
list=16%,
signal=72%
tags=36%,
list=11%,
signal=41%
tags=51%,
list=17%,
signal=61%
tags=37%,
list=12%,
signal=42%
tags=67%,
list=20%,
signal=83%
tags=44%,
list=23%,
signal=56%
tags=58%,
list=15%,
signal=68%
tags=44%,
list=9%,
signal=48%
166
FRIDMAN_SENESCENCE_UP
68
-2,15093
0,000246
1959
BOQUEST_STEM_CELL_CULTUR
ED_VS_FRESH_UP
311
-2,14904
0,000246
2771
SMID_BREAST_CANCER_NORMA
L_LIKE_UP
222
-2,14547
0,000258
2727
VERHAAK_GLIOBLASTOMA_NE
URAL
149
-2,1415
0,000277
2909
RICKMAN_TUMOR_DIFFERENTI
ATED_WELL_VS_POORLY_DN
257
-2,13732
0,000301
2651
NADERI_BREAST_CANCER_PRO
GNOSIS_DN
12
-2,13558
0,000303
956
SARRIO_EPITHELIAL_MESENCH
YMAL_TRANSITION_DN
103
-2,1332
0,00032
1665
WANG_BARRETTS_ESOPHAGUS_
AND_ESOPHAGUS_CANCER_DN
18
-2,13277
0,000317
587
ZHANG_TLX_TARGETS_DN
86
-2,13017
0,000319
2821
JI_CARCINOGENESIS_BY_KRAS_
AND_STK11_DN
13
-2,1294
0,000324
911
GERHOLD_ADIPOGENESIS_DN
55
-2,12638
0,000338
2364
LIU_VAV3_PROSTATE_CARCINO
GENESIS_UP
54
-2,12467
0,000345
1965
MOLENAAR_TARGETS_OF_CCND
1_AND_CDK4_UP
43
-2,12007
0,000374
2010
PODAR_RESPONSE_TO_ADAPHO
STIN_UP
106
-2,11194
0,000436
2321
CHIANG_LIVER_CANCER_SUBCL
ASS_CTNNB1_DN
99
-2,10817
0,000471
1464
ZHENG_GLIOBLASTOMA_PLASTI
CITY_DN
44
-2,10812
0,000467
2195
TARTE_PLASMA_CELL_VS_PLAS
MABLAST_UP
206
-2,10676
0,000474
2814
RODRIGUES_THYROID_CARCINO
MA_ANAPLASTIC_DN
369
-2,10662
0,000472
3034
WAMUNYOKOLI_OVARIAN_CAN
CER_GRADES_1_2_DN
53
-2,10616
0,000475
3582
tags=53%,
list=15%,
signal=62%
tags=44%,
list=21%,
signal=55%
tags=43%,
list=21%,
signal=54%
tags=48%,
list=22%,
signal=62%
tags=40%,
list=20%,
signal=50%
tags=58%,
list=7%,
signal=63%
tags=32%,
list=13%,
signal=36%
tags=50%,
list=5%,
signal=52%
tags=50%,
list=22%,
signal=63%
tags=62%,
list=7%,
signal=66%
tags=55%,
list=18%,
signal=66%
tags=41%,
list=15%,
signal=48%
tags=40%,
list=15%,
signal=47%
tags=42%,
list=18%,
signal=50%
tags=28%,
list=11%,
signal=32%
tags=45%,
list=17%,
signal=55%
tags=41%,
list=22%,
signal=52%
tags=43%,
list=23%,
signal=55%
tags=66%,
list=28%,
167
TAKEDA_TARGETS_OF_NUP98_H
OXA9_FUSION_10D_DN
62
-2,10474
0,000482
1595
GERY_CEBP_TARGETS
93
-2,10471
0,000478
3429
BASSO_HAIRY_CELL_LEUKEMIA
_DN
62
-2,10012
0,000508
2061
MISSIAGLIA_REGULATED_BY_M
ETHYLATION_UP
96
-2,09977
0,000505
2660
PETROVA_ENDOTHELIUM_LYMP
HATIC_VS_BLOOD_DN
135
-2,09729
0,000519
1651
RUTELLA_RESPONSE_TO_HGF_U
P
310
-2,09608
0,000532
3407
HAN_JNK_SINGALING_UP
29
-2,09487
0,000541
2497
RICKMAN_METASTASIS_DN
183
-2,09248
0,000564
2121
SUNG_METASTASIS_STROMA_U
P
89
-2,09241
0,00056
2019
KANG_AR_TARGETS_DN
11
-2,08183
0,000656
542
KAYO_CALORIE_RESTRICTION_
MUSCLE_UP
70
-2,0779
0,000691
3115
CROMER_TUMORIGENESIS_UP
46
-2,07587
0,000721
1755
INGRAM_SHH_TARGETS_DN
41
-2,07153
0,000771
1795
VERRECCHIA_EARLY_RESPONSE
_TO_TGFB1
49
-2,07007
0,000788
1464
SANCHEZ_MDM2_TARGETS
14
-2,05994
0,000923
1300
SASAI_RESISTANCE_TO_NEOPLA
STIC_TRANSFROMATION
46
-2,05903
0,000947
2796
ROZANOV_MMP14_TARGETS_SU
BSET
30
-2,05824
0,000952
2413
WELCH_GATA1_TARGETS
14
-2,05744
0,000956
607
CHIARADONNA_NEOPLASTIC_T
37
-2,05602
0,000977
2525
signal=91%
tags=34%,
list=12%,
signal=38%
tags=54%,
list=26%,
signal=73%
tags=42%,
list=16%,
signal=50%
tags=46%,
list=20%,
signal=57%
tags=38%,
list=13%,
signal=43%
tags=48%,
list=26%,
signal=63%
tags=55%,
list=19%,
signal=68%
tags=31%,
list=16%,
signal=36%
tags=40%,
list=16%,
signal=48%
tags=55%,
list=4%,
signal=57%
tags=53%,
list=24%,
signal=69%
tags=37%,
list=14%,
signal=43%
tags=41%,
list=14%,
signal=48%
tags=43%,
list=11%,
signal=48%
tags=50%,
list=10%,
signal=56%
tags=57%,
list=22%,
signal=72%
tags=53%,
list=19%,
signal=65%
tags=36%,
list=5%,
signal=37%
tags=59%,
168
RANSFORMATION_KRAS_CDC25
_DN
MCCABE_HOXC6_TARGETS_CAN
CER_UP
16
-2,05584
0,000971
2655
VECCHI_GASTRIC_CANCER_EAR
LY_DN
157
-2,05533
0,000977
2468
RUTELLA_RESPONSE_TO_CSF2R
B_AND_IL4_DN
217
-2,05438
0,000984
3284
MARKEY_RB1_CHRONIC_LOF_D
N
71
-2,05099
0,001054
2690
LANDIS_ERBB2_BREAST_TUMOR
S_324_DN
124
-2,04709
0,001111
2132
WANG_CISPLATIN_RESPONSE_A
ND_XPC_DN
183
-2,04703
0,001105
2502
KANNAN_TP53_TARGETS_UP
46
-2,04557
0,001123
2278
DELPUECH_FOXO3_TARGETS_UP
49
-2,04478
0,001128
1058
MANALO_HYPOXIA_UP
152
-2,04402
0,001127
2009
THUM_MIR21_TARGETS_HEART_
DISEASE_UP
15
-2,04231
0,001153
2240
MISHRA_CARCINOMA_ASSOCIA
TED_FIBROBLAST_UP
15
-2,04181
0,001152
963
GNATENKO_PLATELET_SIGNAT
URE
38
-2,04023
0,001171
999
SENGUPTA_NASOPHARYNGEAL_
CARCINOMA_WITH_LMP1_DN
56
-2,03961
0,00117
3249
UZONYI_RESPONSE_TO_LEUKOT
RIENE_AND_THROMBIN
28
-2,03919
0,001164
2736
KEEN_RESPONSE_TO_ROSIGLIT
AZONE_DN
79
-2,03884
0,001163
2075
ONDER_CDH1_SIGNALING_VIA_
CTNNB1
66
-2,03818
0,001162
2277
ROY_WOUND_BLOOD_VESSEL_
UP
42
-2,02827
0,0014
3812
GUENTHER_GROWTH_SPHERICA
L_VS_ADHERENT_DN
25
-2,02544
0,001461
3276
list=19%,
signal=74%
tags=75%,
list=20%,
signal=94%
tags=39%,
list=19%,
signal=48%
tags=47%,
list=25%,
signal=61%
tags=45%,
list=21%,
signal=57%
tags=38%,
list=16%,
signal=45%
tags=38%,
list=19%,
signal=46%
tags=43%,
list=18%,
signal=53%
tags=29%,
list=8%,
signal=31%
tags=38%,
list=15%,
signal=44%
tags=73%,
list=17%,
signal=89%
tags=53%,
list=7%,
signal=58%
tags=34%,
list=8%,
signal=37%
tags=54%,
list=25%,
signal=71%
tags=64%,
list=21%,
signal=81%
tags=37%,
list=16%,
signal=43%
tags=47%,
list=18%,
signal=57%
tags=69%,
list=29%,
signal=97%
tags=76%,
list=25%,
signal=101%
169
ZHANG_TLX_TARGETS_36HR_UP
175
-2,02458
0,001468
2279
LANDIS_ERBB2_BREAST_TUMOR
S_65_DN
32
-2,02209
0,001529
2046
DAVICIONI_MOLECULAR_ARMS
_VS_ERMS_DN
147
-2,02166
0,001529
2898
ZHAN_V1_LATE_DIFFERENTIATI
ON_GENES_UP
27
-2,01943
0,00159
2955
HUPER_BREAST_BASAL_VS_LU
MINAL_UP
23
-2,01906
0,001588
2077
TONKS_TARGETS_OF_RUNX1_R
UNX1T1_FUSION_ERYTHROCYTE
_UP
114
-2,01858
0,001588
2097
SMID_BREAST_CANCER_LUMIN
AL_B_DN
276
-2,01497
0,001671
2457
BERENJENO_ROCK_SIGNALING_
NOT_VIA_RHOA_UP
21
-2,01155
0,001743
2090
MCDOWELL_ACUTE_LUNG_INJU
RY_UP
31
-2,00857
0,001816
2078
OLSSON_E2F3_TARGETS_UP
19
-2,00828
0,001813
2413
KOKKINAKIS_METHIONINE_DEP
RIVATION_96HR_UP
103
-2,00797
0,001808
1452
KONDO_EZH2_TARGETS
151
-2,00736
0,001805
2320
YAMAZAKI_TCEB3_TARGETS_U
P
127
-2,00657
0,001812
2768
WESTON_VEGFA_TARGETS
75
-2,00628
0,001806
1852
BROWNE_HCMV_INFECTION_20
HR_DN
85
-2,00561
0,001811
2125
YAO_TEMPORAL_RESPONSE_TO
_PROGESTERONE_CLUSTER_0
55
-2,00493
0,001823
2553
SENESE_HDAC2_TARGETS_DN
78
-2,00163
0,001909
1978
DELYS_THYROID_CANCER_UP
292
-2,0012
0,001904
3012
MIKKELSEN_IPS_ICP_WITH_H3K
4ME3_AND_H327ME3
37
-2,00102
0,001898
2807
tags=39%,
list=18%,
signal=47%
tags=56%,
list=16%,
signal=67%
tags=52%,
list=22%,
signal=66%
tags=59%,
list=23%,
signal=77%
tags=48%,
list=16%,
signal=57%
tags=36%,
list=16%,
signal=43%
tags=38%,
list=19%,
signal=45%
tags=57%,
list=16%,
signal=68%
tags=52%,
list=16%,
signal=61%
tags=58%,
list=19%,
signal=71%
tags=28%,
list=11%,
signal=31%
tags=37%,
list=18%,
signal=45%
tags=40%,
list=21%,
signal=51%
tags=32%,
list=14%,
signal=37%
tags=36%,
list=16%,
signal=43%
tags=55%,
list=20%,
signal=68%
tags=40%,
list=15%,
signal=47%
tags=44%,
list=23%,
signal=56%
tags=68%,
list=22%,
170
VERRECCHIA_RESPONSE_TO_TG
FB1_C2
20
-1,99903
0,001943
2130
BURTON_ADIPOGENESIS_PEAK_
AT_0HR
53
-1,99523
0,002038
3435
LINDGREN_BLADDER_CANCER_
CLUSTER_2A_DN
114
-1,99228
0,002113
2705
KRASNOSELSKAYA_ILF3_TARGE
TS_UP
33
-1,99172
0,002116
3358
YAO_HOXA10_TARGETS_VIA_PR
OGESTERONE_UP
50
-1,99051
0,00214
3078
SCHRAETS_MLL_TARGETS_UP
24
-1,98807
0,002208
2319
KOHOUTEK_CCNT1_TARGETS
32
-1,98587
0,002268
1065
BURTON_ADIPOGENESIS_8
76
-1,98261
0,00237
2097
JAATINEN_HEMATOPOIETIC_STE
M_CELL_DN
93
-1,98232
0,002366
2534
WESTON_VEGFA_TARGETS_6HR
42
-1,98137
0,002393
756
LEE_LIVER_CANCER_E2F1_UP
42
-1,9807
0,002404
1468
LIANG_SILENCED_BY_METHYLA
TION_2
34
-1,98044
0,002399
486
LU_AGING_BRAIN_UP
214
-1,97554
0,002565
2453
DORSEY_GAB2_TARGETS
21
-1,9712
0,002699
1464
ALONSO_METASTASIS_NEURAL
_UP
15
-1,9698
0,002752
1329
WILCOX_PRESPONSE_TO_ROGES
TERONE_DN
44
-1,96932
0,002761
1441
GRAESSMANN_RESPONSE_TO_M
C_AND_SERUM_DEPRIVATION_U
P
140
-1,9668
0,002864
2505
ZWANG_CLASS_2_TRANSIENTLY
_INDUCED_BY_EGF
30
-1,96651
0,002851
2736
TSAI_RESPONSE_TO_RADIATION
27
-1,96541
0,0029
1464
signal=86%
tags=65%,
list=16%,
signal=78%
tags=57%,
list=26%,
signal=77%
tags=39%,
list=21%,
signal=49%
tags=52%,
list=26%,
signal=69%
tags=56%,
list=24%,
signal=73%
tags=58%,
list=18%,
signal=71%
tags=34%,
list=8%,
signal=37%
tags=43%,
list=16%,
signal=51%
tags=42%,
list=20%,
signal=52%
tags=26%,
list=6%,
signal=28%
tags=36%,
list=11%,
signal=40%
tags=18%,
list=4%,
signal=18%
tags=34%,
list=19%,
signal=41%
tags=48%,
list=11%,
signal=54%
tags=47%,
list=10%,
signal=52%
tags=39%,
list=11%,
signal=43%
tags=33%,
list=19%,
signal=40%
tags=57%,
list=21%,
signal=72%
tags=33%,
171
_THERAPY
WINTER_HYPOXIA_DN
24
-1,96358
0,002959
3133
SUZUKI_RESPONSE_TO_TSA_AN
D_DECITABINE_1A
17
-1,96103
0,003051
1841
MARKEY_RB1_ACUTE_LOF_UP
143
-1,95609
0,003228
3364
WAMUNYOKOLI_OVARIAN_CAN
CER_LMP_DN
162
-1,9549
0,003268
3559
VART_KSHV_INFECTION_ANGIO
GENIC_MARKERS_UP
89
-1,95385
0,003295
3276
KANG_GIST_WITH_PDGFRA_UP
29
-1,9526
0,003333
1951
MASSARWEH_TAMOXIFEN_RESI
STANCE_UP
388
-1,95254
0,003318
2364
CHIARADONNA_NEOPLASTIC_T
RANSFORMATION_CDC25_DN
130
-1,95014
0,00341
2825
WEST_ADRENOCORTICAL_TUM
OR_MARKERS_DN
11
-1,94963
0,003419
1418
PEDRIOLI_MIR31_TARGETS_DN
207
-1,94803
0,003474
3633
NAKAMURA_ADIPOGENESIS_LA
TE_DN
31
-1,94784
0,003467
1986
PANGAS_TUMOR_SUPPRESSION_
BY_SMAD1_AND_SMAD5_UP
86
-1,94621
0,003513
1834
JOHANSSON_BRAIN_CANCER_E
ARLY_VS_LATE_DN
39
-1,94412
0,00358
763
GARCIA_TARGETS_OF_FLI1_AN
D_DAX1_UP
41
-1,9426
0,003629
3010
DASU_IL6_SIGNALING_UP
55
-1,94131
0,003667
2281
POTTI_TOPOTECAN_SENSITIVIT
Y
111
-1,94072
0,003683
1955
IZADPANAH_STEM_CELL_ADIPO
SE_VS_BONE_DN
79
-1,94007
0,003699
2727
NADLER_OBESITY_UP
50
-1,93976
0,003691
1468
list=11%,
signal=37%
tags=71%,
list=24%,
signal=93%
tags=59%,
list=14%,
signal=68%
tags=47%,
list=26%,
signal=63%
tags=54%,
list=27%,
signal=73%
tags=48%,
list=25%,
signal=64%
tags=41%,
list=15%,
signal=49%
tags=37%,
list=18%,
signal=44%
tags=46%,
list=22%,
signal=58%
tags=64%,
list=11%,
signal=71%
tags=46%,
list=28%,
signal=63%
tags=55%,
list=15%,
signal=65%
tags=38%,
list=14%,
signal=44%
tags=31%,
list=6%,
signal=33%
tags=61%,
list=23%,
signal=79%
tags=40%,
list=18%,
signal=48%
tags=37%,
list=15%,
signal=43%
tags=46%,
list=21%,
signal=57%
tags=38%,
list=11%,
signal=43%
172
TARTE_PLASMA_CELL_VS_B_LY
MPHOCYTE_UP
58
-1,93912
0,003703
3217
BEGUM_TARGETS_OF_PAX3_FO
XO1_FUSION_UP
38
-1,93845
0,003721
3228
CREIGHTON_ENDOCRINE_THER
APY_RESISTANCE_5
326
-1,93719
0,003757
2195
BOYAULT_LIVER_CANCER_SUB
CLASS_G3_DN
29
-1,93712
0,003742
2452
SWEET_KRAS_TARGETS_UP
71
-1,93706
0,003728
2431
SMIRNOV_RESPONSE_TO_IR_6H
R_UP
124
-1,93626
0,003745
2272
ODONNELL_TFRC_TARGETS_UP
209
-1,92788
0,0042
1951
CHARAFE_BREAST_CANCER_LU
MINAL_VS_MESENCHYMAL_DN
392
-1,92745
0,004202
2008
WINNEPENNINCKX_MELANOMA
_METASTASIS_DN
24
-1,92695
0,004208
2816
BIDUS_METASTASIS_DN
115
-1,92448
0,004322
3080
BURTON_ADIPOGENESIS_7
44
-1,92443
0,004306
2439
SOTIRIOU_BREAST_CANCER_GR
ADE_1_VS_3_DN
39
-1,92428
0,004294
2363
WANG_ESOPHAGUS_CANCER_V
S_NORMAL_UP
78
-1,9232
0,004329
1624
INGRAM_SHH_TARGETS_UP
85
-1,91222
0,005
2950
LIEN_BREAST_CARCINOMA_ME
TAPLASTIC
25
-1,91169
0,005018
1226
STEARMAN_TUMOR_FIELD_EFF
ECT_UP
19
-1,91054
0,005075
2586
HELLEBREKERS_SILENCED_DUR
ING_TUMOR_ANGIOGENESIS
61
-1,90608
0,00536
1689
GRUETZMANN_PANCREATIC_CA
NCER_UP
299
-1,90572
0,005364
1364
GRAHAM_CML_DIVIDING_VS_N
ORMAL_QUIESCENT_DN
58
-1,90572
0,00534
3516
tags=55%,
list=25%,
signal=73%
tags=55%,
list=25%,
signal=73%
tags=32%,
list=17%,
signal=38%
tags=52%,
list=19%,
signal=64%
tags=48%,
list=19%,
signal=59%
tags=32%,
list=18%,
signal=39%
tags=30%,
list=15%,
signal=35%
tags=30%,
list=15%,
signal=34%
tags=58%,
list=22%,
signal=74%
tags=49%,
list=24%,
signal=63%
tags=57%,
list=19%,
signal=70%
tags=46%,
list=18%,
signal=56%
tags=33%,
list=13%,
signal=38%
tags=46%,
list=23%,
signal=59%
tags=44%,
list=9%,
signal=48%
tags=58%,
list=20%,
signal=72%
tags=38%,
list=13%,
signal=43%
tags=25%,
list=11%,
signal=27%
tags=62%,
list=27%,
173
SCHAEFFER_PROSTATE_DEVELO
PMENT_48HR_DN
237
-1,90357
0,005454
1988
BROWNE_HCMV_INFECTION_16
HR_DN
70
-1,90125
0,005613
2683
PETROVA_PROX1_TARGETS_DN
53
-1,90085
0,005629
2381
FERREIRA_EWINGS_SARCOMA_
UNSTABLE_VS_STABLE_DN
67
-1,90058
0,00562
2660
NAKAYAMA_SOFT_TISSUE_TUM
ORS_PCA2_DN
38
-1,89997
0,005648
1631
VALK_AML_CLUSTER_5
18
-1,89961
0,005653
1963
HOWLIN_PUBERTAL_MAMMARY
_GLAND
43
-1,8996
0,005629
2479
ROSS_AML_WITH_PML_RARA_F
USION
52
-1,89676
0,00582
2598
GOZGIT_ESR1_TARGETS_DN
450
-1,89517
0,005908
3099
BERENJENO_TRANSFORMED_BY
_RHOA_REVERSIBLY_DN
23
-1,89448
0,005927
1637
ONGUSAHA_TP53_TARGETS
29
-1,89372
0,005958
1778
TAKADA_GASTRIC_CANCER_CO
PY_NUMBER_DN
17
-1,89302
0,005991
1568
BONOME_OVARIAN_CANCER_S
URVIVAL_SUBOPTIMAL_DEBUL
KING
355
-1,8929
0,005975
2462
CHARAFE_BREAST_CANCER_LU
MINAL_VS_BASAL_DN
355
-1,8902
0,006165
2287
HATADA_METHYLATED_IN_LUN
G_CANCER_UP
186
-1,89013
0,006143
3138
PLASARI_TGFB1_TARGETS_10HR
_DN
166
-1,8882
0,006271
3182
STOSSI_RESPONSE_TO_ESTRADI
OL
24
-1,8879
0,006267
2277
MCLACHLAN_DENTAL_CARIES_
DN
141
-1,8874
0,006292
3208
LIM_MAMMARY_LUMINAL_PRO
26
-1,88684
0,006315
2166
signal=85%
tags=33%,
list=15%,
signal=38%
tags=47%,
list=21%,
signal=59%
tags=55%,
list=18%,
signal=67%
tags=37%,
list=20%,
signal=47%
tags=39%,
list=13%,
signal=45%
tags=61%,
list=15%,
signal=72%
tags=47%,
list=19%,
signal=57%
tags=52%,
list=20%,
signal=65%
tags=42%,
list=24%,
signal=54%
tags=39%,
list=13%,
signal=45%
tags=45%,
list=14%,
signal=52%
tags=47%,
list=12%,
signal=53%
tags=32%,
list=19%,
signal=39%
tags=30%,
list=18%,
signal=36%
tags=47%,
list=24%,
signal=62%
tags=46%,
list=25%,
signal=60%
tags=46%,
list=18%,
signal=55%
tags=48%,
list=25%,
signal=62%
tags=46%,
174
GENITOR_UP
NAKAYAMA_FGF2_TARGETS
20
-1,88462
0,006451
1294
THUM_SYSTOLIC_HEART_FAILU
RE_UP
281
-1,8834
0,006522
1701
PAPASPYRIDONOS_UNSTABLE_
ATEROSCLEROTIC_PLAQUE_DN
31
-1,88266
0,006552
1019
GU_PDEF_TARGETS_UP
59
-1,88167
0,006618
2194
WESTON_VEGFA_TARGETS_12H
R
28
-1,88062
0,006687
1852
LINDSTEDT_DENDRITIC_CELL_
MATURATION_D
48
-1,88041
0,006681
3603
SMID_BREAST_CANCER_BASAL_
DN
385
-1,88008
0,006692
2836
AZARE_NEOPLASTIC_TRANSFOR
MATION_BY_STAT3_DN
90
-1,87942
0,006705
2264
NAKAMURA_ADIPOGENESIS_LA
TE_UP
80
-1,87938
0,006679
1627
JISON_SICKLE_CELL_DISEASE_U
P
137
-1,87522
0,006997
3436
BROWNE_HCMV_INFECTION_14
HR_DN
228
-1,87477
0,007004
2266
ZHENG_IL22_SIGNALING_UP
22
-1,87444
0,007012
1473
DAVICIONI_RHABDOMYOSARCO
MA_PAX_FOXO1_FUSION_UP
35
-1,87326
0,007095
1748
ZAMORA_NOS2_TARGETS_DN
70
-1,87201
0,007182
2227
SCHLINGEMANN_SKIN_CARCIN
OGENESIS_TPA_DN
17
-1,87192
0,007165
309
CROONQUIST_IL6_DEPRIVATION
_UP
12
-1,86834
0,007431
2756
ABBUD_LIF_SIGNALING_1_UP
29
-1,86719
0,007497
2778
NAKAMURA_ADIPOGENESIS_EA
RLY_UP
51
-1,86666
0,00752
1438
list=17%,
signal=55%
tags=40%,
list=10%,
signal=44%
tags=26%,
list=13%,
signal=30%
tags=35%,
list=8%,
signal=38%
tags=44%,
list=17%,
signal=53%
tags=39%,
list=14%,
signal=46%
tags=65%,
list=28%,
signal=89%
tags=40%,
list=22%,
signal=50%
tags=33%,
list=17%,
signal=40%
tags=28%,
list=13%,
signal=31%
tags=47%,
list=26%,
signal=64%
tags=32%,
list=17%,
signal=39%
tags=36%,
list=11%,
signal=41%
tags=43%,
list=13%,
signal=49%
tags=43%,
list=17%,
signal=51%
tags=29%,
list=2%,
signal=30%
tags=75%,
list=21%,
signal=95%
tags=48%,
list=21%,
signal=61%
tags=33%,
list=11%,
signal=37%
175
WOOD_EBV_EBNA1_TARGETS_D
N
39
-1,86563
0,007578
2082
WANG_BARRETTS_ESOPHAGUS_
UP
26
-1,86347
0,007754
2480
BONOME_OVARIAN_CANCER_P
OOR_SURVIVAL_UP
20
-1,86306
0,007772
2118
QI_PLASMACYTOMA_DN
79
-1,86211
0,007837
2125
GRANDVAUX_IFN_RESPONSE_N
OT_VIA_IRF3
13
-1,86114
0,007904
1194
MCGOWAN_RSP6_TARGETS_UP
12
-1,8611
0,007876
2127
MAHAJAN_RESPONSE_TO_IL1A_
DN
63
-1,85781
0,008114
761
CROMER_TUMORIGENESIS_DN
22
-1,85737
0,008127
1766
CLAUS_PGR_POSITIVE_MENINGI
OMA_DN
11
-1,85716
0,00811
2317
LEE_NEURAL_CREST_STEM_CEL
L_DN
68
-1,85582
0,008197
3339
LY_AGING_MIDDLE_UP
11
-1,85571
0,008176
2277
WINZEN_DEGRADED_VIA_KHSR
P
67
-1,85531
0,008189
4302
PASINI_SUZ12_TARGETS_DN
256
-1,85476
0,008208
2818
CHIBA_RESPONSE_TO_TSA_UP
39
-1,84616
0,009041
845
SCHAVOLT_TARGETS_OF_TP53_
AND_TP63
11
-1,84605
0,009025
873
TAVAZOIE_METASTASIS
44
-1,84514
0,009085
1705
LEIN_MEDULLA_MARKERS
49
-1,84361
0,009219
1140
LEE_LIVER_CANCER_MYC_E2F1
_UP
33
-1,84339
0,009205
1265
CONCANNON_APOPTOSIS_BY_E
POXOMICIN_UP
187
-1,843
0,009211
2118
tags=41%,
list=16%,
signal=49%
tags=54%,
list=19%,
signal=66%
tags=50%,
list=16%,
signal=60%
tags=35%,
list=16%,
signal=42%
tags=38%,
list=9%,
signal=42%
tags=58%,
list=16%,
signal=70%
tags=25%,
list=6%,
signal=27%
tags=50%,
list=14%,
signal=58%
tags=73%,
list=18%,
signal=88%
tags=56%,
list=26%,
signal=75%
tags=82%,
list=18%,
signal=99%
tags=66%,
list=33%,
signal=98%
tags=40%,
list=22%,
signal=50%
tags=31%,
list=7%,
signal=33%
tags=45%,
list=7%,
signal=49%
tags=34%,
list=13%,
signal=39%
tags=33%,
list=9%,
signal=36%
tags=33%,
list=10%,
signal=37%
tags=28%,
list=16%,
176
LINDGREN_BLADDER_CANCER_
HIGH_RECURRENCE
40
-1,84288
0,009194
1140
LI_WILMS_TUMOR_VS_FETAL_K
IDNEY_2_DN
37
-1,84124
0,009336
3150
LINDGREN_BLADDER_CANCER_
WITH_LOH_IN_CHR9Q
92
-1,83994
0,009424
2393
ROSS_AML_WITH_MLL_FUSIONS
57
-1,83993
0,009391
1389
SMID_BREAST_CANCER_LUMIN
AL_A_UP
44
-1,83936
0,009422
3367
SMITH_TERT_TARGETS_DN
73
-1,83914
0,009408
3239
GAVIN_FOXP3_TARGETS_CLUST
ER_P7
55
-1,83849
0,009439
2859
NIELSEN_LEIOMYOSARCOMA_C
NN1_DN
16
-1,83807
0,009436
2077
MCLACHLAN_DENTAL_CARIES_
UP
140
-1,83789
0,009426
3204
ZHOU_INFLAMMATORY_RESPO
NSE_FIMA_UP
245
-1,83614
0,009577
2375
MOROSETTI_FACIOSCAPULOHU
MERAL_MUSCULAR_DISTROPHY
_UP
20
-1,83543
0,009606
3759
ZHANG_ANTIVIRAL_RESPONSE_
TO_RIBAVIRIN_UP
23
-1,83441
0,009683
1342
MIKKELSEN_ES_ICP_WITH_H3K4
ME3
372
-1,83291
0,009812
2499
CHIARADONNA_NEOPLASTIC_T
RANSFORMATION_CDC25_UP
90
-1,83269
0,009801
2534
EBAUER_TARGETS_OF_PAX3_FO
XO1_FUSION_UP
107
-1,83188
0,009859
2080
STAMBOLSKY_TARGETS_OF_MU
TATED_TP53_DN
36
-1,82883
0,010149
2866
WU_CELL_MIGRATION
130
-1,82853
0,010149
2446
NIELSEN_GIST
62
-1,82664
0,010332
1728
SCHAEFFER_PROSTATE_DEVELO
120
-1,82629
0,010342
2265
signal=33%
tags=33%,
list=9%,
signal=36%
tags=59%,
list=24%,
signal=78%
tags=35%,
list=18%,
signal=42%
tags=33%,
list=11%,
signal=37%
tags=55%,
list=26%,
signal=73%
tags=49%,
list=25%,
signal=65%
tags=45%,
list=22%,
signal=58%
tags=63%,
list=16%,
signal=74%
tags=47%,
list=25%,
signal=62%
tags=31%,
list=18%,
signal=37%
tags=85%,
list=29%,
signal=119%
tags=39%,
list=10%,
signal=44%
tags=35%,
list=19%,
signal=42%
tags=38%,
list=20%,
signal=47%
tags=36%,
list=16%,
signal=42%
tags=36%,
list=22%,
signal=46%
tags=38%,
list=19%,
signal=47%
tags=37%,
list=13%,
signal=43%
tags=29%,
177
PMENT_6HR_UP
HELLER_SILENCED_BY_METHYL
ATION_UP
164
-1,8232
0,010675
3208
YAGUE_PRETUMOR_DRUG_RESI
STANCE_DN
11
-1,82228
0,010748
1651
KYNG_DNA_DAMAGE_DN
152
-1,82001
0,011006
2202
CERVERA_SDHB_TARGETS_1_UP
69
-1,81872
0,011136
1422
VALK_AML_CLUSTER_12
20
-1,81824
0,011147
1719
MURATA_VIRULENCE_OF_H_PIL
ORI
17
-1,81787
0,01115
1056
ABRAHAM_ALPC_VS_MULTIPLE
_MYELOMA_UP
23
-1,81781
0,011122
1441
ALONSO_METASTASIS_EMT_UP
32
-1,81079
0,011957
1687
KATSANOU_ELAVL1_TARGETS_
UP
98
-1,80964
0,012073
3168
APPEL_IMATINIB_RESPONSE
28
-1,80955
0,012043
3485
TRAYNOR_RETT_SYNDROM_UP
34
-1,80935
0,012038
2325
TSENG_ADIPOGENIC_POTENTIA
L_DN
34
-1,80689
0,012357
1853
CASTELLANO_NRAS_TARGETS_
UP
46
-1,80658
0,012374
3182
DELYS_THYROID_CANCER_DN
135
-1,80588
0,01242
1136
SMID_BREAST_CANCER_RELAPS
E_IN_LUNG_DN
14
-1,80333
0,012711
4168
HUMMERICH_SKIN_CANCER_PR
OGRESSION_UP
63
-1,80326
0,012682
2540
BACOLOD_RESISTANCE_TO_AL
KYLATING_AGENTS_UP
18
-1,80264
0,012714
960
MORI_EMU_MYC_LYMPHOMA_B
Y_ONSET_TIME_DN
13
-1,80215
0,012745
2932
list=17%,
signal=35%
tags=48%,
list=25%,
signal=63%
tags=64%,
list=13%,
signal=73%
tags=38%,
list=17%,
signal=45%
tags=26%,
list=11%,
signal=29%
tags=55%,
list=13%,
signal=63%
tags=41%,
list=8%,
signal=45%
tags=39%,
list=11%,
signal=44%
tags=44%,
list=13%,
signal=50%
tags=47%,
list=24%,
signal=62%
tags=61%,
list=27%,
signal=83%
tags=47%,
list=18%,
signal=57%
tags=38%,
list=14%,
signal=44%
tags=54%,
list=25%,
signal=72%
tags=22%,
list=9%,
signal=24%
tags=93%,
list=32%,
signal=137%
tags=44%,
list=20%,
signal=55%
tags=22%,
list=7%,
signal=24%
tags=62%,
list=23%,
signal=79%
178
WALLACE_PROSTATE_CANCER_
RACE_UP
149
-1,80178
0,012752
1951
FOSTER_TOLERANT_MACROPHA
GE_UP
92
-1,8008
0,012846
2725
HAN_SATB1_TARGETS_DN
336
-1,80013
0,012894
2558
LE_EGR2_TARGETS_DN
69
-1,79996
0,012884
2260
LINDVALL_IMMORTALIZED_BY_
TERT_UP
63
-1,79984
0,012855
2633
ACOSTA_PROLIFERATION_INDE
PENDENT_MYC_TARGETS_DN
72
-1,79884
0,012949
2919
NIELSEN_LIPOSARCOMA_UP
11
-1,79876
0,012918
3092
DELACROIX_RARG_BOUND_MEF
256
-1,79828
0,012944
2498
YU_MYC_TARGETS_DN
29
-1,79448
0,013458
1733
MAHADEVAN_RESPONSE_TO_M
P470_DN
18
-1,79304
0,013647
2946
RIGGINS_TAMOXIFEN_RESISTAN
CE_UP
37
-1,79226
0,013702
2319
WANG_NEOPLASTIC_TRANSFOR
MATION_BY_CCND1_MYC
13
-1,78948
0,014049
2768
JEON_SMAD6_TARGETS_UP
18
-1,7887
0,014117
2413
CHEN_LVAD_SUPPORT_OF_FAILI
NG_HEART_DN
25
-1,78801
0,01418
3302
BAELDE_DIABETIC_NEPHROPAT
HY_DN
351
-1,7872
0,01427
1863
CAIRO_LIVER_DEVELOPMENT_U
P
130
-1,78551
0,014494
2481
LEIN_CHOROID_PLEXUS_MARKE
RS
54
-1,7849
0,014549
1778
MIKKELSEN_NPC_ICP_WITH_H3
K4ME3
286
-1,78438
0,014578
2814
ZWANG_EGF_PERSISTENTLY_UP
23
-1,78284
0,014772
4352
tags=29%,
list=15%,
signal=34%
tags=38%,
list=21%,
signal=48%
tags=32%,
list=20%,
signal=39%
tags=36%,
list=17%,
signal=44%
tags=40%,
list=20%,
signal=50%
tags=47%,
list=22%,
signal=61%
tags=73%,
list=24%,
signal=95%
tags=34%,
list=19%,
signal=42%
tags=38%,
list=13%,
signal=44%
tags=44%,
list=23%,
signal=57%
tags=43%,
list=18%,
signal=53%
tags=54%,
list=21%,
signal=68%
tags=72%,
list=19%,
signal=89%
tags=52%,
list=25%,
signal=70%
tags=24%,
list=14%,
signal=27%
tags=35%,
list=19%,
signal=43%
tags=41%,
list=14%,
signal=47%
tags=39%,
list=22%,
signal=48%
tags=74%,
list=34%,
179
TSUNODA_CISPLATIN_RESISTAN
CE_DN
38
-1,78275
0,014746
1058
ALTEMEIER_RESPONSE_TO_LPS_
WITH_MECHANICAL_VENTILATI
ON
69
-1,78105
0,014959
3318
HESS_TARGETS_OF_HOXA9_AN
D_MEIS1_DN
43
-1,77858
0,015305
1978
HUTTMANN_B_CLL_POOR_SURV
IVAL_UP
184
-1,77834
0,0153
2100
CUI_TCF21_TARGETS_UP
30
-1,77804
0,01531
1342
NEMETH_INFLAMMATORY_RESP
ONSE_LPS_UP
71
-1,77757
0,015353
1206
WANG_MLL_TARGETS
178
-1,77757
0,015309
2583
MCBRYAN_PUBERTAL_TGFB1_T
ARGETS_UP
141
-1,77376
0,015875
1905
KUNINGER_IGF1_VS_PDGFB_TA
RGETS_DN
37
-1,77297
0,01596
2847
RORIE_TARGETS_OF_EWSR1_FLI
1_FUSION_UP
27
-1,77273
0,015965
999
CAVARD_LIVER_CANCER_MALI
GNANT_VS_BENIGN
21
-1,77191
0,016054
648
ROSS_LEUKEMIA_WITH_MLL_FU
SIONS
62
-1,77123
0,016113
2593
LEIN_PONS_MARKERS
53
-1,77081
0,016128
2849
WANG_RESPONSE_TO_GSK3_INH
IBITOR_SB216763_UP
225
-1,7701
0,01617
3095
SCHRAETS_MLL_TARGETS_DN
27
-1,76998
0,016147
1823
ONDER_CDH1_TARGETS_1_UP
103
-1,76926
0,016214
2957
HARRIS_BRAIN_CANCER_PROGE
NITORS
25
-1,76852
0,016299
1978
KHETCHOUMIAN_TRIM24_TARG
ETS_UP
33
-1,76816
0,016316
3150
MIKKELSEN_IPS_LCP_WITH_H3K
71
-1,76805
0,016291
1328
signal=111%
tags=29%,
list=8%,
signal=31%
tags=43%,
list=26%,
signal=58%
tags=40%,
list=15%,
signal=46%
tags=30%,
list=16%,
signal=35%
tags=40%,
list=10%,
signal=45%
tags=25%,
list=9%,
signal=28%
tags=40%,
list=20%,
signal=49%
tags=30%,
list=15%,
signal=35%
tags=54%,
list=22%,
signal=69%
tags=26%,
list=8%,
signal=28%
tags=29%,
list=5%,
signal=30%
tags=42%,
list=20%,
signal=52%
tags=47%,
list=22%,
signal=60%
tags=36%,
list=24%,
signal=47%
tags=44%,
list=14%,
signal=52%
tags=42%,
list=23%,
signal=54%
tags=48%,
list=15%,
signal=57%
tags=61%,
list=24%,
signal=80%
tags=24%,
180
4ME3
GHANDHI_BYSTANDER_IRRADI
ATION_UP
51
-1,76786
0,016288
3204
GAZDA_DIAMOND_BLACKFAN_
ANEMIA_PROGENITOR_UP
28
-1,76779
0,016252
1572
RIZKI_TUMOR_INVASIVENESS_2
D_UP
50
-1,76751
0,016249
1596
HOFFMANN_PRE_BI_TO_LARGE_
PRE_BII_LYMPHOCYTE_DN
55
-1,76712
0,016277
2317
GARGALOVIC_RESPONSE_TO_O
XIDIZED_PHOSPHOLIPIDS_TURQ
UOISE_UP
60
-1,76537
0,016509
1536
GAJATE_RESPONSE_TO_TRABEC
TEDIN_UP
53
-1,76428
0,016662
1770
GROSS_ELK3_TARGETS_UP
21
-1,76305
0,016832
2072
MOHANKUMAR_TLX1_TARGETS
_DN
87
-1,7624
0,016891
2078
BOYLAN_MULTIPLE_MYELOMA
_C_D_DN
126
-1,76226
0,016869
2218
NING_CHRONIC_OBSTRUCTIVE_
PULMONARY_DISEASE_DN
93
-1,76114
0,01703
3103
DAVICIONI_PAX_FOXO1_SIGNAT
URE_IN_ARMS_UP
34
-1,7587
0,017406
2199
ZHENG_RESPONSE_TO_ARSENIT
E_DN
13
-1,75794
0,017491
2100
SCHAEFFER_PROSTATE_DEVELO
PMENT_48HR_UP
264
-1,75754
0,017528
2361
WEST_ADRENOCORTICAL_CARC
INOMA_VS_ADENOMA_DN
16
-1,75739
0,017502
3106
VALK_AML_CLUSTER_9
25
-1,75736
0,017459
1398
ISSAEVA_MLL2_TARGETS
36
-1,75717
0,017454
870
SHEDDEN_LUNG_CANCER_GOO
D_SURVIVAL_A4
127
-1,75513
0,017779
2472
NUTT_GBM_VS_AO_GLIOMA_UP
38
-1,75341
0,018047
2374
list=10%,
signal=27%
tags=39%,
list=25%,
signal=52%
tags=32%,
list=12%,
signal=36%
tags=30%,
list=12%,
signal=34%
tags=36%,
list=18%,
signal=44%
tags=30%,
list=12%,
signal=34%
tags=38%,
list=14%,
signal=44%
tags=43%,
list=16%,
signal=51%
tags=37%,
list=16%,
signal=44%
tags=36%,
list=17%,
signal=43%
tags=49%,
list=24%,
signal=65%
tags=47%,
list=17%,
signal=57%
tags=54%,
list=16%,
signal=64%
tags=33%,
list=18%,
signal=39%
tags=69%,
list=24%,
signal=90%
tags=36%,
list=11%,
signal=40%
tags=31%,
list=7%,
signal=33%
tags=39%,
list=19%,
signal=48%
tags=50%,
list=18%,
signal=61%
181
DALESSIO_TSA_RESPONSE
13
-1,74981
0,018624
1864
SANSOM_APC_TARGETS_DN
194
-1,74964
0,018605
2836
HENDRICKS_SMARCA4_TARGET
S_UP
44
-1,74782
0,018889
2825
JIANG_AGING_HYPOTHALAMUS
_DN
34
-1,74621
0,019127
2715
STAEGE_EWING_FAMILY_TUMO
R
15
-1,74561
0,019185
2564
SHIN_B_CELL_LYMPHOMA_CLU
STER_2
17
-1,74537
0,01918
2983
BOWIE_RESPONSE_TO_EXTRACE
LLULAR_MATRIX
17
-1,74507
0,01919
2660
MASRI_RESISTANCE_TO_TAMOX
IFEN_AND_AROMATASE_INHIBI
TORS_DN
14
-1,74422
0,019316
910
COLIN_PILOCYTIC_ASTROCYTO
MA_VS_GLIOBLASTOMA_UP
22
-1,74419
0,01927
1555
ROZANOV_MMP14_TARGETS_UP
204
-1,74397
0,019266
2428
WIERENGA_STAT5A_TARGETS_
DN
128
-1,74376
0,019252
3416
FULCHER_INFLAMMATORY_RES
PONSE_LECTIN_VS_LPS_DN
325
-1,74351
0,019235
2929
POMEROY_MEDULLOBLASTOM
A_DESMOPLASIC_VS_CLASSIC_
DN
49
-1,7433
0,019226
951
GRAESSMANN_RESPONSE_TO_M
C_AND_DOXORUBICIN_UP
436
-1,74248
0,019342
2111
MANTOVANI_NFKB_TARGETS_U
P
25
-1,74231
0,019326
1954
WARTERS_RESPONSE_TO_IR_SKI
N
56
-1,74115
0,019504
2258
JOHNSTONE_PARVB_TARGETS_2
_UP
116
-1,74034
0,019617
1960
SAKAI_CHRONIC_HEPATITIS_VS
_LIVER_CANCER_DN
19
-1,73972
0,01969
2615
IVANOVSKA_MIR106B_TARGETS
71
-1,73942
0,019689
2090
tags=46%,
list=14%,
signal=54%
tags=39%,
list=22%,
signal=49%
tags=43%,
list=22%,
signal=55%
tags=47%,
list=21%,
signal=59%
tags=60%,
list=20%,
signal=75%
tags=71%,
list=23%,
signal=92%
tags=35%,
list=20%,
signal=44%
tags=43%,
list=7%,
signal=46%
tags=36%,
list=12%,
signal=41%
tags=32%,
list=19%,
signal=39%
tags=52%,
list=26%,
signal=70%
tags=36%,
list=23%,
signal=45%
tags=27%,
list=7%,
signal=29%
tags=28%,
list=16%,
signal=32%
tags=44%,
list=15%,
signal=52%
tags=39%,
list=17%,
signal=47%
tags=31%,
list=15%,
signal=36%
tags=53%,
list=20%,
signal=66%
tags=38%,
list=16%,
182
TAKEDA_TARGETS_OF_NUP98_H
OXA9_FUSION_8D_DN
101
-1,73754
0,020004
3691
GILDEA_METASTASIS
24
-1,7374
0,019985
3528
DUTERTRE_ESTRADIOL_RESPON
SE_24HR_DN
346
-1,73698
0,020011
2988
HUANG_DASATINIB_RESISTANC
E_UP
76
-1,73589
0,020179
1428
VANASSE_BCL2_TARGETS_DN
41
-1,73367
0,020527
2317
WOO_LIVER_CANCER_RECURRE
NCE_UP
87
-1,73064
0,021049
2858
ZHANG_TARGETS_OF_EWSR1_FL
I1_FUSION
68
-1,72781
0,021586
1819
LABBE_WNT3A_TARGETS_DN
46
-1,72741
0,021614
273
BROWNE_INTERFERON_RESPON
SIVE_GENES
52
-1,72673
0,021698
2891
VERHAAK_AML_WITH_NPM1_M
UTATED_UP
110
-1,72596
0,021794
2984
TOMLINS_PROSTATE_CANCER_
DN
34
-1,72513
0,021915
3292
CHANDRAN_METASTASIS_TOP50
_DN
38
-1,72336
0,022236
2051
GAURNIER_PSMD4_TARGETS
33
-1,72331
0,022189
3038
CHEBOTAEV_GR_TARGETS_DN
65
-1,72319
0,022163
3189
BOYLAN_MULTIPLE_MYELOMA
_PCA1_UP
43
-1,72144
0,022475
2218
KANG_CISPLATIN_RESISTANCE_
UP
16
-1,72116
0,022488
3339
ICHIBA_GRAFT_VERSUS_HOST_
DISEASE_35D_UP
73
-1,72097
0,022473
3802
HAN_JNK_SINGALING_DN
27
-1,71887
0,022877
2768
ZHU_SKIL_TARGETS_UP
17
-1,71603
0,023431
2553
signal=45%
tags=49%,
list=28%,
signal=67%
tags=71%,
list=27%,
signal=97%
tags=38%,
list=23%,
signal=48%
tags=26%,
list=11%,
signal=29%
tags=39%,
list=18%,
signal=47%
tags=46%,
list=22%,
signal=59%
tags=32%,
list=14%,
signal=37%
tags=17%,
list=2%,
signal=18%
tags=38%,
list=22%,
signal=49%
tags=40%,
list=23%,
signal=52%
tags=59%,
list=25%,
signal=79%
tags=37%,
list=16%,
signal=44%
tags=42%,
list=23%,
signal=55%
tags=43%,
list=25%,
signal=57%
tags=40%,
list=17%,
signal=48%
tags=56%,
list=26%,
signal=76%
tags=58%,
list=29%,
signal=81%
tags=56%,
list=21%,
signal=70%
tags=53%,
183
CASORELLI_ACUTE_PROMYELO
CYTIC_LEUKEMIA_UP
121
-1,7155
0,023484
2383
TAKEDA_TARGETS_OF_NUP98_H
OXA9_FUSION_16D_DN
70
-1,70996
0,024652
742
BRUINS_UVC_RESPONSE_VIA_TP
53_GROUP_B
355
-1,70872
0,024887
2939
ZIRN_TRETINOIN_RESPONSE_WT
1_UP
19
-1,70859
0,024857
1776
ONDER_CDH1_TARGETS_3_UP
16
-1,70718
0,025127
2460
LABBE_TGFB1_TARGETS_UP
68
-1,70608
0,025342
2103
KOKKINAKIS_METHIONINE_DEP
RIVATION_48HR_UP
109
-1,70419
0,025726
2364
KAPOSI_LIVER_CANCER_MET_U
P
15
-1,70169
0,026244
542
PAPASPYRIDONOS_UNSTABLE_
ATEROSCLEROTIC_PLAQUE_UP
33
-1,70101
0,026351
3736
SENGUPTA_NASOPHARYNGEAL_
CARCINOMA_DN
113
-1,7004
0,026447
2593
LIANG_SILENCED_BY_METHYLA
TION_UP
21
-1,69434
0,027936
2534
MATTHEWS_AP1_TARGETS
15
-1,69378
0,028007
3488
AMUNDSON_DNA_DAMAGE_RES
PONSE_TP53
12
-1,69226
0,028309
893
MCBRYAN_PUBERTAL_BREAST_
6_7WK_UP
144
-1,69116
0,028543
2772
PROVENZANI_METASTASIS_DN
111
-1,69114
0,028482
2233
MILI_PSEUDOPODIA_CHEMOTA
XIS_DN
389
-1,69058
0,028559
2106
HOQUE_METHYLATED_IN_CANC
ER
36
-1,69042
0,02853
2256
TSUNODA_CISPLATIN_RESISTAN
CE_UP
12
-1,68686
0,029394
3173
list=20%,
signal=66%
tags=36%,
list=18%,
signal=43%
tags=21%,
list=6%,
signal=23%
tags=38%,
list=23%,
signal=48%
tags=37%,
list=14%,
signal=43%
tags=50%,
list=19%,
signal=62%
tags=37%,
list=16%,
signal=44%
tags=33%,
list=18%,
signal=40%
tags=27%,
list=4%,
signal=28%
tags=52%,
list=29%,
signal=72%
tags=40%,
list=20%,
signal=49%
tags=62%,
list=20%,
signal=77%
tags=73%,
list=27%,
signal=100%
tags=33%,
list=7%,
signal=36%
tags=38%,
list=21%,
signal=47%
tags=41%,
list=17%,
signal=49%
tags=30%,
list=16%,
signal=34%
tags=44%,
list=17%,
signal=54%
tags=75%,
list=24%,
signal=99%
184
SESTO_RESPONSE_TO_UV_C6
38
-1,68628
0,029471
1928
WATTEL_AUTONOMOUS_THYRO
ID_ADENOMA_DN
33
-1,68325
0,030216
2425
IIZUKA_LIVER_CANCER_PROGR
ESSION_L0_L1_DN
20
-1,68063
0,030881
3275
ICHIBA_GRAFT_VERSUS_HOST_
DISEASE_D7_UP
65
-1,67643
0,031976
3182
COULOUARN_TEMPORAL_TGFB1
_SIGNATURE_DN
100
-1,67568
0,032109
2314
HOSHIDA_LIVER_CANCER_LATE
_RECURRENCE_UP
37
-1,67542
0,032112
1496
CASTELLANO_NRAS_TARGETS_
DN
11
-1,6754
0,032042
815
ODONNELL_TARGETS_OF_MYC_
AND_TFRC_UP
44
-1,67415
0,032314
2544
FOSTER_KDM1A_TARGETS_UP
106
-1,67369
0,032359
3057
DELASERNA_MYOD_TARGETS_D
N
47
-1,67338
0,032383
1949
DURAND_STROMA_MAX_DN
91
-1,67293
0,03245
2827
SMIRNOV_CIRCULATING_ENDO
THELIOCYTES_IN_CANCER_UP
110
-1,67248
0,03251
3012
WOO_LIVER_CANCER_RECURRE
NCE_DN
40
-1,67094
0,032885
2235
KIM_WT1_TARGETS_12HR_UP
126
-1,66949
0,033219
3126
TAKEDA_TARGETS_OF_NUP98_H
OXA9_FUSION_3D_UP
111
-1,66793
0,033617
3458
KOYAMA_SEMA3B_TARGETS_UP
197
-1,66724
0,033736
2000
HERNANDEZ_MITOTIC_ARREST_
BY_DOCETAXEL_2_DN
10
-1,66575
0,034105
1869
TSAI_DNAJB4_TARGETS_UP
11
-1,66482
0,034301
1841
HIRSCH_CELLULAR_TRANSFOR
MATION_SIGNATURE_UP
201
-1,66342
0,034635
1410
tags=39%,
list=15%,
signal=46%
tags=52%,
list=19%,
signal=63%
tags=60%,
list=25%,
signal=80%
tags=45%,
list=25%,
signal=59%
tags=34%,
list=18%,
signal=41%
tags=32%,
list=12%,
signal=37%
tags=36%,
list=6%,
signal=39%
tags=41%,
list=20%,
signal=51%
tags=41%,
list=24%,
signal=53%
tags=36%,
list=15%,
signal=42%
tags=37%,
list=22%,
signal=47%
tags=45%,
list=23%,
signal=58%
tags=35%,
list=17%,
signal=42%
tags=44%,
list=24%,
signal=57%
tags=38%,
list=27%,
signal=51%
tags=31%,
list=15%,
signal=36%
tags=60%,
list=14%,
signal=70%
tags=27%,
list=14%,
signal=32%
tags=23%,
list=11%,
185
SANA_RESPONSE_TO_IFNG_UP
46
-1,66299
0,034675
1342
AMIT_SERUM_RESPONSE_40_MC
F10A
23
-1,66198
0,034914
894
LIAN_LIPA_TARGETS_6M
23
-1,66176
0,034913
1954
PASQUALUCCI_LYMPHOMA_BY_
GC_STAGE_UP
205
-1,66073
0,035161
2453
CHEMNITZ_RESPONSE_TO_PROS
TAGLANDIN_E2_DN
214
-1,65742
0,03614
2139
HINATA_NFKB_TARGETS_KERA
TINOCYTE_UP
65
-1,65601
0,036486
3204
NIKOLSKY_BREAST_CANCER_7Q
21_Q22_AMPLICON
40
-1,65533
0,036636
2233
GHANDHI_DIRECT_IRRADIATIO
N_UP
76
-1,65449
0,036802
4230
ZHAN_MULTIPLE_MYELOMA_C
D2_UP
26
-1,65393
0,036904
1853
HECKER_IFNB1_TARGETS
57
-1,65221
0,037365
3182
WIKMAN_ASBESTOS_LUNG_CAN
CER_DN
17
-1,65185
0,037412
1496
TERAO_AOX4_TARGETS_HG_UP
22
-1,65119
0,037552
1943
NAKAMURA_TUMOR_ZONE_PER
IPHERAL_VS_CENTRAL_DN
436
-1,65094
0,037551
3092
DACOSTA_ERCC3_ALLELE_XPCS
_VS_TTD_DN
26
-1,65074
0,03754
1832
PECE_MAMMARY_STEM_CELL_
UP
120
-1,65044
0,037552
2193
KAMIKUBO_MYELOID_MN1_NET
WORK
16
-1,64994
0,03763
2199
POTTI_ADRIAMYCIN_SENSITIVIT
Y
59
-1,64954
0,037672
1417
LEIN_ASTROCYTE_MARKERS
22
-1,64908
0,037745
763
KYNG_ENVIRONMENTAL_STRES
48
-1,64733
0,038264
2147
signal=25%
tags=28%,
list=10%,
signal=31%
tags=22%,
list=7%,
signal=23%
tags=52%,
list=15%,
signal=61%
tags=34%,
list=19%,
signal=41%
tags=29%,
list=16%,
signal=35%
tags=48%,
list=25%,
signal=63%
tags=33%,
list=17%,
signal=39%
tags=53%,
list=33%,
signal=78%
tags=38%,
list=14%,
signal=45%
tags=37%,
list=25%,
signal=49%
tags=47%,
list=12%,
signal=53%
tags=50%,
list=15%,
signal=59%
tags=35%,
list=24%,
signal=45%
tags=42%,
list=14%,
signal=49%
tags=30%,
list=17%,
signal=36%
tags=50%,
list=17%,
signal=60%
tags=27%,
list=11%,
signal=30%
tags=32%,
list=6%,
signal=34%
tags=35%,
186
S_RESPONSE_UP
MEINHOLD_OVARIAN_CANCER_
LOW_GRADE_UP
14
-1,64688
0,038321
893
WANG_CLASSIC_ADIPOGENIC_T
ARGETS_OF_PPARG
18
-1,64682
0,038259
2184
CORRE_MULTIPLE_MYELOMA_D
N
43
-1,64642
0,038302
2519
NIKOLSKY_BREAST_CANCER_21
Q22_AMPLICON
12
-1,64597
0,038393
1481
XU_HGF_TARGETS_REPRESSED_
BY_AKT1_DN
38
-1,64204
0,039618
3383
ABE_VEGFA_TARGETS_2HR
21
-1,64114
0,039839
1705
DAVIES_MULTIPLE_MYELOMA_
VS_MGUS_DN
19
-1,63994
0,040139
1193
HEIDENBLAD_AMPLICON_8Q24_
DN
34
-1,6392
0,040326
1512
ACEVEDO_LIVER_CANCER_WIT
H_H3K27ME3_UP
109
-1,63878
0,040387
2209
BRUINS_UVC_RESPONSE_VIA_TP
53_GROUP_A
429
-1,63875
0,040315
2563
HENDRICKS_SMARCA4_TARGET
S_DN
34
-1,63608
0,041165
1667
BRIDEAU_IMPRINTED_GENES
34
-1,63579
0,041166
1942
BILD_HRAS_ONCOGENIC_SIGNA
TURE
189
-1,6353
0,041256
2849
HASINA_NOL7_TARGETS_UP
12
-1,6351
0,041243
3016
FLECHNER_BIOPSY_KIDNEY_TR
ANSPLANT_REJECTED_VS_OK_U
P
49
-1,63436
0,041413
3400
ABE_VEGFA_TARGETS
12
-1,63416
0,041404
324
BURTON_ADIPOGENESIS_11
45
-1,63268
0,04182
721
MARTENS_TRETINOIN_RESPONS
E_UP
252
-1,63232
0,041848
2744
list=17%,
signal=42%
tags=36%,
list=7%,
signal=38%
tags=44%,
list=17%,
signal=53%
tags=44%,
list=19%,
signal=55%
tags=42%,
list=11%,
signal=47%
tags=61%,
list=26%,
signal=82%
tags=38%,
list=13%,
signal=44%
tags=37%,
list=9%,
signal=41%
tags=32%,
list=12%,
signal=37%
tags=35%,
list=17%,
signal=42%
tags=30%,
list=20%,
signal=37%
tags=41%,
list=13%,
signal=47%
tags=32%,
list=15%,
signal=38%
tags=34%,
list=22%,
signal=43%
tags=75%,
list=23%,
signal=98%
tags=49%,
list=26%,
signal=66%
tags=25%,
list=2%,
signal=26%
tags=27%,
list=6%,
signal=28%
tags=34%,
list=21%,
signal=42%
187
BERENJENO_TRANSFORMED_BY
_RHOA_FOREVER_UP
17
-1,63065
0,042344
3586
CAIRO_PML_TARGETS_BOUND_
BY_MYC_DN
13
-1,63009
0,042457
1650
MARTINEZ_RESPONSE_TO_TRAB
ECTEDIN_UP
60
-1,62953
0,042576
1734
BUCKANOVICH_T_LYMPHOCYT
E_HOMING_ON_TUMOR_DN
17
-1,6294
0,042539
1241
HOSHIDA_LIVER_CANCER_SUBC
LASS_S3
163
-1,62861
0,042728
2057
KARLSSON_TGFB1_TARGETS_D
N
171
-1,62858
0,042651
2785
POTTI_CYTOXAN_SENSITIVITY
30
-1,62671
0,043222
1227
LE_SKI_TARGETS_UP
15
-1,62641
0,043235
2103
GRAESSMANN_APOPTOSIS_BY_S
ERUM_DEPRIVATION_UP
367
-1,6249
0,043694
2505
WINTER_HYPOXIA_METAGENE
186
-1,62227
0,044528
2577
ZHONG_RESPONSE_TO_AZACITI
DINE_AND_TSA_UP
122
-1,62147
0,044722
2561
LI_CISPLATIN_RESISTANCE_DN
12
-1,61974
0,045271
1342
CASORELLI_APL_SECONDARY_V
S_DE_NOVO_UP
28
-1,61876
0,045543
4002
TIAN_TNF_SIGNALING_VIA_NFK
B
20
-1,6158
0,046568
2277
WUNDER_INFLAMMATORY_RES
PONSE_AND_CHOLESTEROL_UP
35
-1,61546
0,046601
3182
CHEN_ETV5_TARGETS_SERTOLI
12
-1,6139
0,047112
3362
LEI_HOXC8_TARGETS_DN
13
-1,61381
0,047047
646
BRACHAT_RESPONSE_TO_CAMP
TOTHECIN_UP
24
-1,61359
0,04704
1346
CHANG_POU5F1_TARGETS_UP
11
-1,61306
0,047173
911
tags=71%,
list=28%,
signal=97%
tags=54%,
list=13%,
signal=62%
tags=33%,
list=13%,
signal=38%
tags=47%,
list=10%,
signal=52%
tags=27%,
list=16%,
signal=32%
tags=40%,
list=21%,
signal=51%
tags=33%,
list=9%,
signal=37%
tags=73%,
list=16%,
signal=87%
tags=27%,
list=19%,
signal=32%
tags=33%,
list=20%,
signal=41%
tags=36%,
list=20%,
signal=45%
tags=50%,
list=10%,
signal=56%
tags=68%,
list=31%,
signal=98%
tags=35%,
list=18%,
signal=42%
tags=46%,
list=25%,
signal=60%
tags=75%,
list=26%,
signal=101%
tags=38%,
list=5%,
signal=40%
tags=38%,
list=10%,
signal=42%
tags=45%,
list=7%,
188
LANDIS_ERBB2_BREAST_PRENE
OPLASTIC_DN
44
-1,61286
0,047153
1329
ELVIDGE_HIF1A_TARGETS_DN
67
-1,6122
0,04731
2602
MCCABE_HOXC6_TARGETS_DN
11
-1,61134
0,047569
1583
YAO_HOXA10_TARGETS_VIA_PR
OGESTERONE_DN
13
-1,61111
0,047566
2089
NIELSEN_GIST_AND_SYNOVIAL_
SARCOMA_DN
14
-1,60944
0,048124
3364
VART_KSHV_INFECTION_ANGIO
GENIC_MARKERS_DN
72
-1,6089
0,048257
2665
KESHELAVA_MULTIPLE_DRUG_
RESISTANCE
67
-1,60703
0,048876
2772
LEE_AGING_MUSCLE_DN
31
-1,60663
0,048925
2939
WELCSH_BRCA1_TARGETS_UP
171
-1,60658
0,048848
1582
DER_IFN_ALPHA_RESPONSE_UP
67
-1,60532
0,049268
1011
AMIT_EGF_RESPONSE_480_HELA
144
-1,60505
0,049278
1566
DAUER_STAT3_TARGETS_UP
38
-1,60496
0,049208
1572
MEISSNER_NPC_HCP_WITH_H3_
UNMETHYLATED
219
-1,6047
0,049217
2726
LENAOUR_DENDRITIC_CELL_M
ATURATION_UP
73
-1,60293
0,049816
1423
signal=49%
tags=27%,
list=10%,
signal=30%
tags=40%,
list=20%,
signal=50%
tags=45%,
list=12%,
signal=52%
tags=69%,
list=16%,
signal=82%
tags=79%,
list=26%,
signal=106%
tags=38%,
list=21%,
signal=47%
tags=39%,
list=21%,
signal=49%
tags=45%,
list=23%,
signal=58%
tags=24%,
list=12%,
signal=27%
tags=21%,
list=8%,
signal=23%
tags=26%,
list=12%,
signal=29%
tags=29%,
list=12%,
signal=33%
tags=36%,
list=21%,
signal=45%
tags=27%,
list=11%,
signal=31%
Результаты GSEA для генов с повышенной экспрессией, база данных
химических и генетических пертурбаций
NAME
SIZE
NES
FDR q-val
RANK
AT
MAX
ZHANG_TLX_TARGETS_60HR_DN
235
2,809378
0
4091
PUJANA_BRCA2_PCC_NETWORK
339
2,715856
0
3298
LEADING
EDGE
tags=74%,
list=32%,
signal=106%
tags=55%,
189
SOTIRIOU_BREAST_CANCER_GRA
DE_1_VS_3_UP
140
2,697773
0
3191
MISSIAGLIA_REGULATED_BY_ME
THYLATION_DN
110
2,639744
0
3608
MUELLER_PLURINET
250
2,629296
0
3566
MANALO_HYPOXIA_DN
263
2,622254
0
4392
PUJANA_XPRSS_INT_NETWORK
148
2,58573
0
4021
DUTERTRE_ESTRADIOL_RESPONS
E_24HR_UP
259
2,557307
0
3785
KOBAYASHI_EGFR_SIGNALING_24
HR_DN
225
2,557248
0
4395
BENPORATH_ES_1
274
2,541795
0
3244
WONG_EMBRYONIC_STEM_CELL_
CORE
315
2,529665
0
3624
ZHANG_TLX_TARGETS_UP
78
2,502492
0
3808
PUJANA_BRCA_CENTERED_NETW
ORK
107
2,478447
0
4179
CROONQUIST_IL6_DEPRIVATION_
DN
89
2,462159
0
3725
ROSTY_CERVICAL_CANCER_PROL
IFERATION_CLUSTER
128
2,460979
0
4372
WHITEFORD_PEDIATRIC_CANCER
_MARKERS
100
2,452613
0
4343
CROONQUIST_NRAS_SIGNALING_
DN
68
2,436003
0
3237
KONG_E2F3_TARGETS
80
2,421892
0
4300
PUJANA_BREAST_CANCER_WITH_
BRCA1_MUTATED_UP
50
2,399737
0
3148
GRAHAM_NORMAL_QUIESCENT_
VS_NORMAL_DIVIDING_DN
75
2,396354
0
4372
list=25%,
signal=72%
tags=66%,
list=25%,
signal=86%
tags=72%,
list=28%,
signal=99%
tags=62%,
list=27%,
signal=84%
tags=70%,
list=34%,
signal=104%
tags=73%,
list=31%,
signal=105%
tags=65%,
list=29%,
signal=90%
tags=74%,
list=34%,
signal=110%
tags=58%,
list=25%,
signal=75%
tags=62%,
list=28%,
signal=84%
tags=79%,
list=29%,
signal=112%
tags=79%,
list=32%,
signal=116%
tags=70%,
list=29%,
signal=97%
tags=80%,
list=34%,
signal=119%
tags=77%,
list=33%,
signal=115%
tags=69%,
list=25%,
signal=92%
tags=81%,
list=33%,
signal=121%
tags=72%,
list=24%,
signal=95%
tags=84%,
list=34%,
signal=126%
190
SHEDDEN_LUNG_CANCER_POOR_
SURVIVAL_A6
377
2,38757
0
3911
WINNEPENNINCKX_MELANOMA_
METASTASIS_UP
136
2,383887
0
4385
ZHANG_TLX_TARGETS_36HR_DN
154
2,380357
0
3903
LI_WILMS_TUMOR_VS_FETAL_KI
DNEY_1_DN
148
2,34152
5,55E-06
3455
ISHIDA_E2F_TARGETS
49
2,359716
5,78E-06
3608
KANG_DOXORUBICIN_RESISTANC
E_UP
48
2,32073
1,07E-05
4025
ZHAN_MULTIPLE_MYELOMA_PR_
UP
40
2,310832
2,05E-05
3191
OXFORD_RALA_OR_RALB_TARGE
TS_UP
44
2,298523
2,46E-05
3242
ZHOU_CELL_CYCLE_GENES_IN_IR
_RESPONSE_6HR
74
2,292328
3,32E-05
4373
KAMMINGA_EZH2_TARGETS
39
2,260985
6,49E-05
4358
TOYOTA_TARGETS_OF_MIR34B_A
ND_MIR34C
359
2,259406
6,72E-05
3944
NIKOLSKY_BREAST_CANCER_20Q
12_Q13_AMPLICON
80
2,254787
6,93E-05
2599
MORI_EMU_MYC_LYMPHOMA_BY
_ONSET_TIME_UP
91
2,251561
7,13E-05
2267
NAKAMURA_CANCER_MICROENV
IRONMENT_DN
41
01,02,248
6
7,33E-05
3477
ABRAMSON_INTERACT_WITH_AI
RE
38
2,235136
8,74E-05
3117
GARCIA_TARGETS_OF_FLI1_AND_
DAX1_DN
130
2,224574
8,86E-05
3363
FEVR_CTNNB1_TARGETS_DN
448
2,235912
8,98E-05
3962
REN_BOUND_BY_E2F
57
2,24166
9,11E-05
4210
BIDUS_METASTASIS_UP
188
2,237179
9,23E-05
3225
tags=57%,
list=30%,
signal=79%
tags=76%,
list=34%,
signal=114%
tags=64%,
list=30%,
signal=90%
tags=76%,
list=28%,
signal=104%
tags=60%,
list=27%,
signal=81%
tags=85%,
list=31%,
signal=123%
tags=75%,
list=25%,
signal=99%
tags=70%,
list=25%,
signal=94%
tags=86%,
list=34%,
signal=130%
tags=90%,
list=34%,
signal=135%
tags=55%,
list=30%,
signal=77%
tags=54%,
list=20%,
signal=67%
tags=46%,
list=17%,
signal=56%
tags=73%,
list=27%,
signal=100%
tags=74%,
list=32%,
signal=109%
tags=50%,
list=25%,
signal=66%
tags=56%,
list=31%,
signal=78%
tags=74%,
list=24%,
signal=97%
tags=58%,
list=26%,
191
CHANG_CYCLING_GENES
130
2,1852
0,000165
3191
AMUNDSON_GAMMA_RADIATION
_RESPONSE
36
2,160431
0,000252
4235
HOFFMANN_LARGE_TO_SMALL_P
RE_BII_LYMPHOCYTE_UP
143
2,154409
0,000269
4300
BHATTACHARYA_EMBRYONIC_S
TEM_CELL
71
2,139437
0,000323
3276
FOURNIER_ACINAR_DEVELOPME
NT_LATE_2
256
2,133646
0,000347
3198
KAUFFMANN_MELANOMA_RELAP
SE_UP
52
2,12699
0,000391
4481
HORIUCHI_WTAP_TARGETS_DN
274
2,120326
0,000422
3720
GOBERT_OLIGODENDROCYTE_DI
FFERENTIATION_UP
482
2,108823
0,000493
3242
FRASOR_RESPONSE_TO_SERM_OR
_FULVESTRANT_DN
47
2,110724
0,000495
3850
DANG_REGULATED_BY_MYC_UP
61
2,099971
0,000544
2585
RICKMAN_TUMOR_DIFFERENTIAT
ED_WELL_VS_POORLY_UP
175
2,09362
0,000588
2763
THILLAINADESAN_ZNF217_TARG
ETS_UP
41
2,09146
0,000593
3256
VECCHI_GASTRIC_CANCER_EARL
Y_UP
312
2,074994
0,000786
3625
PENG_GLUTAMINE_DEPRIVATION
_DN
300
2,075783
0,000791
3104
BENPORATH_PROLIFERATION
124
2,070953
0,00082
2126
MORI_LARGE_PRE_BII_LYMPHOC
YTE_UP
73
2,057088
0,000973
4300
SONG_TARGETS_OF_IE86_CMV_P
ROTEIN
54
2,058855
0,000976
4074
WAKASUGI_HAVE_ZNF143_BINDI
NG_SITES
49
2,057458
0,000985
2823
FUJII_YBX1_TARGETS_DN
173
2,050326
0,00107
3725
signal=77%
tags=60%,
list=25%,
signal=79%
tags=86%,
list=33%,
signal=127%
tags=71%,
list=33%,
signal=104%
tags=69%,
list=25%,
signal=92%
tags=50%,
list=25%,
signal=65%
tags=75%,
list=35%,
signal=114%
tags=52%,
list=29%,
signal=71%
tags=77%,
list=30%,
signal=109%
tags=49%,
list=25%,
signal=63%
tags=52%,
list=20%,
signal=65%
tags=46%,
list=21%,
signal=58%
tags=68%,
list=25%,
signal=91%
tags=43%,
list=24%,
signal=56%
tags=54%,
list=28%,
signal=73%
tags=41%,
list=16%,
signal=49%
tags=74%,
list=31%,
signal=108%
tags=53%,
list=22%,
signal=68%
tags=77%,
list=33%,
signal=114%
tags=57%,
192
BENPORATH_ES_2
18
2,047478
0,001108
2512
BERENJENO_TRANSFORMED_BY_
RHOA_UP
467
2,038144
0,001285
3260
PYEON_CANCER_HEAD_AND_NEC
K_VS_CERVICAL_UP
133
2,03425
0,001333
4210
WANG_RESPONSE_TO_GSK3_INHI
BITOR_SB216763_DN
288
2,033412
0,001334
3824
ZHANG_BREAST_CANCER_PROGE
NITORS_UP
337
2,027319
0,001451
3611
TARTE_PLASMA_CELL_VS_PLASM
ABLAST_DN
277
2,024644
0,001503
2639
LE_NEURONAL_DIFFERENTIATIO
N_DN
15
2,021791
0,001546
2248
MIKKELSEN_MEF_HCP_WITH_H3K
27ME3
115
2,01825
0,001596
2349
LEE_METASTASIS_AND_RNA_PRO
CESSING_UP
17
2,016913
0,001609
1368
GARGALOVIC_RESPONSE_TO_OXI
DIZED_PHOSPHOLIPIDS_TURQUOI
SE_DN
46
2,012943
0,001677
3608
GRAHAM_CML_DIVIDING_VS_NO
RMAL_QUIESCENT_UP
152
2,009918
0,001722
4372
SU_TESTIS
41
2,007682
0,001743
4104
DELPUECH_FOXO3_TARGETS_DN
36
2,006115
0,001751
1989
LE_EGR2_TARGETS_UP
95
2,001462
0,001869
3865
BLUM_RESPONSE_TO_SALIRASIB_
DN
308
1,995527
0,002026
4078
LEE_EARLY_T_LYMPHOCYTE_UP
81
1,984927
0,002281
4385
FARMER_BREAST_CANCER_CLUS
TER_2
31
1,986588
0,002289
4372
BURTON_ADIPOGENESIS_PEAK_A
T_24HR
36
1,98497
0,002306
3063
list=29%,
signal=78%
tags=72%,
list=19%,
signal=89%
tags=49%,
list=25%,
signal=63%
tags=60%,
list=32%,
signal=88%
tags=54%,
list=29%,
signal=75%
tags=47%,
list=28%,
signal=64%
tags=40%,
list=20%,
signal=50%
tags=73%,
list=17%,
signal=89%
tags=40%,
list=18%,
signal=48%
tags=47%,
list=11%,
signal=53%
tags=57%,
list=28%,
signal=78%
tags=70%,
list=34%,
signal=105%
tags=73%,
list=32%,
signal=107%
tags=53%,
list=15%,
signal=62%
tags=67%,
list=30%,
signal=95%
tags=60%,
list=31%,
signal=86%
tags=87%,
list=34%,
signal=131%
tags=61%,
list=24%,
signal=80%
tags=74%,
list=34%,
signal=111%
193
BOYAULT_LIVER_CANCER_SUBC
LASS_G3_UP
175
1,974791
0,002651
4078
ZHOU_CELL_CYCLE_GENES_IN_IR
_RESPONSE_24HR
113
1,971443
0,002753
4088
WHITFIELD_CELL_CYCLE_LITERA
TURE
39
1,964812
0,002964
3608
DANG_MYC_TARGETS_UP
123
1,963759
0,00297
2946
SCHUHMACHER_MYC_TARGETS_
UP
72
1,950841
0,003545
2565
MOLENAAR_TARGETS_OF_CCND1
_AND_CDK4_DN
47
1,949359
0,00358
4336
WONG_MITOCHONDRIA_GENE_M
ODULE
191
1,940873
0,003886
2038
MORI_IMMATURE_B_LYMPHOCY
TE_DN
81
1,941546
0,003901
4300
CHIANG_LIVER_CANCER_SUBCLA
SS_PROLIFERATION_UP
145
1,935896
0,004029
4091
NADERI_BREAST_CANCER_PROG
NOSIS_UP
32
1,93625
0,00406
2970
BASAKI_YBX1_TARGETS_UP
246
1,936694
0,004077
3258
SHIPP_DLBCL_VS_FOLLICULAR_L
YMPHOMA_UP
43
1,933895
0,004108
2568
SMID_BREAST_CANCER_LUMINA
L_A_DN
13
1,932084
0,004173
2849
GARY_CD5_TARGETS_DN
360
1,930462
0,004229
3134
BROWNE_HCMV_INFECTION_18H
R_UP
132
1,92614
0,004437
1537
FERREIRA_EWINGS_SARCOMA_U
NSTABLE_VS_STABLE_UP
135
1,919445
0,004802
4442
LEE_LIVER_CANCER_SURVIVAL_
DN
148
1,916281
0,004962
2885
GAVIN_FOXP3_TARGETS_CLUSTE
R_P6
67
1,913011
0,005132
2902
ZHANG_RESPONSE_TO_CANTHAR
IDIN_DN
65
1,905932
0,005621
2194
tags=57%,
list=31%,
signal=82%
tags=71%,
list=32%,
signal=102%
tags=74%,
list=28%,
signal=103%
tags=50%,
list=23%,
signal=65%
tags=50%,
list=20%,
signal=62%
tags=79%,
list=33%,
signal=118%
tags=72%,
list=33%,
signal=106%
tags=30%,
list=16%,
signal=35%
tags=50%,
list=25%,
signal=65%
tags=50%,
list=23%,
signal=65%
tags=66%,
list=32%,
signal=95%
tags=53%,
list=20%,
signal=66%
tags=77%,
list=22%,
signal=98%
tags=40%,
list=24%,
signal=52%
tags=24%,
list=12%,
signal=27%
tags=67%,
list=34%,
signal=101%
tags=48%,
list=22%,
signal=61%
tags=52%,
list=22%,
signal=67%
tags=42%,
list=17%,
194
EGUCHI_CELL_CYCLE_RB1_TARG
ETS
23
1,90326
0,005764
4372
GRASEMANN_RETINOBLASTOMA
_WITH_6P_AMPLIFICATION
12
1,90051
0,005927
2027
GROSS_HYPOXIA_VIA_HIF1A_UP
66
1,890322
0,0067
2598
YEGNASUBRAMANIAN_PROSTAT
E_CANCER
49
1,888896
0,006781
1957
MARKEY_RB1_ACUTE_LOF_DN
197
1,883396
0,007186
3297
MOOTHA_MITOCHONDRIA
371
1,882353
0,0072
2522
MITSIADES_RESPONSE_TO_APLID
IN_DN
227
1,87795
0,007523
3617
ODONNELL_TFRC_TARGETS_DN
94
1,874695
0,007743
4385
MATTIOLI_MGUS_VS_PCL
80
1,873654
0,007768
2207
PENG_LEUCINE_DEPRIVATION_D
N
171
1,868864
0,008162
3335
KAUFFMANN_DNA_REPAIR_GENE
S
180
1,859615
0,008901
3808
KYNG_ENVIRONMENTAL_STRESS
_RESPONSE_DN
15
1,859858
0,008967
1178
KALMA_E2F1_TARGETS
11
1,853531
0,00947
3117
FURUKAWA_DUSP6_TARGETS_PCI
35_DN
64
1,851868
0,009549
4038
OZEN_MIR125B1_TARGETS
19
1,848758
0,009832
3407
NIKOLSKY_BREAST_CANCER_8P1
2_P11_AMPLICON
37
1,845897
0,01007
3328
HESS_TARGETS_OF_HOXA9_AND_
MEIS1_UP
54
1,844103
0,01022
3625
FU_INTERACT_WITH_ALKBH8
12
1,839305
0,010819
3104
BURTON_ADIPOGENESIS_3
92
1,837877
0,01091
4294
signal=50%
tags=87%,
list=34%,
signal=131%
tags=75%,
list=16%,
signal=89%
tags=45%,
list=20%,
signal=57%
tags=35%,
list=15%,
signal=41%
tags=49%,
list=25%,
signal=65%
tags=33%,
list=19%,
signal=40%
tags=49%,
list=28%,
signal=67%
tags=68%,
list=34%,
signal=102%
tags=50%,
list=17%,
signal=60%
tags=49%,
list=26%,
signal=65%
tags=40%,
list=9%,
signal=44%
tags=50%,
list=29%,
signal=70%
tags=82%,
list=24%,
signal=108%
tags=66%,
list=31%,
signal=95%
tags=68%,
list=26%,
signal=93%
tags=57%,
list=26%,
signal=76%
tags=63%,
list=28%,
signal=87%
tags=83%,
list=24%,
signal=109%
tags=71%,
195
CHIANG_LIVER_CANCER_SUBCLA
SS_UNANNOTATED_DN
174
1,836317
0,011014
2684
BROWNE_HCMV_INFECTION_48H
R_UP
117
1,832867
0,011334
3149
YU_MYC_TARGETS_UP
37
1,831341
0,011432
3401
MOOTHA_HUMAN_MITODB_6_200
2
357
1,82414
0,012207
2522
HUMMEL_BURKITTS_LYMPHOMA
_UP
31
1,824375
0,012271
1270
NIELSEN_SYNOVIAL_SARCOMA_
UP
10
1,822359
0,012368
871
REICHERT_MITOSIS_LIN9_TARGE
TS
26
1,818062
0,012888
2849
HEDENFALK_BREAST_CANCER_H
EREDITARY_VS_SPORADIC
44
1,816789
0,012968
1380
BROWN_MYELOID_CELL_DEVELO
PMENT_DN
88
1,814332
0,013196
2256
RUIZ_TNC_TARGETS_DN
129
1,811723
0,013338
3407
RHODES_UNDIFFERENTIATED_CA
NCER
62
1,812238
0,013374
3191
ODONNELL_TARGETS_OF_MYC_A
ND_TFRC_DN
40
1,809573
0,013589
4311
ZHAN_MULTIPLE_MYELOMA_SUB
GROUPS
27
1,803881
0,014397
2970
JUBAN_TARGETS_OF_SPI1_AND_F
LI1_DN
72
1,80138
0,014697
3460
MOOTHA_VOXPHOS
79
1,789521
0,016552
2511
LINDGREN_BLADDER_CANCER_C
LUSTER_3_UP
268
1,785942
0,017086
3209
SCHLOSSER_MYC_TARGETS_REP
RESSED_BY_SERUM
143
1,778896
0,018286
4231
BILANGES_SERUM_AND_RAPAMY
CIN_SENSITIVE_GENES
63
1,777374
0,018417
4053
list=33%,
signal=105%
tags=40%,
list=21%,
signal=49%
tags=44%,
list=24%,
signal=57%
tags=65%,
list=26%,
signal=88%
tags=39%,
list=10%,
signal=43%
tags=33%,
list=19%,
signal=40%
tags=50%,
list=7%,
signal=54%
tags=65%,
list=22%,
signal=84%
tags=45%,
list=11%,
signal=51%
tags=40%,
list=17%,
signal=48%
tags=58%,
list=25%,
signal=77%
tags=55%,
list=26%,
signal=74%
tags=73%,
list=33%,
signal=108%
tags=59%,
list=23%,
signal=77%
tags=51%,
list=27%,
signal=70%
tags=39%,
list=19%,
signal=48%
tags=45%,
list=25%,
signal=58%
tags=55%,
list=33%,
signal=81%
tags=60%,
list=31%,
signal=87%
196
FINETTI_BREAST_CANCER_KINO
ME_RED
16
1,773912
0,018957
4300
LY_AGING_OLD_DN
54
1,768932
0,019859
3751
BROWNE_HCMV_INFECTION_14H
R_UP
122
1,767452
0,019996
3949
CHNG_MULTIPLE_MYELOMA_HY
PERPLOID_UP
49
1,764404
0,020324
2908
WELCSH_BRCA1_TARGETS_DN
129
1,764677
0,020423
2587
POMEROY_MEDULLOBLASTOMA_
PROGNOSIS_DN
40
1,762
0,020693
2872
KORKOLA_YOLK_SAC_TUMOR_U
P
15
1,760557
0,020847
305
YAMAZAKI_TCEB3_TARGETS_DN
167
1,754208
0,022037
3746
YAO_TEMPORAL_RESPONSE_TO_
PROGESTERONE_CLUSTER_13
155
1,750962
0,022603
1350
SMID_BREAST_CANCER_RELAPSE
_IN_BRAIN_UP
20
1,748627
0,022984
1473
YAMASHITA_LIVER_CANCER_WIT
H_EPCAM_UP
46
1,745412
0,023578
2626
WATANABE_COLON_CANCER_MS
I_VS_MSS_UP
17
1,73908
0,02495
3175
MOREAUX_MULTIPLE_MYELOMA
_BY_TACI_DN
149
1,734407
0,025908
2770
PENG_RAPAMYCIN_RESPONSE_D
N
227
1,72896
0,027096
2985
BENPORATH_ES_CORE_NINE_COR
RELATED
70
1,72524
0,027902
3322
MOREAUX_B_LYMPHOCYTE_MAT
URATION_BY_TACI_DN
65
1,719303
0,029424
3104
PYEON_HPV_POSITIVE_TUMORS_
UP
62
1,716206
0,030182
3545
HOSHIDA_LIVER_CANCER_SUBCL
ASS_S2
92
1,714317
0,030404
2760
LI_WILMS_TUMOR_ANAPLASTIC_
UP
16
1,714635
0,030508
3552
tags=88%,
list=33%,
signal=131%
tags=67%,
list=29%,
signal=93%
tags=48%,
list=30%,
signal=69%
tags=42%,
list=20%,
signal=52%
tags=49%,
list=22%,
signal=63%
tags=48%,
list=22%,
signal=61%
tags=27%,
list=2%,
signal=27%
tags=47%,
list=29%,
signal=66%
tags=24%,
list=10%,
signal=26%
tags=30%,
list=11%,
signal=34%
tags=43%,
list=20%,
signal=54%
tags=65%,
list=24%,
signal=86%
tags=34%,
list=21%,
signal=42%
tags=41%,
list=23%,
signal=52%
tags=57%,
list=26%,
signal=76%
tags=43%,
list=24%,
signal=56%
tags=56%,
list=27%,
signal=77%
tags=75%,
list=27%,
signal=103%
tags=40%,
list=21%,
197
CHANG_CORE_SERUM_RESPONSE
_UP
178
1,707565
0,032178
3018
RICKMAN_TUMOR_DIFFERENTIAT
ED_MODERATELY_VS_POORLY_D
N
11
1,706352
0,032363
4210
GRADE_COLON_AND_RECTAL_CA
NCER_UP
250
1,702823
0,033235
2251
WONG_PROTEASOME_GENE_MOD
ULE
46
1,700181
0,033891
4180
RHODES_CANCER_META_SIGNAT
URE
60
1,699064
0,034015
2093
TANG_SENESCENCE_TP53_TARGE
TS_DN
49
1,696886
0,034434
3955
KAUFFMANN_DNA_REPLICATION
_GENES
117
1,695261
0,034767
3553
MARCINIAK_ER_STRESS_RESPON
SE_VIA_CHOP
18
1,688945
0,036611
1231
VANTVEER_BREAST_CANCER_ME
TASTASIS_DN
96
1,681473
0,038741
4110
FERRANDO_T_ALL_WITH_MLL_E
NL_FUSION_DN
76
1,681837
0,038848
3850
KUMAMOTO_RESPONSE_TO_NUT
LIN_3A_DN
10
1,679085
0,039075
3865
WINTER_HYPOXIA_UP
78
1,679783
0,039086
2184
MORI_PRE_BI_LYMPHOCYTE_UP
65
1,677136
0,039546
1720
SCIAN_CELL_CYCLE_TARGETS_O
F_TP53_AND_TP73_DN
21
1,676086
0,039702
2093
BILANGES_RAPAMYCIN_SENSITIV
E_VIA_TSC1_AND_TSC2
67
1,674785
0,039918
2896
WU_APOPTOSIS_BY_CDKN1A_VIA
_TP53
51
1,672321
0,040528
4210
CHICAS_RB1_TARGETS_LOW_SER
UM
76
1,670346
0,040966
2495
CHEMNITZ_RESPONSE_TO_PROST
AGLANDIN_E2_UP
123
1,664533
0,042913
3521
GREENBAUM_E2A_TARGETS_UP
29
1,659213
0,044654
4078
signal=51%
tags=40%,
list=23%,
signal=51%
tags=100%,
list=32%,
signal=148%
tags=33%,
list=17%,
signal=39%
tags=59%,
list=32%,
signal=86%
tags=45%,
list=16%,
signal=53%
tags=76%,
list=30%,
signal=108%
tags=49%,
list=27%,
signal=66%
tags=33%,
list=9%,
signal=37%
tags=57%,
list=30%,
signal=80%
tags=55%,
list=32%,
signal=80%
tags=35%,
list=17%,
signal=41%
tags=90%,
list=30%,
signal=128%
tags=35%,
list=13%,
signal=41%
tags=52%,
list=16%,
signal=62%
tags=45%,
list=22%,
signal=57%
tags=76%,
list=32%,
signal=113%
tags=39%,
list=19%,
signal=49%
tags=54%,
list=27%,
signal=74%
tags=83%,
198
NAKAYAMA_SOFT_TISSUE_TUMO
RS_PCA2_UP
70
1,658354
0,04474
2944
CHEN_ETV5_TARGETS_TESTIS
16
1,651763
0,047071
993
HATADA_METHYLATED_IN_LUNG
_CANCER_DN
12
1,64833
0,048182
904
LIN_MELANOMA_COPY_NUMBER
_UP
55
1,647107
0,048406
1908
TIEN_INTESTINE_PROBIOTICS_24
HR_UP
496
1,6462
0,048514
3266
list=31%,
signal=120%
tags=47%,
list=23%,
signal=61%
tags=31%,
list=8%,
signal=34%
tags=17%,
list=7%,
signal=18%
tags=33%,
list=15%,
signal=38%
tags=38%,
list=25%,
signal=49%