Положение об организации питания в МДОУ «Детский сад;doc

На правах рукописи
Концевая Ирина Сергеевна
ОСНОВНЫЕ ГЕНЕТИЧЕСКИЕ ГРУППЫ
MYCOBACTERIUM TUBERCULOSIS
В САМАРСКОЙ ОБЛАСТИ
03.02.07 – генетика
Автореферат
диссертации на соискание ученой степени
кандидата биологических наук
Уфа − 2014
2
Работа выполнена на кафедре биологической химии, биотехнологии и
биоинженерии ФГБОУ ВПО «Самарский государственный университет» и в
бактериологической лаборатории ГБУЗ «Самарский областной клинический
противотуберкулезный диспансер имени Н. В. Постникова»
Научный руководитель:
Официальные оппоненты:
Мавзютов
Айрат Радикович
доктор медицинских наук,
профессор
Макурина Ольга Николаевна
доктор биологических наук, профессор
заведующий кафедрой фундаментальной и
прикладной микробиологии ГБОУ ВПО
Башкирский государственный медицинский
университет МЗ РФ
Маркушева
Татьяна Вячеславовна
доктор биологических наук,
доцент
руководитель группы генетики микроорганизмов
ФГБУН Институт биологии Уфимского научного
центра РАН
Ведущая организация:
ГБОУ ВПО Северный государственный
медицинский университет МЗ РФ
Защита диссертации состоится «__» мая 2014 г. в «__:__» часов на заседании
Диссертационного совета Д 002.133.01 при Федеральном государственном
бюджетном учреждении науки Институте биохимии и генетики Уфимского
научного центра РАН по адресу: 450054, г. Уфа, пр. Октября, 71. ИБГ УНЦ РАН
С диссертацией можно ознакомиться на сайте ИБГ УНЦ РАН
(ibg.anrb.ru/dissov.html) и в Научной библиотеке Уфимского научного центра РАН
(Уфа, просп. Октября, д. 71), с авторефератом - на сайте ВАК РФ
E-mail: [email protected]
Автореферат разослан «___» _________ 2014 г.
Ученый секретарь
диссертационного совета, к.б.н.
С. М. Бикбулатова
3
ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ
Актуальность работы. Туберкулез (ТБ) остается важной проблемой
здравоохранения во всем мире и Российской Федерации в частности. Самарская
область относится к регионам России с неблагоприятной обстановкой по
туберкулезу, где уровень заболеваемости в 2011 году (78,5 случаев на 100 тыс.
населения) превышал средний показатель по стране (73,0 случая на 100 тыс.
населения) (Аналитический обзор МЗ РФ, 2011). Около 20% всех впервые
выявленных заболевших и 60% получавших лечение в прошлом пациентов в
Самарской области инфицированы штаммами микобактерий с множественной
лекарственной устойчивостью (Balabanova et al., 2006). Серьезной проблемой
является
также
рост
заболеваемости
ТБ
с
обширной
лекарственной
устойчивостью, вызванным микобактериями, дополнительно устойчивыми к
фторхинолонам и инъекционным препаратам, особенно в сочетании с ВИЧинфекцией (Balabanova et al., 2011). Преобладающей генетической группой
штаммов, циркулирующей в Самарской области, является группа Beijing
(Балабанова, 2006). Она характеризуется высокой степенью внутригрупповой
гомогенности, а также повышенной вирулентностью, патогенностью и
ассоциированностью с лекарственной устойчивостью (Степаншина, 2007;
Дымова, 2008; Baranov et al., 2009; Nodieva et al., 2010; Маничева, 2011; Лац,
2012; Дымова, 2013).
Генетические факторы играют ключевую роль в формировании важных в
клинико-эпидемиологическом
отношении
свойств
патогена,
включая
лекарственную устойчивость, вирулентность и повышенную способность к
трансмиссии. Изучение особенностей генетики возбудителя туберкулеза,
включая его принадлежность к той или иной генетической группе и
закономерности формирования лекарственной устойчивости и повышенной
вирулентности, является необходимым звеном в комплексе мер борьбы с
туберкулезом и его трансмиссией и разработки новых методов его диагностики,
лечения и профилактики.
4
К
настоящему
времени
имеются
лишь
единичные
данные
по
популяционно-генетической структуре штаммов Mycobacterium tuberculosis,
циркулирующих
в
Самарской
области,
распространенности
различных
генетических групп и их ассоциированности с лекарственной устойчивостью и
вирулентностью.
Цель работы: выявление генетической структуры популяции и
закономерностей циркуляции и распространения основных генетических групп
M. tuberculosis в Самарской области, а также их ассоциаций с вирулентностью и
устойчивостью к противотуберкулезным препаратам.
Задачи исследования:
1.
С помощью методов молекулярного генотипирования определить
основные
генетические
группы
и
кластеры
штаммов
M. tuberculosis,
циркулирующие в Самарской области.
2.
Выявить закономерности распространения генетических групп и
кластеров
штаммов
M. tuberculosis
в
районах
Самарской
области
и
медицинских учреждениях, где пациенты проходят лечение от ТБ.
3.
Выявить закономерности трансмиссии штаммов M. tuberculosis,
устойчивых к противотуберкулезным препаратам, включая
штаммы с
множественной и обширной лекарственной устойчивостью и установить их
ассоциированность с генетическими группами и кластерами M. tuberculosis.
4.
Провести
анализ
полиморфизмов
в
генах
M. tuberculosis,
ассоциированных с вирулентностью: генов фосфолипазы С (plcA, plcB, plcC),
липазы (lipR), поликетидсинтазы (pks15/1) и сенсорной гистидинкиназы (dosT),
выявить закономерности их связи с генетическими группами и кластерами
M. tuberculosis,
а
также
чувствительностью
к
противотуберкулезным
препаратам.
Научная новизна. В настоящей работе впервые проведено масштабное
исследование популяционно-генетической структуры штаммов M. tuberculosis,
циркулирующих в Самарской области. Продемонстрировано преобладание
штаммов генетической группы Beijing и штаммов Евро-Американской линии, а
также появление штаммов генетических групп EAI и Delhi/CAS, ранее не
5
зарегистрированных в регионе. Показана неравномерность распространенности
кластера Samara4 и ряда мелких кластеров группы Beijing по медицинским
учреждениям, а также ассоциации между проживанием в крупных городах и
риском заражения штаммами Beijing, а в сельской местности – со штаммами
других
групп.
Выявлены
ассоциации
лекарственной
устойчивости
к
противотуберкулезным препаратам с генетической группой Beijing и рядом
наиболее крупных ее кластеров, в частности Samara4, Samara24 и Samara16.
Обнаружены ассоциации между полиморфизмами в гене plcA и генетической
группой LAM (кластерами Samara227 и Samara228), в генах dosT и pks15/1 и
всей группой Beijing, а также в гене lipR с большинством кластеров групп
Ghana,
Cameroon,
Uganda
и
S.
Установлены
ассоциации
между
полиморфизмами в генах dosT и pks15/1 и лекарственной устойчивостью, а
также в генах plcA и lipR и лекарственной чувствительностью.
Научно-практическая
значимость.
На
основании
материалов
диссертации нами внесены предложения по совершенствованию методов
лабораторной диагностики туберкулеза, которые могут быть использованы в
работе ГБУЗ «Самарский областной клинический противотуберкулезный
диспансер имени Н.В. Постникова» и иных противотуберкулезных учреждений.
В целом результаты работы по выявлению ряда генетических групп,
закономерностей их циркуляции и ассоциированности с лекарственной
устойчивостью могут быть использованы в качестве основы для оптимизации
методов диагностики, профилактики и лечения пациентов Самарской области и
других регионов Российской Федерации, включающей в себя своевременную
коррекцию схем химиотерапии, совершенствование инфекционного контроля
для борьбы с трансмиссией наиболее вирулентных штаммов микобактерий, а
также разработку долговременной стратегии по борьбе с туберкулезом.
Сведения о распространенности определенных генетических групп и их
ассоциированности с лекарственной устойчивостью могут быть использованы
для разработки и апробации новых методов лабораторной диагностики
туберкулеза фирмами-изготовителями диагностикумов. Полученные нами
теоретические данные об ассоциированности различных типов полиморфизмов
в геноме M. tuberculosis могут послужить основой дальнейших исследований,
6
направленных на изучение эволюции и популяционной генетики бактерий
комплекса M. tuberculosis.
Результаты работы могут быть использованы при чтении спецкурсов на
биологических факультетах университетов, в медицинских ВУЗах и на курсах
повышения квалификации медицинских работников.
Апробация работы. Результаты исследования были представлены на II
Всероссийской научной конференции с международным участием «Научное
творчество
XXI
века»
(Красноярск,
2010);
Международной
научно-
практической конференции “Теоретические и прикладные проблемы науки и
образования” (Курск, 2010); семинаре Joint NIAID-ISTC Workshop ‘Research
Opportunities in TB Drug Discovery and Diagnosis‘ (Москва, 2010); 21-ом
Европейском конгрессе по клинической микробиологии и инфекционным
заболеваниям ECCMID 2011 (Милан, Италия, 2011); 32-м ежегодном конгрессе
Европейского сообщества микобактериологов ESM 2011 (Любек, Германия,
2011); Международной научно-практической конференции “Физиологические
механизмы адаптации живых систем” (Сухум, 2011); II Международной
научно-практической конференции «Социальные и медико-биологические
вопросы адаптации» (Курск, 2011); Международной научно-практической
конференции «Теоретические и прикладные проблемы современной науки и
образования» (Курск, 2012); 17-ой Международной Пущинской школеконференции молодых ученых (Пущино, 2013).
Публикации. По теме диссертации опубликовано 17 научных работ, в
том числе 3 статьи в рецензируемых журналах, рекомендованных ВАК для
защиты кандидатских и докторских диссертаций, и 5 статей в зарубежных
журналах, включенных в международные системы цитирования Pubmed, Scopus
и др.
Структура и объем диссертации. Диссертация состоит из введения,
обзора литературы, описания материалов и методов исследования, трех глав
результатов исследования и их обсуждения, заключения, выводов и списка
литературы. Работа изложена на 161 листе, содержит 14 рисунков и 38 таблиц.
Список литературы включает 247 источников, из которых 174 – зарубежных.
7
СОДЕРЖАНИЕ РАБОТЫ
Материалы и методы. Объектом исследования служили 1304 изолята
M. tuberculosis, выделенных из мокроты пациентов с бактериологически
подтвержденным диагнозом туберкулез легких, проходивших стационарное
или амбулаторное лечение в противотуберкулезных учреждениях г. Самары и
Самарской области, набираемых в течение одного года. Из них у 807 (61,89%)
пациентов ТБ был выявлен впервые, а 497 (38,11%) пациентов получали
противотуберкулезное лечение в прошлом.
Обработку мокроты, выделение чистых культур микобактерий и их
идентификацию, а также тесты на лекарственную чувствительность проводили
с использованием системы автоматизированных жидких питательных сред
BACTEC MGIT 960 (Becton Dickinson, Cockeysville, MD) в соответствии с
рекомендациями производителя (Siddiqi et al., 2006) и Приказом №109 (МЗ РФ,
2003). Выделение ДНК из изолятов производили методом нагревания с
хлороформом (Yates et al., 2002). Молекулярно-генетический анализ ДНК
изолятов включал 4 этапа. 1. Сполиготипирование с гибридизацией на
мембранах с нанесенными олигонуклеотидными пробами (Kamerbeek et al.,
1997). 2. Генотипирование по 9-ти и 17-ти локусам VNTR для штаммов группы
Beijing (VNTR 1982, 2163B, 3232, 4052, MIRU 10, 23, 26, 31, 40) и штаммов
остальных групп (VNTR 1982, 3232, MIRU 2, 4, 10, 16, 20, 23, 24, 26, 27, 31, 39,
40, ETR-A, B, C) соответственно (Supply et al., 2000; Smittipat et al., 2005; Supply
et al., 2006). 3. Выявление делеций и вставок в генах plcA, plcB, plcC и lipR
(Tsolaki et al., 2004; Talarico et al., 2005) методом ПЦР со специфическими
праймерами с последующим электрофорезом на агарозном геле. 4. Анализ
полиморфизмов в генах pks15/1 и dosT методом пиросеквенирования (Clarke,
2005). Кластерный анализ проводили с использованием программы Bionumerics
v. 6.1 (Applied Maths, Ghent, Бельгия). Генетические группы штаммов
определяли
с
помощью
всемирной
базы
(http://www.miru-vntrplus.org/MIRU/index.faces)
данных
на
MIRU-VNTRplus
основании
данных
сполиготипирования и VNTR-типирования.
Статистическую обработку результатов генотипирования и выявление
значимых ассоциаций проводили при помощи программы WINPEPI (Abramson,
8
2011). Для сравнения распределения генетических групп M. tuberculosis среди
штаммов, объединенных общими фенотипическими признаками, использовали
критерий согласия Пирсона (χ2). Для сравнения распределения генетических
групп M. tuberculosis использовали показатель соотношения (RR) с 95%-ным
интервалом достоверности (CI). Для оценки разрешающей способности и
вариабельности отдельных локусов VNTR использовали индекс ХантераГастона (Hunter et al., 1988).
РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ
Распространенность генетических групп M. tuberculosis
по районам Самарской области
Важнейшей генетической характеристикой возбудителя туберкулеза в
РФ и, в частности, в Самарской области является высокая степень
гомогенности популяции с преобладанием штаммов генетической группы
Beijing (Медведева, 2004; Балабанова, 2006; Огарков, 2007; Baranov et al., 2009;
Вязовая, 2011; Жданова, 2012а; Лац, 2013) и высокие уровни кластеризации,
свидетельствующие об активном эпидемическом процессе (Нарвская, 1999;
Норкина, 2003; Мокеева, 2005; Сивков, 2006; Марьяндышев, 2007).
В исследованной нами выборке 71,6% составляли штаммы группы
Beijing, при этом доля штаммов групп Евро-Американской линии (Haarlem,
LAM, S, Uganda, Ghana, Cameroon, URAL и X) составила 23,2%. Наибольшее
количество штаммов Евро-Американской линии, обнаруженных в Самарской
области, относилось к группам LAM (8,9%) и URAL (7,5%). Штаммы
остальных генетических групп встречались значительно реже (0,3-5,7%).
Принадлежность к генетической группе 7 штаммов (0,5%) не была определена
использованными в исследовании методами (рис. 1).
9
S
0,8%
Ghana
1,7%
Uganda
1,9%
X
URAL
0,3%
7,5%
Haarlem LAM
5,7% 8,9%
Неклассифированные
0,5%
EAI
0,1%
Beijing
71,6%
Delhi/CAS
0,1%
Cameroon
0,8%
Рис. 1. Распределение генетических групп в исследованной выборке
M. tuberculosis
На основании результатов многолокусного VNTR-типирования был
проведен кластерный анализ штаммов, при этом штаммы группы Beijing и
остальные штаммы анализировались раздельно. Кластером считались два и
более изолята с неразличимыми профилями VNTR. Из кластерного анализа
исключили 50 штаммов (3,8%) в связи с неполными данными по профилю
VNTR. Общий уровень кластеризации составил 81,6% (1024 из 1254 штаммов),
при этом уровни кластеризации среди двух групп были достоверно различны,
составив в группе Beijing 87,7% (790 из 901 штаммов), а среди остальных
генетических групп – 66,3% (234 из 353 штаммов) (RR=1,323, 95% CI=1,221,43). В обеих группах для дальнейшего анализа нами были выделены по 5
кластеров, содержащих наибольшее количество штаммов (табл. 1 и 2).
Таблица 1 − MIRU-VNTR профиль 5 крупнейших кластеров штаммов,
принадлежащих генетической группе Beijing
Число повторов в локусах
Кластер
(количество
штаммов)
10
23
26
31
40
2163b
3232
1982
4052
Samara4 (n=253)
3
5
5
5
3
6
12
8
6
Samara24 (n=103)
3
5
7
5
3
6
14
6
7
Samara12 (n=54)
3
5
5
5
3
6
14
8
8
Samara17 (n=40)
3
5
5
5
3
6
12
8
8
Samara16 (n=34)
3
5
5
5
3
6
15
8
8
MIRU
VNTR
10
Таблица 2 − MIRU-VNTR профиль 5 крупнейших кластеров штаммов,
не принадлежащих генетической группе Beijing
Число повторов в локусах
Кластер
(количество
штаммов)
2 4
10
16
20
23
24
26
27
31
39
40
A
B
C
Samara255 (n=18)
2 2
7
2
2
5
1
1
3
2
2
3
4
2
5
Samara227 (n=17)
1 2
4
3
2
5
1
5
3
2
2
4
2
2
2
Samara205 (n=13)
2 2
4
3
2
5
1
4
3
3
2
3
2
2
3
Samara228 (n=12)
1 2
4
3
2
5
1
5
3
2
2
5
2
2
2
Samara201 (n=12)
2 2
5
3
2
5
1
5
3
3
2
3
3
2
3
MIRU
ETR
Наиболее крупные кластеры в группе Beijing (Samara4, Samara24,
Samara12, Samara17 и Samara16) насчитывали от 34 до 253 штаммов, при этом
их доля составила 53,7% от общего количества штаммов Beijing (табл. 1).
Кластеры в группе штаммов, не относящихся к Beijing, были существенно
мельче, при этом на долю пяти крупнейших из них (Samara255, Samara227,
Samara205, Samara228 и Samara201) пришлось лишь 20,4% всех штаммов
группы
(табл.
2).
Наблюдаемые
высокие
уровни
кластеризации
свидетельствуют об активной трансмиссии штаммов в Самарской области,
особенно штаммов генетической группы Beijing.
Полученные данные о распределении групп и уровнях кластеризации
штаммов согласуются с предыдущими результатами исследований как в других
регионах России (Baranov et al., 2009; Makinen et al., 2011; Вязовая, 2011;
Chernyaeva et al., 2011; Маничева, 2011; Mokrousov et al., 2012; Огарков, 2012;
Савилов, 2013), так и в Самарской области (Drobniewski et al., 2005; Балабанова,
2006; Balabanova et al., 2011б). Следует отметить, что доля штаммов Beijing в
структуре популяции M. tuberculosis в Самарской области за последнее
десятилетие выросла с 62,0% в 2001-2002 гг. (Drobniewski et al., 2005) до 67,9%
в 2005 г. (Николаевский, 2005) и до 71,6% в 2008-2009 гг.
Проведенный нами анализ выявил ряд различий в распространенности
генетических групп M. tuberculosis по медицинским учреждениям и районам
проживания, при этом проживание в городах было ассоциировано с риском
заражения штаммами группы Beijing, а в сельской местности – штаммами
11
других групп. Достоверные различия в распространенности по районам были
выявлены для кластеров Samara227 и Samara228, не относящихся к Beijing
(χ2=59,566, р=0,003 и χ2=61,044, р=0,002 соответственно), а также кластера
Samara17 (χ2=47,66, р=0,047) и всей группы Beijing в целом (χ2=48,470,
р=0,040).
По
медицинским
учреждениям
достоверно
различалась
распространенность кластера Samara4 группы Beijing (χ2=29,448, р<0,005), а
также группы мелких кластеров штаммов, не относящихся к Beijing (χ2=16,015,
р=0,042).
Исходя из полученных данных, можно сделать вывод о том, что за
эпидемический процесс отвечает не генетическая группа в целом, а лишь
несколько
крупных
кластеров
внутри
нее.
Одной
из
причин
распространенности штаммов группы Beijing может являться трансмиссия
штаммов в медицинских
инфекционного
учреждениях
контроля.
Это
вследствие недостаточных
подтверждается
выявленным
мер
нами
преобладанием кластеров Samara4 (χ2=8,574, р=0,003) и Samara24 (χ2=6,163,
р=0,013) группы Beijing среди пациентов, получавших лечение в прошлом.
Генетические характеристики лекарственно-устойчивых и
чувствительных штаммов M. tuberculosis в Самарской области
Одной из особенностей эпидемиологии ТБ в РФ являются постоянно
растущие уровни распространения штаммов, устойчивых к основным и/или
резервным противотуберкулезным препаратам (Balabanova et al., 2011а;
Воробьева, 2012; Жукова, 2012; Леликова, 2013; Корецкая, 2013). Туберкулез с
множественной (МЛУ) и обширной лекарственной устойчивостью (ОЛУ)
характеризуется
значительно
более
длительными
сроками
лечения,
неудовлетворительными результатами лечения и высокой смертностью,
особенно в сочетании с ВИЧ-инфекцией (Migliori et al., 2007; Shah et al., 2007;
Balabanova et al., 2011а).
Результаты проведенных нами исследований продемонстрировали высокие
уровни лекарственной устойчивости среди изолятов, циркулирующих в
Самарской области, включая МЛУ и ОЛУ, при этом распространенность
различных типов устойчивости значительно различалась в группах впервые
12
выявленных и получавших лечение в прошлом пациентов с преобладанием
устойчивых форм среди последних (рис. 2).
А
Б
Рис. 2. Различия профилей лекарственной чувствительности штаммов,
выделенных от впервые выявленных (А) и получавших лечение в прошлом
пациентов (Б).
Полученные нами данные по уровням устойчивости в Самарской области
дополняют ранее опубликованные данные (Drobniewski et al., 2005; Balabanova
et al., 2006; Balabanova et al., 2011б) и показывают значительный рост уровня
распространенности лекарственно-устойчивых штаммов, особенно штаммов с
МЛУ: с 17,5% среди новых случаев и 34,0% среди получавших лечение в
прошлом пациентов в 2002-2003 гг. (Balabanova et al., 2006) до 37,7% и 66,6%
соответственно в 2008-2009 гг.
Анализ распространенности лекарственной устойчивости в генетических
группах и кластерах штаммов M. tuberculosis был проведен отдельно среди
впервые выявленных пациентов и пациентов, получавших лечение в прошлом.
Среди впервые выявленных пациентов распространенность лекарственной
устойчивости
среди
генетических
групп
оказалась
неравномерной:
статистически значимые ассоциации были зарегистрированы для групп Beijing,
Haarlem, LAM и URAL (χ2=14,955, p<0,001; χ2=15,095, p=0,002; χ2=35,033,
p<0,001 и χ2=10,014, p=0,018 соответственно). При этом среди штаммов группы
Beijing гораздо чаще встречались устойчивые штаммы (70,0%; 87,5% и 97,0%
штаммов с моно- и полирезистентностью, МЛУ и ОЛУ соответственно), тогда
как в группах Haarlem, LAM и URAL превалировали лекарственночувствительные штаммы. Анализ распространенности штаммов с МЛУ
(включая ОЛУ) относительно всех остальных типов устойчивости подтвердил
различия в распределении группы Beijing (RR=0,646, 95% CI=0,59-0,70),
Haarlem (RR=3,891, 95% CI=1,78-8,52), LAM (RR=3,631, 95% CI=1,95-6,76) и
13
URAL (RR=2,531, 95% CI=1,33-4,81). В свою очередь, генотип Beijing, в
отличие
от
штаммов
Евро-Американской
линии,
был
ассоциирован
практически со всеми профилями лекарственной устойчивости: полностью
чувствительными (RR=0,408, 95% CI=0,34-0,49), МЛУ без ОЛУ (RR=3,158, 95%
CI=2,28-4,38), ОЛУ (RR=13,082, 95% CI=1,79-95,50), не-МЛУ, включая
полностью чувствительных (RR=0,533, 95% CI=0,49-0,58) и МЛУ, включая
ОЛУ (RR=3,441, 95% CI=2,50-4,73), при этом наблюдались положительные
ассоциации
с
лекарственной
устойчивостью
и
отрицательные
−
с
лекарственной чувствительностью.
Полученные нами данные в целом подтверждают ранее опубликованные
результаты для Самарской области и других регионов РФ, где показана
выраженная
ассоциированность
противотуберкулезным
генотипа
препаратам,
в
Beijing
первую
с
устойчивостью
очередь
изониазиду
к
и
рифампицину (Степаншина, 2007; Дымова, 2008; Baranov et al., 2009; Brown et
al., 2010; Nodieva et al., 2010; Маничева, 2011). Причиной данной ассоциации
среди штаммов Beijing, распространенных на территории России, по-видимому,
является наличие у резистентных к изониазиду и рифампицину штаммов
определенных мутаций (в частности, S315T в гене katG и в кодоне 531 гена
rpoB) (Drobniewski et al., 2005; Nikolayevskyy et al., 2007; Дымова, 2008;
Mokrousov et al., 2009), однако генетическая природа данных ассоциаций
неизвестна. В несколько меньшей степени с генотипом Beijing ассоциирована
устойчивость к фторхинолонам и инъекционным препаратам, в основном
обусловленная мутациями в генах gyrA, gyrB и rrs. Эти точечные мутации
возникают спорадически (Mokrousov et al., 2008б; Kontsevaya et al., 2011; Casali
et al., 2012) и, таким образом, не вносят вклад в трансмиссию лекарственноустойчивых штаммов. Остальные типы мутаций, обуславливающих развитие
устойчивости к стрептомицину, пиразинамиду и другим препаратам, повидимому, в значительно меньшей степени ассоциированы с генотипом.
В формирование лекарственной устойчивости штаммов, выделенных от
ранее
лечившихся
пациентов,
значительный
вклад
вносят
клинико-
эпидемиологические факторы, которые могут привести к селекции устойчивых
штаммов в результате неправильного лечения. В группе ранее лечившихся
14
пациентов нами обнаружены достоверные различия в распространенности
штаммов с различными профилями лекарственной устойчивости внутри
генетических групп Beijing и LAM (χ2=31,284 и χ2=18,688, p<0,001). Как и среди
впервые выявленных пациентов, штаммы Beijing значительно реже встречались
среди лекарственно-чувствительных штаммов (RR=0,745, 95% CI=0,65-0,85),
тогда как LAM был распространен в данной группе гораздо чаще (RR=3,429,
95% CI=1,82-6,45). Анализ генетических характеристик штаммов с различными
типами
устойчивости
выявил
различия
практически
для
всех
групп
устойчивости, кроме групп моно- и полирезистентных штаммов и штаммов с
ОЛУ.
Полученные
данные
об
ассоциированности
различных
типов
устойчивости с отдельными кластерами хорошо согласуются с результатами
наших исследований по распространенности отдельных кластеров в Самарской
области. Статистически значимые ассоциации зарегистрированы для кластеров
Samara4 (χ2=107,299, p<0,001), Samara24 (χ2=27,932, p<0,001), Samara16
(χ2=14,402, p=0,002) группы Beijing, а также в группах малых (не относящихся к
крупнейшим пяти) кластеров (χ2=45,274, p<0,001) и уникальных (χ2=39,762,
p<0,001) штаммов, не относящихся
к Beijing.
Крупнейшие кластеры
генетической группы Beijing Samara4 и Samara24 более распространены в
группе штаммов с МЛУ (включая ОЛУ), нежели среди чувствительных
штаммов или штаммов с моно- и полирезистентностью (RR=0,164, 95%
CI=0,11-0,25 и RR=0,252, 95% CI=0,14-0,45). Группы уникальных и малых
кластеров штаммов, не относящихся к Beijing, достоверно превалировали среди
лекарственно-чувствительных
штаммов
(RR=3,480,
95%
CI=1,92-6,32
и
RR=4,193, 95% CI=2,44-7,21).
Анализ показал, что имеются достоверные различия распространенности
всех типов устойчивости среди кластеров штаммов (χ2=28,430, р=0,012 для
группы моно- и полирезистентных штаммов, χ2=36,413, р=0,001 для группы
ОЛУ, χ2=141,185, р<0,001 для группы полностью чувствительных, χ2=130,351,
р<0,001 для штаммов с МЛУ без ОЛУ). Распространенность штаммов с МЛУ
(включая ОЛУ) достоверно отличалась от таковой для штаммов без МЛУ
(включая полностью чувствительных) (χ2=174,109, р<0,001).
15
Полученные нами данные подтверждают имеющиеся представления о
генетической неоднородности группы Beijing и о том, что ассоциированность с
лекарственной устойчивостью является характеристикой отдельных генотипов
внутри
группы
Beijing
(нередко
ассоциированных
с
определенными
географическими зонами), а не группы в целом (Brown et al., 2010). Повидимому, это подтверждает гипотезу о сочетанной эволюции возбудителя
туберкулеза и человека, связанной, в том числе, с миграциями отдельных групп
людей (Mokrousov, 2008а). На основании наших исследований можно сделать
вывод о том, что в Самарской области преобладают штаммы современных
групп Beijing, родственные штаммам, распространенным в Китае и странах
Юго-Восточной Азии.
В Самарской области наблюдается активная трансмиссия устойчивых
штаммов, в особенности штаммов с МЛУ, что обусловлено, вероятно, более
длительным периодом лечения и нахождения в медицинских учреждениях
инфицированных ими пациентов, более низкой приверженностью лечению и
недостаточным
уровнем
инфекционного
контроля
на
стационарном и
амбулаторном этапах лечения. Трансмиссия чувствительных штаммов в
Самарской области выражена в меньшей степени, что может объясняться
относительно быстрой излечиваемостью инфицированных ими пациентов,
коротким периодом пребывания в стационарах и меньшей степенью контактов
с другими пациентами и здоровыми людьми.
Среди пациентов, получавших лечение в прошлом, были обнаружены
достоверные различия в распределении между профилями устойчивости
кластера Samara4 (χ2=15,201, p=0,002), Samara17 (χ2=7,909, р=0,048), Samara227
(χ2=10,544, р=0,014), а также мелких кластеров группы Beijing (χ2=10,185,
р=0,017) и не-Beijing (χ2=28,968, р<0,001).
Кластер Samara4 и мелкие кластеры Beijing достоверно чаще встречались в
группе МЛУ (включая ОЛУ) (RR=0,463, 95% CI=0,29-0,74 и RR=0,653, 95%
CI=0,46-0,92). Напротив, мелкие кластеры не-Beijing и штаммы с неполным
профилем VNTR более распространены среди не-МЛУ штаммов, включая
полностью чувствительных (RR=3,444, 95% CI=1,99-5,97 и RR=6,000, 95%
CI=1,65-21,87).
16
Нами были обнаружены достоверные различия в распространенности
кластеров штаммов в группах полностью чувствительных, штаммов с МЛУ без
ОЛУ, не-МЛУ (включая полностью чувствительных) и МЛУ (включая ОЛУ)
(χ2=74,706, χ2=44,100, χ2=61,769, χ2=61,769 соответственно, р<0,001).
Полученные данные подтверждают обнаруженные ранее закономерности
относительно трансмиссии в медицинских учреждениях кластера Samara4,
относящегося к группе Beijing и ассоциированного с МЛУ. Напротив, роль
внутрибольничной передачи в трансмиссии штаммов, не относящихся к группе
Beijing, незначительна.
Генетический полиморфизм генов, ассоциированных с
вирулентностью, среди штаммов M. tuberculosis в Самарской области
К настоящему времени в геноме M. tuberculosis идентифицирован ряд
генов, ассоциированных с повышенной вирулентностью и участвующих в
процессах
синтеза
компонентов
клеточной
стенки,
ряда
ферментов,
метаболизме липидов, а также окислительно-восстановительных процессах,
обеспечивающих внутриклеточное паразитирование микобактерий и их
выживание в условиях недостатка кислорода и питательных веществ. Наличие
полиморфизмов в таких генах может повлечь за собой фенотипические
изменения, влияющие на вирулентность микроорганизма (Sherman et al., 2001;
Boon et al., 2002; Constant et al., 2002; Raynaud et al., 2002; Voskuil et al., 2003;
Reed et al., 2004; Boshoff et al., 2005; Sheline et al., 2009).
В данном исследовании мы проанализировали наличие и распределение
в популяции M. tuberculosis Самарской области штаммов с полиморфизмами в
генах plcA, plcB, plcC (в комплексе с геном plcD кодирующих фермент
фосфолипазу С), lipR (кодирующем фермент липазу), dosT (кодирующем
сенсорную
гистидинкиназу,
входящую
в
состав
двухкомпонентной
регуляторной системы комплекса DosR) и pks15/1 (кодирующем фермент
поликетидсинтазу). Исследовались вставки последовательностей IS6110 в генах
фосфолипазы С, крупные делеции в гене липазы lipR (рис. 3), вставки размером
1-6 и 7 п.н. в гене поликетидсинтазы pks15/1 и мелкие делеции в гене
гистидинкиназы dosT (рис. 4).
17
WT
A
MUT
Б
Рис. 3. Электрофореграмма
результатов анализа гена
lipR, ассоциированного с
вирулентностью.
WT – дикий тип, фрагмент
размером 3600 п.н.;
MUT – мутантный тип,
фрагмент размером 720 п.н.
Рис. 4. Пример пирограммы.
А – последовательность дикого типа
(GACGCGTCGAATCCTACGGACAGCCCTGGT).
Б – мутантная последовательность
(GACGTGTCGAATCCTACGGGCACCCCTGGT).
По данным ряда исследователей, некоторые полиморфизмы в генах
вирулентности ассоциированы с определенными генетическими группами
(Reed et al., 2007; Caws et al., 2008; Thwaites et al., 2008; Krishnan et al., 2011).
Природа таких ассоциаций неясна, так как указанные полиморфизмы не
являются синонимичными, находятся под эволюционным давлением и имеют
фенотипическое выражение.
Среди штаммов в Самарской области полиморфизмы в генах plcA, plcB,
plcC, lipR, dosT и pks15/1 встречались в 35 (3,0%), 2 (0,2%), 6 (0,5%), 142
(15,6%),
979
(75,1%)
и
956
(74,1%)
штаммах
соответственно.
Распространенность полиморфизмов среди различных генетических групп
характеризовалась выраженной неоднородностью. Статистически значимые
различия были обнаружены для полиморфизмов в генах plcA (χ2=353,944 для
дикого и χ2=340,988 для мутантного типа, р<0,001), dosT (χ2=1063,803, р<0,001),
pks15/1 (χ2=1044,451 для дикого типа и χ2=1022,534 для вставки 7 п.н., р<0,001)
и lipR (χ2=244,037 для дикого и χ2=259,554 для мутантного типа, р<0,001), в то
18
время как существенных различий в распространенности полиморфизмов в
генах plcB и plcC обнаружено не было. Наличие полиморфизмов в генах dosT и
pks15/1 было ассоциировано с принадлежностью штамма к генетической группе
Beijing (RR=7,070, 95%CI=5,35-9,34 и RR=7,784, 95%CI=5,79-10,46), в которой
они имелись у 99,4% и 98,4% штаммов соответственно. Мутации в гене plcA
наблюдались, главным образом, среди штаммов группы LAM (n=30, 35,7%), а в
гене lipR – в группах Ghana, Cameroon, Uganda и S (RR=7,017, 95%CI=5,578,85).
Наши данные относительно ассоциированности полиморфизмов в генах
pks15/1 и dosT с генетической группой Beijing, а также plcA с группой LAM
хорошо согласуются с ранее опубликованными данными (Constant et al., 2002;
Gagneux et al., 2007; Dubiley et al., 2007). В то же время, данные об
ассоциированности дикого типа гена lipR со штаммами, принадлежащими к
принципиальной генетической группе 2 (Cameroon, Uganda, X, Haarlem и LAM)
(Sheline et al., 2009), в нашем исследовании на территории Самарской области
не подтвердились.
Анализ распространенности полиморфизмов среди кластеров штаммов
M. tuberculosis выявил значимые различия для полиморфизмов в тех же генах,
что и анализ по генетическим группам: plcA (χ2=397,592 для дикого и
χ2=406,803 для мутантного типа, р<0,005), dosT (χ2=1078,96, р<0,005),
pks15/1(χ2=1031,404 для дикого типа и χ2=1008,738 для вставки 7 п.н., р<0,005)
и lipR (χ2=153,438 для дикого и χ2=155,313 для мутантного типа).
Хотя большинство исследуемых штаммов имели интактный ген plcA
(96,9%), вставки в данном гене достоверно чаще встречались у штаммов
Samara227 и Samara228 группы LAM, чем у всех остальных штаммов
(RR=40,035, 95%CI=24,24-66,12). Низкая распространенность лекарственной
устойчивости в штаммах
этих кластеров и
потенциально
сниженная
вирулентность вследствие мутаций в гене фосфолипазы С позволяет
предположить
наличие
компенсаторных
механизмов,
обусловивших
сравнительно широкое распространение данных штаммов в Самарской области.
В группах уникальных штаммов и мелких кластеров, относящихся к
Евро-Американской линии, полиморфизмы в гене lipR встречались достоверно
19
чаще (более 40%), чем в среднем по популяции (не более 10%) (RR=6,098,
95%CI=4,44-8,38). По всей видимости, ген lipR играет незначительную роль в
трансмиссивной способности штаммов. Ассоциированные с генетической
группой Beijing полиморфизмы pks15/1 и dosT, вероятно, не являются
кластерспецифическими и могут считаться генетическими маркерами данной
группы, что ранее было показано для других популяций (Constant et al., 2002;
Gagneux et al., 2007; Fallow et al., 2010).
Анализ распространенности полиморфизмов в генах plcA, plcB, plcC,
lipR, dosT и pks15/1 в группах штаммов с различными профилями
лекарственной устойчивости продемонстрировал ассоциации для тех же генов
(plcA, lipR, dosT и pks15/1). Полиморфизмы генов plcA и lipR достоверно чаще
встречались среди полностью чувствительных штаммов и штаммов с моно- и
полирезистентностью (RR=2,557, 95%CI=1,25-5,24 и RR=2,291, 95%CI=1,603,28 соответственно). Напротив, вставки размером 7 п.н. в гене pks15/1
(RR=0,727, 95%CI=0,64-0,83) и однонуклеотидные замены в гене dosT
(RR=0,724, 95%CI=0,64-0,82) встречались чаще в группе штаммов с МЛУ и
ОЛУ.
Полностью
чувствительные
штаммы
и
штаммы
с
моно-
и
полирезистентностью достоверно чаще имели интактный тип гена pks15/1
(RR=2,841,
95%CI=2,22-3,64).
Более
мелкие
вставки
(1-6
п.н.)
чаще
наблюдались в группах штаммов с МЛУ и ОЛУ (RR=0,000, 95%CI=0,00-0,74).
Таким образом, лекарственная
устойчивость
штаммов
в
целом
статистически достоверно ассоциирована с полиморфизмами в генах dosT и
pks15/1, в то время как лекарственная чувствительность ассоциирована с
дикими типами генов dosT и pks15/1 и полиморфизмами в генах plcA и lipR.
Однако ассоциации лекарственной устойчивости с генами вирулентности,
скорее всего, носят опосредованный характер, являясь в первую очередь
ассоциациями с теми или иными генетическими группами.
Наши данные в целом подтверждают существующие представления о
том, что вирулентность и лекарственная устойчивость являются важными
факторами в эпидемическом процессе M. tuberculosis, но механизмы их влияния
различны. Вирулентность штаммов играет роль в заражении ТБ, тогда как
лекарственная
устойчивость
непосредственно
участвует
в
трансмиссии
20
заболевания, обеспечивая более длительное и массивное бактериовыделение и
тем самым повышая вероятность заболевания других людей от пациента,
инфицированного устойчивым штаммом. Скорее всего, и вирулентность, и
лекарственную
устойчивость
можно
рассматривать
как
факторы
эволюционного успеха определенных групп M. tuberculosis, в частности,
группы Beijing.
ВЫВОДЫ
1.
С
помощью
методов
типирования
по
локусам
VNTR
и
сполиготипирования выявлены основные генетические группы и кластеры
штаммов M. tuberculosis, циркулирующие в Самарской области. Установлено,
что генетическая структура популяции M. tuberculosis в Самарской области
характеризуется значительной гомогенностью. 71,6% штаммов принадлежали
генетической группе Beijing, 23,2% составляли группы Евро-Американской
линии; на группы EAI и Delhi/CAS приходилось по 0,1%. Уровни
кластеризации среди штаммов генетической группы Beijing были достоверно
выше (87,7%), чем у штаммов других генетических групп (66,3%).
2.
Показано, что генетические группы микобактерий распространены
на территории Самарской области неравномерно, при этом проживание в
городах ассоциировано с риском заражения штаммами группы Beijing, а
проживание в сельской местности − штаммами других групп. Неравномерная
распространенность кластеров генетической группы Beijing (Samara4 и мелких
кластеров) в медицинских учреждениях и преобладание кластеров Samara4 и
Samara24 среди пациентов, повторно проходивших курс противотуберкулезной
терапии, свидетельствует о значительной роли трансмиссии данных штаммов в
стационарах вследствие длительного пребывания пациентов и недостаточных
мер инфекционного контроля.
3.
и
Установлено, что штаммы внутри групп генетически неоднородны
различаются
по
способности
к
трансмиссии.
Основной
вклад
в
эпидемический процесс вносит ограниченное число крупнейших кластеров
(Samara4, Samara12, Samara16, Samara17, Samara24, Samara227 и Samara228), в
основном принадлежащих генетической группе Beijing.
21
Выявлено, что для кластеров Samara4, Samara24 и Samara16
4.
характерны
выраженная
ассоциированность
с
устойчивостью
к
противотуберкулезным препаратам и их активная трансмиссия в медицинских
учреждениях Самарской области. Лекарственно-чувствительные штаммы
входят
в
состав
малых
кластеров
или
являются
уникальными,
что
свидетельствует о незначительных уровнях их текущей трансмиссии.
5.
У штаммов M. tuberculosis, циркулирующих в Самарской области,
обнаружены ассоциации между полиморфизмами в гене plcA и генетической
группой LAM (кластерами Samara227 и Samara228), в генах dosT и pks15/1 и
группой Beijing, а также в гене lipR с большинством кластеров групп Ghana,
Cameroon, Uganda и S. Взаимосвязь между полиморфизмами в генах,
ассоциированных
с
вирулентностью,
и
чувствительностью
к
противотуберкулезным препаратам носит опосредованный характер, связанный
с неодинаковой распространенностью лекарственной устойчивости среди
отдельных генетических групп и кластеров штаммов микобактерий.
СПИСОК ПУБЛИКАЦИЙ ПО ТЕМЕ ДИССЕРТАЦИИ
Публикации в журналах, рекомендованных ВАК РФ
1.
Балабанова, Я.М. Использование автоматизированной системы
BACTEC MGIT 960 в диагностике лекарственной устойчивости к резервным
препаратам в г. Самаре / Я.М. Балабанова, И.М. Федорин, Н.А. Маломанова, Ф.
Дробниевский, В.В. Николаевский, Х. Сун, Ю.А. Машкова, Т.Г. Симак, И.С.
Концевая, О.А. Игнатьева, С.А. Миронова // Проблемы туберкулеза и болезней
легких. – 2009. – № 10. – С. 63-70.
2.
Концевая, И. С. Изучение устойчивости к противотуберкулезным
препаратам у Mycobacterium tuberculosis в Самарской области / И. С. Концевая,
О. Н. Макурина, Я. М. Балабанова // В мире научных открытий. – 2010. – № 4. –
С. 51-52.
3.
Концевая, И.С. Молекулярная эпидемиология туберкулеза: задачи,
методы, перспективы / И.С. Концевая, В.В. Николаевский, Я.М. Балабанова //
Молекулярная генетика, микробиология и вирусология. – 2011. – № 1. – С. 3-10.
22
Публикации в зарубежных журналах
4.
Kontsevaya, I.S. Evaluation of Two Molecular Assays for Rapid
Detection of Mycobacterium tuberculosis Resistance to Fluoroquinolones in HighTuberculosis and -Multidrug-Resistance Settings / I. Kontsevaya, S. Mironova, V.
Nikolayevskyy, Y. Balabanova, S. Mitchell, F. Drobniewski // Journal of Clinical
Microbiology. – 2011. – Т. 49. − № 8. – С. 2832-2837.
5.
Balabanova, Y. Survival of civilian and prisoner drug-sensitive, multi-
and extensive drug- resistant tuberculosis cohorts prospectively followed in Russia /
Y. Balabanova, V. Nikolayevskyy, O. Ignatyeva, I. Kontsevaya, C. M. Rutterford, A.
Shakhmistova, N. Malomanova, Y. Chinkova, S. Mironova, I. Fedorin, F.
Drobniewski // PLoS One. – 2011. – Т. 6. − № 6. – С. e20531.
6.
Casali, N. Microevolution of extensively drug-resistant tuberculosis in
Russia / N. Casali, V. Nikolayevskyy, Y. Balabanova, O. Ignatyeva, I. Kontsevaya, S.
R. Harris, S. D. Bentley, J. Parkhill, S. Nejentsev, S. E. Hoffner, R. D. Horstmann, T.
Brown, F. Drobniewski // Genome Res. – 2012. – Т. 22. − 4. – С. 735-745.
7.
Allix-Béguec, C. Proposal of a Consensus Set of Hypervariable
Mycobacterial Interspersed Repetitive-Unit-Variable-Number Tandem-Repeat loci
for Subtyping of Mycobacterium tuberculosis Beijing Isolates / C. Allix-Béguec, C.
Wahl, M. Hanekom, V. Nikolayevskyy, F. Drobniewski, S. Maeda, I. CamposHerrero, I. Mokrousov, S. Niemann, I. Kontsevaya, N. Rastogi, S. Samper, L. H. Sng,
R.M. Warren, P. Supply // J Clin Microbiol. – 2014. – Т. 52. − № 1. – С. 164-72.
8.
Casali, N. Evolution and transmission of drug-resistant tuberculosis in a
Russian population / N. Casali, V. Nikolayevskyy, Y. Balabanova, S. R. Harris, O.
Ignatyeva, I. Kontsevaya, J. Corander, J. Bryant, J. Parkhill, S. Nejentsev, R. D.
Horstmann, T. Brown, F. Drobniewski // Nat. Genet. – 2014. – Т. 46. − № 3. – С.
279-286.
Тезисы и статьи в материалах конференций
9.
Концевая, И. С. Эпидемиологическая характеристика штаммов
Mycobacterium tuberculosis в Самарской области / И. С. Концевая, О. Н.
Макурина, В. В. Николаевский // Материалы международной научнопрактической конференции “Теоретические и прикладные проблемы науки и
образования”. – Курск. – 2010. – С. 146-148.
23
10.
Концевая, И. С. Применение сполиготипирования в эпидемиологии
туберкулеза / И. С. Концевая // Материалы международной научнопрактической конференции “Теоретические и прикладные проблемы науки и
образования”. – Курск. – 2010. – С. 148-151.
11.
Концевая,
И.С.
Идентификация
мутаций
и
диагностика
устойчивости возбудителя туберкулеза к фторхинолонам с использованием
тест-системы GenoType® MTBDRsl в Самарской области / И. С. Концевая //
Материалы
международной
научно-практической
конференции
“Физиологические механизмы адаптации живых систем”. – Сухум. – 2011. – С.
135-139.
12.
Концевая, И. С. Распространенность основных генетических групп
M. tuberculosis в Самарской области и их ассоциированность с мутациями,
связанными
с
лекарственной
устойчивостью
к
основным
противотуберкулезным препаратам / И. С. Концевая // Материалы II
Международной научно-практической конференции «Социальные и медикобиологические вопросы адаптации». – Курск. – 2011. – С. 70-72.
13.
Концевая, И. С. Применение методов филогенетического анализа
при изучении эпидемиологии туберкулеза / И. С. Концевая // Материалы
Международной
научно-практической
конференции
«Теоретические
и
прикладные проблемы современной науки и образования». – Курск. – 2012. – С.
91-93.
14.
Balabanova, Y. Epidemiology of Drug Resistant Tuberculosis in Samara
Oblast, Russian Federation / Y. Balabanova, V. Nikolayevskyy, O. Ignatyeva, S.
Mironova, A. Kovalev, N. Malomanova, Y. Chinkova, A. Rybkina, I. Fedorin, F.
Drobniewski // Материалы совместного семинара NIAID-ISTC «Research
Opportunities in TB Drug Discovery and Diagnosis». – Москва. − 2010.
15.
Ignatyeva, O. Genetic analysis of the host-pathogen interaction in
tuberculosis (“TB-EURO-GEN”) study – progress and current tuberculosis
epidemiology / O. Ignatyeva, I. Kontsevaya, Y. Balabanova, V. Nikolaevskyy, S.
Mironova, A. Kovalev, A. Isaeva, Y. Chinkova, A. Rybkina, A. Kritskyy, D.
Gromova, M. Korobova, A. Shakhmistova, N. Malomanova, I. Fedorin, S. Nejentsev,
R. Horstmann, S. Hoffner, F. Drobniewski // Материалы 21-го Европейского
24
конгресса по клинической микробиологии и инфекционным заболеваниям. –
Милан. – 2011.
16.
Allix-Beguec, C. Typing Mycobacterium tuberculosis Beijing isolates
with hypervariable MIRU-VNTR loci: a multicentric consensus study / C. AllixBeguec, C. Wahl, M. Hanekom, S. Maeda, C. Martin, I. Mokrousov, S. Nieman, V.
Nikolayevskyy, N. Rastogi, S. Samper, L.-H. Sng, S.-X. Wang, R. Warren, P. Supply
//
Материалы
32-го
ежегодного
конгресса
Европейского
сообщества
микобактериологов. – Любек. – 2011. – С. 19.
17.
Kontsevaya, I. Performance of the GenoType MTBDRsl assay for rapid
diagnosis of extensively drug-resistant tuberculosis in HIV-coinfected patients / I.
Kontsevaya, O. Ignatyeva, V. Nikolayevskyy, Y. Balabanova, A. Kovalyov, A.
Kritsky, O. Matskevich, F. Drobniewski // Сборник тезисов 17-ой Международной
Пущинской школы-конференции молодых ученых. – Пущино. – 2013. – С. 248249.
СПИСОК СОКРАЩЕНИЙ
МЛУ – множественная лекарственная устойчивость
ОЛУ − обширная лекарственная устойчивость
ТБ – туберкулез
CI – доверительный интервал (Confidence interval)
ETR – точные тандемные повторы (Exact tandem repeats)
MIRU – микобактериальные рассеянные повторяющиеся единицы
(Mycobacterial interspersed repetitive units)
RR – показатель соотношения (rate ratio)
VNTR – вариабельные длины тандемных повторов (Variable number tandem
repeats)