Ализаде Фуад;pdf

РОССИЙСКАЯ АКАДЕМИЯ НАУК
СИБИРСКОЕ ОТДЕЛЕНИЕ
Институт химической биологии и фундаментальной медицины
На правах рукописи
АПАРЦИН
ЕВГЕНИЙ КОНСТАНТИНОВИЧ
МУЛЬТИФУНКЦИОНАЛЬНЫЕ ГИБРИДЫ НК-КОНСТРУКЦИЙ С
УГЛЕРОДНЫМИ НАНОТРУБКАМИ
02.00.10 – биоорганическая химия
Диссертация на соискание ученой степени
кандидата химических наук
Научный руководитель:
к.х.н. Новопашина Д. С.
НОВОСИБИРСК 2014
2
СОДЕРЖАНИЕ
СПИСОК ПРИНЯТЫХ СОКРАЩЕНИЙ ............................................................................................ 4
ВВЕДЕНИЕ ............................................................................................................................................. 6
ГЛАВА 1. ГИБРИДЫ УГЛЕРОДНЫХ НАНОТРУБОК С НУКЛЕИНОВЫМИ КИСЛОТАМИ:
ПОЛУЧЕНИЕ И ПРИМЕНЕНИЕ (ОБЗОР ЛИТЕРАТУРЫ) ............................................................. 9
1.1.
Методы получения гибридов нуклеиновых кислот с углеродными нанотрубками .......... 12
1.1.1. Ковалентные гибриды углеродных нанотрубок с нуклеиновыми кислотами ..................... 12
1.1.2. Нековалентные гибриды углеродных нанотрубок с нуклеиновыми кислотами ................. 14
1.1.3. Использование якорных групп для иммобилизации нуклеиновых кислот на поверхности
углеродных нанотрубок ....................................................................................................................... 18
1.2.
Применение гибридов нуклеиновых кислот с углеродными нанотрубками ..................... 20
1.2.1.
Доставка нуклеиновых кислот в клетки с использованием углеродных нанотрубок ... 20
1.2.2.
Создание биосенсоров на основе гибридов нуклеиновых кислот с углеродными
нанотрубками ........................................................................................................................................ 40
Наноассоциаты на основе гибридов НК-комплексов с углеродными нанотрубками ... 59
1.2.3.
ГЛАВА
2.
МУЛЬТИФУНКЦИОНАЛЬНЫЕ
ГИБРИДЫ
НК-КОНСТРУКЦИЙ
С
УГЛЕРОДНЫМИ НАНОТРУБКАМИ (РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ)................................. 64
2.1. Модифицированные одностенные углеродные нанотрубки и их физико-химические
свойства ................................................................................................................................................. 65
2.1.1. Карбоксимодифицированные одностенные углеродные нанотрубки .................................. 65
2.1.2. Аминомодифицированные углеродные нанотрубки .............................................................. 66
2.1.3. Флуоресцентно модифицированные одностенные углеродные нанотрубки ....................... 68
2.1.4. Характеристики модифицированных одностенных нанотрубок .......................................... 71
2.2. Конъюгаты олигонуклеотидов, содержащие пиренильную якорную группу ........................ 78
2.3.
Мультифункциональные
гибриды
пиренильных
конъюгатов
олигонуклеотидов
с
одностенными углеродными нанотрубками...................................................................................... 82
2.3.1. Формирование нековалентных гибридов пиренильных конъюгатов олигонуклеотидов с
одностенными углеродными нанотрубками...................................................................................... 83
2.3.2. Исследование стабильности олигонуклеотидов в условиях формирования гибридов с
углеродными нанотрубками ................................................................................................................ 86
2.3.3. Исследование стабильности олигонуклеотидов в культуральной среде, содержащей 10%ную эмбриональную телячью сыворотку, в составе гибрида с одностенными углеродными
нанотрубками ........................................................................................................................................ 88
2.3.4. Спектральные свойства гибридов пиренильных конъюгатов олигонуклеотидов с
модифицированными углеродными нанотрубками .......................................................................... 90
3
2.3.5. Гидродинамические свойства гибридов пиренильных конъюгатов олигонуклеотидов с
модифицированными углеродными нанотрубками .......................................................................... 92
2.3.6.
Структурные
исследования
нековалентных
гибридов
пиренильных
конъюгатов
олигонуклеотидов с одностенными углеродными нанотрубками .................................................. 94
2.3.7.
Закономерности
формирования
нековалентных
гибридов
олигонуклеотидов
с
одностенными углеродными нанотрубками...................................................................................... 96
2.4.
Мультифункциональные
гибриды
НК-комплексов
с
одностенными
углеродными
нанотрубками ...................................................................................................................................... 102
2.4.1.
Гибриды
НК-дуплексов
с
модифицированными
одностенными
углеродными
нанотрубками ...................................................................................................................................... 105
2.4.2. Гибриды трехкомпонентных НК-комплексов с модифицированными одностенными
углеродными нанотрубками .............................................................................................................. 114
2.4.3. Исследование возможности высвобождения siРНК из состава нековалентного гибрида под
действием РНКазы Н ......................................................................................................................... 119
2.5. Исследование биосовместимости и взаимодействия с клетками модифицированных
одностенных углеродных нанотрубок и их гибридов с олигонуклеотидами .............................. 121
2.5.1. Исследование цитотоксичности одностенных углеродных нанотрубок и их гибридов с
олигонуклеотидами ............................................................................................................................ 122
2.5.2. Ультраструктурное исследование взаимодействия модифицированных
одностенных
углеродных нанотрубок и их гибридов с олигонуклеотидами с клетками .................................. 123
2.6.
Гибриды
пиренильных
конъюгатов
олигорибонуклеотидов
с
вертикально
ориентированными многостенными углеродными нанотрубками для детекции РНК ............... 126
2.6.1. Получение и характеризация гибридных электродов .......................................................... 127
2.6.2. Исследование взаимодействия модельных гомоолигорибонуклеотидов-мишеней с
гибридными электродами .................................................................................................................. 129
ГЛАВА 3. ЭКСПЕРИМЕНТАЛЬНАЯ ЧАСТЬ ............................................................................... 134
3.1. Исходные материалы .................................................................................................................. 134
3.2. Основные методы работы........................................................................................................... 135
3.3. Методики эксперимента ............................................................................................................. 143
ВЫВОДЫ ............................................................................................................................................ 158
СПИСОК ЛИТЕРАТУРЫ.................................................................................................................. 160
4
Список принятых сокращений
CNT – carbon nanotubes – углеродные нанотрубки
DCA – дихлоруксусная кислота
DMAP – 4-N,N′-диметиламинопиридин
DМSО – диметилсульфоксид
EDC –1-этил-3-[3-(диметиламино)пропил]карбодиимид
EDTA – N,N,N′,N′-этилендиаминтетрауксусная кислота
FITC – изотиоцианат флуоресцеина
HEG –гексаэтиленгликоль
HMDA – гексаметилендиамин
MWCNT – multi-walled carbon nanotubes – многостенные углеродные нанотрубки
NMP – N-метилпирролидинон
PAMAM – полиамидоаминовые дендримеры
PEG –полиэтиленгликоль
PivCl – триметилацетил хлорид
Py – пиридин
Pyr – остаток пирена
siРНК – малые интерферирующие РНК
SDE –сульфонилдиэтанол
SWСNT – single-walled carbon nanotubes – одностенные углеродные нанотрубки
TBDMSi – трет-бутилдиметилсилильная защитная группа
TEA – триэтиламин
TEMED – N,N,N′,N′-тетраметилэтилендиамин
АТФ – аденозинтрифосфат
5
ДНК – дезоксирибонуклеиновая кислота
дц - двуцепочечный
НК – нуклеиновая кислота
ОЕ260 – оптическая единица
офВЭЖХ – обращенно-фазовая высокоэффективная жидкостная хроматография
оц - одноцепочечный
ПААГ – полиакриламидный гель
пДНК – плазмидная ДНК
ПЭМ – просвечивающая электронная микроскопия
РНК – рибонуклеиновая кислота
ЦВА – циклическая вольтамперометрия
6
Введение
Углеродные нанотрубки и конструкции на их основе в настоящее время находят
широкое применение в различных областях нанотехнологии, в том числе, бионанотехнологии и
наномедицины [1–7]. Интерес к этому классу наноматериалов обусловлен их уникальными
структурными,
механическими
и
электронными
свойствами,
совместимостью
с
биомакромолекулами и клетками, а также возможностью ковалентной и нековалентной
модификации [8–10]. Важным свойством углеродных нанотрубок, открывающим возможность
их биологического применения, является поглощение нанотрубок животными и растительными
клетками [11]. Другая особенность углеродных нанотрубок, а именно, высокая электрическая
проводимость, в сочетании с их совместимостью с биомакромолекулами, дает возможность
конструирования сенсорных систем для детекции широкого спектра мишеней: от малых
молекул до протяженных нуклеиновых кислот (НК), белков и живых клеток [6,12–14].
Несмотря на определенную химическую инертность углеродных нанотрубок, они могут
быть модифицированы путем введения на их поверхность функциональных групп, что
позволяет изменять свойства нанотрубок в широком диапазоне, таким образом расширяя
возможности их потенциального использования. Для введения функциональных групп на
поверхность одностенных и многостенных углеродных нанотрубок был разработан ряд методов
ковалентной и нековалентной модификации поверхности и концов нанотрубок [15,16]. С
использованием предложенных методов получают гибриды углеродных нанотрубок с
олигонуклеотидами, короткими и протяженными двуцепочечными НК, отличающиеся как
типом модификации нанотрубок, так и способом иммобилизации НК на их поверхности. В то
же время, большой интерес вызывают мультифункциональные гибриды НК с углеродными
нанотрубками, то есть гибридные конструкции, содержащие одновременно НК и другие
функциональные группировки, например, репортерные группы, на поверхности нанотрубок.
Особенности строения углеродных нанотрубок позволяют комбинировать ковалентный
и нековалентный методы функционализации, что приводит к получению наноконструкций,
содержащих одновременно несколько различных функциональных групп. Большой потенциал в
этом
плане
имеют
методы
нековалентной
модификации
поверхности
нанотрубок
полициклическими ароматическими соединениями, взаимодействующими с нею за счет π-πстэкинг-взаимодействий [17–22].
Целью
данной
работы
являлись
разработка
подхода
к
созданию
новых
мультифункциональных наноконструкций, представляющих собой нековалентные гибриды
пирен-содержащих олигонуклеотидов и НК-комплексов с модифицированными углеродными
7
нанотрубками, и демонстрация потенциальной возможности использования созданных
конструкций как транспортеров НК в клетки и компонентов электрохимических биосенсоров.
Для достижения поставленной цели необходимо было решить следующие задачи:
•
разработать методы создания мультифункциональных гибридов одностенных и
многостенных CNT с пиренильными конъюгатами олигонуклеотидов;
•
разработать методы сборки гибридов модифицированных одностенных углеродных
нанотрубок с НК-дуплексами и трехкомпонентными НК-комплексами;
•
изучить физико-химические свойства полученных мультифункциональных гибридов
одностенных углеродных нанотрубок с пиренсодержащими олигонуклеотидами и НКкомплексами, исследовать их биосовместимость и возможность проникновения в клетку;
•
изучить возможность использования электродов на основе гибридов вертикально
ориентированных многостенных углеродных нанотрубок с пиренильными конъюгатами
олигонуклеотидов для детекции РНК-мишеней.
Настоящая работа вносит вклад в изучение взаимодействий олигонуклеотидов, их
производных и НК-комплексов с модифицированными одностенными и многостенными
углеродными нанотрубками. Можно ожидать, что результаты, полученные в работе, позволят
создать
стабильные
в
биологических
средах
перспективные
мультифункциональные
транспортеры терапевтических нуклеиновых кислот в клетки и высокочувствительные
электрохимические сенсоры нуклеиновых кислот.
Положения, выносимые на защиту:
1. Разработан новый подход к получению мультифункциональных гибридов углеродных
нанотрубок с олигонуклеотидами и НК-комплексами.
2. Разработаны
новые
методы
оценки
эффективности
формирования
гибридов
пиренильных конъюгатов олигонуклеотидов с модифицированными одностенными
углеродными нанотрубками.
3. Показано, что основной вклад в эффективность адсорбции пиренильных конъюгатов
олигонуклеотидов на поверхности одностенных углеродных нанотрубок вносит тип
химической модификации нанотрубок, а также длина олигонуклеотида.
4. Разработаны и оптимизированы подходы к сборке НК-комплексов на поверхности
модифицированных одностенных углеродных нанотрубок.
8
5. Продемонстрировано высвобождение анти-mdr1-siРНК из гибрида трехкомпонентного
НК-комплекса с модифицированными одностенными углеродными нанотрубками под
действием РНКазы Н.
6. Показана низкая цитотоксичность гибридных конструкций на основе одностенных
углеродных нанотрубок в широком диапазоне концентраций, продемонстрировано их
проникновение через клеточную мембрану путем эндоцитоза.
7. Продемонстрировано специфичное распознавание модельного олигорибонуклеотидамишени за счет изменения емкостных характеристик гибридного электрода из
вертикально
ориентированных
многостенных
углеродных
нанотрубок
и
олигорибонуклеотида-зонда. Показано, что иммобилизация зонда за счет пиренильной
якорной группы на поверхности углеродных нанотрубок позволяет улучшить
аналитический сигнал.
По материалам диссертации опубликовано 4 статьи в журналах, входящих в Перечень
ведущих
рецензируемых
научных
изданий
и
журналов,
рекомендуемых
Высшей
аттестационной комиссией, глава в монографии и получен патент РФ. Результаты работы
представлены и обсуждены на российских и международных научных конференциях.
9
Глава 1. Гибриды углеродных нанотрубок с нуклеиновыми
кислотами: получение и применение (обзор литературы)
Углеродные нанотрубки (carbon nanotubes, CNT) представляют собой квазиодномерные
наноцилиндры, стенки которых построены из атомов углерода в sp2-гибридизации. Нанотрубки,
поверхность которых представляет собой одностенный цилиндр, получили название
одностенных нанотрубок (single-walled carbon nanotubes, SWCNT) (рис. 1.1а). Нанотрубки,
построенные из цилиндров разного диаметра, «вложенных» один в другой, называются
многостенными нанотрубками (multi-walled carbon nanotubes, MWCNT) (рис. 1.1б).
а
б
Рис. 1.1. Одностенные (а) и многостенные (б) углеродные нанотрубки.
Диаметр SWCNT составляет 1-2 нм, длина – от 30 нм до 2 мкм. Диаметр MWCNT
зависит от количества слоев (от 2 до 30 и более) и может достигать 50 нм при длине нанотрубки
до 2 мкм [23]. Поверхность CNT может иметь различную конформацию (рис. 1.2). Различают
конформации «кресло» (armchair), «зигзаг» и хиральную конформацию [24]. Геометрия
поверхности CNT определяет их электропроводность. Нанотрубки в конформациях «кресло» и
«зигзаг» имеют металлическую проводимость, хиральные нанотрубки – полупроводники
[25,26]. CNT интенсивно поглощают излучение в ближнем инфракрасном диапазоне (от 800 до
1600 нм) и могут обладать фотолюминесцентными свойствами [27].
Рис. 1.2. Конформации SWCNT:
а – «кресло»;
б – «зигзаг»;
в – хиральная конформация.
а
б
в
Несмотря на определенную инертность, CNT могут быть химически модифицированы
путем введения на их поверхность функциональных групп, что позволяет изменять свойства
10
нанотрубок в широком диапазоне, таким образом расширяя возможность их потенциального
применения во многих областях современной технологии – от создания конструкционных
материалов и фотоэлементов до новых инструментов биологии и медицины. Под
функциональными группами в химии CNT понимают любые органические группировки,
полимеры, макромолекулы, супрамолекулярные комплексы и др., вводимые на поверхность
CNT для придания им специфических свойств. В случае введения более одной функциональной
группы в структуру CNT, говорят о мультифункционализации. Для введения функциональных
групп на поверхность SWCNT и MWCNT был разработан ряд методов ковалентной и
нековалентной модификации [15,16].
Среди методов ковалентной модификации поверхности CNT следует выделить три
основные группы: окисление, функционализацию 1,3-диполярным циклоприсоединением
азометиновых илидов и функционализацию с использованием метода «клик»-химии [8,9].
Окисление
CNT
является
одним
из
наиболее
распространенных
типов
первичной
функционализации углеродных нанотрубок. Механизм окисления CNT в различных условиях
до сих пор не был детально изучен, однако принципиальным моментом является атака
окислителем атомов углерода в сайтах напряженности структуры. К таким сайтам на
поверхности нанотрубок можно отнести дефекты углеродной структуры (например, дефекты
Стоуна-Труэра-Уэльса), сайты допирования CNT гетероатомами, включения примесных
металлических частиц, концы нанотрубок. В качестве реагентов-окислителей используют
азотную кислоту, перманганат калия, дихромат калия, пероксид водорода в сильнокислой или
сильнощелочной среде. В зависимости от условий окисления, на поверхности CNT можно
получать карбоксильные, карбонильные и гидроксильные функциональные группы [28–30].
Наиболее широко применяют окисление концентрированной азотной кислотой с образованием
карбоксильных групп [30], окисленные CNT используют в качестве платформы для дальнейших
модификаций. Важной для биологического применения является конъюгация с алифатическими
аминами [31,32], полиаминами [33–35], полиэтиленгликолем [1] и углеводами [36,37].
Карбоксильные группы можно превращать в аминогруппы и напрямую по Гофману или по
Курциусу [38].
Функционализация CNT 1,3-диполярным присоединением азометиновых илидов
(реакция Прато) была предложена M. Prato для модификации фуллеренов [39] и позднее
применена для модификации CNT [40–42]. Азометиновый илид образуется в результате
нуклеофильной атаки α-углеродного атома аминокислоты на карбонильный атом углерода в
молекуле альдегида с последующими дегидратацией и декарбоксилированием продукта
конденсации. Циклоприсоединение полученного илида к CNT протекает в соответствии с
правилами Вудворда-Хоффмана так же, как и другие реакции циклоприсоединения.
11
Метод «клик»-химии получил широкое распространение благодаря своей простоте,
универсальности и мягким условиям ведения реакции при практически количественном выходе
продукта. Суть метода «клик»-химии состоит в катализируемом ионами Cu+ [3+2]-диполярном
циклоприсоединении азида к алкину с образованием 1,2,3-триазольного цикла. Относительно
недавно метод «клик»-химии были применен для функционализации CNT. Был разработан
метод введения азидных групп на поверхность нанотрубок путем взаимодействия с азидом иода
для конъюгации с алкинами, а также методы введения терминальных алкинов на поверхность
CNT для последующей конъюгации с азидо-синтонами [43,44].
Методы нековалентной функционализации CNT основаны на способности многих
макромолекул адсорбироваться на поверхности нанотрубок. Описана модификация SWCNT и
MWCNT синтетическими полимерами и сополимерами [33,45,46], конъюгатом фосфолипидполиэтиленгликоль [47–51]. Были получены гибриды этого производного с НК, их свойства
будут рассмотрены ниже.
Отдельно следует упомянуть функционализацию поверхности CNT полициклическими
ароматическими соединениями и их конъюгатами с другими молекулами. Показано, что
молекулы, обладающие ароматической сопряженной системой, взаимодействуют с CNT за счет
π-π-стэкинг-взаимодействий [17–22], наиболее эффективная адсорбция характерна для
антрахинона, антрацена и пирена [17]. Адсорбция ароматических молекул на CNT сильно
влияет на распределение в них электронной плотности, как следствие, значительно изменяя
спектры поглощения [17,52,53] и флуоресценции [54–56]. Пиренильные остатки выступают в
качестве якорных групп для закрепления на поверхности нанотрубок супрамолекулярных
комплексов [57,58], полимеров [49,59–62], белков [63,64] и НК (см. ниже).
Функционализация углеродных нанотрубок существенно влияет на их свойства и
реакционную способность. На сегодняшний день спектр методов функционализации
достаточно разнообразен и позволяет получать гибриды CNT с биологическими молекулами с
сохранением свойств последних, предназначенные для решения широкого круга задач. Ниже
будут рассмотрены методы получения гибридов углеродных нанотрубок с нуклеиновыми
кислотами и их применение.
12
1.1.
Методы получения гибридов нуклеиновых кислот с углеродными
нанотрубками
1.1.1. Ковалентные гибриды углеродных нанотрубок с нуклеиновыми кислотами
Методы ковалентной иммобилизации молекул НК на поверхности CNT обеспечивают
высокую стабильность синтезируемых гибридов с сохранением возможности селективной
гибридизации
олигонуклеотида
распространенным
присоединение
методом
5′-
или
с
комплементарной
получения
последовательностью.
ковалентных
гибридов
3′-аминомодифицированного
CNT-НК
Наиболее
является
олигонуклеотида
к
карбоксимодифицированным CNT, активированным с помощью карбодиимида (схема 1.1).
Возможность
использования
данного
метода
была
продемонстрирована
на
примере
модификации диспергированных CNT [65–69], массивов ориентированных CNT, а также CNT,
ковалентно присоединенных к подложке [70–72]. Описан также другой подход к получению
гибридов НК и их фрагментов с CNT, подразумевающий активацию 5′-фосфатной группы
олигонуклеотида
с
последующим
взаимодействием
с
CNT,
модифицированными
этилендиамином [73].
Схема 1.1
Следует отметить, что к поверхности окисленных CNT могут быть присоединены и
немодифицированные олигонуклеотиды [74,75] благодаря взаимодействиям аминогрупп
гетероциклических оснований с активированными карбоксильными группами, при этом
функциональная активность олигонуклеотида сохраняется.
Авторы работы [76] предложили метод ковалентного присоединения олигонуклеотида
на поверхность этилендиамин-содержащих SWCNT, обработанных бифункциональным
реагентом N-оксисукцинимидным эфиром 4-(N-малеимидометил)циклогексан-1-карбоксилата
(SMCC) для формирования реакционноспособных групп на поверхности SWCNT (рис. 1.3).
13
Взаимодействие олигонуклеотида, несущего 5′-концевые тиольные группы, с этими SWCNT
приводило к его ковалентному присоединению.
Рис. 1.3. Схема получения ковалентных гибридов SWCNT с ДНК [76].
M. J. Mogghaddam с соавт. предложили метод получения гибридов CNT-НК с
использованием фотомодификации поверхности CNT азидами различной структуры - 3′азидотимидином или N-5-азидо-2-(нитробензоилокси)сукцинимидом (рис. 1.4).
a
б
Олигодезоксирибонуклеотид
Рис. 1.4. Синтез олигодезоксирибонуклеотида на поверхности CNT, фотохимически
функционализированных с использованием азидотимидина (а) [77]. Ковалентный гибрид CNT с
олигодезоксирибонуклеотидом,
иммобилизованным
через
N-5-азидо-2(нитробензоилокси)сукцинимидный линкер (б) [78].
3′-Азидотимидин-функционализированные CNT использовали в качестве носителя для
фосфитамидного синтеза олигодезоксирибонуклеотидов (рис. 1.4а) [77]. Функционализация
14
нанотрубок
N-5-азидо-2-(нитробензоилокси)сукцинимидом
приводила
к
появлению
на
поверхности CNT фрагментов, несущих активированные карбоксильные группы, к которым на
следующей стадии присоединяли молекулы пресинтезированного 5′-аминомодифицированного
олигонуклеотида (рис. 1.4б) [78].
Достоинством ковалентной иммобилизации нуклеиновых кислот и их фрагментов на
поверхности CNT является стабильное связывание наноматериала с биомолекулой. Молекулы
олигонуклеотида, ковалентно присоединенные к поверхности CNT, способны образовывать
дуплекс с комплементарной последовательностью [77,78]. В то же время, относительно низкое
содержание на поверхности CNT сайтов, доступных для ковалентного присоединения
олигонуклеотидов, препятствует присоединению большого числа молекул НК.
1.1.2. Нековалентные гибриды углеродных нанотрубок с нуклеиновыми кислотами
Нуклеиновые
кислоты
способны
взаимодействовать
с
немодифицированными
углеродными нанотрубками за счет стэкинг-взаимодействий гетероциклических оснований с
ароматической системой CNT (рис. 1.5), гидрофильный сахарофосфатный остов в этом случае
направлен наружу от поверхности нанотрубки, что обеспечивает высокую растворимость
полученных гибридов [79–84]. Кроме того, взаимодействуя с поверхностью углеродных
нанотрубок, олигонуклеотиды разрушают пучки CNT вследствие разрыва Ван-дер-Ваальсовых
взаимодействий между индивидуальными нанотрубками.
Рис. 1.5. Модель взаимодействия
одноцепочечной ДНК с SWCNT
[79].
Результаты
расчетов
свободной
энергии
взаимодействия
олигонуклеотидов
с
индивидуальными нанотрубками показывают, что модельные олигонуклеотиды спонтанно
оборачиваются вокруг CNT с образованием целого ряда пространственных структур, среди
которых преобладают петли и спирали [85,86]. В целом пуриновые нуклеозиды обладают
бόльшим сродством к поверхности CNT, чем пиримидиновые [87–89], а структурированные
олигонуклеотиды – по сравнению с неструктурированными [90,91], что подтверждается
экспериментальными данными [92–94].
15
SWCNT обладают высоким сродством к т.н. i-мотивам, C-богатым структурным
мотивам
центромерных
и
теломерных
последовательностей
ДНК,
обеспечивающим
специфическое взаимодействие с белками [95]. Показано, что SWCNT способны не только
прочно связывать i-мотивы ДНК [96], но и стимулировать их формирование в C-богатых
олигонуклеотидах [97,98]. MWCNT, в отличие от SWCNT, практически не связывают i-мотивы,
на этом свойстве основан метод различения нанотрубок разных типов в биологических
образцах [99]. Отметим, что SWCNT способны индуцировать формирование и неканонического
дуплекса поли(rA)-поли(rA), образующегося в естественных условиях только при закислении
среды [100].
Значительный вклад в сродство олигонуклеотида к CNT вносит также геометрия
поверхности нанотрубок [101,102]. Показано, что хиральные нанотрубки эффективнее
связывают олигонуклеотиды по сравнению с нанотрубками в конформациях «кресло» и
«зигзаг» [103,104], однако путем моделирования и молекулярного дизайна были найдены
паттерны первичной структуры олигонуклеотидов, связывающиеся с высокой эффективностью
с CNT заданной хиральности [105–109]. Эти результаты находят применение в создании
хроматографических колонок для разделения CNT по диаметру [110], длине [111] и
хиральности [105].
После адсорбции на поверхности CNT олигонуклеотиды сохраняют способность
формировать дуплексы с комплементарной последовательностью [112], но за счет влияния
нанотрубок процесс гибридизации сильно замедлен [113]. Двуцепочечные фрагменты НК (РНК
или ДНК) также способны образовывать гибриды с CNT, но стабильность таких гибридов
значительно ниже, чем с одноцепочечными фрагментами, и для формирования стабильного
гибрида требуется частичное расплетение дуплекса [114].
Для получения нековалентных гибридов НК с CNT обычно применяют ультразвуковую
обработку CNT в растворе олигонуклеотида. Олигонуклеотиды и короткие НК-комплексы
сохраняют стабильность в этих условиях [47,115,116], CNT предотвращают окисление
гетероциклических оснований [117]. Сформированные гибриды сохраняют стабильность в
условиях ионообменной и эксклюзионной хроматографии [26,118,119], а также в условиях
электрохимического анализа [120–123], но разрушаются при электрофоретическом анализе
[97,98,124,125] и после транслокации через клеточную мембрану [126]. Описано также
применение
механохимической
активации
для
покрытия
поверхности
нанотрубок
нуклеозидами, нуклеотидами и протяженными ДНК [127,128].
Широкое распространение получили способы конструирования гибридов НК с CNT,
основанные на электростатических взаимодействиях катионных CNT с сахарофосфатным
остовом олигонуклеотида. Простой способ получения катионных CNT заключается в
16
присоединении алифатических аминов [33,129,130] (схема 1.2), дендримеров, несущих
концевые
аминогруппы
[118,119],
диамино-олигоэтиленгликолей
[121,131,132]
к
активированным карбоксильным группам карбоксимодифицированных CNT. Осуществляют
также синтез полиаминов на поверхности CNT [2,133,134].
Схема 1.2
дцДНК
Другой метод получения гибридов CNT-НК, основанный на электростатических
взаимодействиях одноцепочечных и двуцепочечных НК с CNT [135–137], предусматривает
функционализацию CNT по реакции Прато. Азометиновые илиды, полученные конденсацией αаминокислоты и альдегида в условиях нагревания, вводили на поверхность CNT посредством
1,3-диполярного присоединения с формированием пирролидиновых циклов. После проведения
модификации на поверхность CNT нековалентно иммобилизовали молекулы НК. С
использованием этого метода были получены нековалентные гибриды CpG-олигонуклеотидов
[138,139], малых интерферирующих РНК [140,141] и плазмидных ДНК
[142–144] с
аминомодифицированными MWCNT и SWCNT (рис. 1.6).
Рис. 1.6. Гибриды аминомодифицированных CNT с пДНК. 1 - Модель гибрида
аминомодифицированной SWCNT c пДНК, 2 - модель гибрида аминомодифицированной
MWCNT c пДНК, 3 - модель гибрида лизин-модифицированной SWCNT c пДНК [143].
Описан метод электростатического присоединения олигонуклеотидов к поверхности
нанотрубок, включающий нековалентную модификацию CNT соединениями, содержащими
гидрофобную часть, взаимодействующую с поверхностью CNT, и положительно заряженную
гидрофильную часть, которая взаимодействует с фрагментами НК. С помощью данного метода
были созданы гибриды малых интерферирующих РНК (siРНК), плазмидных ДНК и ДНК
17
тимуса теленка с CNT, функционализированными гидробромидом додецилтриметиламина
[125], гидрохлоридом цетилпиридина [145], катионными производными холестерина [146–148]
и пирена [149,150]. В качестве примера использования более сложных молекул для
присоединения НК на поверхность CNT можно привести иммобилизацию конъюгата
глицеролипида с лизиновым дендримером на поверхности нанотрубок с последующим
электростатическим взаимодействием с siРНК [151]. Среди широкого спектра катионных
полимеров для получения гибридов CNT-НК активно применяют полиэтиленимин [152–154],
поли(L-лизин)
[155],
поли(диаллилдиметиламин)
[33,74,156],
поли(пиридин-2,6-диовую
кислоту) [157], катионные глико-полимеры [158] и хитозан [159].
Селективное присоединение олигонуклеотида по сайтам функционализации CNT можно
осуществить
с
стрептавидина
использованием
с
биотином.
высокоспецифичного
Для
получения
нековалентного
нековалентных
взаимодействия
гибридов
CNT-НК
биотинилированный олигонуклеотид иммобилизуют на стрептавидин-модифицированных
CNT. Функционализация CNT стрептавидином может быть осуществлена как нековалентной
адсорбцией белка на поверхности CNT [160], так и ковалентным присоединением
стрептавидина к префункционализированным CNT [161]. В другом методе на первом этапе
CNT
модифицируют
взаимодействуют
с
биотином,
сайтами
на
втором
-
молекулы
биотинилирования.
На
стрептавидина
последнем
этапе
специфично
добавляют
биотинилированный олигонуклеотид для присоединения к молекулам стрептавидина [162].
Применение данного метода обусловлено строением стрептавидина, который является
гомотетрамерным белком с четырьмя сайтами связывания. Подходы к получению гибридов
CNT-НК,
основанные
на
взаимодействии
стрептавидин-биотин,
используют
для
иммобилизации на поверхности CNT различных олигонуклеотидов, таких как ДНКзимы,
аптамеры, олигонуклеотидные зонды и двуцепочечные ДНК-фрагменты [163–165].
Нековалентные методы иммобилизации НК на поверхности CNT привлекают внимание
исследователей вследствие их разнообразия и простоты в использовании. Преимуществом
использования нековалентных методов является возможность иммобилизации большего
количества олигонуклеотида на поверхности CNT в сравнении с ковалентными методами.
Недостатком нековалентных методов функционализации является относительно низкая
стабильность
сформированных
гибридов
(например,
возможность
десорбции
иммобилизованных соединений), а также трудности получения материала с контролируемыми
строением и составом.
18
1.1.3. Использование якорных групп для иммобилизации нуклеиновых кислот на
поверхности углеродных нанотрубок
Наряду с нековалентными и ковалентными методами получения гибридов НК с CNT
следует
отметить
подход,
сочетающий
методы
ковалентной
и
нековалентной
функционализации, основанный на использовании якорных групп для иммобилизации
олигонуклеотидов на поверхности нанотрубок. Под якорными группами для иммобилизации на
поверхности CNT понимают органические молекулы, имеющие высокое сродство к
поверхности нанотрубок и связывающиеся с ними нековалентно. На практике в качестве
якорных групп используют гиброфобные молекулы, несущие протяженные алифатические
остатки или имеющие полиароматические фрагменты.
Существуют два альтернативных подхода, использующие якорные группы для
присоединения НК и их фрагментов на поверхность CNT. В первом подходе предварительно
получают конъюгат «олигонуклеотид-якорная группа», а затем полученный конъюгат
взаимодействует с CNT для формирования нековалентного гибрида CNT-НК. Второй подход
подразумевает нековалентную функционализацию CNT якорными группами, несущими
реакционноспособные группы, с последующей их конъюгацией с олигонуклеотидом.
Эффективным методом, сочетающим функционализацию CNT и присоединение НК,
является использование в качестве якорных групп молекул фосфолипида, к гидрофобной части
которого присоединен аминомодифицированный полиэтиленгликоль. После нековалентной
функционализации
гидрофобная
часть
фосфолипида покрывает
поверхность
CNT, а
полиэтиленгликоль обеспечивает высокую гидрофильность конструкции. Далее терминальные
аминогруппы
полиэтиленгликоля
обрабатывают
бифункциональным
реагентом
N-
сукцинимидил-3-(2-пиридилдитио)пропионатом для формирования активированных S-S-групп
на
поверхности
CNT,
после
чего
5′-SH-олигонуклеотид
присоединяют
к
функционализированным CNT через дисульфидную связь. Описанный подход был использован
для получения гибридов CNT с антисенс-олигонуклеотидами [132] и siРНК [131,166–168] (рис.
1.7). Показано, что после функционализации и присоединения НК у гибридов SWCNT-НК
повышаются растворимость и биосовместимость. Следует отметить, что дисульфидная связь
может быть восстановлена тиол-восстанавливающими ферментами в лизосомах (pH 4.0-5.0),
что приводит к высвобождению активной НК.
19
Рис. 1.7. Гибриды фосфолипид-модифицированных SWCNT с олигодезоксирибонуклеотидами
и siРНК [131].
Одним из самых простых методов получения гибридов CNT-НК является присоединение
олигонуклеотидов к CNT с помощью производных пирена в качестве якорной группы (рис. 1.8).
Пиренильные якорные группы присоединяют к олигонуклеотидам ковалентно посредством
амидной связи. Для этой цели часто используют 5′- или 3′-аминомодифицированные
олигонуклеотиды, легко реагирующие с N-оксисукцинимидным эфиром пиренбутановой
кислоты в растворе или на поверхности CNT [169–172]. Также описан способ присоединения на
поверхность SWCNT олигонуклеотидов, содержащих пиренильный остаток, введенный в 2′положение одного из нуклеотидов методом «клик»-химии [173].
Рис. 1.8. Гибрид SWCNT c дцДНК,
иммобилизованной с помощью
пиренильной
якорной
группы
[172].
Применение
пиренильных
якорных
групп
для
нековалентной
иммобилизации
олигонуклеотидов и их комплексов на CNT является весьма перспективным подходом.
Основными достоинствами якорных групп такого типа являются высокая стабильность
получаемого гибрида НК с CNT, высокая плотность и степень функционализации, возможность
присоединения олигонуклеотида к функционализированным CNT, а также функционализации
CNT предформированным конъюгатом олигонуклеотид-якорная группа.
Представленные в этом разделе данные свидетельствуют о разнообразии подходов к
созданию гибридов олигонуклеотидов, НК-комплексов и протяженных НК с одностенными и
20
многостенными углеродными нанотрубками, позволяющих конструировать гибрид CNT-НК
определенным образом в зависимости от поставленной задачи. Благодаря этому, гибриды
SWCNT и MWCNT с НК находят применение в различных областях бионанотехнологии.
Примеры применения таких гибридов будут приведены ниже.
1.2.
Применение
гибридов
нуклеиновых
кислот
с
углеродными
нанотрубками
Формирование гибридов нуклеиновых кислот с углеродными нанотрубками позволяет
расширить границы применения их индивидуальных компонентов. Гибриды олигонуклеотидов
и протяженных НК с CNT находят применение в различных областях нанотехнологии,
бионанотехнологии, наноэлектроники и нанофотоники как в качестве действующего элемента,
так и платформы для создания более сложных конструкций. Так, CNT обеспечивают транспорт
НК через клеточную мембрану, увеличивают их стабильность. НК, в свою очередь,
обеспечивают селективность электродов на основе CNT, способствуют самосборке CNTнаноконструкций, изменяют электронные и оптические свойства SWCNT и MWCNT. В
настоящем обзоре будут рассмотрены три основных направления применения гибридов CNTНК: использование SWCNT и MWCNT для доставки НК в клетки, создание биосенсорных
систем на основе гибридов CNT-НК и создание наноконструкций из CNT и НК. Эти три
направления являются на сегодняшний день наиболее разработанными и достаточно полно
раскрывают функциональные возможности гибридов CNT-НК.
1.2.1. Доставка нуклеиновых кислот в клетки с использованием углеродных
нанотрубок
Доставка в клетки терапевтически значимых олигонуклеотидов, таких как антисенсолигонуклеотиды или siРНК, и протяженных НК является актуальной задачей, поскольку
развитие этого направления бионанотехнологии позволит в будущем создать новые
фармацевтические препараты, в т.ч., для направленной терапии опухолей [174,175], а также
новые конструкции для трансгенеза [176]. Для применения новых гибридных наноконструкций
на основе углеродных нанотрубок в экспериментах на живых системах требуется тщательное
изучение биосовместимости CNT и механизмов их проникновения в клетки. В данном разделе
обобщены литературные данные о влиянии различных факторов на биосовместимость CNT и
их гибридов с НК и о механизмах проникновения CNT через клеточную мембрану, а также
21
приведен ряд примеров доставки в растительные и животные клетки модельных и
биологически активных олигонуклеотидов и протяженных дцДНК.
1.2.1.1.
Представления о биосовместимости углеродных нанотрубок
Проблема биосовместимости углеродных наноматериалов, в частности, CNT, является
предметом широкого обсуждения, поскольку сфера их применения выходит далеко за пределы
фундаментальных и прикладных исследований. Действительно, в последние годы углеродные
материалы стали важным компонентом электронных устройств и композитных материалов,
выпускаемых
в
промышленных
масштабах,
что
обусловило
интерес
к
изучению
распространения CNT в биосфере и их влияния на живые организмы [177,178]. На сегодняшний
день проведены многочисленные исследования цито- и генотоксичности SWCNT и MWCNT
как in vitro, так и in vivo. Значительная доля этих исследований была проведена с
использованием коммерчески доступных немодифицированных CNT, однако, опубликован и
ряд работ по изучению влияния модификаций поверхности нанотрубок на их токсичность.
1.2.1.1.1.
Методы оценки токсических эффектов углеродных нанотрубок
Оценка токсичности CNT in vitro проводится по ряду параметров, включающих ответ
клетки на наночастицы как клетки в целом, так и отдельных клеточных структур (рис. 1.9)
[179].
Рис. 1.9. Основные виды токсических эффектов CNT in vitro.
В первую очередь представляет интерес сродство CNT к поверхности клеток и их
проникновение через плазматическую мембрану (механизмы этого процесса достаточно
сложны и разнообразны и будут рассмотрены в следующем разделе). Токсический «брутто»эффект нанотрубок на культуру клеток оценивают с помощью тестов метаболической
активности. Наиболее распространенный реагент, используемый для этой цели – бромид 3-(4,5диметилтиазол-2-ил)-2,5-дифенилтетразолия (MTT), характеризующий активность клеточных
22
редуктаз. Основной недостаток этого реагента заключается в том, что он способен
адсорбироваться на поверхности CNT, таким образом искажая результаты анализа в сторону
ложно-положительных. В связи с этим применяют реагенты следующего поколения: XTT (2,3бис-(2-метокси-4-нитро-5-сульфофенил)-2H-тетразолий-5-карбоксанилид),
MTS
(3-(4,5-
диметилтиазол-2-ил)-5-(3-карбоксиметоксифенил)-2-(4-сульфофенил)-2H-тетразолий), а также
водорастворимые соли тетразолия, например, WST-1 или WST-8 (2-(2-метокси-4-нитрофенил)3-(4-нитрофенил)-5-(2,4-дисульфофенил)-2H-тетразолий) [180]. Для оценки индукции апоптоза
или некроза наночастицами (и, в частности, CNT) используют лактатдегидрогеназный тест,
определение митохондриального потенциала [180], оценку уровня каспаз -3 и -8 [181,182] и
белка p53 [183], мечение аннексином V и окраску иодистым пропидием [184]. Для оценки
жизнеспособности могут применяться также световая или просвечивающая электронная
микроскопия и даже простое измерение оптической плотности клеточной суспензии [185].
Другой важный параметр клеточного ответа на CNT – это возможная генотокичность.
Для ее определения контролируют формирование одноцепочечных разрывов в клеточной ДНК
методом электрофореза ДНК одиночных клеток [186], а также возможные нарушения синтеза и
репарации ДНК. Для оценки активности функциональных генов используют ПЦР или ДНКмикрочипы [187], а также Вестерн-блоттинг [183,188–190]. Эти же методы, наряду с
иммуносорбцией, используются для оценки уровня экспрессии провоспалительных цитокинов
(интерлейкины -6, -8 и -18) [191].
Присутствие CNT внутри клетки способно значительно увеличивать продукцию
активных форм кислорода. Для определения количества свободных радикалов используют
флуоресцентные тесты с 2′,7′-дихлорфлуоресцеиндиацетатом [192] и другими флуорофорами и
их предшествениками. Измерения вторичных эффектов свободных радикалов проводят,
оценивая уровень перекисного окисления липидов, а также количество продукта окисления - 8гидроксидезоксигуанозина и активности супероксиддисмутазы и других ферментативных и
неферментативных клеточных антиоксидантов, например, глутатиона [182]. Для этой цели
используют как флуоресцентные тесты, так и иммуноблоттинг и ВЭЖХ.
Важным индикатором общего клеточного состояния является пролиферативная
активность. Наноматериалы, в частности CNT, взаимодействуя с клеточными культурами,
способны как подавлять, так и напротив, стимулировать пролиферацию. Количественные
характеристики влияния CNT на деление клеток получают с помощью проточной цитометрии и
метода формирования колоний [193].
Таким образом, оценка потенциальных токсических эффектов CNT-конструкций не
может быть сведена к использованию одного из тестов. Приведенные выше методы позволяют
достаточно полно охарактеризовать влияние CNT на различные функциональные системы
23
клетки.
Сочетанное
применение
этих
методов
позволяет
получать
информацию
о
функционировании органелл, клетки и клеточной культуры в целом при экспозиции с
одностенными и многостенными углеродными нанотрубками. Результаты исследований
влияния типа CNT, их длины, дефектности, химической модификации и других факторов на их
биосовместимость будут приведены в следующем разделе.
1.2.1.1.2.
Биологические эффекты углеродных нанотрубок in vitro
Многочисленные исследования влияния CNT на жизнеспособность клеток различного
происхождения доказывают, что как SWCNT, так и MWCNT демонстрируют дозо-зависимое
цитотоксическое действие на клетки линий RAW 264.7 (макрофаги мыши) [133,194], J774
(макрофаги человека) [134], клетки легких крысы [182], кератиноциты человека [191],
остеобласты [188] и др., при этом было показано, что цитотоксическое действие CNT зависит от
клеточной линии [185]. В настоящее время говорят о меньшей токсичности MWCNT по
сравнению с SWCNT, однако, прямое сравнение цитотоксичности нанотрубок разных типов
затруднено в связи с тем, что до конца неясно, следует ли оценивать цитотоксичность в
зависимости от массовой доли CNT или же в зависимости от суммарной площади поверхности
[2,176]. Отметим, что большая часть данных исследованию жизнеспособности клеток в
присутствии CNT получена с использованием MTT-теста. Как уже было упомянуто выше, за
счет неспецифической адсорбции MTT на поверхности SWCNT и MWCNT доля живых клеток
в культуре может быть ощутимо занижена (до 40%) [180].
Наряду с цитотоксическим действием, могут проявляться и генотоксические эффекты
CNT (поражение ДНК). На сегодняшний день генотоксическое действие немодифицированных
CNT исследовано на культурах животных и растительных клеток, а также на модельной
системе - плазмиде pBR322 в бесклеточной среде [183,184]. В этих работах показано, что в
эмбриональных стволовых клетках и клетках костного мозга мыши и лейкоцитах человека при
экспозиции с MWCNT возрастает частота нуклеотидных сшивок. Как следствие, усиливается
экспрессия 8-оксогуанин-ДНК-гликозилазы OGG1, белка репарации двуцепочечных разрывов
Rad51, увеличивается частота фосфорилирования гистона H2AX и убиквитино-подобной
модификации белка репарации кросс-сшивок XRCC4, а также происходит активация белка p53.
Кроме того, частота мутаций в клетках в результате взаимодействия с MWCNT увеличивается
вдвое. В клетках лука MWCNT вызывают хромосомные абберации и фрагментацию ДНК и
индуцируют апоптоз [184]. В бесклеточной среде показана корреляция между концентрацией
MWCNT и частотой одноцепочечных разрывов плазмидной ДНК [195].
Токсическое действие немодифицированных SWCNT и MWCNT напрямую зависит от
удельной площади поверхности материала. В этом случае, SWCNT должны демонстрировать
большую токсичность. Однако, в отличие от MWCNT, они подвержены более сильной
24
агрегации в пучки, что существенно осложняет сравнение свойств этих материалов. Что
касается влияния длины CNT на цитотоксичность, то в диапазоне длин до 1 мкм не выявлено
значимых различий.
Так, в работе [196] было проведено сравнение цитотоксической
активности двух фракций MWCNT диаметром 20-40 нм со средними длинами 220 и 825 нм.
Обе фракции обладали близкими значениями удельной площади поверхности. При инкубации
образцов MWCNT с клетками острой моноцитарной лейкемии человека не было выявлено
значительных различий токсических эффектов. В то же время, протяженные пучки нанотрубок
длиной более 20 мкм вызывают асбестоподобное поражение тканей [197,198].
Важную роль в проявлении токсичности углеродных наноматериалов играют остаточные
частицы катализаторов газофазного синтеза и дефекты поверхности [199]. Остаточные примеси
металлов вызывают окислительный стресс, выражающийся в накоплении активных форм
кислорода, продуктов перекисного окисления липидов, уменьшении содержания глутатиона,
что приводит к гибели клеток [182,200]. Образование в структуре CNT дефектов изменяет
сродство нанотрубок к биологическим молекулам [143,201], что также сказывается на реакции
клеток на CNT. В первую очередь, это справедливо для наиболее распространенного типа
дефектности
CNT,
дефектов
Стоуна-Труэра-Уэльса
(изомеризация
конденсированной
ароматической системы из четырех шестичленных циклов в систему из двух семичленных и
двух пятичленных) [202]. После очистки образцов CNT от примесей катализаторов и окисления
дефектных сайтов поверхности CNT химическими методами их токсичность резко снижается
[181,194,203,204].
Значительный вклад в токсический эффект CNT вносит способ диспергирования
нанотрубок. Известно, что в водных растворах SWCNT и MWCNT имеют ярко выраженную
тенденцию к агрегации, что препятствует какому бы то ни было поглощению клетками.
Использование поверхностно-активных веществ для диспергирования CNT, с одной стороны,
позволяет получать однородные растворы нанотрубок, что облегчает их взаимодействие с
клетками, с другой стороны, реагенты, используемые для диспергирования углеродных
нанотрубок могут обладать собственным цитотоксическим эффектом [191,205,206]. Ярким
примером таких токсических веществ являются синтетические ПАВ, применяемые для
диспергирования CNT в небиологических системах, использование которых невозможно при
работе с клетками и живыми организмами, например, додецилсульфат натрия [207].
Свести к минимуму возможное токсическое действие CNT возможно путем химической
модификации их поверхности. Из всего разнообразия описанных на сегодняшний день методов
ковалентной и нековалентной функционализации поверхности CNT, для применения в живых
системах часто используют методы, модулирующие взаимодействия нанотрубок с клетками за
счет появления положительного эффективного заряда на поверхности нанотрубок или
25
повышения их гидрофильности. К таким методам относятся присоединение органических
аминов [9,16,208], модификация положительно заряженными малыми биомолекулами (холин
[33], глюкозамин [209] и др.), присоединение к CNT белков [210–212], нековалентная
модификация
поверхности
нанотрубок
катионными
полимерами
[33].
Другой
распространенный вариант химической модификации CNT – ковалентная или нековалентная
модификация молекулами полиэтиленгликоля. Модифицированные подобным образом CNT не
влияют на функциональную активность клеток иммунной системы, практически не уменьшают
выживаемость клеток многих линий в условиях длительной экспозиции, вызывают
существенно меньшее накопление в клетках активных форм кислорода [213]. На сегодняший
день показана биосовместимость SWCNT и MWCNT, несущих органические фрагментыбиомиметики (полиамины, полиэтиленгликоль и др.).
В отличие от влияния химической модификации CNT на их биосовместимость, вклад
введения НК на поверхность нанотрубок до сих пор исследован слабо. Опубликованные данные
свидетельствуют, что в целом формирование гибридов с модельными олигонуклеотидами не
вносит значительного вклада в биосовместимость CNT [155]. Лишь в случае использования
немодифицированных CNT проникновение их гибридов с модельными олигонуклеотидами в
клетки сопровождается более острым проявлением цитотоксических эффектов, что, однако,
можно объяснить большей доступностью гибрида для взаимодействия с клетками по сравнению
с исходными наночастицами за счет разрушения пучков нанотрубок [126]. пДНК, покрывая
поверхность CNT, напротив, уменьшают токсичность гибридных конструкций [158]. При
исследовании биосовместимости гибридов CNT с терапевтическими НК дополнительным
препятствием выступают их собственные биологические эффекты. Так, доставка в клетки
siРНК, вызывающей интенсивный интерфероновый ответ, приводит к гибели 70-90% клеток, в
зависимости от типа клеточной линии, сходный эффект наблюдается при использовании siРНК,
направленной на мРНК гена кинезина [215]. Доставка в клетку siРНК, направленных на мРНК
генов, менее критичных для жизнедеятельности клетки, не сопровождается проявлением
токсических эффектов [151,215]. В целом, биосовместимость гибрида CNT-НК определяется в
основном биосовместимостью нанотрубок-транспортера [145]. Представленные результаты
свидетельствуют о том, что объем опубликованных данных по биосовместимости гибридов НК
с модифицированными SWCNT и MWCNT пока недостаточен, и требуется более детальное
изучение вклада в биологический эффект гибридов как химической модификации нанотрубок,
так и введения НК на их поверхность.
Завершая рассмотрение токсических эффектов CNT in vitro, нельзя не отметить, что не
всегда токсические эффекты CNT считаются нежелательным явлением. Растворы CNT, пленки
и композиты на их основе представляют собой перспективный материал для создания
26
антимикробных покрытий [216–220]. Так же, как и в случае культур клеток млекопитающих,
основной вклад в токсический эффект CNT по отношению к микроорганизмам и рачкам
дафниям вносят степень диспергирования CNT [221], электронная структура CNT [222] и
степень их химической модификации [223].
Следует также упомянуть, что CNT за счет своей жесткой структуры способны
эффективно стимулировать остеогенез. Как индивидуальные нанотрубки, так и их сети служат
хорошим субстратом для роста остеобластов. Данный эффект показан как для SWCNT
[204,224], так и для MWCNT [225–229]. Описано стимулирующее действие CNT на
пролиферацию фибробластов [230] и миоцитов [231], дифференцировку мезенхимальных
[227,232–234], нейральных [235] и эмбриональных стволовых клеток [236], причем
функционализация CNT приводит к усилению эффекта.
1.2.1.1.3.
Биологические эффекты углеродных нанотрубок in vivo
Проникновение наночастиц в организм возможно в
результате
перорального
или
внутривенного
введения,
чрескожного проникновения и попадания в легкие с током
воздуха. На организменном уровне большое значение имеет
распределение CNT по органам после проникновения (рис.
1.10). Для экспериментальной оценки распределения CNT в
организме используют, как правило, мышиные модели,
визуализацию нанотрубок в тканях осуществляют методом
гамма-сцинтиграфии. Такой подход к визуализации требует
модификации нанотрубок хелатирующими агентами, такими
как DOTA (1,4,7,10-тетраазациклододекан-N, N′, N′′, N′′′тетрауксусная
кислота)
и
DTPA
(диэтилендиаминпентауксусный диангидрид) с последующей
инкубацией в растворе солей гамма-излучающих изотопов,
например, меди-64, технеция-99m, индия-111 или иода-125
[50,237–240]. Показано, что при системном введении SWCNT
и MWCNT накапливаются преимущественно в печени и
селезенке, значительно меньше - в почках и мочевом пузыре
[50,237]. В первые 15 минут после введения нанотрубки
Рис. 1.10. Распределение CNT в детектируют и в легких [238,239], до 6 часов после введения
организме и основные очаги
обнаруживают следы нанотрубок в крови [238], 80%-ный
поражения.
клиренс из крови достигается за 10 ч [240]. Большая часть
исследований распределения и токсического действия CNT in vivo была выполнена на
27
лабораторных мышах. В условиях внутривенного введения немодифицированные SWCNT
обладают тератогенным действием на эмбрионы мыши даже в малых дозах [241], а
протяженные MWCNT вызывают асбестоподобное поражение тканей [197], однако связывание
с
белками
крови
иммуноглобулинами,
(фибриногеном,
альбумином,
трансферрином)
значительно уменьшает их цитотоксичность [242]. Как уже было упомянуто выше,
модификация поверхности CNT полиэтиленгликолем позволяет элиминировать токсические
эффекты и продлить время циркуляции нанотрубок в кровотоке [1,243,244]; при попадании в
печень полиэтиленгликоль-модифицированные CNT претерпевают дефункционализацию [245].
В
отдельных
случаях
функционализация
поверхности
приводит
к
появлению
иммуностимулирующих свойств углеродных нанотрубок, что дает возможность рассматривать
их как потенциальные иммунотерапевтические агенты, а также в качестве адъювантов при
вакцинотерапии опухолей и инфекционных заболеваний [246].
Путем выбора адресующих молекул можно повлиять на распределение СNT в организме
при системном введении. Так, модификация нанотрубок RGD-пептидом (циклический
пентапептид, содержащий аминокислотную последовательность Arg-Gly-Asp), лигандом αVβ3интегрина, позволила перенаправить до 50% модифицированных SWCNT в опухоль U87MG с
повышенной
экспрессией
интегрина
[237,247],
а
модификация
SWCNT
лигандами
глюкокортикоид-индуцируемого рецептора фактора некроза опухолей позволила селективно
направлять нанотрубки в опухоль [248]. Полученные результаты подтверждают возможность
создания эффективных систем адресной доставки терапевтических препаратов на основе CNT.
Чрескожное проникновение углеродных нанотрубок в организм затруднено. Это связано
с тем, что кожа состоит из нескольких слоев эпителия, формирующих многослойный защитный
барьер. В экспериментах на лаборатоных мышах было показано, что большая часть CNT
задерживается слоями кожи, экспозиция углеродных материалов с кожей не приводит к ее
существенному
поражению.
CNT,
как
и
другие
углеродные
материалы,
вызывают
незначительное воспаление [249]. Пероральное введение CNT также не приводит к
существенному поражению тканей организма [250].
Поражение организма наночастицами при их попадании в дыхательные пути является
одной из наиболее острых проблем нанотехнологии. В условиях промышленного производства
наноматериалов, в частности, CNT, формирующих аэрозоли, следует тщательно изучать
потенциальные риски производства и разрабатывать способы предотвращения поражения
дыхательных
путей.
Имеющиеся
данные
по
ингаляционному
поражению
организма
немодифицированными углеродными нанотрубками in vivo свидетельствуют об индукции
воспаления [251,252] и фиброза легких у мышей [253,254]. Попадание нанотрубок в легкие
приводит к резким изменениям профиля окисления в клетках легочного эпителия в результате
28
интенсивной продукции активных форм кислорода и, как следствие, к индукции апоптоза [255].
Описаны изменения сердечного ритма у мышей в результате массированного ингаляционного
поражения легких нанотрубками [256].
В то же время, химическая функционализация поверхности нанотрубок позволяет свести
к минимуму токсические эффекты [257]. На сегодняшний день наиболее популярной
модификацией CNT для использования in vivo является ковалентное или нековалентное
введение остатков полиэтиленгликоля на поверхность нанотрубок, что позволяет увеличить
время циркуляции CNT-конструкций в кровотоке, практически не вызывая выраженной
реакции со стороны иммунной системы [1,243,258,259]. Для других типов модифицированных
CNT не опубликовано надежных данных о возможном ответе на них на организменном уровне.
К сожалению, до сих пор не опубликовано работ по исследованию биологических
эффектов in vivo гибридов CNT-НК в сравнении с CNT, не несущими НК. Можно ожидать, что
развитие применения гибридов SWCNT и MWCNT с олигонуклеотидами и НК-комплексами в
биологических системах в качестве инструментов терапии и диагностики будет сопровождаться
накоплением результатов и о биосовместимости гибридных наноконструкций.
Представленные
в
данном
разделе
данные
свидетельствуют
о
том,
что
немодифицированные SWCNT и MWCNT проявляют острую и хроническую токсичность in
vitro и in vivo, причем определяющий вклад в токсичность вносят не длина и структура, а
наличие дефектов и химическая модификация поверхности. Возможность химической
функционализации поверхности CNT позволяет использовать их в качестве транспортеров
терапевтических агентов в определенную ткань-мишень и внутрь клеток.
1.2.1.2.
Механизмы проникновения углеродных нанотрубок и их гибридов с НК
через плазматическую мембрану
Применение CNT в качестве внутриклеточных
транспортеров терапевтических
препаратов требует изучения механизмов проникновения CNT в клетки-мишени. Исследования,
проведенные за последние десять лет, позволяют утверждать, что наиболее характерными
путями проникновения углеродных нанотрубок в клетки являются фагоцитоз, макропиноцитоз,
пассивная
диффузия
и
клатрин-опосредованный
эндоцитоз
(рис.
1.11).
Механизм
проникновения CNT в клетки зависит от длины нанотрубок, метода их функционализации,
степени и способа диспергирования, способности к формированию супрамолекулярных
гибридов и других факторов [11,260,261].
29
Рис. 1.11. Основные пути проникновения CNT в клетки [11].
Для пучков SWCNT диаметром около нескольких нанометров, а также для длинных
углеродных нанотрубок длиной более 1 мкм наиболее вероятным механизмом интернализации
является фагоцитоз [262–265]. Фагоцитоз - это процесс, при котором макрофаги и клетки
тканей организма захватывают и разрушают клеточные фрагменты, бактерии или твердые
микрочастицы.
Гибриды ДНК с SWCNT за счет меньших размеров частиц и лучшего их
диспергирования способны проникать в клетки по механизму эндоцитоза [266] и
макропиноцитоза [267], что показано на модели эндотелиальных клеток сосудов пуповины
человека. С помощью методов конфокальной микроскопии и ПЭМ авторы работы подтвердили
проникновение SWCNT в клеточные вакуоли. Следует отметить, что в вакуолях наблюдали не
индивидуальные SWCNT, а их агрегаты, что может свидетельствовать об отделении свободной
ДНК с поверхности нанотрубок. Для подтверждения проникновения гибрида SWCNT-ДНК
путем макропиноцитоза, активируемого полимеризацией актина, авторы использовали
ретровирус, ингибирующий ГТФазу гена Rac1, отвечающего за полимеризацию актина вблизи
плазматической мембраны. Было показано, что в присутствии ретровируса уровень
проникновения гибридов уменьшился на 90%.
30
Углеродные нанотрубки, формирующие гибриды с олигонуклеотидами, белками,
моноклональными антителами и другими биологически активными веществами, способны к
интернализации в клетки путем клатрин-зависимого эндоцитоза [152,263,268–270]. Клатрин –
клеточный белок, способствующий изгибанию мембраны для захвата частиц и их транспорта
внутрь клетки. Для подтверждения предполагаемого механизма проникновения авторы работы
[266] применяли хлорпромазин, ингибирующий формирование клатрин-опушенных пузырьков.
С помощью конфокальной микроскопии и ПЭМ было показано отсутствие гибридов в клетках
при добавлении хлорпромазина. Предполагали, что, вследствие естественного ограничения
размерами клатриновых пузырьков (диаметр до 150 нм), SWCNT длиной около 1 мкм и
MWCNT длиной более 600 нм, не способны проникать в клетки путем клатринопосредованного эндоцитоза. Однако последние экспериментальные исследования в данной
области показали, что теоретические ограничения размеров являются неточными [266].
Для функционализированных углеродных нанотрубок, не несущих биологически
активные молекулы, реализуется механизм пассивной диффузии [271–273]. Процесс
проникновения включает проникновение CNT в клеточную мембрану и диффузию внутрь
клетки, хотя точный механизм интернализации остается не полностью выясненным.
Выдвинуты предположения о возможном проникновении нанотрубок через плазматическую
мембрану в результате ее пронзания [126,138,274], или путем, аналогичным проникновению
мембрано-проникающих белков [275]. Механизм пронзания (т.н. «наношприц») объясняют
самопроизвольным проникновением CNT через липидный бислой путем диффузии без затрат
энергии. Механизм включает двухступенчатый процесс, в котором CNT сначала связываются с
поверхностью
клеточной
мембраны,
а
затем
переориентируются
для
принятия
трансмембранной конфигурации. С помощью математических методов было смоделировано
проникновение в клеточную мембрану одиночных углеродных нанотрубок (см., например,
[276]). Следует отметить, что длина CNT влияет на их способность к проникновению: короткие
CNT (длиной до нескольких сотен нанометров) способны проникать в клеточную мембрану
более эффективно, чем длинные CNT (длиной до нескольких микрометров), образующие пучки
[260]. Проникновение CNT через плазматическую и ядерную мембраны клеток [277] путем
диффузии было подтверждено методами конфокальной микроскопии и ПЭМ.
Для доказательства проникновения CNT в клетки по механизму пассивной диффузии
авторы опубликованных работ проводили эксперименты при низких температурах или в
присутствии
ингибиторов
эндоцитоза.
Необходимо,
однако,
отметить,
что
широко
используемый в работах в качестве ингибитора эндоцитоза азид натрия является ингибитором
многих клеточных процессов, и результаты, полученные в описанных работах, могут вызывать
сомнение.
31
Таким образом, механизмы проникновения CNT в клетки остаются не до конца
изученным. В данной области необходимы более детальные исследования, сочетающие
подходы молекулярной биологии с использованием современных микроскопических методов.
Полное понимание механизмов проникновения CNT в клетки на молекулярном уровне
позволит осуществить рациональный дизайн терапевтических препаратов на основе CNT.
1.2.1.3.
Примеры
применения
углеродных
нанотрубок
как
транспортеров
нуклеиновых кислот в клетки
Как было отмечено выше, CNT способны взаимодействовать с клетками различных
линий и проникать через плазматическую мембрану, что делает их крайне перспективными
объектами для создания систем доставки терапевтических препаратов. Действительно,
благодаря наличию приемов ортогонального введения различных функциональных групп, в том
числе и репортерных, эффективности проникновения в клетки и высокой биосовместимости
после функционализации поверхности, CNT широко используются для доставки биологически
активных соединений in vitro и in vivo [15,136,166,176,200,278–285]. Большой интерес вызывает
возможность использования CNT в качестве транспортеров НК.
Первые работы по доставке НК в растительные и животные клетки проводили с
использованием модельных олигонуклеотидов (рис. 1.12а). Задачей этих экспериментов было
показать принципиальную возможность доставки НК с использованием углеродных нанотрубок
(см. табл. 1.1). В качестве платформы для создания гибридов с НК использовали
немодифицированные нанотрубки [126,268,286], окисленные SWCNT [287] и покрытые
катионными полимерами [155,288]. На 5′- или 3′-конец олигонуклеотидов вводили
флуоресцентные группы, и детекцию наноконструкций в клетке проводили методом
конфокальной микроскопии. Ту же цель преследовали авторы работ по доставке плазмидных
ДНК (рис. 1.12б) в клетки млекопитающих (см. табл. 1.1). Для трансгенеза выбирали плазмиды,
кодирующие легко детектируемые белки: люциферазу [152,289,290], β-галактозидазу [142,143]
и зеленый флуоресцентный белок [158]. Была продемонстрирована бόльшая эффективность
трансгенеза
с
(липофектамин).
использованием
CNT
по
сравнению
с
референтным
транспортером
32
Рис. 1.12. Доставка модельных олигонуклеотидов (а), плазмидных ДНК (б) и CpGолигонуклеотидов (в) в клетки с использованием CNT.
Для доставки НК в клетки используют, как правило, фракции коротких CNT (в
основном, до 500 нм длиной), что в сочетании с функционализацией поверхности химическими
методами
обеспечивает
высокую
биосовместимость
гибридных
CNT-НК-конструкций.
Доставка олигонуклеотидов, siРНК и протяженных ДНК не сопровождается острыми
токсическими эффектами как в экспериментах на клеточных культурах, так и in vivo на
организменном уровне. Ответ живых систем на введение наноконструкций выражается
преимущественно в выбросе провоспалительных цитокинов. Этот эффект может быть
дополнительно усилен введением иммуностимулирующих олигонуклеотидов (рис. 1.12в) (см.
табл.
1.1).
Так,
доставка
CpG-олигонуклеотидов
с
помощью
MWCNT,
аминомодифицированных по реакции Прато, приводит к увеличению секреции интерлейкина-6
и интерферона-гамма [138,139].
Гибриды углеродных нанотрубок с нуклеиновыми кислотами могут быть использованы
в качестве транспортеров терапевтических нуклеиновых кислот в клетки для подавления
экспрессии генов и направленного уничтожения опухолевых клеток. В таблице 1.2
представлены примеры доставки антисенс-олигонуклеотидов (рис. 1.13а) и siРНК (рис. 1.13б) in
vitro и in vivo с помощью углеродных нанотрубок.
Рис. 1.13. Доставка антисенс-олигонуклеотидов (а) и siРНК (б) в клетки с использованием CNT.
33
Для направленного подавления экспрессии генов используют гибриды SWCNT и
MWCNT с антисенс-олигонуклеотидами и siРНК. Преимуществами доставки терапевтических
олигонуклеотидов с помощью углеродных нанотрубок являются повышение их устойчивости к
расщеплению нуклеазами в составе гибрида с CNT, а также высокая эффективность
трансфекции по сравнению с другими трансфекционными агентами, что позволяет уменьшить
количество siРНК, необходимой для достижения терапевтического эффекта [291,292].
Направленное
уничтожение
опухолевых
клеток
достигается
путем
доставки
siРНК,
индуцирующих переход клеток в апоптоз. В большинстве работ для присоединения
терапевтической НК на поверхность CNT используют нековалентные методы. Для доставки
антисенс-олигонуклеотидов и siРНК используют как немодифицированные углеродные
нанотрубки
[215], так и модифицированные аминами (этилендиамин, гексаметилендиамин
[130,293], дендримеры [35,151,294] и дендроны [141,295]), катионными полимерами
(поли(диаллилдиметиламин) [33], полиэтиленимин [145,296,297], полилизин [298]). Отдельно
следует отметить серию работ по доставке антисенс-олигонуклеотидов и siРНК в клетки с
использованием SWCNT, модифицированных конъюгатами фосфолипидов с диаминополиэтиленгликолем
[131,132,166–168,298,299].
Олигонуклеотиды
иммобилизуют
поверхности CNT нековалентно или посредством биодеградируемой дисульфидной связи.
на
34
Таблица 1.1. Примеры доставки модельных олигонуклеотидов, плазмидных ДНК и CpG-олигонуклеотидов в клетки млекопитающих
с помощью углеродных нанотрубок
Путь
Доставляемый
Эффект (метод
CNT-транспортер
проникновения
Ссылка
олигонуклеотид
Объект
(репортерная группа)
(метод
регистрации)
(репортерная группа)
регистрации)
Модельные олигонуклеотиды
поли-(rU) (иодистый
пропидий)
MCF7 (человек)
SWCNT, 400 нм
5′-CATTCCGAGTGTCCAX, X=Cy3 или флуоресцеин
HL60, HeLa
(человек)
SWCNT, до 1 мкм
5′-FITCCTTCTTCATGCTCAACCT
GGTGCTC
5′-FITCTCTGGTCGGAATTCTTCT
CTGTGTGTGTGTGTGTGT
GTGTGTGTGTGTGTGTGT
GTGTGT
(dT)20
B1-лимфоциты
(мышь Balb/c)
[126]
Клатринзависимый
эндоцитоз (КМ)
Накопление
флуоресценции
(ПЦ, КМ)
[268]
Активация
лимфоцитов (ПЦ)
[155]
Накопление
флуоресценции
(КМ)
[287]
Комплекс SWCNT с поли-L-лизином,
Наношприц (КМ)
1.5 мкм
BY-2 (табак)
SWCNT-COOH, <500 нм
Эндоцитоз (КМ)
HeLa (человек)
Комплекс SWCNT с конъюгатом
поли-L-лизина и ПЭГ, 280 нм (Alexa
647)
н/о
SWCNT, 800-900нм
н/о
Клетки
5′-FITCCCTGAGCCATGATCAAA микроваскулярного
эндотелия (крыса)
CCTGTGCAGT
Плазмидная ДНК pCMVLuc, несущая ген
люциферазы
н/о
Накопление
флуоресценции
(КМ)
293, COS7, HepG2
(человек)
Плазмидные ДНК
MWCNT с выращенными на их
поверхности полиамидоаминовыми
дендронами (флуоресцеин)
н/о
Накопление
сигнала (КМ, КРспектроскопия)
Накопление
флуоресценции в
цитоплазме и ядре
(КМ)
Накопление
люциферазы в
клетках (Фл)
[288]
[286]
[152]
35
Плазмидная ДНК pCMVBgal , несущая ген βгалактозидазы
Плазмидная ДНК pCMVBgal , несущая ген βгалактозидазы
CHO (хомячок)
MWCNT, аминомодифицированные
Наношприц (ПЭМ)
по реакции Прато, 200 нм
A549 (человек)
SWCNT и MWCNT,
аминомодифицированные по реакции
Прато
н/о
Плазмидная ДНК pEGFP ,
несущая ген зеленого
флуоресцентного белка
HeLa (человек)
Конъюгат SWCNT-сополимер 3глюконамидопропилметакриламида и
2-лактобионамидоэтилметакриламида
н/о
Плазмидная ДНК pGL-3,
несущая ген люциферазы
(Cy3)
COS-7, HeLa
(человек)
MWCNT с выращенными на их
поверхности полиамидоаминовыми
дендронами
н/о
Плазмидная ДНК pGL-3,
несущая ген люциферазы
HeLa (человек)
Комплекс DWCNT с
полиэтиленимином (хлорокин)
н/о
Накопление βгалактозидазы
(люминометрия)
Накопление βгалактозидазы
(люминометрия)
Накопление
зеленого
флуоресцентного
белка (КМ)
Накопление
люциферазы и Cy3
в клетках (КМ)
Накопление
люциферазы в
клетках (Фл)
[142]
[143]
[158]
[289]
[290]
CpG-олигонуклеотиды
Увеличение
5′-TCCATGACGTTCCTGA
SWCNT и MWCNT,
TGCT;
секреции IL-6 и
Спленоциты мыши аминомодифицированные по реакции
н/о
IFN-γ
5′-TCCAGGACTTCTCTCA
Прато
(иммуносорбция)
GGTT
Примечание: КМ – конфокальная микроскопия; ПЦ – проточная цитофлуориметрия; Фл – флуоресцентная спектроскопия.
[138,139]
36
Таблица 1.2. Примеры доставки антисенс-олигонуклеотидов и siРНК в клетки млекопитающих с помощью углеродных нанотрубок
Путь
Эффект (метод
проникновения
Мишень
Объект
CNT-транспортер
Ссылка
(метод
регистрации)
регистрации)
Антисенс-олигонуклеотиды
Накопление
Ингибирование
Конъюгат SWCNT-PAMAM
SWCNT в клетках
мРНК сурвивина
MCF-7 (человек)
пролиферации
[35]
поколения 1-4
подтверждали
(MTT)
методом ПЭМ
Снижение
Конъюгат MWCNT-PAMAM
Наношприц (КМ,
мРНК белка C-Myc
MCF-7 (человек)
экспрессии белка
[294]
поколения 1-5
ПЭМ)
C-Myc (ВБ)
Снижение
мРНК
Комплекс SWCNT-фосфолипидэкспрессии мРНК
тирозинфосфатазы
Т-лимфоциты (человек)
полиэтиленгликоль-S-Sн/о
(ПЦР в реальном
[132]
N22 (PTPN22)
олигонуклеотид (120-200 нм)
времени) и белка
PTPN22 (ВБ)
siРНК
Комплекс SWCNT-фосфолипидСнижение
мРНК ламина A/C
HeLa (человек)
полиэтиленгликоль-S-S-siРНК
Эндоцитоз (КМ) экспрессии ламина
[131]
(50-300 нм)
(КМ)
Накопление в
Снижение
мРНК Т-клеточных
Т-клетки,
Комплекс SWCNT-фосфолипидкультуре клеток
экспрессии
рецепторов CD4,
периферические
полиэтиленгликоль-S-S- siРНК
доказывали
[167]
рецепторов (ПЦ,
CXCR4/CCR5
мононуклеары (человек)
(200 нм)
методами ПЦ и
ФМ)
ФМ
SWCNT, модифицированные
мРНК сигналСнижение
Кардиомиоциты крыс
гексаметилендиамином, холином Наношприц (ФМ,
регулирующих киназ
экспрессии белков
[33]
Wistar
или полидиаллилдиметиламином
ПЭМ)
ERK1/ERK2
(ВБ)
(100-1000 нм)
Снижение
SWCNT, модифицированные
экспрессии мРНК
[130,293]
мРНК циклина A2
К562 (человек)
гексаметилендиамином (50-300
н/о
(ОТ-ПЦР) и белка
нм)
циклина А2 (ВБ)
37
Нет мишени
(использовали
токсичную siРНК)
мРНК временных
рецепторов Ca2+
(TRPC3, TRPC6)
In vitro:
SVEC 4-10, 2F2B,
B16F10, NIH 3T3
(мышь); Calu 6, A549,
MCF-7, DU145, C-33 A,
293, HeLa (человек),
In vivo:
Мышь с привитой
опухолью Calu 6
Зрелые клетки скелетных
мышц (человек)
MWCNT,
аминомодифицированные по
реакции Прато (500-2000 нм)
н/о
Индукция
апоптоза
[140]
Комплекс SWCNT-фосфолипидполиэтиленгликоль-S-S- siРНК
Накопление в
культуре клеток
доказывали
методом КМ
Снижение
экспрессии
рецепторов (ВБ)
[168]
Накопление в
культуре клеток
доказывали
методом КМ
Снижение
экспрессии белков
(ПЦ)
[166]
Накопление в
культуре клеток
доказывали
методом ФМ, в
привитой опухоли
– методом БИКспектроскопии
Снижение
экспрессии
целевых белков
(ВБ)
[215]
Накопление в
культуре клеток
доказывали
методом КМ
н/о
[141]
Накопление в
культуре клеток
доказывали
методом КМ
Снижение
экспрессии мРНК
(ОТ-ПЦР) и белка
ApoB (ВБ)
[151]
In vitro:
мРНК Т-клеточных
U87MG, MCF-7, BT474,
Комплекс SWCNT-фосфолипидрецепторов CXCR4;
CEM, NKR (человек)
полиэтиленгликоль-S-S- siРНК
мРНК люциферазы
In vivo:
мышь
In vitro:
MiaPaCa2, MCF-7, MDAмРНК гипоксияMB-231, RGM1
индуцированного
(человек);
SWCNT
фактора HIF-1α; мРНК
In vivo:
киназы PLK1; мРНК
мышь с привитой
кинезина Kif11
опухолью MiaPaCa2HRE
Нет мишени
(использовали siРНК,
MWCNT, модифицированные
не имеющую сайтов
HeLa (человек)
аминами и амино-дендронами по
комплементарности ни
реакции Прато
с одной из мРНК)
In vitro:
мРНК
SWCNT, модифицированные
FL83B (мышь)
аполипопротеина B
тетраолеил-лизиновым
In vivo:
(ApoB)
дендримером поколения 3
C57BL/6 (мышь)
38
мРНК зеленого
флуоресцентного
белка (GFP)
Накопление в
культуре клеток
доказывали
методом ПЦ
A549, HeLa,
экспрессирующие GFP
(человек)
MWCNT, модифицированные
аминами и амино-дендронами по
реакции Прато
мРНК люциферазы
U87 (человек)
Конъюгат MWCNTполиэтиленимин (200 нм)
Эндоцитоз
мРНК люциферазы
H1299 (человек)
Конъюгат MWCNTполиэтиленимин, комплекс
MWCNT-цетилпиридин (150 нм)
Эндоцитоз
мРНК каспазы-3
(CASP3)
In vitro:
N2a (мышь)
In vivo
Мышь
MWCNT,
аминомодифицированные по
реакции Прато (до 1 мкм)
Накопление в
культуре клеток и
в нейронах мыши
доказывали
методами криоРЭМ и ПЭМ
Снижение
экспрессии мРНК
(ОТ-ПЦР) и белка
CASP3 (ВБ)
[300]
HepG2 (человек)
SWCNT-СOOH
Накопление в
культуре клеток
доказывали
методом ФМ
Снижение
экспрессии мРНК
(ОТ-ПЦР)
[301]
B-Cap-37 (человек)
Комплекс SWCNT-фосфолипидполиэтиленгликоль-S-SsiРНК(100-1000 нм)
Снижение
экспрессии MDM2
(ПЦ)
[298]
PC-3, HeLa (человек)
Комплекс DWNT(поли(Lys:Phe)/siРНК
Снижение
экспрессии белков
(КМ, ПЦ)
[302]
мРНК белка p53;
мРНК фактора некроза
опухолей TNF-α;
мРНК фактора роста
эндотелия сосудов
VEGF
мРНК белка MDM2
(Murine Double Minute
Clone 2)
мРНК зеленого
флуоресцентного
белка (GFP); мРНК
сурвивина
Накопление в
культуре клеток
доказывали
методом ПЦ
Накопление в
культуре клеток
доказывали
методом КМ
Снижение
экспрессии GFP
(ВБ, ФМ)
Снижение
экспрессии
люциферазы
(люминометрия)
Снижение
экспрессии
люциферазы
(люминометрия)
[295]
[296]
[145]
39
мРНК рецептора
эпидермального
фактора роста (EGFR);
мРНК k-ras-антигена
(KRAS); мРНК
тиоредоксина-1 (Trx)
In vitro:
H2122, MiaCaPa-2
(человек)
In vivo:
Мыши линии C57BL6
SWCNT; комплекс SWCNTфосфолипид-полиэтиленгликоль
Накопление в
культурах клеток и
в тканях
доказывали
методом БИК-ФМ
Снижение
экспрессии белков
(ВБ)
[7]
Накопление в
культуре клеток
Снижение
SWCNT, модифицированные
PC-3 (человек)
доказывали
экспрессии белка
[297]
полиэтиленимином
методами ФМ и
(ВБ)
ПЦ
Накопление в
мРНК рецептора
культурах клеток и
Снижение
гастринКомплекс SWCNT-фосфолипиддоказывали
BE(2)-C (человек)
экспрессии белка
[299]
высвобождающего
полиэтиленгликоль
методом БИК-ФМ;
(ВБ)
белка (GRP-R)
в тканях –
методом МРТ
Примечание: ВБ – Вестерн-блоттинг; КМ – конфокальная микроскопия; ОТ-ПЦР – ПЦР с обратной транскрипцией; ПЦ – проточная
цитофлуориметрия; ФМ – флуоресцентная микроскопия.
мРНК теломеразыобратной
транскриптазы
человека (hTERT)
40
Таким образом, гибриды олигонуклеотидов, их комплексов и протяженных ДНК c CNT
способны эффективно доставлять НК в клетки для осуществления трансгенеза или подавления
экспрессии
генов.
CNT-транспортеры
НК
отличаются
высокой
биосовместимостью.
Эффективность доставки НК с использованием CNT выше по сравнению с использованием
коммерчески доступных трансфекционных агентов.
1.2.2. Создание
биосенсоров
на
основе
гибридов
нуклеиновых
кислот
с
углеродными нанотрубками
Биосенсоры - это аналитические устройства, использующие биологические молекулы
для распознавания веществ-мишеней, и трансдьюсеры, преобразующие связывание мишени в
удобный для регистрации сигнал. В настоящее время ведутся активные разработки,
посвященные созданию диагностических биосенсоров на основе гибридов углеродных
нанотрубок и нуклеиновых кислот [5,303]. Разрабатываемые сенсорные конструкции
отличаются высокой чувствительностью и селективностью. В последние годы создан ряд CNTНК-биосенсорных систем для определения нуклеиновых кислот, белков, живых клеток, малых
молекул и др. (см., например, [5,6,304–314]).
1.2.2.1.
Электрохимические биосенсоры
1.2.2.1.1. Подходы к модификации электродов с использованием углеродных нанотрубок
Модификация поверхности электрода углеродными нанотрубками является начальной
стадией производства электрохимических биосенсоров, на этом этапе определяется будущая
конфигурация прибора, его физические и механические свойства, динамический диапазон
[305]. Методы модификации электродов углеродными нанотрубками можно условно разделить
на нековалентные и ковалентные.
Наиболее простой вариант нековалентной модификации электрода CNT - это нанесение
суспензии нанотрубок в воде или в органическом растворителе на поверхность электрода и ее
высушивание с целью формирования слоя CNT (рис. 1.14а). Как правило, для осаждения на
поверхности электрода используют окисленные CNT, что открывает возможность их
дальнейшей химической модификации. В большинстве работ были использованы MWCNT,
значительно реже исследователи используют SWCNT для нековалентной модификации
электродов. CNT-содержащий электрод сохраняет стабильность в процессе химической
модификации и в электрохимических экспериментах. Описано применение данного подхода
для модификации платиновых [73], стеклоуглеродных [65,315] и графитовых [316] рабочих
электродов.
41
Рис. 1.14. Электроды, содержащие пленку CNT (а), вертикально ориентированные CNT (б) и
сети CNT (в).
Другим вариантом нековалентной модификации электродов является технология
получения печатных электродов (screen-printed electrodes). С ее использованием была
изготовлена
трехэлектродная
электрохимическая
ячейка
[317].
Для
этого
на
поливинилхлоридной мембране формировали три электрода путем нанесения слоя серебра,
который затем покрывали слоем MWCNT. После этого один электрод электрохимически
окисляли в растворе KCl для получения хлорсеребряного электрода сравнения. Два других
электрода выступали в качестве рабочего и вспомогательного.
Использование композитов CNT с синтетическими или природными полимерами для
модификации электрода позволяет усилить электрохимический отклик электрода. В работах
[157,318] описана модификация стеклоуглеродного электрода композитом поли(пиридин-2,6диовой кислоты) с MWCNT. Для получения композита проводили электрополимеризацию
пиридин-2,6-диовой кислоты на пленке CNT, сформированной непосредственно на электроде.
Аналогичным образом модифицировали и электрод на основе оксида индия-олова композитом
полианилина с MWCNT [319]. Использование хитозана в качестве полимерной матрицы не
требует электрополимеризации, и композитную пленку с MWCNT получают простым
высушиванием нанесенной на поверхность электрода суспензии [320,321]. Введение в состав
композита наночастиц приводит к синергетическому усилению электрохимического сигнала.
Так в работах [157,321] описано использование для этой цели наночастиц ZrO2.
В работе Y. Zhang с соавт. [322] был применен подход к модификации
стеклоуглеродного
электрода,
сочетающий
описанные
выше
методы
нековалентной
модификации электродов. На поверхность электрода наносили слой окисленных MWCNT,
42
затем электрополимеризовали на нем слой транс-3-(3-пиридил)-акриловой кислоты, на
который электрохимически осаждали слой наночастиц серебра. Такой многослойный электрод
отличался высокой чувствительностью, а также легкостью присоединения серосодержащего
НК-зонда.
N. Zhu с соавт. модифицировали стеклоуглеродный электрод MWCNT, поверхность
которых была функционализирована путем присоединения полиамидоаминового дендримера
поколения
2
[323].
Наличие
первичных
аминогрупп
дендримера
на
поверхности
модифицированного электрода позволяет проводить последующие химические модификации, в
частности, присоединение олигонуклеотидных зондов. Другой вариант модификации электрода
представлен
в
работе
После
[324].
нековалентной
иммобилизации
на
поверхности
стеклоуглеродного электрода карбоксил-содержащих MWCNT к нанотрубкам присоединяли
молекулы
кислоты,
п-аминобензойной
к
которым
впоследствии
электростатически
присоединяли наночастицы серебра.
Методы
нековалентной
модификации
электродов
углеродными
нанотрубками
используются также и для получения микро- и наноразмерных электродов. Наиболее
распространенным примером таких электродов является полевой транзистор [308]. При
нанесении
суспензии
CNT
на
электрод
нанотрубки
замыкают
цепь
между двумя
микроэлектродами [304,308,325,326]. Получающуюся конструкцию практически полностью
покрывают изолятором, при этом CNT остаются непокрытыми и доступными для последующих
модификаций, за счет чего полевые транзисторы оказываются крайне чувствительными к
изменению
окружения
нанотрубок,
что
делает
их
чрезвычайно
востребованными
инструментами для детекции молекул. T. Kurkina с соавт. конструировали CNT-транзистор,
нанося суспензию индивидуальных SWCNT, полученную ультразвуковой обработкой образца
нанотрубок с поверхностно-активным веществом Triton X-100, на платиновые микроэлектроды,
сформированные на SiO2-подложке [327]. С использованием диэлектрофореза в переменном
токе нанотрубки ориентировали перпендикулярно электродам, замыкая таким образом
электрическую цепь. На завершающей стадии подготовки устройства контакты пассивировали
SiO2. Y. Weizmann с соавт. подобным способом получали сети SWCNT между золотыми
электродами, сформированными на поверхности SiO2, покрытой слоем хрома [328].
Методы нековалентной модификации электродов суспензией CNT доступны и просты в
исполнении, однако такие конструкции проигрывают в стабильности электродам, содержащим
массивы
вертикально
ориентированных
нанотрубок,
ковалентно
присоединенных
к
поверхности электрода. Как правило, нанотрубки в массиве представлены преимущественно
MWCNT, однородными по размерам и структуре, длиной до 1 мм. Существует два метода
создания электродов на основе массивов вертикально ориентированных CNT: в первом
43
варианте проводят ковалентное присоединение предварительно выращенных CNT на
поверхность проводящей подложки с использованием химических методов (т.н. метод «grafting
to»); другой вариант предусматривает выращивание массива нанотрубок непосредственно на
проводящей подложке (метод «grafting from») [329]. Оба метода находят применение в
создании электродов для детекции НК. Химическое присоединение CNT на поверхность
электрода проводят как напрямую, так и с использованием линкеров. В наиболее простом
варианте, реализованном в работе [330], окисленные SWCNT, содержащие карбоксильные
группы,
присоединяли
на
поверхность
стеклоуглеродного
электрода
при
активации
карбодиимидом и N-оксисукцинимидом. В другом варианте модификации окисленные
MWCNT фиксировали на поверхности стеклоуглеродного электрода посредством линкера –
4,4′-диаминоазобензола [331]. Модифицированные электроды сохраняли структуру после
ультразвуковой обработки, что говорит о высокой прочности присоединения.
Для присоединения CNT на поверхность золотых электродов необходимо использование
серосодержащих линкеров. Специфическое ковалентное взаимодействие атомов серы с
поверхностью золотого электрода позволяет закрепить массив CNT на его поверхности.
Описано присоединение окисленных CNT на поверхность золотых электродов путем обработки
поверхности золота амино-1-ундекантиолом [332,333] или цистеамином [68] с последующим
присоединением карбоксил-содержащих нанотрубок по аминогруппам линкера. В работе [323]
было проведено «прореживание» массива CNT в процессе присоединения к электроду для
обеспечения полноты их последующей модификации и однородности электрохимического
отклика.
Для
этого
была
использована
смесь
серосодержащих
модификаторов
–
тиоэтанол:цистеамин (3:1). В процессе присоединения к электроду карбоксил-содержащих
MWCNT при активации карбодиимидом происходило присоединение нанотрубок только к
аминогруппам цистеамина, таким образом, MWCNT покрывали только четверть площади
электрода.
Выращивание массива CNT на проводящей подложке также является распространенным
методом получения электродов, содержащих ориентированные нанотрубки (рис. 1.14б) [6]. В
работе [70] описан синтез массива вертикально ориентированных CNT на поверхности золотого
электрода путем пиролиза комплекса железа (II) с фталоцианином. После синтеза массив
нанотрубок подвергали окислению, что приводило к образованию карбоксильных групп на
концах нанотрубок и позволяло проводить дальнейшую химическую модификацию электрода.
В другом варианте выращивание вертикально ориентированных нанотрубок на поверхности
золотого электрода проводили стандартным CVD-методом, предварительно напыляя на
поверхность золота пленку никелевого катализатора [71]. Для образования карбоксильных
групп на концах нанотрубок массив обрабатывали азотной кислотой.
44
Как уже было отмечено выше, основным достоинством метода «grafting from» по
сравнению с «grafting to» является его меньшая трудоемкость, в то же время электроды,
полученные этим методом, существенно менее устойчивы к физическому воздействию [329].
Сочетание выращивания ориентированных CNT на поверхности электрода с последующим
нанесением инертного покрытия позволяет устранить этот недостаток. Путем контролируемого
размещения каталитических частиц никеля на кремниевой подложке удалось достичь
распределения ориентированных нанотрубок по электроду в процессе CVD, после чего
промежутки между CNT-содержащими районами пассивировали, формируя слой SiO2 [334–
336]. Поверхность электрода полировали, а концы нанотрубок электрохимически окисляли с
образованием карбоксильных групп. Такой же метод был применен и для создания электрода,
содержащего углеродные нановолокна [337].
Выращивание CNT на поверхности электродов используют также для создания полевых
транзисторов. Сети CNT синтезируют методом CVD на полупроводниковой или изолирующей
подложке с последующим фотолитографическим нанесением на нее электрических контактов
(рис. 1.14в) [338–340]. Этот простой метод имеет существенный недостаток: присутствие в
массиве нанотрубок с металлической проводимостью увеличивает его проводимость, снижая
чувствительность. Это связано с тем, что отклик полевого транзистора определяется, в
основном, полупроводниковыми явлениями, соответственно, обогащение массива CNT
нанотрубками-полупроводниками может значительно увеличить чувствительность полевого
транзистора. Для селективного удаления нанотрубок с металлической проводимостью из сети
CNT применяют электрохимическое окисление [341]. Полевой транзистор, содержащий сеть
CNT, может быть также использован в качестве платформы для последующих модификаций.
Сеть CNT на поверхности золотого электрода декорируют наночастицами золота для
последующего присоединения олигонуклеотидного зонда [342].
Для создания биосенсоров на основе CNT используют как ковалентное, так и
нековалентное присоединение нанотрубок к поверхности электрода. Для электрохимической
детекции применяют системы, различающиеся как способом создания электрода, так и общим
аппаратным оформлением эксперимента.
1.2.2.1.2.
Электрохимические биосенсоры нуклеиновых кислот
Открытие электрохимической активности НК стимулировало развитие аналитических
технологий их определения. Был разработан ряд методов количественного определения НК и
анализа их структуры, основанных на специфическом распознавании и гибридизации
олигонуклеотидного
зонда
с
НК-мишенью
[343].
Электрохимические
биосенсоры
конвертируют гибридизацию НК в удобный для регистрации сиквенс-специфический
электрохимический сигнал, что делает их весьма привлекательным инструментом для
45
биологических, медицинских (в т.ч., клинических) и экологических исследований [344].
Электрохимическую детекцию НК осуществляют двумя способами. Способ непосредственной
детекции основан на регистрации сигнала окисления-восстановления азотистых оснований НК.
Известно, что основной вклад в электрохимический отклик НК вносят остатки аденина и
гуанина, претерпевающие окисление в диапазоне [0.8; 1.0] В [345]. Другой способ
предусматривает введение электрохимических меток в состав олигонуклеотидного зонда или
непосредственно в раствор аналита. В качестве таких меток используют НК-интеркаляторы
(антибиотики, красители и др.) или комплексы металлов [313]. Для подавления собственного
сигнала НК-зонда в его составе заменяют все электроактивные гуанозиновые нуклеозиды на
электронеактивные инозиновые с сохранением комплементарных взаимодействий [334,335].
Модификация
электродов
олигонуклеотидными
зондами
определяет
будущую
специфичность сенсора, а также метод детекции. Присоединение зондов на поверхность
электродов осуществляют как ковалентными, так и нековалентными методами. Нековалентное
присоединение
осуществляется
за
счет
электростатических
или
Ван-дер-Ваальсовых
взаимодействий с поверхностью модифицированного электрода. Ниже будут рассмотрены
методы создания гибридных электродов, содержащих CNT и НК, а также их применение для
детекции биологических НК-мишеней.
Ковалентный метод присоединения зонда на поверхность CNT хорошо зарекомендовал
себя вследствие прочности связывания зонда с электродом. Широко используется метод
присоединения олигонуклеотидов, несущих первичную аминогруппу на 5′- или 3′-конце, к
окисленным нанотрубкам, содержащим карбоксильные группы, при активации карбодиимидом
(рис. 1.15а). В литературе описано ковалентное присоединение НК-зондов к CNT на
поверхности золотых [68,70,71,323,332,333], платиновых [73], стеклоуглеродных [65,315,331],
графитовых [316] и печатных [72,346] электродов, а также к CNT в составе полевых
транзисторов [328,334,335,339,347]. Предел обнаружения у таких электродов составил 1 аМ–10
нМ. Введение тиольной группы на 5′-конец НК-зонда делает возможным его присоединение к
наночастицам металлов (Ag, Au), декорирующим поверхность CNT-содержащего электрода.
Описано применение такого подхода для модификации полевых транзисторов [340,342] и
печатных электродов [346,348].
46
Рис. 1.15. Способы иммобилизации НК-зондов на поверхности CNT-содержащего электрода:
ковалентный (а), адсорбция зонда на поверхности CNT (б), электростатическое взаимодействие
зонда с полимер-модифицированными CNT (в).
Модификация поверхности CNT полимерами, несущими реакционноспособные группы,
позволяет увеличить количество иммобилизованного олигонуклеотидного зонда на единицу
площади нанотрубок, тем самым увеличивая чувствительность биосенсора. Авторы работы
[327] электрополимеризовали 4-аминобензойную кислоту на поверхности CNT в составе
полевого транзистора. Образующийся полимер содержал большое число карбоксильных групп,
активация которых карбодиимидом позволяла проводить присоединение олигонуклеотидного
зонда, содержащего аминогруппу на 5′-конце. Альтернативный вариант модификации
поверхности CNT полимерами был предложен в работе [319]. Нанотрубки покрывали слоем
полианилина,
аминогруппы
несущего
концевые
активировали
первичные
глутаровым
аминогруппы.
альдегидом,
На
после
следующей
чего
стадии
присоединяли
аминомодифицированный НК-зонд без предварительной активации. Предел обнаружения
электродов в таком исполнении составил 10–100 аМ.
CNT-содержащие электроды с ковалентно присоединенными НК-зондами используют
как для детекции модельных последовательностей, так и для определения фрагментов НК
биологических объектов: вирусов, опухолевых клеток, трансгенных растений и др. (см. табл.
1.3).
47
Таблица 1.3. Детекция НК-мишеней с использованием CNT-содержащих электродов с
ковалентно присоединенными олигонуклеотидными зондами
Метод детекции
Предел
CNT-содержащий
Мишень (длина, нт)
(электроактивная обнаруже Ссылка
электрод/зонд
метка)
ния
Модельный
олигодезоксирибонук
Золотой/ДНК-зонд
ИС
800 фМ
[323]
леотид (24)
Модельный
олигодезоксирибонук
Золотой/ДНК-зонд
ЦВА (ферроцен)
н/о
[70]
леотид (20)
Модельный
ЦВА, ДИВ
олигодезоксирибонук
Золотой/ДНК-зонд
н/о
[71]
(метиленовый синий)
леотид (21)
Модельный
ИС, КВВ, ЦВ
олигодезоксирибонук
Золотой/ДНК-зонд (метиленовый синий,
100 нМ
[332,333]
[Fe(CN)6]3-/4-)
леотид (30)
ЦВ (MnL; L=3Модельный
Стеклоуглеродный/
формил-4олигодезоксирибонук
140 пМ
[315]
ДНК-зонд
гидроксибензосульф
леотид (24)
онат)
Модельный
Стеклоуглеродный/
ЦВ, ДИВ
олигодезоксирибонук
10 нМ
[65]
ДНК-зонд
(дауномицин)
леотид (24)
Модельный
Стеклоуглеродный/ ЦВ, ИС ([Fe(CN)6]3-/4олигодезоксирибонук
10 пМ
[349]
ДНК-зонд
)
леотид (24)
Модельный
ЦВ (CuLut2;
Стеклоуглеродный/
650 фМ
[350]
олигодезоксирибонук
Lut=лутеолин
ДНК-зонд
леотид (21)
C15H9O6)
Модельный
Полевой
олигодезоксирибонук
транзистор/ДНКИС
200 аМ
[327]
леотид (24)
зонд
Модельный
Полевой
Амперометрия
олигодезоксирибонук
транзистор/ДНК100 фМ
[342]
(наночастицы Au)
леотид (24)
зонд
Модельный
Полевой
Кондуктометрия
олигодезоксирибонук
транзистор/ДНК10 фМ
[328]
(пероксидаза хрена)
леотид (30)
зонд
Модельный
Полевой
ЦВ (наночастицы
олигодезоксирибонук
транзистор/PNA100 аМ
[340]
Au)
леотид (15)
зонд
Фрагмент генома
КВВ (5Золотой/ДНК-зонд
н/о
[68]
ВИЧ-1 (27)
гидроксинафтохинон)
Фрагмент генома
вируса гриппа типа A Печатный/ДНК-зонд
ИС, КВВ
500 пМ
[73]
(24)
Фрагмент генома ВГБ
Графитовый/
ИС, ДИВ
200 нМ
[316]
(20)
ДНК-зонд
([Fe(CN)6]3-/4-)
Фрагмент генома ВГБ Стеклоуглеродный/
ЦВ, ДИВ
10 нМ
[331]
(21)
ДНК-зонд
48
Фрагмент генома
вируса гриппа H5N1
ДНК из клеток
Neisseria gonorrhoeae
Фрагмент гена и
полноразмерный ген
каннабиоидного
рецептора CB2 (12,
237)
Фрагмент мутантного
гена муковисцидоза
(25)
Полевой транзистор/
ЦВ
ДНК-зонд
Композит
ЦВ, ДИВ
CNT/полианилин/
(метиленовый синий)
ДНК-зонд
н/о
[347]
1.2 пМ
[319]
Печатный/ДНК-зонд
ДИВ (щелочная
фосфатаза)
400 пМ
[72]
Печатный/ДНК-зонд
ИС (наночастицы
Au)
10 нМ
[346]
Полевой
транзистор/ДНКзонд
ЦВ ([Ru(bpy)3]2+/3+)
1 аМ
[334,335]
Фрагмент гена
BRCA1 (30)
Фрагмент генома
ИС (наночастицы
трансгенной кукурузы Печатный/ДНК-зонд
2.2 фМ
[348]
Au)
(24)
Фрагмент генома V.
ITO-MgOИС
3 нМ
[351]
cholerae (23)
MWCNT/ДНК-зонд
SiO2-электродкДНК фрагмента
ДИВ
н/о
[352]
рРНК E. coli (31)
MWCNT/ДНК-зонд
Фрагмент региона Е7
генома вируса
SiO2/Si-электрод,
< 1 аМ
папилломы человека- покрытый SWCNT c
ИС ([Fe(CN)6]3-)
[353]
16 (24)
наночастицами
золота/ДНК-зонд
Фрагмент генома ВГБ
1 аМ
(21)
Примечание: ДИВ - дифференциальная импульсная вольтамперометрия; ИС - импедансная
спектроскопия; КВВ - квадратно-волновая вольтамперометрия; ЦВА - циклическая
вольтамперометрия.
Как видно из представленных в таблице 1.3 данных, в качестве ковалентно
присоединенных
НК-зондов
в
основном
используют
олигодезоксирибонуклеотиды,
комплементарные выбранному участку НК-мишени. Также описано использование для этой
цели модифицированных олигонуклеотидов и их аналогов, в частности, олигомеров пептидных
нуклеиновых кислот [340].
CNT-биосенсоры, содержащие нековалентно присоединенные НК-зонды, применяют
реже, чем описанные выше биосенсоры, содержащие ковалентно присоединенные зонды. Такое
предпочтение может объясняться тем, что нековалентное присоединение НК-зонда, как
правило, не обеспечивает необходимой стабильности связи зонда с поверхностью электрода.
Нековалентная иммобилизация немодифицированных олигонуклеотидных зондов на CNT
осуществляется за счет Ван-дер-Ваальсовых взаимодействий ароматических систем азотистых
оснований с поверхностью нанотрубки (рис. 1.15б). При гибридизации с мишенью гибрид зонда
49
с CNT разрушается, что приводит к изменению электрического сигнала [330,338]. При
использовании PNA-зонда гибрид зонда с электродом дополнительно стабилизирован за счет
взаимодействия псевдопептидного остова PNA с поверхностью нанотрубок [341].
Для сохранения возможности комплементарного взаимодействия олигонуклеотидного
зонда с НК-мишенью было предложено использовать остаток пирена в качестве якорной
группы для иммобилизации зонда на поверхность углеродных нанотрубок. Описан метод
иммобилизации
пиренильного
конъюгата
олигонуклеотидного
зонда
на
поверхности
нанотрубок в составе полевого транзистора. Остаток пирена необратимо сорбируется на CNT за
счет прочных стэкинг-взаимодействий, удерживая таким образом как зонд, так и дуплекс зонда
с мишенью после гибридизации [325].
НК-зонд может быть присоединен к поверхности электрода и электростатически. В этом
случае получают композит CNT с аминосодержащими полимерами или покрывают ими
нанотрубки (рис. 1.15в). Для этой цели применяют поли(пиридин-2,6-диовую кислоту)
[157,318], поли(диаллилдиметиламин) [157], полианилин [321], полипиррол [350] и хитозан
[320].
Примеры
использования
CNT-содержащих
биосенсоров
с
нековалентно
присоединенными НК-зондами для детекции модельных последовательностей, а также
фрагментов НК биологических объектов представлены в таблице 1.4.
Таблица 1.4. Детекция НК-мишеней с использованием CNT-содержащих электродов с
нековалентно присоединенными олигонуклеотидными зондами
Метод детекции
Предел
Мишень (длина,
CNT-содержащий
(электроактивна обнаруже Ссылка
электрод/зонд
нт)
я метка)
ния
Модельный
Стеклоуглеродный/ДНКДИВ
олигодезоксирибо
20 нМ
[330]
зонд
([Fe(CN)6]3-/4-)
нуклеотид (24)
Модельный
ДИВ
Стеклоуглеродный/ДНКолигодезоксирибо
(наночастицы
75 пМ
[320]
зонд
нуклеотид (45)
ZrO2)
Модельный
Композит
олигодезоксирибо MWCNT/полипиррол/ДНКИС
25 пМ
[350]
нуклеотид (25)
зонд
Фрагмент
полиморфного
варианта гена
Полевой транзистор/ДНККондуктометрия
1 пМ
[338]
наследственного
зонд
гетерохроматоза
HFE (51)
Фрагмент РНК
Полевой транзистор/
ИС
500 фМ
[341]
ВГС (12)
PNA-зонд
Фрагмент гена
Пастовый,
ИС, ЦВ, ДИВ
[157,318
27 фМ
фосфинотрицинац
стеклоуглеродный,
(метиленовый
,321]
50
етилтрансферазы
PAT(20)
Ген
нопалинсинтазы
трансгенной сои
печатный/ДНК-зонд
синий,
[Co(phen)3]3+,
[Fe(CN)6]3-)
н/о
Стеклоуглеродный/MWCNTКВВ (сополимер
сополимер 3-(5-гидроксивыступает в
Малая РНК miR1,4-диоксо-1,4141 (маркер рака
дигидронафталин-2(3)качестве
8 фМ
[354]
ил)пропионовой кислоты и
электроактивной
простаты)
метки)
5-гидрокси-1,4нафтохинона/ДНК-зонд
Примечание: ДИВ - дифференциальная импульсная вольтамперометрия; ИС - импедансная
спектроскопия; КВВ - квадратно-волновая вольтамперометрия; ЦВА - циклическая
вольтамперометрия.
Следует отметить, что CNT-содержащие электроды проявляют чувствительность к
протяженным НК и в отсутствие зонда [355,356]. Показана возможность определения ДНК
кератиноцитов человека, опухолевых клеток линии U937 [120], дрожжевой тРНК, ДНК тимуса
теленка [74,317] методами циклической вольтамперометрии, дифференциальной импульсной
вольтамперометрии и импедансной спектроскопии на печатных и золотых электродах,
покрытых плетками угеродных нанотрубок. Для усиления электрохимического сигнала
используют электроактивные метки: [Co(phen)3]3+, [Fe(CN)6]3-/4-.
Конечно, сфера применения электрохимических сенсоров на основе гибридов CNT-НК
не исчерпывается детекцией последовательностей НК. Использование олигонуклеотидов в
качестве элемента распознавания сенсорной системы открывает возможности определения
широкого спектра мишеней. С другой стороны, НК также находят применение в качестве
структурного, а не распознающего компонента сенсорной системы. Некоторые примеры
электрохимических сенсоров для детекции мишеней ненуклеотидной природы будут
представлены в следующем разделе.
1.2.2.1.3.
Другие примеры электрохимических биосенсоров
При конструировании электрохимических биосенсоров для детекции малых молекулмишеней фрагменты НК часто выступают не в качестве элемента разпознавания, а в роли
модификатора для улучшения электрических свойств сенсорной системы или увеличения
чувствительности, при этом гибрид CNT-НК остается ключевым компонентом сенсора. Так,
описано использование олигонуклеотидов для модулирования электрического отклика SWCNT,
покрытых слоем платиновой черни, для детекции глюкозы и АТФ [357]. Формирование гибрида
с НК увеличивает рабочий ток в электроде, при этом уменьшая перенапряжение.
Другой пример использования НК в качестве структурного, а не функционального
элемента CNT-сенсоров – для диспергирования нанотрубок перед нанесением на поверхность
51
рабочего электрода. В работе [358] была создана система для электрохимической детекции
пероксида
водорода,
в
которой
аналитический
сигнал
обеспечивался
окислительно-
восстановительным переходом иона железа в активном центре пероксидазы хрена,
иммобилизованной на поверхности SWCNT, покрывающих стеклоуглеродный электрод. Для
обеспечения равномерного покрытия электрода нанотрубками авторы работы использовали
диспергирование углеродного материала в растворе ДНК тимуса теленка. Для диспергирования
применяют также олигонуклеотиды, имеющие высокое сродство к поверхности нанотрубок,
например, d(AT)n или d(GC)n [359]. Покрывающие поверхность CNT НК могут также выступать
в роли якорных групп, удерживая на поверхности сенсора электроактивные метки. P. Zhou и
соавт. создали сенсор для электрохимической детекции 6-меркаптопурина, рабочим элементом
в
котором
выступали
MWCNT,
покрытые
ДНК
спермы
лосося,
на
поверхности
стеклоуглеродного электрода [360]. Слой ДНК не только обеспечивал диспергирование
нанотрубок, но и координировал электроактивную метку, комплекс [Co(phen)2(tatp)]3+ или
[Co(phen)3]3+.
НК могут быть также использованы для присоединения CNT к поверхности электрода.
Описана сенсорная конструкция для детекции пестицидов метилпаратиона и хлорпирофоса,
состоящая из слоя SWCNT, нековалентно модифицированных 5′-тиопроизводным 21-звенного
олигодезоксирибонуклеотида
и
ацетилхолинэстеразой
[121].
В
данной
конструкции
олигонуклеотид выступал в качестве якорной группы для иммобилизации нанотрубок на
поверхности золотого электрода за счет 5′-тиольных групп, а фермент осуществлял гидролиз
ацетилхолина. Содержание пестицидов в растворе оценивали косвенно по изменению
активности ацетилхолинэстеразы.
Другой пример использования НК для создания биосенсорных систем представлен в
работе [361] на примере электрода для определения витамина B1. В основу метода положена
неспецифическая интеркаляция молекул тиамина в ДНК тимуса теленка, адсорбированную на
поверхности MWCNT-пастового электрода. На взаимодействии с НК-дуплексом основан и
метод количественного определения ионов ртути (II), описанный в работе [362]. Для детекции
использовали
стеклоуглеродный
электрод,
покрытый
MWCNT,
декорированными
наночастицами золота с присоединенным 5′-тио-модифицированным олигонуклеотидом 5′-SH(CH2)6–ACCGTGTTTGCCTTTGACCTC-3′. В присутствии ионов ртути (II) олигонуклеотидный
зонд формировал прочный дуплекс с частично комплементарным олигонуклеотидом 5′GAGGTCTTTGGCTTTCACGGT-3′, стабилизированный координацией ионов ртути между
расположенными друг напротив друга T-богатыми участками.
Детекция белков и живых клеток требует повышения чувствительности определения по
сравнению с сенсорами НК и малых ненуклеотидных мишеней. Причина этого - в низкой
52
копийности мишеней в реальных биологических образцах. В целом, CNT-НК-биосенсоры для
этой цели устроены аналогично сенсорам НК, низких пределов обнаружения достигают путем
использования наиболее чувствительных электронных устройств в качестве платформы для
создания сенсорной системы. Олигонуклеотиды в составе таких сенсоров, как правило,
выполняют функцию молекулярного распознавания, для обеспечения селективности детекции
часто используют аптамеры, одноцепочечные НК, которые за счет своей третичной структуры
способны связываться с мишенью [312,363]. Типичный пример такой техники – детекция
белков и бактериальных клеток-мишеней с использованием SWCNT-полевых транзисторов. На
поверхности нанотрубок иммобилизуют аптамер к соответствующей мишени, для этого
SWCNT покрывают N-оксисукцинимидным эфиром пиренбутановой кислоты, а затем
присоединяют к нему аминомодифицированный аптамер. Описано применение таких сенсоров
для детекции тромбина [170,304,326,364], иммуноглобулина E [171] и клеток E. сoli [160].
Другой распространенный тип конструкции аптасенсоров представлен ковалентными
гибридами
аптамер-SWCNT.
Сенсоры
такого
рода
получают
конъюгацией
5′-
аминомодифицированного аптамера с карбоксимодифицированными нанотрубками при
активации карбодиимидом. Различия между разными моделями сенсоров состоят в выборе
основы для электрода и в методе детекции. Описано использование сенсоров такого рода для
определения тромбина [365], SSB-белка E. сoli [366] и живых бактерий S. typhi [367].
X. Liu с соавт. предложили электрохимический MWCNT-аптасенсор на тромбин, в
котором элемент распознавания (конъюгат аптамера с ферроценом) неовалентно удерживался
на
поверхности
нанотрубок
благодаря
комплементарным
взаимодействиям
с
олигонуклеотидом-коннектором, ковалентно присоединенным к MWCNT на поверхности
стеклоуглеродного электрода [368]. В отсутствие белка-мишени на вольтамперограммах и
профилях дифференциальной импульсной вольтамперометрии регистрировали интенсивные
сигналы электрохимического окисления-восстановления ферроцена. При взаимодействии с
белком контакт аптамера с олигонуклеотидом-коннектором нарушается, комплекс аптамертромбин диссоциирует от электрода, электрохимический отклик электрода уменьшается.
Следует отметить также работу [369], в которой олигонуклеотид в составе гибрида с
SWCNT не выполняет функции распознавания. Авторы данной работы решали задачу детекции
белка фолатного рецептора с использованием SWCNT как электрохимически активного
элемента сенсорной системы на основе золотого электрода, модифицированного 16меркаптогексадекановой
кислотой.
На
поверхности
нанотрубок
иммобилизовали
олигонуклеотид (GT)20, модифицированный фолатом по 3′-концу. После добавления аналита в
ячейку дополнительно вносили экзонуклеазу I. В присутствии белка-мишени, связывающего
фолат, 3′-конец олигонуклеотида, адсорбированного на поверхности SWCNT, оказывался
53
недоступным для нуклеолитической деградации. Такой гибрид за счет отрицательного
суммарного заряда имел низкое сродство к модифицированному электроду. В отсутствие белкамишени в аналите происходила деградация олигонуклеотида с последующей адсорбцией
SWCNT на электроде, при этом на вольтамперограммах наблюдали гистерезис, характерный
для
углеродных
материалов,
характерный
сигнал
появлялся
также
в
профилях
дифференциальной импульсной вольтамперометрии и на диаграммах Найквиста. В таблице 1.5
представлены примеры детекции мишеней ненуклеотидной природы с использованием
электродов на основе гибридов CNT-НК.
Таблица 1.5. Детекция ненуклеотидных мишеней с использованием CNT-НК-электродов
Метод детекции
Предел
CNT-содержащий
(электроактивная обнаруже Ссылка
Мишень
электрод
метка)
ния
СтеклоуглеродныйHg2+
MWCNT-наночастицы
ДИВ
30 пМ
[362]
Au/ДНК-дуплекс
СтеклоуглеродныйH2O2
MWCNT/ДНКЦВА
300 нМ
[358]
дуплекс/пероксидаза хрена
Глюкоза
1 мкМ
Pt/Ir-микроэлектродЦВА ([Fe(CN)6]3-),
[357]
SWCNT/ДНК-Pt-чернь
амперометрия
АТФ
2 мкМ
ЦВА, ДИВ
Стеклоуглеродный6MWCNT/ДНК спермы
([Co(phen)2(tatp)]3+,
50 нМ
[360]
меркаптопурин
лосося
[Co(phen)3]3+)
MWCNT-пастовый/ДНК
Витамин B1
ДИВ
4 нМ
[361]
тимуса теленка
СтеклоуглеродныйЦВА,
Допамин
MWCNT/ДНК-наночастицы
450 нМ
[359]
амперометрия
Pt
Метилпаратион
Au-электрод-SWCNT/SHКВВ, ИС
1 пМ
[121]
ДНК/ацетилхолинэстераза
([Fe(CN)6]3-)
Хлорпирофос
Полевой
Тромбин
транзистор/аптамер
Амперометрия
10 нМ
[170]
(нековалентно)
Полевой
Тромбин
транзистор/аптамер
Амперометрия
2.6 фМ
[365]
(ковалентно)
СтеклоуглеродныйЦВА, ДИВ
Тромбин
MWCNT/ДНК-коннектор500 фМ
[368]
([Fe(CN)6]3-), ИС
аптамер
Полевой
ЦВА, ДИВ
IgE
транзистор/аптамер
250 пМ
[171]
([Fe(CN)6]3-), ИС
(нековалентно)
Печатный электрод/АТSSB-белок E.
богатый ДНКЦВА, ДИВ
0.15 мг/л
[366]
coli
олигонуклеотид
Фолатный
Au-электродЦВА, ДИВ, ИС
3 пМ
[369]
рецептор
COOH/SWCNT-конъюгат
54
ДНК-фолат
Полевой
E. coli
транзистор/аптамер
Амперометрия
н/о
[160]
(нековалентно)
Стеклоуглеродный
Полевой
0.2
S. typhi
электрод/аптамер
[367]
транзистор
КОЕ/мл
(ковалентно)
Примечание: ДИВ - дифференциальная импульсная вольтамперометрия; ИС - импедансная
спектроскопия; КВВ - квадратно-волновая вольтамперометрия; ЦВА - циклическая
вольтамперометрия.
1.2.2.2.
Оптические биосенсоры на основе гибридов нуклеиновых кислот с
углеродными нанотрубками
Наряду с конструированием электрохимических биосенсоров на основе CNT, большое
распространение получили сенсоры, использующие оптические методы детекции [309].
Использование CNT как платформы для создания такого типа сенсоров представляется весьма
перспективным ввиду способности углеродных наноматериалов модулировать поглощение и
эмиссию флуоресцентных меток за счет переноса энергии флуоресценции. Как правило, CNT
выступают в роли «черного» тушителя для широкого спектра флуорофоров, как органических
красителей [370–372], так и квантовых точек [123].
Сенсорные системы на основе гибридов CNT (в первую очередь, SWCNT) с
олигонуклеотидными зондами различного строения находят применение для детекции НК- и
белковых мишеней. В основу работы таких систем положено различие сродства флуоресцентно
меченого олигонуклеотидного зонда к поверхности нанотрубок до и после взаимодействия с
мишенью. Аналитический сигнал в данном случае обеспечивается введением флуоресцентных
репортерных групп в состав зондов. Двуцепочечные НК способны взаимодействовать с
SWCNT, однако их сродство к поверхности нанотрубок значительно слабее, чем сродство оцНК
[84,123,373]. В присутствии НК-мишени происходит образование дуплекса мишени и зонда,
иммобилизованного на поверхности SWCNT, с дальнейшей его десорбцией с поверхности CNT,
что приводит к увеличению интенсивности флуоресценции. Таким образом, регистрируя
флуоресцентный сигнал, можно оценивать количество НК-мишени в растворе. Ниже приведен
ряд типичных примеров применения гибридов CNT-НК в качестве компонентов оптических
сенсорных устройств.
Один из наиболее простых вариантов оптического НК-сенсора на основе CNT
представлен в работе [374]. На поверхности нанотрубок были адсорбированы 20-звенный
олигодезоксирибонуклеотидный зонд и краситель бромистый этидий. Адсорбция красителя на
поверхности SWCNT вызывает полное тушение его флуоресценции. В присутствии
комплементарной модельной 20-звенной ДНК-мишени происходит образование дуплекса,
55
после чего краситель интеркалирует между основаниями сформированного дуплекса, и его
флуоресценция восстанавливается (рис. 1.16). Предел обнаружения для данного НК-биосенсора
составил 1 мкМ.
EtB
r
Рис. 1.16. Модель взаимодействия ДНК-мишени с трехкомпонентным комплексом
SWCNT/ДНК-зонд/интеркалирующий краситель. EtBr – бромистый этидий [374]. Стадия I –
адсорбция олигонуклеотида-зонда на поверхности SWCNT, стадия II – формирование дуплекса
зонда с мишенью и его десорбция с поверхности SWCNT.
Авторы работы [123] представили другой тип флуоресцентной сенсорной платформы,
основанной на резонансном переносе энергии флуоресценции (fluorescence resonance energy
transfer, FRET). В качестве источника флуоресценции были использованы квантовые точки
теллурида
кадмия,
отличающиеся
высокой
химической
стабильностью,
яркостью
флуоресценции и «настраиваемыми» спектральными свойствами. Конъюгат одноцепочечного
ДНК-зонда
и
квантовых
точек
теллурида
кадмия
адсорбировали
на
поверхности
карбоксимодифицированных SWCNT, что приводило к тушению флуоресценции квантовых
точек за счет FRET. Добавление комплементарной 20-звенной мишени (фрагмент ДНК вируса
гриппа H5N1) приводило к гибридизации, десорбции дуплекса с поверхности SWCNT и
восстановлению флуоресценции квантовых точек (рис. 1.17). Предел обнаружения для данного
сенсорного устройства составил 10 нM. Известен похожий способ детекции, в котором в
качестве репортерной группы используют флуоресцеин [375], а также его модификация с
использованием флуорофора и тушителя, располагающихся на разных концах НК-зонда,
формирующего шпильку [371].
Конъюгат
олигонуклеотидквантовая точка
Флуоресценция восстанавливается
Нет флуоресценции
Нет мишени
Рис. 1.17. Принцип действия CNT-НК-биосенсора на основе FRET [123].
Нет флуоресценции
56
В работе [376] описан колориметрический тест для детекции геномной ДНК S. aureus.
Авторы работы использовали иммобилизованный на поверхности SWCNT ДНК-зонд,
состоящий из адресующей части и ДНКзима, координирующего гемин. При добавлении ДНКмишени и гемина происходило разрушение гибрида зонд-SWCNT, причем адресующая часть
зонда вступала в комплементарные взаимодействия с мишенью, а ДНКзим формировал
комплекс с гемином (рис. 1.18). В присутствии пероксида водорода координированный гемин
окислял 2,2′-азино-бис(3-этилбензотиазолин-6-сульфоновую кислоту) (ABTS) с образованием
окрашенного производного.
ДНК-мишень
Гемин
Рис. 1.18. Принцип действия CNT-НК-биосенсора для колориметрической детекции ДНК [376].
P. Hu с соавт. предложили метод детекции последовательностей ДНК, основанный на
явлении светорассеяния раствором MWCNT [330]. Принцип работы сенсора основан на
сэндвич-гибридизации ДНК-мишени с зондами, иммобилизованными на магнитных частицах и
MWCNT. После инкубации всех компонентов магнитные частицы отделяли и измеряли
светорассеяние раствора. При образовании совершенного дуплекса присутствовавшие в
растворе нанотрубки оказывались связанными с магнитными частицами, и соответственно, не
рассеивали свет. Авторы работы сообщают о высокочувствительной детекции модельных
олигонуклеотидов-мишеней, а также фрагментов ДНК M. tuberculosis.
Гибридные CNT-НК-оптические сенсоры находят применение для детекции не только
нуклеиновых кислот, но и белков. Так, например, описан способ определения белка-фолатного
рецептора (предшественник описанного выше способа электрохимической детекции [369]) с
использованием конъюгата ДНК-зонда с фолатом, меченного флуоресцеином по одному из
гетероциклических оснований [377]. Связывание фолата с белком-рецептором защищает
олигонуклеотидный зонд от деградации экзонуклеазой I. В противном случае зонд претерпевает
нуклеолитическую деградацию с высвобождением флуорофора, флуоресценция которого в
удалении от поверхности нанотрубки полностью восстанавливается. Такой вариант сенсора
57
предполагает
обратное определение концентрации белка-мишени по разнице между
предполагаемым и зарегистрированным флуоресцентным сигналом. Тем не менее, предел
обнаружения данного метода составляет 100 пМ.
Описан также вариант мультимодальной детекции различных мишеней, зонды к
которым
иммобилизованы
на
одном
массиве
нанотрубок.
Авторы
работы
[378]
иммобилизовали на поверхности нанотрубок аптамеры к тромбину и АТФ, меченные
флуоресцеином и родамином, соответственно. Раствор гибрида не проявлял флуоресцентных
свойств. При добавлении одной из мишеней в раствор происходило связывание с ней
соответствующего аптамера, как следствие его высвобождение с поверхности нанотрубок, что
приводило к увеличению интенсивности флуоресценции в одном из каналов.
Примеры детекции биомолекул с использованием оптических сенсоров на основе
гибридов CNT-НК, сконструированных с использованием описанных выше процедур,
приведены в табл. 1.6.
Таблица 1.6. Детекция биомолекул с использованием оптических сенсоров на основе гибридов
CNT-НК
CNTПредел
Метод детекции
Мишень (длина, нт)
содержащий
обнаруже Ссылка
(метка)
электрод/зонд
ния
Флуоресцентная
Модельный
спектроскопия
олигодезоксирибонуклеотид
SWCNT/зонд
1 мкМ
[374]
(бромистый
(20)
этидий)
SWCNT/зонд
Флуоресцентная
Модельный
(молекулярный
спектроскопия
н/о
[371]
олигодезоксирибонуклеотид
маяк, шпилька или
(флуоресцеин)
(19)
линейный)
Модельный
Флуоресцентная
олигодезоксирибонуклеотид
SWCNT/зонд
спектроскопия
н/о
[375]
(23)
(флуоресцеин)
Флуоресцентная
Модельный
Конъюгат
микроскопия
н/о
[76]
олигодезоксирибонуклеотид
SWCNT-зонд
(флуоресцеин)б
(16)
колориметрия
Флуоресцентная
Фрагмент ДНК вируса
SWCNT/конъюгат
спектроскопия
30 пМ
[123]
гриппа типа H5N1 (20)
зонд-CdTe
(квантовые точки
CdTe)
Флуоресцентная
Фрагменты кДНК ВИЧ1 (26,
[379]
SWCNT/зонд
спектроскопия
50 пМ
28)
(флуоресцеин)
SWCNT/зондКолориметрия
Геномная ДНК S. aureus
30 нМ
[376]
ДНК-зим
(ABTS)
Флуоресцентная
Тромбин
SWCNT/аптамер
н/о
[375]
спектроскопия
58
Тромбин
АТФ
SWCNT/аптамеры
к тромбину и АТФ
Фолатный рецептор
SWCNT/конъюгат
зонд-фолат
(флуоресцеин)
Флуоресцентная
спектроскопия
(флуоресцеин,
родамин)
Флуоресцентная
спектроскопия
(флуоресцеин)
1.6 нМ
100 пМ
[378]
100 пМ
[377]
Следует отметить, что известны оптические CNT-НК-сенсоры для детекции ионов и
малых молекул. В качестве примера можно привести систему для детекции ионов ртути (II), в
которой распознающим элементов является ДНК-аптамер [380]. Аналитическим сигналом
такой сенсорной системы является изменение КД-спектра аптамера, индуцированное его
десорбцией с поверхности нанотрубок после взаимодействия с ионом-мишенью. Другой
пример детекции малых мишеней – определение оксида азота (II) с помощью гибрида
полупроводниковых SWCNT, излучающих в ближнем ИК-диапазоне, с олигонуклеотидом
(AT)15 [381]. Взаимодействие такого гибрида с молекулами оксида азота в растворе вызывает
тушение
собственной
флуоресценции
SWCNT.
Также
было
показано,
что
выбор
последовательности олигонуклеотида критичен для специфичности детекции.
Тот же метод был положен в основу работы сенсорной системы для количественного
определения глюкозы в растворе, созданной В. А. Карачевцевым и сотр [382]. SWCNT
покрывали слоем ДНК из эритроцитов цыпленка, фрагментированной ультразвуковой
обработкой, а затем адсорбировали на поверхность гибрида молекулы глюкозоксидазы. Такая
сэндвич-конструкция позволяла сохранить активность фермента после адсорбции на
поверхности нанотрубок. Для улучшения окислительной активности фермента в буфер для
анализа добавляли гексацианоферрат калия, что приводило также к тушению собственной
флуоресценции
SWCNT.
При
добавлении
глюкозы
флуоресценция
нанотрубок
восстанавливалась.
Создание биосенсоров на основе гибридов углеродных нанотрубок и нуклеиновых
кислот является многообещающим направлением развития аналитической химии. В настоящее
время в этом направлении достигнуты большие успехи, так, например, разработаны платформы
для обнаружения фрагментов нуклеиновых кислот и белков в аттомолярной концентрации, а
также бактериальных клеток. Тем не менее, поиск наиболее дешевого и простого способа
получения таких биосенсоров без потери их чувствительности является по-прежнему
актуальным направлением исследований [383]. Представленные данные свидетельствуют о
недостаточном освоении области детекции РНК, а также о недостаточном использовании РНК
и их аналогов в качестве элементов распознавания. Развитие этой области внесет большой
вклад как в фундаментальные исследования регуляции экспрессии генов, так и в такие
59
практические приложения, как лабораторная диагностика вирусных инфекций и других
заболеваний.
1.2.3. Наноассоциаты
на
основе
гибридов
НК-комплексов
с
углеродными
нанотрубками
Относительно новым направлением развития бионанотехнологии с использованием
гибридов
нуклеиновых
кислот
с
углеродными
нанотрубками
является
получение
наноассоциатов для применения в сенсорных устройствах, системах доставки лекарственных
средств,
нанофотонике
олигонуклеотидами,
и
др.
Ассоциация
возможна
вследствие
индивидуальных
нанотрубок,
комплементарных
покрытых
взаимодействий
олигонуклеотидов, адсорбированных на них. Путем варьирования последовательностей
олигонуклеотидов удается добиться контролируемой самоорганизации нанотрубок в ассоциаты
с различной геометрией.
В работе Y. Li с соавт. был представлен метод, реализующий контролируемую
самосборку SWCNT [384]. Авторами были получены 2 типа нековалентных гибридов оцДНК с
SWCNT, в которых молекулы ДНК были частично комплементарны друг другу. При инкубации
двух гибридов ДНК-SWCNT происходила частичная десорбция ДНК с поверхности SWCNT с
последующим
образованием
дуплекса
с
комплементарной
последовательностью,
иммобилизованной на поверхности второго гибрида (рис. 1.19). В более поздней работе этих же
авторов сообщается об организации гибридов НК с SWCNT в гидрогель [385]. Путем подбора
последовательностей олигонуклеотидов-линкеров модулировали механическую прочность
формируемого геля, а также его реологические свойства.
SWCNT-1
SWCNT-2
Рис. 1.19. Схема самоорганизации гибридов SWCNT с частично комплементарными
фрагментами ДНК в наноассоциат [384].
Оптимизация
длины
линкерных
олигонуклеотидов
позволила
осуществить
самоорганизацию SWCNT в гибридные нано-кольца [386]. Форма полученных ассоциатов была
задана сочетанием коротких и длинных линкеров, соединяющих индивидуальные нанотрубки
(рис. 1.20). Отметим, что в данной работе адресующие олигонуклеотиды присоединяли к
60
нанотрубкам ковалентно, а не с использованием протяженного «якорного» участка
олигонуклеотида.
б
а
Рис. 1.20. Схема самоорганизации гибридов SWCNT-ДНК в нанокольца (а) и АСМизображение полученных нано-колец (б) [386].
НК-направленная
самоорганизация
позволяет
создавать
ультратонкие
пленки
одностенных углеродных нанотрубок для использования в электронных устройствах.
Разработки пяти последних лет позволили создавать транзисторы и сенсорные устройства
микрометрового размера на основе SWCNT, однако, перевод полученных устройств на
нанометровый уровень, а также необходимость улучшения связывания SWCNT с другими
нанообъектами требуют разработки новых способов создания геометрически упорядоченных
структур.
В работе [387] был предложен метод создания самоорганизующихся структурных
параллельных пленок для применения в высокоэффективных сенсорных устройствах. Процесс
сборки наноассоциатов включал несколько стадий. На первой стадии с помощью
ультразвуковой обработки SWCNT в растворе с ДНК-линкерами был получен коллоидный
раствор, который осаждали на заряженной поверхности в присутствии двухвалентных ионов
металлов. ДНК-линкеры представляли собой две частично комплементарные молекулы ДНК,
состоящие из нескольких частей - «якоря», «спейсера», образуемого комплементарными
участками, и «точки опоры». На второй стадии при добавлении одновалентых ионов гибрид
ДНК-SWCNT диффундировал в двумерный слой на заряженной поверхности. Из-за
поверхностного натяжения слабые дисперсионные взаимодействия между ДНК-линкерами на
поверхности одной нанотрубки и поверхностью соседней нанотрубки вызывали сборку
параллельных слоев SWCNT (рис. 1.21). Двуцепочечные домены ДНК-линкеров располагались
между соседними SWCNT для поддержания их на фиксированном расстоянии до 3 нм.
61
SWCNT
Рис. 1.21. Схема сборки SWCNT в упорядоченные слои с помощью ДНК-линкеров [387].
Получение упорядоченного CNT-ассоциата на поверхности подложки было описано и в
работе [388]. Для создания паттерна укладки нанотрубок на кремниевой подложке
иммобилизовали линкерный олигонуклеотид (AG)7. Нанесение на обработанную таким образом
подложку гибрида SWCNT с олигонуклеотидом T40-(TC)7 приводило к формированию
упорядоченных линий нанотрубок. Фрагмент T40 в данном случае выступал в качестве якорной
группы для присоединения олигонуклеотида к поверхности нанотрубок.
Относительно новое направление гибридной CNT-НК-наноархитектоники объединяет
два типа нанообъектов: SWCNT и ДНК-оригами. В данном случае ДНК-наноконструкция
выступает в качестве шаблона для последующей укладки нанотрубок. Для присоединения
нанотрубок к ДНК-оригами используют как взаимодействие стрептавидин-биотин [389] (в
данной работе взаимодействие стрептавидин-биотин использовали и для связывания ДНКоригами-шаблона с
подложкой),
так и якорные
LNA- [390]
или
ДНК- [391,392]
олигонуклеотиды. Оптимизация состава и структуры ДНК-шаблона приводит к ассоциации
нанотрубок
и
ДНК-оригами
в
квази-нольмерные,
квази-одномерные
и
двумерные
супрамолекулярные ансамбли различной морфологии (рис. 1.22). Полученные наноассоциаты
потенциально могут быть использованы в качестве компонентов полевых транзисторов и
других электронных устройств, требующих программируемой укладки нанотрубок.
62
а
б
в
Рис. 1.22. Квази-нольмерные [391,392] (а), квази-одномерные [391] (б) и двумерные [389] (в)
наноконструкции из SWCNT и ДНК-оригами.
В заключение нельзя не отметить не столь зрелищный, но хорошо проработанный с
точки
зрения
взаимодействий
нуклеиновых
кислот
способ
организации
SWCNT
в
наноассоциат, описанный в работе C. Zhao и соавт. [69]. Авторы работы использовали явление
формирования триплексов dT⋅dA⋅dT для объединения в наноконструкции SWCNT, ковалентно
модифицированных олигонуклеотидом dT22. После гибридизации с комплементарным
олигонуклеотидом dA22 в присутствии индуктора формирования триплексов (коралина)
происходила организация гибрида SWCNT-dT22⋅dA22 в разветвленные наноконструкции (рис.
1.23). Формирование триплекса олигонуклеотидов подтверждали методами КД-спектроскопии
и термической денатурации НК-комплексов. В то же время, использование других
интеркаляторов (бромистого этидия, DAPI, неомицина) не приводило к формированию
ассоциатов нанотрубок. Авторы работы предлагают использовать данный метод для скрининга
триплекс-индуцирующей активности малых молекул.
63
а
Гибридизация
б
Неомицин
Формирование
триплекса
Коралин
Триплекс не
формируется
Рис. 1.23. Схема образования наноассоциатов SWCNT в результате формирования НКтриплексов в присутствии коралина (а), АСМ-изображение наноассоциата (б) [69].
Углеродные нанотрубки и их гибриды с НК могут быть организованы в наноассоциаты
различной
морфологии.
Самосборка
таких
конструкций
осуществляется
за
счет
комплементарных взаимодействий НК в составе «строительных блоков» - гибридов CNT-НК.
Путем варьирования метода функционализации CNT, типа НК, а также метода сборки
компонентов можно получать структуры различной морфологии и функциональности.
Подобные наноматериалы могут найти применение в таких областях как создание электронных
и сенсорных устройств, а также разработка методов лабораторного скрининга и клинической
диагностики.
*
*
*
Представленные в обзоре литературы данные свидетельствуют о том, что гибриды
углеродных нанотрубок с нуклеиновыми кислотами являются перспективным материалом для
применения в различных областях бионанотехнологии, в особенности, для создания
биосенсорных систем и транспортеров НК в клетки.
64
Глава 2. Мультифункциональные гибриды НК-конструкций с
углеродными нанотрубками (результаты и обсуждение)
Как
было
отмечено
в
обзоре
литературы,
углеродные
нанотрубки
являются
перспективной платформой для создания транспортеров различных биологических молекул в
клетки [31,166,393,394], в т.ч., функциональных терапевтических нуклеиновых кислот
[142,215,298], а также для создания биосенсорных систем [6,12–14]. Особенности строения
углеродных
нанотрубок
позволяют
получать
мультифункциональные
конструкции,
содержащие несколько различных функциональных групп. В то же время, подходы к
получению мультифункциональных гибридов НК с углеродными нанотрубками до сих пор
остаются недостаточно разработанными. В данной работе предложен подход к получению
мультифункциональных гибридов одностенных и многостенных углеродных нанотрубок с
нуклеиновыми кислотами, основанный на сочетании процессов ковалентной и нековалентной
модификации, разобщенных во времени (процессы модификации независимы) и в пространстве
(модификация проводится по разным сайтам на поверхности нанотрубок). Для иммобилизации
олигонуклеотидов и НК-конструкций на поверхности углеродных нанотрубок в настоящей
работе использованы остатки пирена, введенные в 5′-положения олигонуклеотидов. Пирен
имеет высокое сродство к поверхности углеродных нанотрубок, взаимодействие с которой
осуществляется
за счет
стэкинг-взаимодействий
и
обеспечивает
высокую
плотность
модификации, причем олигонуклеотид, присоединенный к CNT через пиренильную якорную
группу, способен взаимодействовать с комплементарным олигонуклеотидом [172]. Этот метод
модификации подходит как для одностенных, так и для многостенных углеродных нанотрубок
[169–173], однако он до сих пор не применялся для получения мультифункциональных
гибридов углеродных нанотрубок с НК, а также для сборки многокомпонентных НКкомплексов на поверхности нанотрубок.
Целью
данной
работы
являлись
разработка
подхода
к
созданию
новых
мультифункциональных наноконструкций, представляющих собой нековалентные гибриды
пирен-содержащих олигонуклеотидов и НК-комплексов с модифицированными углеродными
нанотрубками, и демонстрация потенциальной возможности использования созданных
конструкций как транспортеров НК в клетки и компонентов электрохимических биосенсоров.
Для достижения поставленной цели необходимо было решить следующие задачи:
•
разработать методы создания мультифункциональных гибридов одностенных и
многостенных CNT с пиренильными конъюгатами олигонуклеотидов;
65
•
разработать методы сборки гибридов модифицированных одностенных углеродных
нанотрубок с НК-дуплексами и трехкомпонентными НК-комплексами;
•
изучить физико-химические свойства полученных мультифункциональных гибридов
одностенных углеродных нанотрубок с пиренсодержащими олигонуклеотидами и НКкомплексами, исследовать их биосовместимость и возможность проникновения в клетку;
•
изучить возможность использования электродов на основе гибридов вертикально
ориентированных многостенных углеродных нанотрубок с пиренильными конъюгатами
олигонуклеотидов для детекции РНК-мишеней.
Первый этап работы был посвящен синтезу модифицированных углеродных нанотрубок
как платформы для создания мультифункциональных гибридов с НК.
2.1. Модифицированные одностенные углеродные нанотрубки и их физикохимические свойства
Одностенные углеродные нанотрубки были выбраны в качестве платформы для
получения гибридов-транспортеров НК благодаря меньшим линейным размерам и меньшей
дефектности их поверхности по сравнению с многостенными углеродными нанотрубками, а
также благодаря возможности достичь более эффективной модификации, то есть возможности
введения большего количества функциональных групп на единицу массы.
2.1.1. Карбоксимодифицированные одностенные углеродные нанотрубки
На первой стадии ковалентной функционализации осуществляли окисление SWCNT
азотной кислотой. Такой вариант окисления приводит к появлению карбоксильных групп на
поверхности SWCNT. SWCNT-COOH формируют стабильные водные золи в широком
диапазоне концентраций, в отличие от немодифицированных SWCNT. Наличие легко
ионизуемых карбоксильных групп приводит к сольватации поверхности CNT и разрыву Вандер-Ваальсовых взаимодействий между индивидуальными нанотрубками, что приводит к
дезагрегации пучков и увеличивает растворимость CNT в воде. Важным свойством
карбоксимодифицированных CNT является возможность активации карбоксильных групп в
мягких условиях с последующим присоединением аминосоединений посредством амидной
связи на стадиях дальнейшей функционализации.
Получение
карбоксимодифицированных
углеродных
нанотрубок
проводили
в
соответствии с методом [38]. Для этого немодифицированные SWCNT подвергали кипячению в
70%-ной HNO3 (115 °С, 6 ч). Такие условия окисления приводят к образованию на поверхности
66
SWCNT карбоксильных групп (схема 2.1), а также к уменьшению длины нанотрубок за счет
разрыва CNT по местам дефектов.
Схема 2.1
Карбоксимодифицированные углеродные трубки SWCNT-COOH использовали далее в
качестве платформы для создания гибридов с олигонуклеотидами и НК-комплексами, а также
для их дальнейшей ковалентной функционализации.
2.1.2. Аминомодифицированные углеродные нанотрубки
SWCNT и MWCNT, функционализированные ди- и полиаминами, находят широкое
применение в области создания наноконструкций как сами по себе [140], так и в качестве
промежуточных продуктов для получения более сложных производных [395]. Наличие в
составе нанотрубок первичных аминогрупп позволяет проводить присоединение к ним других
низко- и высокомолекулярных соединений [396,397], при этом присоединенный амин
выступает в качестве линкера.
В данной работе было получено три типа амино-функционализированных SWCNT,
содержащих гексаметилендиамин (HMDA), О,О′-бис-(3-аминопропил)полиэтиленгликоль-1500
(H2N-PEG1500-NH2) и полиамидоаминовый дендример поколения 3.0 (PAMAM G3.0).
Гексаметилендиамин и полиамидоаминовые дендримеры зарекомендовали себя как хорошие
модификаторы нанотрубок для придания им биосовместимости в экспериментах in vitro, а
полиэтиленгликоль-модифицированные CNT активно используются в качестве транспортеров
для системной доставки биологически активных молекул (лекарственные препараты, витамины,
нуклеиновые кислоты, антитела) [1].
Для
активации
карбоксильных
групп
SWCNT-COOH
использовали
этилдиметиламинопропилкарбодиимид (EDC) [36,37,398,399]. Активированные нанотрубки
вводили в реакцию с HMDA, H2N-PEG1500-NH2 или PAMAM G3.0 (схема 2.2). Удаление
несвязавшихся аминов после окончания реакции осуществляли промывкой взвеси SWCNT
67
2.5%-ным водным этанолом, смесью этанол:диэтиловый эфир (1:1 v/v) или этанол:ацетон:вода
(95:2.5:2.5 v/v/v) в зависимости от типа присоединяемого амина.
Побочным процессом, осложняющим модификацию, является возможность конъюгации
одной молекулы амина с двумя карбоксильными группами на поверхности одной или разных
нанотрубок, что может привести к ковалентным сшивкам нанотрубок в пучки, а также к
уменьшению содержания первичных аминогрупп по сравнению с ожидаемым. Для
предотвращения этого использовали прием, описанный в работах [31,42]. К активированным
SWCNT-COOH присоединяли моно-N-Boc-гексаметилендиамин, а в процесс модификации
включали
стадию
удаления
Boc-защитных
групп
обработкой
10%-ным
раствором
трифторуксусной кислоты в диоксане (схема 2.2а). При модификации SWCNT-COOH диаминополиэтиленгликолем
и
полиамидоаминовыми
дендримерами
эту
проблему
решали
использованием избытка аминов (схема 2.2б,в).
Схема 2.2
Для определения удельного содержания первичных аминогрупп в SWCNT после
присоединения аминов использовали тест Кайзера [400] – обработку образца раствором
нингидрина с последующим спектрофотометрическим определением количества окрашенного
продукта реакции (см.табл. 2.1).
68
Таблица 2.1. Удельное содержание аминогрупп в SWCNT после присоединения аминов
Содержание
Тип SWCNT
аминогрупп, ммоль/г
SWCNT-HMDA
0.26±0.04
SWCNT-PEG
0.18±0.06
SWCNT-PAMAM
0.54±0.06
Результаты, полученные нами, коррелируют с данными, полученными для SWCNT,
модифицированных 1,3-диполярным циклоприсоединением аминолинкера по поверхности и
несущих концевые аминогруппы (0.25-0.55 ммоль/г) [42,143].
Сравнительно
низкое
содержание
аминогрупп
в
дендример-модифицированных
SWCNT-PAMAM оказалось неожиданным для нас. Причиной этого могут являться стерические
затруднения,
препятствующие
присоединению
нескольких
молекул
дендримера
к
карбоксильным группам в одном сайте окисления нанотрубки, а также недоступность части
аминогрупп дендримера для реакции с нингидрином. Возможным способом обойти это
препятствие может быть использование дендримеров младших поколений (1.0 или 2.0), а также
выращивание дендримеров непосредственно на поверхности CNT [141].
На
следующей
стадии
проводили
присоединение
флуоресцеина
к
аминомодифицированным углеродным нанотрубкам SWCNT-HMDA, SWCNT-PEG и SWCNTPAMAM.
2.1.3. Флуоресцентно модифицированные одностенные углеродные нанотрубки
Создание наносистем для доставки биологически активных соединений требует наличия
в их составе репортерных групп. Введение флуоресцентных меток в нанотранспортеры
позволяет контролировать
их взаимодействие с клетками в реальном времени методами
конфокальной микроскопии. В качестве флуоресцентной метки нами был выбран флуоресцеин.
Данный флуорофор нашел широкое применение в микроскопических исследованиях живых
клеток, в том числе, в экспериментах по проникновению наноконструкций внутрь клеток
[215,296,398].
Для введения флуоресцеина в структуру SWCNT нами был выбран подход,
предусматривающий
ковалентное
присоединение
его
активированного
производного
(изотиоцианат флуоресцеина, FITC) к первичным аминогруппам на поверхности SWCNT
[275,401]. При этом получение флуоресцентных дендример-модифицированных SWCNT
представлялось весьма привлекательным, т.к. теоретическое количество первичных аминогрупп
в дендримере выше по сравнению с алифатическим аминолинкером, что может обеспечить
присоединение большего количества остатков флуоресцеина на единицу массы нанотрубок. Мы
69
предположили, что флуоресцентные дендример-модифицированные нанотрубки будут давать
на порядок больший флуоресцентный отклик по сравнению с HMDA-содержащими аналогами.
Аминомодифицированые SWCNT диспергировали в DMF или DMSO в присутствии
триэтиламина с последующим добавлением FITC (схема 2.3).
Схема 2.3
Как было показано выше, дендример-модифицированные SWCNT-PAMAM содержали
относительно небольшое количество аминогрупп по сравнению с ожидаемым. Поэтому для
получения флуоресцентных SWCNT-PAMAM-FITC нами был применен другой метод,
предусматривающий присоединение к активированным SWCNT-COOH предварительно
полученного конъюгата PAMAM с флуоресцеином [398,402]. Конъюгат PAMAM-FITC
70
получали присоединением FITC к PAMAM в соотношении 1:3 по количеству реагирующих
между собой групп (схема 2.3в), что должно обеспечивать высокий флуоресцентный отклик и в
то же время наличие свободных аминогрупп для присоединения к SWCNT-COOH. Тест
Кайзера подтвердил наличие в конъюгате PAMAM-FITC первичных аминогрупп. Конъюгат
присоединяли к SWCNT-COOH, активированным EDC, без предварительного выделения.
Были
исследованы
спектральные
свойства
полученных
флуоресцентно
модифицированных SWCNT. В спектрах поглощения наблюдаются максимумы поглощения на
длинах волн 260 и 495 нм (рис. 2.1а). Вид спектров поглощения согласуется с данными,
приведенными в работе [398]. Первый максимум соответствует SWCNT, второй –
флуоресцеину. В спектрах флуоресценции (λвозб.=495 нм) выражен максимум на длине волны
514 нм, соответствующий флуоресцеину.
Зависимость интенсивности флуоресценции
модифицированных нанотрубок от их концентрации демонстрирует отклонения от линейной в
области содержания SWCNT более 60 мг/л, что, по-видимому, объясняется формированием
агрегатов нанотрубок, рассеивающих излучение (рис. 2.1б).
а
б
УНТ
SWNT
SWCNT
Поглощение
Поглощение
0,40
0,35
FITC
FITC
0,30
0,25
0,20
0,15
200
250
300
350
400
450
500
550
600
Длина
волны
(нм)
Длина
волны
(нм
)
600
500
400
300
200
500
510
520
530
540
550
Длина волны (нм)
в
Интенсивность флуоресценции
(усл. ед.)
Интенсивность флуоресценции
(усл. ед.)
0,45
Рис. 2.1. Спектры поглощения (а) и
флуоресценции (б) растворов SWCNTPEG-FITC (100 мг/л) и (в) зависимость
интенсивности флуоресценции растворов
SWCNT-PEG-FITC
от
концентрации
нанотрубок. Условия: 10 мМ Трис-HCl,
pH 7.5, 1 мМ Na2EDTA, 0.1 М NaCl;
комнатная температура.
800
600
400
200
0
0
20
40
60
80
100
120
Содержание SWCNT-PEG-FITC (мг/л)
71
Известно, что интенсивность флуоресценции FITC зависит от pH среды [121]. Кроме
того,
она
может
существенно
изменяться
при
введении
флуоресцеина
в
состав
наноконструкций. Исследование pH-зависимости флуоресценции модифицированных SWCNT
важно для использования их в качестве внутриклеточных транспортеров, поскольку вследствие
различий pH клеточных органелл, флуоресценция наноконструкции может изменяться, что
следует учитывать при микроскопических исследованиях. Нами было проведено изучение pHзависимости интенсивности флуоресценции модифицированных SWCNT в растворе в
диапазоне pH 5.5 – 8.9 (рис. 2.2).
Интенсивность флуоресценции
(усл. ед.)
1000
FITC
SWCNT-HMDA-FITC
SWNT-PAMAM-FITC
SWCNT-PEG-FITC
800
600
400
200
0
5,5
6,0
6,5
7,0
7,5
8,0
8,5
9,0
Зависимость
интенсивности
Рис.
2.2.
флуоресценции (514 нм) SWCNT-HMDAFITC, SWCNT-PAMAM-FITC, SWCNT-PEGFITC и FITC от pH раствора. Содержание
флуоресцентно модифицированных SWCNT 100 мг/л, концентрация FITC - 0.5 мкM.
Условия: 10 мМ какодилат натрия, 1 мМ
Na2EDTA, 0.1 М NaCl, pH 5.5; 6.0; 6.5; 7.0
или 10 мМ Трис-HCl, 1 мМ Na2EDTA, 0.1 М
NaCl, pH 7.5; 8.0; 8.5; 8.9; комнатная
температура, возбуждение светом с длинной
волны 499 нм.
pH
Для флуорецеин-содержащих углеродных нанотрубок наблюдали монотонный рост
интенсивности флуоресценции с выходом на плато в области pH 8.5-9.0. Интенсивность
флуоресценции FITC возрастает до значения pH 7.5 с дальнейшим выходом на плато.
Смещение области выхода флуоресценции на плато в случае модифицированных SWCNT
можно объяснить экранированием карбоксильных групп остатков флуоресцеина вблизи
поверхности нанотрубок. Форма спектров испускания FITC, а также положение максимумов
флуоресценции (514 нм) не изменялись после конъюгации с SWCNT.
Использование
описанного
метода
позволяет
проводить
ковалентную
функционализацию концов и сайтов дефектности поверхности SWCNT, в то время как
основная поверхность нанотрубок остается немодифицированной, что позволяет выполнять
селективную ее функционализацию путем нековалентной иммобилизации биологических
молекул, в частности, НК.
2.1.4. Характеристики модифицированных одностенных нанотрубок
Как
уже
было
отмечено
в
обзоре
литературы,
доказательство
строения
модифицированных CNT представляет собой достаточно сложную задачу. Действительно,
72
являясь не индивидуальным веществом, а материалом, CNT демонстрируют широкую
дисперсию
структур
и
физико-химических
свойств.
В
связи
с
этим
однозначно
охарактеризовать модифицированные CNT (хотя бы в терминах количества функциональных
групп) с использованием одного метода анализа не представляется возможным, поэтому
полученные в работе модифицированные SWCNT были охарактиризованы набором физических
и физико-химических методов.
Включение органических фрагментов в состав SWCNT доказывали методом ИКспектроскопии. Полосы поглощения, наблюдаемые в ИК-спектрах, характеризуют колебания
связей, содержащихся, в основном, в составе функциональных групп, поскольку колебания
углерод-углеродных связей в составе нанотрубок не наблюдаются в ИК-спектрах. По наличию
и интенсивности тех или иных полос можно сделать вывод о присутствии функциональных
групп на поверхности углеродных нанотрубок.
В ИК-спектрах аминомодифицированных SWCNT наблюдали полосы поглощения,
соответствующие валентным колебаниям N–H-связей в аминогруппах, C=O- связей в амидных
группах. При этом в спектрах SWCNT-PEG и SWCNT-PAMAM наблюдали также полосы,
соответствующие валентным колебаниям C–H-групп, не выраженные в спектрах SWCNTHMDA. Это свидетельствует о присоединении к нанотрубкам функциональных групп,
содержащих
большое
количество
алифатических
фрагментов
(полиэтиленгликоль,
дендримеры) [31,395]. В ИК-спектрах флуоресцентно модифицированных SWCNT наблюдали
полосы, соответствующие валентным колебаниям N–H-связей в аминогруппах, C–H-связей в
линкерах, C=O- и C-N-связей в амидных группах (табл. 2.2). В спектрах флуоресцентно
модифицированных нанотрубок слабее, по сравнению с аминомодифицированными, выражены
полосы, характеризующие валентные колебания связей N–H, что указывает на уменьшение
количества первичных аминогрупп, то есть на присоединение остатков флуоресцеина
[31,38,395,397].
Таблица 2.2. Основные полосы поглощения в ИК-спектрах модифицированных SWCNT
Тип SWCNT
Волновые числа и их отнесения
SWCNT-COOH
3430 см-1, ν(O-H); 1730 см-1, ν(C=O).
SWCNT-HMDA
3431 см-1, ν(O-H), ν(N-H); 2923, 2854 см-1, ν(C-H)*; 1730 см1
SWCNT-PEG
, ν(C=O); 1619, δ(NH2); 1135-1030 см-1, ν(C-C), δ(O-H).
SWCNT-PAMAM
SWCNT-HMDA-FITC
3427 см-1, ν(O-H), ν(N-H); 3007, ν(C-H)кольцо; 2923, 2854 см -1,
SWCNT-PEG-FITC
ν(C-H); 1745, 1694 см -1, ν(C=O); 1162-1035 см -1, ν(C-C),
SWCNT-PAMAM-FITC
δ(O-H).
*
Максимум не наблюдали в спектрах SWCNT-HMDA.
73
Динамика изменения содержания углерода, водорода и азота по данным элементного
анализа в процессе функционализации SWCNT указывает на присоединение к ним
органических фрагментов (табл. 2.3).
Таблица 2.3. Данные элементного анализа модифицированных SWCNT
Тип SWCNT
%C
%H
%N
SWCNT-COOH
89.8
0.7
SWCNT-HMDA
79.5
2.5
4.7
SWCNT-PEG
67.0
2.8
2.8
SWCNT-PAMAM
56.2
5.5
14.6
SWCNT-HMDA-FITC
70.7
3.0
3.5
SWCNT-PEG-FITC
63.4
3.4
3.3
SWCNT-PAMAM-FITC
63.6
2.9
10.2
На рис. 2.3 представлены типичные кривые термогравиметрического анализа (ТГА)
SWCNT на последовательных стадиях их ковалентной функционализации. Из анализа
термограмм можно извлечь информацию о наличии нековалентно сорбированных соединений
на поверхности нанотрубок [395,396]. На термограммах модифицированных SWCNT в
диапазоне до 200 °С не происходит значительного уменьшения массы образцов, что
свидетельствует об отсутствии нековалентно сорбированных соединений на поверхности
нанотрубок. Значительная потеря массы в диапазоне температур от 200 °С до 400 °С
подтверждает наличие функциональных групп, ковалентно присоединенных к поверхности
нанотрубок.
100
SWNT-COOH
Рис. 2.3. Термограммы SWCNT-COOH,
SWCNT-PEG, SWCNT-PEG-FITC.
Масса (%)
90
80
70
SWNT-PEG
60
SWNT-PEG-FITC
50
0
200
400
600
800
T (°C )
Данные о структуре SWCNT были получены с использованием спектроскопии
комбинационного рассеяния (КР-спектроскопии). Этот метод нашел широкое применение в
исследованиях углеродных нанотрубок ввиду того, что колебания неполярных связей –C–C– и –
С=С– (подавляющее большинство всех колебаний в CNT) активны именно в спектрах КР. На
рис. 2.4 приведен типичный спектр КР модифицированных SWCNT. В области 100-200 см-1
наблюдается т.н. дышащая мода (ДМ) колебаний, соответствующая
симметричному
74
радиальному сжатию-растяжению графитового цилиндра, данный тип колебаний характерен
исключительно для одностенных углеродных нанотрубок и служит доказательством их наличия
в образце. В области ω~1300 см-1 наблюдается D-полоса (от англ. disorder) – колебания атомов
углерода в sp3-гибридизации. В области 1500-1600 см-1 наблюдается G-полоса – основная мода
колебаний в CNT, соответствующая колебаниям атомов углерода в sp2-гибридизации [122]. В
областях 2600 см-1 и 3000-3200 см-1 наблюдаются полосы D′ и G′ – обертоны колебаний D и G,
соответственно.
3000
G
Рис. 2.4. КР-спектр SWCNTHMDA-FITC. ДМ – дышащая
мода колебаний.
Интенсивность (усл.ед.)
2500
2000
ДМ
1500
D'
D
G'
1000
500
0
0
500
1000
1500
2000
2500
3000
3500
-1
Волновое число (см )
Из значений ωДМ можно получить информацию о диаметре и хиральности SWCNT. Для
вычисления диаметра используется простое соотношение ωДМ=248/d [403]. Определение
хиральности нанотрубок существенно сложнее и включает сопоставление спектральных
данных с моделями [404]. Соотношение интенсивностей полос D и G (ID/IG) характеризует
содержание в CNT дефектов, связанных с наличием кластеров аморфного углерода, примесных
атомов и др. Сравнивая величины ID/IG для разных образцов нанотрубок, можно делать выводы
о большем или меньшем содержании в них дефектов и о модификации поверхности [405].
Полосы D′ и G′ не несут информации о дефектности CNT. В процессе функционализации CNT
мы регистрировали увеличение отношения ID/IG, что говорит о некотором разупорядочении
структуры SWCNT после ковалентной функционализации (рис. 2.5).
75
1,0
Соотношение
Рис.
2.5.
интенсивностей ID/IG в образцах
модифицированных SWCNT.
0,8
0,6
ID/IG
0,4
0,2
SW
N
T
SW SW -CO
N
O
N
T- T-H H
H
M
M
D DA
A
-F
IT
SW
C
N
T
S
SW W -C
N NT OO
TPA PA H
M MA
A
M M
-F
IT
SW
C
N
TS CO
SW WN OH
TN
P
TPE EG
G
-F
IT
C
0,0
Структурные свойства модифицированных SWCNT были исследованы с использованием
метода просвечивающей электронной микроскопии без использования и с использованием
контрастирующих
реагентов:
ацетата
уранила
и
фосфорно-вольфрамовой
кислоты.
Использование контрастирующих реагентов позволяет провести визуализацию заряженных
функциональных групп при относительно низком ускоряющем напряжении, что позволяет
избежать разрушения органических фрагментов гибридов. Визуализация достигается благодаря
электростатическим взаимодействиям уранил-катионов с карбоксильными группами SWCNTCOOH и в составе остатка флуоресцеина или взаимодействиям вольфрамат-анионов с
аминогруппами модифицированных SWCNT.
На рис. 2.6 приведено типичное ПЭМ-изображение модифицированных SWCNT. На рис.
2.7 приведены ПЭМ-изображения SWCNT на трех последовательных стадиях ковалентной
функционализации, полученные с использованием контрастирующих реагентов. На ПЭМизображениях модифицированных SWCNT наблюдали пучки SWCNT диаметром около 10-20
нм и длиной до 1 мкм. Объемные структуры на поверхности нанотрубок соответствуют
введенным функциональным группам.
76
Рис. 2.6. ПЭМ-изображение SWCNT-PAMAM-FITC. Белыми стрелками отмечены области
введения функциональных групп. Размер шкалы соответствует 200 нм. Ускоряющее
напряжение – 150 кВ.
а
б
Рис. 2.7. ПЭМ-изображения SWCNTCOOH (а), SWCNT-PEG (б), SWCNTБелыми
стрелками
PEG-FITC
(в).
отмечены
области
введения
функциональных групп. Образцы были
контрастированы с помощью ацетата
уранила
(а,
в)
или
фосфорновольфрамовой кислоты (б). Размер шкалы
соответствует 100 нм. Ускоряющее
напряжение – 80 кВ.
в
Для использования углеродных нанотрубок для доставки НК в клетки, гибридные
конструкции на их основе должны образовывать стабильные колоидные растворы. Для
модифицированных углеродных нанотрубок характерно образование стабильных суспензий и
золей [62,79,82,406–408]. Тем не менее, в литературе устоялся термин «раствор углеродных
нанотрубок», под которым понимают не истинный, а коллоидный раствор – суспензию или
77
золь. Кроме того, при исследовании свойств коллоидных растворов CNT-наноконструкций в
расчетах часто используют допущение, считая коллоидный раствор истинным. В связи с этим, в
дальнейшей работе мы также считаем возможным придерживаться приведенных выше
терминологических и методических допущений, упрощенно называя суспензии нанотрубок
растворами и принимая их таковыми в расчетах.
Определение суммарного заряда наночастиц в растворе и оценку стабильности
растворов осуществляли с использованием метода электрофоретического светорассеяния, в
основе
которого
лежит
регистрация
света,
рассеиваемого
заряженными
частицами,
движущимися в электрическом поле. Данный метод позволяет определить суммарный заряд
наночастиц,
а
также
оценить
стабильность
растворов
посредством
измерения
электрокинетического потенциала.
В частности, известно, что Ван-дер-Ваальсовы взаимодействия между наночастицами
могут являться причиной их агрегации в агломераты, что приводит к увеличению их
суммарного объема. Под действием внешнего электрического поля агрегированные частицы
двигаются медленнее, при этом электрокинетический потенциал уменьшается по модулю по
сравнению с потенциалом индивидуальных наночастиц. Если частицы имеют одинаковый
заряд, они отталкиваются друг от друга, предотвращая агрегацию, в результате чего
электрокинетический потенциал возрастает по модулю. Таким образом, высокое по модулю
значение электрокинетического потенциала соответствует высокой степени диспергирования
частиц в растворе и характерно для стабильных суспензий.
Нами
были
получены
зависимости
электрокинетического
потенциала
модифицированных SWCNT в зависимости от pH и от содержания SWCNT в растворе (рис.
2.8). Полученные нами данные подтверждают, что растворы модифицированных SWCNT
являются стабильными в диапазоне pH от 5.5 до 8.9, а также в широком диапазоне
концентраций SWCNT. Растворы всех модифицированных SWCNT сохраняют стабильность в
течение продолжительного времени.
78
а
б
Рис. 2.8. Изменение электрокинетического потенциала в зависимости от pH (а) и содержания
SWCNT в растворе (б) для SWCNT-COOH, SWCNT-PEG и SWCNT-PEG-FITC. Условия: 10 мМ
какодилат натрия, 1 мМ Na2EDTA, 0.1 М NaCl, pH 5.5; 6.0; 6.5; 7.0 или 10 мМ Трис-HCl, 1 мМ
Na2EDTA, 0.1 М NaCl, pH 7.5; 8.0; 8.5; 8.9; 25 °C. Экспериментальные данные
аппроксимировали линейной регрессией (а) или полиномом по Савицкому-Голаю (б).
Таким образом, была получена и охарактеризована серия модифицированных SWCNT
для
создания
гибридов
углеродных
нанотрубок
с
пиренильными
конъюгатами
олигонуклеотидов. С помощью набора физических и физико-химических методов было
доказано
строение
синтезированных
модифицированных
SWCNT.
Полученные
модифицированные SWCNT были использованы для получения гибридов и исследования их
физико-химических свойств.
2.2. Конъюгаты олигонуклеотидов, содержащие пиренильную якорную
группу
При конструировании пиренильных производных олигонуклеотидов весьма важным
является выбор положения в структуре олигонуклеотида, модификация которого не влияла бы
на способность олигонуклеотида к уотсон-криковским взаимодействиям, то есть на
способность образовывать достаточно стабильные дуплексы с комплементарными мишенями.
Одним из таких положений является терминальный 5′-фосфат, который легко может быть
активирован для последующего взаимодействия с функциональными группами различных
лигандов.
Преимущество
этого
положения
заключается
также
в
конформационной
подвижности присоединенной группы.
Для обеспечения доступности олигонуклеотида в составе наноконструкции для
взаимодействий
с
комплементарной
последовательностью
или
белковым
комплексом
необходимо наличие линкера, соединяющего олигонуклеотид с остатком пирена. В качестве
такого линкера нами был выбран гексаэтиленгликоль, обладающий необходимыми качествами
79
оптимального линкера – гидрофильностью, гибкостью и достаточной длиной для обеспечения
подвижности остатка пирена. Первой нашей задачей стал синтез 5′-фосфорилированных
олигорибо- и олигодезоксирибонуклеотидов – модельных олигонуклеотидов и компонентов
НК-комплексов - содержащих и не содержащих гексаэтиленгликолевый линкер.
Для синтеза 5′-модифицированных олигонуклеотидов нами был выбран подход,
основанный на сочетании фосфитамидного и H-фосфонатного методов синтеза. Исходили из
полимер-связанных олигонуклеотидов в виде фосфотриэфиров, полученных твердофазным
фосфитамидным методом и содержащих защищенные межнуклеозидные фосфатные группы
(последовательности олигонуклеотидов приведены в таблице 3.1). Для получения 5′фосфатсодержащих олигонуклеотидов после удаления 5′-O-диметокситритильной защитной
группы проводили конденсацию с H-фосфонатом диметокситритилсульфонилдиэтанола,
полученным по аналогии с [409,410]. Получение 5′-гексаэтиленгликольфосфатсодержащих
олигонуклеотидов проводили в 2 стадии (схема 2.4). На первой стадии проводили конденсацию
с H-фосфонатом диметокситритилгексаэтиленгликоля, полученным по аналогии с [411,412], на
второй – с H-фосфонатом диметокситритилсульфонилдиэтанола. Реакционные смеси после
деблокирования олигонуклеотидов в стандартных условиях анализировали с помощью
аналитического гель-электрофореза в 15%-ном ПААГ. Было показано, что содержание
искомого продукта в них составляет более 90%, что позволило использовать эти реакционные
смеси непосредственно для синтеза пиренильных производных олигонуклеотидов, содержащих
5′-фосфат и 5′-гексаэтиленгликольфосфат.
80
Схема 2.4
O
O
)4
DMTr
O)
DMTrO
O B'
O
O
P
O
R
O P O(CH2)2CN
O B'
O
O
DMTrO
(
O
O
O )4
H
P
H
DCA, CH2Cl2
O-TEAH+
PivCl, Py/CH3CN
O
DCA, CH2Cl2
R
O P O(CH2)2CN
O B'
O
O
R
O P O(CH2)2CN
O O
O B'
O
O
B'
R
O P O(CH2)2CN
O
O
B'
R
O
O
O
O
S
H
O
)O
4
R
DMTr
O
-O
O
P
O
)4O
O
O
S
O
O
PivCl, Py/CH3CN
O
P
P
H
O)
O
O
O- TEAH+
H
O
O
O)
DMTrO
P
O
O B'
O
O
1. DCA, CH2Cl2
O
R
O P O(CH2)2CN 2. I2, Py/H2O
R=H: CH3NH2/H2O
R=OH: 1.CH3NH2/H2O
2. TEA*3HF/TEA/NMP
O B'
O
O
R
O P O(CH2)2CN
O
O
O
OP
B'
R
O
O
B
O
R
O P OO
O
O
B
R
O P OO O
B
OH R
(В)В'-(не)защищенное гетероциклическое основание;
R = H, OH
R' = H, OTBDMSi
- полимерный носитель
Из описанных в литературе методов введения остатков пирена по терминальному 5′фосфату олигонуклеотида нами был выбран удобный постсинтетический способ введения этой
группировки в олигонуклеотид, не требующий использования дополнительных защитных
групп, а именно метод активации концевого фосфата олигонуклеотида парой реагентов
81
трифенилфосфин-дипиридилдисульфид
в
присутствии
нуклеофильного
катализатора
с
последущим его взаимодействием с 1-пиренилметиламином (схема 2.5) [413,414]. Для
предотвращения образования 5′-бис-пиренильных производных олигонуклеотидов после
активации концевого фосфата проводили удаление избытка активирующих реагентов. Реакцию
присоединения 1-пиренилметиламина проводили в водно-органической среде.
Схема 2.5
Реакционные смеси анализировали методом гель-электрофореза и офВЭЖХ. По данным
офВЭЖХ степень превращения составила 60-80%. Конъюгаты выделяли препаративным гельэлектрофорезом в 15%-ном ПААГ. Для подтверждения строения пиренильных производных
олигонуклеотидов был использован метод MALDI-TOF масс-спектрометрии.
Шифр
Таблица 2.4. Синтезированные пиренильные конъюгаты олигонуклеотидов
Молекулярная масса
Последовательность олигонуклеотида1
Рассчитано Найдено2
Pyr(rA)10
5′-PyrCH2NHpr(AAAAAAAAAA)
3408.3
3409.5
Pyr(rA)15
5′-PyrCH2NHpr(AAAAAAAAAAAAAAA)
5169.4
5169.9
Pyr(rA)20
5′-PyrCH2NHpr(AAAAAAAAAAAAAAAAAAAA)
6815.4
6819.7
Pyr(rA)25
5′ PyrCH2NHpr(AAAAAAAAAAAAAAAAAAAAAAA
AA)
8461.4
8467.1
Pyr(dA)15
5′-PyrCH2NHpd(AAAAAAAAAAAAAAA)
4929.4
4929.8
Pyr(dA)20
5′-PyrCH2NHpd(AAAAAAAAAAAAAAAAAAAA)
6495.4
6500.3
Pyrd22
5′-PyrCH2NHpd(ACCCTGAAGTTCCGGCAAGCTG)
7013.6
7020.0
PyrHEGd22
5′ PyrCH2NHpHEGpd(ACCCTGAAGTTCCGGCAAGC
TG)
7358.0
7364.0
Pyrd17
5′-PyrCH2NHpd(АACCGTGGTCATGCTCC)
5439.6
5448.7
PyrHEGd17
5′-PyrCH2NHpHEGpd(ACCGTGGTCATGCTCC)
5783.9
5785.1
82
Pyrmdr1-S
1
2
7011.3
5′-PyrCH2NHpr(GGCUUGACAAGUUGUAUAUGG)
7011.0
Pyr - остаток пирена; HEG - остаток гексаэтиленгликоля; p - фосфатная группа;
MALDI TOF масс-спектрометрия.
Наличе остатка пирена в структуре конъюгатов подтверждали методами электронной и
флуоресцентной спектроскопии. В спектрах поглощения наблюдали максимум на длине волны
260 нм, соответствующий олигонуклеотидной части и два максимума в области 330-360 нм,
соответствующие поглощению остатков пирена (рис. 2.9а). В спектрах испускания наблюдали
два максимума на длинах волн 380 и 392 нм, соответствующие флуоресценции остатков пирена
а
б
0,14
0,12
Поглощение
0,10
0,08
0,06
0,04
0,02
0,00
250
300
350
400
450
500
Интенсивность флуоресценции (усл.ед.)
(рис. 2.9б).
500
400
300
200
100
0
360
Длина волны (нм)
380
400
420
440
460
480
500
Длина волны (нм)
Рис. 2.9. Спектры поглощения (а) и флуоресценции (б) пиренильного производного
PyrHEGd22. Концентрация олигонуклеотида 5 мкМ. Условия: 10 мМ Трис-HCl, pH 7.5, 1 мМ
Na2EDTA, 0.1 М NaCl; комнатная температура.
Таким образом, была синтезирована серия пиренильных конъюгатов олигорибо- и
олигодезоксирибонуклеотидов, которые далее использовали для получения нековалентных
гибридов с одностенными и многостенными углеродными нанотрубками.
2.3.
Мультифункциональные
гибриды
пиренильных
конъюгатов
олигонуклеотидов с одностенными углеродными нанотрубками
Для получения гибридов олигонуклеотидов и НК-комплексов с
углеродными
нанотрубками разработан ряд подходов с использованием ковалентного и нековалентного
присоединения НК к CNT, а также с использованием якорных групп для иммобилизации НК на
поверхности нанотрубок (см. раздел 1.1). Использование якорных групп позволяет объединить
преимущества ковалентного (прочность иммобилизации НК-конструкций на поверхности
нанотрубок, получение гибридов контролируемого состава и строения) и нековалентного
(возможность иммобилизации большего количества олигонуклеотида на поверхности CNT)
83
методов
получения
гибридов,
а
также
получать
гибриды
НК-конструкций
с
модифицированными SWCNT, несущими различные функциональные группы, т.е. получать
мультифункциональные гибриды. На сегодняшний день получение таких гибридных
конструкций практически не описано в литературе.
Данный раздел посвящен созданию мультифункциональных гибридов НК-конструкций с
модифицированными SWCNT и изучению факторов, влияющих на процесс их формирования.
На первом этапе работы изучали закономерности взаимодействия пиренильных конъюгатов
модельных
олигонуклеотидов
и
олигонуклеотидов-компонентов
НК-конструкций
с
модифицированными SWCNT.
2.3.1.
Формирование
нековалентных
гибридов
пиренильных
конъюгатов
олигонуклеотидов с одностенными углеродными нанотрубками
Общая процедура получения нековалентных гибридов включает ультразвуковую
обработку порошка SWCNT в растворе пиренильного конъюгата олигонуклеотида с
последующим
отделением
нерастворимых
агрегатов
нанотрубок
центрифугированием.
Ультразвук вызывает интенсивные колебания частиц в растворе или суспензии, что приводит к
эффективной сольватации и диспергированию нанотрубок; также происходит разрушение
пучков. Формирование гибрида происходит за счет π-π-стэкинг взаимодействий ароматических
систем пирена и гетероциклических оснований олигонуклеотида с поверхностью нанотрубки.
Адсорбция пиренильного конъюгата олигонуклеотида на поверхности SWCNT предотвращает
агрегацию индивидуальных нанотрубок за счет разрыва Ван-дер-Ваальсовых взаимодействий
между ними. Из литературных данных известно, что остатки пирена имеют весьма высокое
сродство к поверхности CNT, и не происходит их самопроизвольной десорбции с поверхности
нанотрубок в водном растворе при физиологической температуре [59,63], следовательно,
можно ожидать, что гибриды пиренильных конъюгатов олигонуклеотидов с углеродными
нанотрубками также не будут подвержены самопроизвольному разрушению. Для проверки
этого предположения изучали стабильность гибрида 3′-[32P]-меченого пиренильного конъюгата
Pyrmdr1-S с SWCNT-COOH в условиях ПААГ-электрофореза с последующей визуализацией
электрофореграмм методом радиоавтогрфии. Было показано, что полученные гибриды
сохраняют стабильность в условиях электрофореза в ПААГ в нативных условиях, но
разрушаются в денатурирующих (рис. 2.10).
84
128 мг/л
0 мг/л
Содержание SWCNT
а
128 мг/л
0 мг/л
Содержание SWCNT
б
Рис. 2.10. Электрофореграммы гибрида 3′-[32P]-меченого Pyrmdr1-S с SWCNT-COOH в 12%ном ПААГ в нативных (а) и денатурирующих (б) условиях. Условия: 10 мМ Трис-HCl, pH 7.5, 1
мМ Na2EDTA, 0.1 М NaCl; концентрация олигонуклеотида 1 мкМ.
Полученные данные свидетельствуют об относительной стабильности гибридов
пиренильных конъюгатов олигонуклеотидов с углеродными нанотрубками. Для более ясного
понимания
природы
взаимодействия
пиренильных
конъюгатов
олигонуклеотидов
на
поверхности углеродных нанотрубок была изучена возможность вытеснения этих конъюгатов с
поверхности SWCNT.
В работе [81] описано вытеснение немодифицированных олигонуклеотидов с
поверхности CNT при добавлении в раствор комплекса красителя метиленового синего,
десорбция сопровождалась выпадением осадка CNT. Такое конкурентное вытеснение основано
на различиях констант ассоциации красителя и олигонуклеотида с углеродными нанотрубками
[17]. Описано также замещение катионного производного пирена на поверхности SWCNT
анионным [150], приводящее к утрате сродства НК к нанотрубкам.
Ультразвуковой обработкой немодифицированных SWCNT в растворе пиренильного
конъюгата Pyrd22 получали нековалентные гибриды. К растворам гибридов добавляли раствор
метиленового синего до концентрации 0.005; 0.01; 0.05; 0.1; 0.5%. В процессе ультразвуковой
обработки происходило вытеснение пиренильных конъюгатов олигонуклеотидов с поверхности
SWCNT молекулами метиленового синего; при этом наблюдали агрегацию нанотрубок и
выпадение их в осадок. Количество осадка возрастало с увеличением концентрации
метиленового синего. Затем образцы наносили на 12%-ный нативный ПААГ и проводили
электрофоретическое разделение. В данных условиях углеродные нанотрубки и их гибриды с
олигонуклеотидами не проникают в толщу ПААГ вследствие малого размера пор и
задерживаются на старте, а десорбированные пиренильные конъюгаты олигонуклеотидов
проникают в гель под действием электрического поля (рис. 2.11). С увеличением концентрации
85
красителя
интенсивность
полос,
соответствующих
пиренильному
производному
олигонуклеотида, возрастает.
BP
К1
1
2
3
4
5
К2
Рис. 2.11. Электрофореграмма нековалентного гибрида Pyrd22 с немодифицированными
SWCNT в 12%-ном нативном ПААГ после вытеснения метиленовым синим. К1 –
нековалентный гибрид без добавления метиленового синего; дорожки 1-5 соответствуют
концентрациям метиленового синего 0.005; 0.01; 0.05; 0.1; 0.5% соответственно; К2 –
пиренильный конъюгат Pyrd22. Визуализацию олигонуклеотидов осуществляли окраской геля
красителем «Stains-All». BP – краситель бромфеноловый синий.
Более строго обратимый характер адсорбции пиренильных конъюгатов на поверхности
SWCNT доказывали замещением пиренильного конъюгата олигонуклеотида на поверхности
SWCNT молекулами пиренбутановой кислоты. Поверхность SWCNT насыщали 3′-[32P]меченым пиренильным конъюгатом Pyrmdr1-S, затем обрабатывали гибрид ультразвуком в
растворе пиренбутановой кислоты. Реакционные смеси наносили на 12%-ный нативный ПААГ,
распределение конъюгата Pyrmdr1-S в геле и на поверхности нанотрубок контролировали
методом
радиоавтографии.
Десорбцию
конъюгата
наблюдали
при
концентрации
пиренбутановой кислоты выше 10 мкМ (рис. 2.12).
Рис. 2.12. Профиль изменения доли 3′[32P]-меченого пиренильного конъюгата
Pyrmdr1-S в составе гибрида с SWCNTCOOH по данным электрофоретического
анализа в 12%-ном нативном ПААГ с
последующей
радиоавтографией.
Условия: 10 мМ Трис-HCl, pH 7.5, 1 мМ
Na2EDTA, 0.1 М NaCl; концентрация
олигонуклеотида 1 мкМ.
Полученные результаты подтверждают обратимый характер адсорбции пиренильных
конъюгатов олигонуклеотидов и их пиренильных конъюгатов на поверхности углеродных
нанотрубок. Вытеснение олигонуклеотидов с поверхности CNT может оказаться полезным для
86
высвобождения терапевтических НК с поверхности наноносителя после транслокации через
клеточную мембрану.
2.3.2. Исследование стабильности олигонуклеотидов в условиях формирования
гибридов с углеродными нанотрубками
Известно, что ультразвуковая обработка может вызывать образование AP-сайтов, а
также разрывы фосфодиэфирных связей в нуклеиновых кислотах [116]. Ввиду того, что
используемая нами методика получения гибридов олигонуклеотидов с углеродными
нанотрубками включает продолжительную ультразвуковую обработку, необходимо было
исследовать устойчивость олигонуклеотидных компонентов в этих условиях. В качестве
модельной системы для изучения стабильности олигонуклеотидов в условиях ультразвуковой
обработки в присутствии углеродных нанотрубок были использованы немодифицированные
SWCNT и два олигодезоксирибонуклеотида длиной 17 (d17) и 22 (d22) нуклеотида.
5′-[32P]-меченые олигонуклеотиды обрабатывали ультразвуком в течение 90 мин в
присутствии и в отсутствие SWCNT. Образцы обработанных ультразвуком олигонуклеотидов
подвергали обработке 10%-ным раствором пиперидина при 95 °C. В этих условиях происходит
разрыв сахарофосфатного остова в AP-сайтах. Затем образцы наносили на 15%-ный
денатурирующий ПААГ и проводили электрофоретическое разделение (рис. 2.13), в качестве
контролей
использовали
электрофоретического
те
же
разделения
образцы
до
происходило
обработки
разрушение
пиперидином.
В
процессе
нековалентных
гибридов
олигонуклеотидов с SWCNT, олигонуклеотиды проникали в гель.
а
б
Рис. 2.13. Исследование стабильности сахарофосфатного остова в условиях ультразвуковой
обработки (УЗ) олигонуклеотидов d22 (а) и d17 (б) в течение 90 мин в отсутствие (дорожки 1-4)
и в присутствии (дорожки 5-8) SWCNT. Дорожки 2,4,6,8 – олигонуклеотид после обработки
87
10%-ным раствором пиперидина, дорожки 1,3,5,7 – без обработки. Условия: 5′-[32P]-меченый
d17 или d22, 50 мкМ; содержание SWCNT 250 мг/л; 15%-ный ПААГ (акриламид:N,N′метиленбисакриламид (29:1), 50 мМ Трис-борат, рН 8.3, 10 мМ Na2EDTA, 8 M мочевина).
На электрофореграммах не наблюдали отличий в составе образцов до и после обработки
пиперидином как в присутствии, так и в отсутствие SWCNT. Это свидетельствует о том, что
ультразвуковая
обработка,
используемая
для
получения
нековалентных
гибридов
с
углеродными нанотрубками, не вызывает ни деградации фосфодиэфирных связей, ни
образования AP-сайтов в исследованных олигонуклеотидах.
Другим возможным повреждением олигонуклеотидов при ультразвуковой обработке в
растворе является окисление азотистых оснований кислородом растворенного воздуха [115];
основным продуктом окисления является 8-оксогуанин. Для идентификации возможных
продуктов окисления нами был выбран метод исчерпывающего ферментативного гидролиза
олигонуклеотидов до и после ультразвуковой обработки с последующим анализом гидролизата
методом офВЭЖХ.
Образцы олигонуклеотидов, обработанных ультразвуком в течение 90 мин в
присутствии и в отсутствие SWCNT, подвергали гидролизу смесью фосфодиэстеразы I (ФДЭ),
расщепляющей олигонуклеотид с 3′-конца до 5′-нуклеотидов, и щелочной фосфатазы. После
инкубации ферменты инактивировали нагреванием реакционных смесей до 90 °С в течение 2
мин. Реакционные смеси центрифугировали в течение 10 мин для удаления нанотрубок и
анализировали гидролизат методом офВЭЖХ (рис. 2.14).
A 0.4
Профиль
офВЭЖХ
Рис.
2.14.
гидролизата
олигонуклеотида
d22
после ультразвуковой обработки в
присутствии
немодифицированных
SWCNT.
Условия
–
см.
экспериментальную часть.
0.2
290 нм
280 нм
270 нм
260 нм
250 нм
0
Профили хроматографии гидролизатов олигонуклеотидов, обработанных ультразвуком в
присутствии
и
в
отсутствие
SWCNT,
не
отличались
от
профилей
контрольных
88
олигонуклеотидов; не было выявлено пиков, соответствующих возможным продуктам
окисления нуклеозидов; соотношение площадей пиков соответствовало расчетному.
Таким образом, в данных условиях не было выявлено ни деградации фосфодиэфирных
связей, ни окисления азотистых оснований в составе олигонуклеотида, вызываемых
продолжительной ультразвуковой обработкой в присутствии SWCNT (90 мин вместо 30 мин в
общей процедуре получения гибридов, см. п .2.3.1). Можно считать, что используемая нами
процедура пригодна для получения нековалентных гибридов углеродных нанотрубок с НКконструкциями.
2.3.3. Исследование стабильности олигонуклеотидов в культуральной среде,
содержащей 10%-ную эмбриональную телячью сыворотку, в составе гибрида с
одностенными углеродными нанотрубками
Известно, что при укладке олигонуклеотидов на поверхности нанотрубок может
изменяться скорость их нуклеолитической деградации [98]. Влияние SWCNT на устойчивость
олигонуклеотидов к действию нуклеаз сыворотки исследовали с использованием 5′-[32P]меченых олигонуклеотидов d22 и d17. В качестве тест-системы использовали культуральную
среду IMDM, содержащую 10% эмбриональной телячьей сыворотки. Нековалентные гибриды
олигонуклеотидов с SWCNT и контрольные олигонуклеотиды инкубировали в среде с
добавлением сыворотки при 37 °С. Отобранные через 0, 5, 10, 15, 30 мин и 1, 2, 4, 6, 24 ч пробы
наносили на 15%-ный денатурирующий ПААГ и проводили электрофоретическое разделение
(рис. 2.15).
89
Рис. 2.15. Исследование стабильности 5′-[32P]-меченых олигонуклеотидов d22 (а) и d17 (б) в
культуральной среде, содержащей 10%-ную эмбриональную телячью сыворотку, в присутствии
(+NT) и в отсутствие (-NT) SWCNT.
Из
представленных
электрофореграмм
видно,
что
скорость
нуклеолитической
деградации олигонуклеотидов несколько уменьшается в присутствии SWCNT по сравнению с
контролем. Это говорит о том, что укладка олигонуклеотида на поверхности SWCNT защищает
его от расщепления нуклеазами. Полученные данные согласуются с литературными [124].
Кроме того, следует учитывать возможную потерю активности нуклеаз сыворотки при
частичной адсорбции на поверхности SWCNT.
Таким
образом,
нами
была
продемонстрировано
увеличение
стабильности
олигонуклеотидов в условиях формирования гибридов с немодифицированными SWCNT.
Присутствие SWCNT не стимулирует деградации олигонуклеотидов; напротив, укладка
олигонуклеотида на поверхности нанотрубок защищает его от нуклеолитической деградации.
Приведенные в даном разделе результаты получены с использованием наиболее простой
системы: гибридов немодифицированных SWCNT и олигодезоксирибонуклеотидов, не
содержащих остатков пирена. На основании полученных результатов можно предположить, что
введение функциональных групп в структуру SWCNT, а также использование пиренильных
якорных групп для иммобилизации олигонуклеотидов на поверхности углеродных нанотрубок,
как минимум, не
уменьшат стабильность олигонуклеотидов в составе гибрида. В
90
действительности
же
можно
ожидать
увеличения
стабильности
олигонуклеотидных
компонентов гибридов за счет более прочной их иммобилизации на поверхности нанотрубок,
обеспечиваемой использованием якорных групп, а также за счет возможного протективного
действия органических функциональных групп на поверхности нанотрубок. К сожалению, в
литературе пока нет данных о стабильности олигонуклеотидов в составе гибридов с
модифицированными SWCNT и MWCNT, это направление нуждается в дальнейшем развитии.
Спектральные
2.3.4.
свойства
гибридов
пиренильных
конъюгатов
олигонуклеотидов с модифицированными углеродными нанотрубками
Формирование нековалентных гибридов пиренильных конъюгатов олигонуклеотидов с
SWCNT
сопровождается
изменением
интенсивностей
оптического
поглощения
и
флуоресценции компонентов гибридов. Как видно из спектров поглощения растворов
пиренильных конъюгатов олигонуклеотидов с немодифицированными SWCNT, оптическое
поглощение растворов гибридов увеличивается с повышением содержания SWCNT (рис. 2.16),
что свидетельствует об увеличении растворимости нанотрубок в результате формирования
гибрида с олигонуклеотидами; в отсутствие олигонуклеотида немодифицированные SWCNT
практически не растворимы в воде [82,415]. Формирование гибрида с SWCNT приводит к
искажению спектров пиренильных конъюгатов олигонуклеотидов: сравнение спектров
конъюгатов в отсутствие SWCNT (черная кривая на рис. 2.16) и при содержании SWCNT 2.5
мг/л (красная кривая) демонстрирует гипохромный эффект олигонуклеотидного компонента в
области около 260 нм при взаимодействии с поверхностью нанотрубок, что согласуется с [91], а
также исчезновение максимумов, соответствующих поглощению остатков пирена, в области
около 360 нм, что свидетельствует о переносе электронов в ароматическую систему нанотрубки
[54,416].
Рис. 2.16. Спектры поглощения
нековалентного гибрида Pyrd22 с
немодифицированными SWCNT.
Условия: 10 мМ Трис-HCl, pH 7.5,
1 мМ Na2EDTA, 0.1 М NaCl;
концентрация олигонуклеотида 1
мкМ, содержание SWCNT (мг/л)
указано на графике.
0,35
0,30
50
Поглощение
0,25
0,20
30
0,15
20
15
0,10
10
5
0,05
2.5
0,00
250
300
350
400
Длина волны (нм)
450
500
0
91
В спектрах испускания флуоресценции в диапазоне, соответствующем испусканию
остатков пирена (длина волны возбуждения 345 нм), наблюдали два максимума на длинах волн
378 нм и 390 нм. При возрастании содержания углеродных нанотрубок в растворе
интенсивность максимумов в спектрах испускания остатков пирена уменьшалась. Данное
явление обусловлено тушением флуоресценции остатков пирена при адсорбции на поверхности
SWCNT за счет эффективного переноса электронов в ароматическую систему нанотрубок
[54,416]. Это явление наблюдалось при формировании гибридов всех исследованных
пиренильных
конъюгатов
гомо-
и
гетеро-олигорибонуклеотидов
и
олигодезоксирибонуклеотидов с модифицированными и немодифицированными SWCNT и
свидетельствовало об адсорбции олигонуклеотидов на поверхности нанотрубок (рис. 2.17).
Более детальный анализ различий в адсорбции пиренильных конъюгатов олигонуклеотидов на
Интенсивность
флуоресценции (усл.ед.)
поверхности SWCNT разных типов функционализации приведен в разделе 2.3.7.
Интенсивность
флуоресценции (усл.ед.)
700
600 0 мг/л
500
400
700
600
500
400
300
200
100
0
0
20
40
60
80
100 120 140
Содержание SWCNT-COOH (мг/л)
300
200
100 128
0
360
380
400
420
440
460
Длина волны (нм)
Рис. 2.17. Изменение спектров флуоресценции остатков пирена (возбуждение светом с длиной
волны 345 нм) в составе конъюгата Pyr(rA)15 при адсорбции на поверхности SWCNT-COOH.
Врезка: профиль изменения интенсивности максимума флуоресценции на длине волны 378 нм с
увеличением содержания SWCNT-COOH в растворе. Содержание нанотрубок в растворе - от
0.5 до 128 мг/л. Концентрация Pyr(rA)15 1 мкМ. Условия: 10 мМ Трис-HCl, 1 мМ Na2EDTA, 0.1
М NaCl, pH 7.5; комнатная температура.
При исследовании свойств гибридов пиренильных конъюгатов олигонуклеотидов с
флуоресцентно мечеными SWCNT дополнительно записывали спектры флуоресценции в
диапазоне, соответствующем испусканию остатков флуоресцеина (возбуждение светом с
длиной волны 495 нм). Типичные профили изменения интенсивности флуоресценции
углеродных нанотрубок самих по себе и в составе гибрида с олигонуклеотидом от
концентрации нанотрубок приведены на рис. 2.18 на примере флуоресцеин-содержащих
нанотрубок SWCNT-PEG-FITC и их гибрида с пиренильным конъюгатом Pyrd22. В спектрах
испускания наблюдали линейное увеличение интенсивности флуоресценции на длине волны
92
514 нм при увеличении содержания SWCNT-PEG-FITC. Напомним, что в отсутствие
олигонуклеотида при увеличении концентрации SWCNT более 50 мг/л наблюдали уменьшение
интенсивности флуоресценции остатков флуоресцеина, вероятно, вследствие ее рассеяния в
результате частичной агрегации нанотрубок (см. разд. 2.1.3). Модификация поверхности
нанотрубок
олигонуклеотидами
препятствует
агрегации
нанотрубок;
интенсивность
флуоресценции растворов гибридов монотонно увеличивается пропорционально концентрации
SWCNT.
Интенсивность
флуоресценции (усл.ед.)
1000
Рис. 2.18. Спектры флуоресценции
остатков флуоресцеина в составе
SWCNT-PEG-FITC и нековалентного
гибрида с олигонуклеотидом Pyrd22.
Концентрация олигонуклеотида 1 мкМ.
Условия: 10 мМ Трис-HCl, 1 мМ
Na2EDTA, 0.1 М NaCl, pH 7.5;
комнатная температура.
SWCNT-PEG-FITC + Pyrd22
SWCNT-PEG-FITC
800
600
400
200
0
0
20
40
60
80
100
120
Содержание SWCNT-PEG-FITC (мг/л)
Таким образом, нами было показано, что адсорбция пиренильных конъюгатов
олигонуклеотидов на поверхности углеродных нанотрубок сопровождается тушением
флуоресценции пиренильных остатков. Мы предлагаем использовать это явление для
количественной оценки адсорбции олигонуклеотидов на поверхности углеродных нанотрубок.
2.3.5.
Гидродинамические
свойства
гибридов
пиренильных
конъюгатов
олигонуклеотидов с модифицированными углеродными нанотрубками
Метод электрофоретического светорассеяния позволяет определить суммарный заряд
наночастиц в растворе и оценить стабильность растворов CNT. Для исследования влияния
олигонуклеотидов на гидродинамические свойства модифицированных SWCNT, а также для
определения наиболее выгодных условий формирования гибридов нанотрубок с пиренильными
конъюгатами олигонуклеотидов было проведено измерение электрокинетического потенциала
растворов гибридов SWCNT с пиренильными конъюгатами гомоолигонуклеотидов различной
природы и длины методом электрофоретического светорассеяния.
На кривых изменения электрокинетического потенциала полученных гибридов
наблюдали появление минимумов, не характерных для модифицированных SWCNT (рис. 2.19).
93
Мы считаем, что это свидетельствует о формировании частиц с наименьшим абсолютным
суммарным зарядом. Возможно, при данных соотношениях олигонуклеотида к SWCNT на
единицу массы нанотрубок приходится наибольшее количество адсорбированных молекул
олигонуклеотида. Такое соотношение можно считать наиболее выгодным для формирования
гибрида.
а
б
Рис. 2.19. Изменение электрокинетического потенциала в зависимости от содержания SWCNT
в растворе для гибридов SWCNT-COOH с пиренильными конъюгатами олигорибонуклеотидов
Pyr(rA)15, Pyr(rA)20, Pyr(rA)25 (а) и олигодезоксирибонуклеотидов Pyr(dA)15, Pyr(dA)20 (б).
Концентрация олигонуклеотидов 1 мкМ. Условия: 10 мМ Трис-HCl, 1 мМ Na2EDTA, 0.1 М
NaCl, pH 7.5; 25 °C.
Следует отметить, что для гибридов SWCNT-COOH с олигорибонуклеотидами
минимумы наблюдали при концентрации SWCNT ~ 60 мг/л, в то время как для гибридов
SWCNT-COOH с олигодезоксирибонуклеотидами наблюдали минимумы при концентрации
SWCNT, соответствующей ~ 100 мг/л. Это явление может быть объяснено различиями
гидратации
олигорибонуклеотидов
и
олигодезоксирибонуклеотидов,
что
приводит
к
формированию гибридов разного состава.
-20
-22
SWCNT-PEG-FITC
SWCNT-PEG-FITC + PyrHEGd22
SWCNT-PEG-FITC + Pyrd22
б
SWCNT-COOH
SWCNT-COOH + PyrHEGd22
SWCNT-COOH + Pyrd22
-14
Электрокинетический
потенциал (мВ)
Электрокинетический
потенциал (мВ)
а
-24
-26
-28
-30
-32
-34
-16
-18
-20
-22
-24
-26
-28
-36
0
20
40
60
80
100
120
Содержание SWCNT-PEG-FITC (мг/л)
140
0
20
40
60
80
100
120
140
Содержание SWCNT-PEG-FITC (мг/л)
Рис. 2.20. Изменение электрокинетического потенциала в зависимости от содержания
модифицированных SWCNT в растворе для гибридов пиренильных конъюгатов
94
олигонуклеотидов Pyrd22, PyrHEGd22 с SWCNT-COOH (а) и SWCNT-PEG-FITC (б).
Концентрация олигонуклеотидов 1 мкМ. Условия: 10 мМ Трис-HCl, 1 мМ Na2EDTA, 0.1 М
NaCl, pH 7.5; 25 °C.
Также методом электрофоретического светорассеяния были исследованы гибриды
модифицированных SWCNT с гетероолигодезоксирибонуклеотидами (рис. 2.20). Аналогично
гибридам модельных гомоолигонуклеотидов с SWCNT-COOH на кривых изменения
электрокинетического потенциала наблюдали минимумы, соответствующие формированию
гибридов с наименьшим суммарным зарядом.
Методом электрофоретического светорассеяния было подтверждено, что растворы
гибридов пиренильных конъюгатов олигонуклеотидов с SWCNT сохраняют стабильность в
широком диапазоне концентраций. Полученные результаты также указывают на увеличение
стабильности растворов гибридов по сравнению с растворами модифицированных углеродных
нанотрубок (см. разд. 2.1.4). На основании полученных данных определены оптимальные
условия формирования гибрида – наиболее стабильный гибрид с наименьшим абсолютным
суммарным зарядом образуется при содержании SWCNT в растворе от 60 до 80 мг/л.
2.3.6.
Структурные
исследования
нековалентных
гибридов
пиренильных
конъюгатов олигонуклеотидов с одностенными углеродными нанотрубками
Данные
о
морфологии
нековалентных
гибридов
пиренильных
конъюгатов
олигонуклеотидов с SWCNT получали с использованием метода просвечивающей электронной
микроскопии (рис. 2.21). Данная часть работы была выполнена совместно с д.б.н., проф. Е.И.
Рябчиковой (ИХБФМ СО РАН) и д.ф.-м.н В.А. Зайковским (ИК СО РАН).
а
95
б
Рис. 2.21. ПЭМ-изображение нековалентного гибрида пиренильного конъюгата Pyrd22 с
SWCNT-COOH (а) и SWCNT-HMDA-FITC (б). Стрелками указаны объемные структуры на
поверхности нанотрубок, предположительно, соответствующие функциональным группам.
Размер шкалы соответствует 10 нм (а) и 100 нм (б). Ускоряющее напряжение – 150 кВ.
Для
дополнительной
визуализации
органических
функциональных
групп
и
олигонуклеотидов на поверхности SWCNT применяли контрастирование с помощью ацетата
уранила и фосфорно-вольфрамовой кислоты (рис. 2.22). Катионы уранила, связываясь с
отрицательно заряженными фосфатными группами олигонуклеотида и карбоксильными
группами на поверхности нанотрубок, обеспечивают визуализацию участков адсорбции
олигонуклеотида и сайтов функционализации (окисление, присоединение флуорофора).
Вольфрамат-анионы связываются с аминогруппами линкеров, обеспечивая их визуализацию в
виде электронно-плотных участков.
а
б
в
г
д
96
Рис. 2.22. ПЭМ-изображения нековалентных гибридов SWCNT-COOH с пиренильными
конъюгатами олигонуклеотида Pyr(rA)15 (а), Pyr(rA)25 (б) и Pyr(dA)20 (в), а также SWCNTCOOH (г) и SWCNT-PEG-FITC (д) с пиренильным конъюгатом олигонуклеотида PyrHEGd17.
Белыми стрелками отмечены области введения функциональных групп; черными стрелками
обозначены места адсорбции олигонуклеотида на поверхности SWCNT. Образцы были
контрастированы раствором ацетата уранила. Размер шкалы соответствует около 100 нм.
Ускоряющее напряжение – 80 кВ.
На полученных изображениях наблюдали пучки длиной до 1.5 мкм, составленные из
углеродных нанотрубок длиной 300-800 нм; на поверхности нанотрубок можно наблюдать
округлые частицы диаметром около 5 нм, скорее всего, соответствующие адсорбированному
олигонуклеотиду. Для гибридов модельных пиренильных конъюгатов олигонуклеотидов с
SWCNT-COOH
наблюдали
электронно-плотные
полоски,
пересекающие
поверхность
нанотрубок (рис. 2.22 а,б,в), соответствующие адсорбированным олигонуклеотидам, что
согласуется с данными работы [147]. Было проведено ПЭМ-исследование влияния длины и
природы олигонуклеотида на их распределение на поверхности SWCNT, однако, значимых
различий в распределении электронно-плотных структур в гибридах олигорибонуклеотидов и
олигодезоксирибонуклеотидов разной длины выявлено не было.
ПЭМ-исследование гибридов олигонуклеотидов с модифицированными нанотрубками
показало наличие объемных электронно-плотных структур, соответствующих введенным
функциональным группам (рис. 2.22 г,д). Таким образом, полученные изображения
подтверждают наличие на углеродных нанотрубках как олигонуклеотидов, так и органических
функциональных групп.
2.3.7. Закономерности формирования нековалентных гибридов олигонуклеотидов с
одностенными углеродными нанотрубками
Для получения мультифункциональных гибридов олигонуклеотидов и НК-комплексов с
SWCNT необходимо исследовать эффективность их образования, а также оценить влияние
различных
факторов,
таких
как
длина
и
природа
олигонуклеотида,
а
также
тип
функционализации нанотрубок. Выбранный метод оценки эффективности формирования
гибрида должен обеспечивать легкость сравнения большого пула экспериментальных данных,
должен быть применим в широком диапазоне концентраций нанотрубок и давать возможность
масштабирования результатов для получения гибридов в препаративных количествах.
Для сравнения эффективности сорбции пиренильных конъюгатов олигонуклеотидов на
SWCNT был использован метод построения и анализа изотерм адсорбции по аналогии с
исследованием адсорбции
ароматических соединений на поверхности
CNT [21].
В
эксперименте фиксировали концентрацию олигонуклеотида и варьировали содержание SWCNT
97
и поэтому не вычисляли константы адсорбции, а сравнивали форму и поведение изотерм для
разных систем по аналогии с [417]. Использование этого подхода представляется нам удобным
ввиду его наглядности и возможности проводить сравнение, используя небольшие количества
олигонуклеотидов.
В
рамках
данной
работы
метод
построения
изотерм
адсорбции
олигонуклеотидов на поверхности SWCNT был реализован в двух вариантах: на основании
данных флуоресцентной спектроскопии и электрофоретического анализа.
При изучении спектральных свойств нековалентных гибридов пиренильных конъюгатов
олигонуклеотидов с SWCNT нами было отмечено, что интенсивность флуоресценции остатков
пирена в растворе уменьшается с возрастанием содержания SWCNT (см. раздел 2.3.4); что
связано с адсорбцией пиренильных остатков на поверхности нанотрубок и тушением
флуоресценции пирена. Это явление было положено нами в основу первого метода оценки
эффективности формирования нековалентных гибридов олигонуклеотидов разного строения с
модифицированными SWCNT. Растворы пиренильных конъюгатов олигонуклеотидов в
фиксированной концентрации титровали модифицированными SWCNT в концентрации 0-128
мг/л. Образцы подвергали ультразвуковой обработке в течение 30 мин и записывали спектры
флуоресценции
остатков
пирена
в
растворах
полученных
нековалентных
гибридов.
Флуоресценция остатков пирена соответствует конъюгатам, не связанным с поверхностью
SWCNT. Долю пиренильного конъюгата олигонуклеотида, находящегося в растворе,
рассчитывали как отношение флуоресценции образца, содержащего SWCNT, к флуоресценции
контрольного раствора, не содержащего SWCNT, затем рассчитывали долю олигонуклеотида,
адсорбированного на поверхности SWCNT (см. раздел 3.3.). Это значение, выраженное в
процентах,
характеризует
эффективность
связывания
олигонуклеотида
в
гибридную
конструкцию, что в рамках данной работы принимали за эффективность формирования
гибрида. Исходя из полученных результатов, строили изотермы адсорбции пиренильных
конъюгатов олигонуклеотидов на поверхности нанотрубок (рис. 2.23).
Описанный выше метод позволяет получать количественные оценки эффективности
адсорбции олигонуклеотидов на SWCNT, но в то же время не дает информации о составе
реакционной смеси. Это требование оказывается критичным при переходе от простых
двухкомпонентных смесей
«олигонуклеотид-нанотрубка» к более сложным системам,
содержащим двух- и многокомпонентные НК-комплексы (см. раздел 2.4). В связи с этим нами
был использован альтернативный метод оценки количества адсорбированного на поверхности
SWCNT
нуклеотидного
материала,
основанный
на
электрофоретическом
разделении
реакционной смеси в нативных условиях с последующей визуализацией олигонуклеотидов
методом радиоавтографии; радиоактивная метка может быть легко введена в НК-конструкцию,
присоединяемую к SWCNT. Как уже было отмечено выше, гибриды SWCNT с пиренильными
98
конъюгатами олигонуклеотидов разрушаются в ходе электрофореза в денатурирующих
условиях, однако остаются стабильными в нативных условиях (см. раздел 2.3.1), причем
SWCNT, несущие олигонуклеотиды, не способны мигрировать в порах ПААГ и задерживаются
на старте (рис. 2.10). Это явление может быть использовано для разделения фракций
олигонуклеотидов, адсорбированных на поверхности нанотрубок и находящихся в свободном
состоянии в растворе. Таким образом, из расположения и интенсивности полос на
электрофореграмме можно получить информацию о качественном и количественном составе
реакционной смеси. Долю пиренильного конъюгата олигонуклеотида, адсорбированного на
поверхности SWNT, рассчитывали как отношение интенсивности радиоактивности на старте к
суммарной радиоактивности на дорожке, остальные вычисления аналогичны описанным выше
и в разделе 3.3. В отличие от использованного ранее метода доказательства формирования
нековалентных
гибридов
катионных
CNT
с
НК
путем
регистрации
остаточных
олигонуклеотидов в геле (см., например, [140]), предложенный нами метод позволяет
осуществлять визуализацию как свободных НК, так и связанных с поверхностью CNT.
Изотермы
адсорбции
Рис.
2.23.
пиренильного конъюгата Pyrmdr1-S на
SWCNT-COOH по данным флуоресцентной
спектроскопии и электрофоретического
анализа. Концентрация олигонуклеотида 1
мкМ. Условия: 10 мМ Трис-HCl, pH 7.5, 1
мМ Na2EDTA, 0.1 М NaCl.
Сравнение
изотерм
адсорбции,
полученных
двумя
независимыми
методами,
демонстрирует их сопоставимость в пределах рассчитанных стандартных отклонений (рис.
2.23). Таким образом, эти методы могут использоваться как взаимозаменяемые и
взаимодополняющие
при
исследовании
формирования
гибридов
НК-конструкций
с
углеродными нанотрубками различных типов функционализации.
Адсорбция пиренильных конъюгатов олигонуклеотидов на поверхности SWCNT может
происходить за счет взаимодействия с поверхностью нанотрубок как остатков пирена, так и
гетероциклических оснований олигонуклеотида [87,92]. Путем анализа изотерм адсорбции 1пиренилметиламина и пиренильных конъюгатов модельных гомоолигорибонуклеотидов
Pyr(rA)15, Pyr(rA)20, Pyr(rA)25 и гомоолигодезоксирибонуклеотидов Pyr(dA)20, Pyr(dA)25 на
SWCNT-COOH, полученных по данным флуоресцентной спектроскопии, было изучено влияние
природы и длины олигонуклеотида на эффективность его адсорбции на поверхности SWCNT.
99
Изотермы
адсорбции
1Рис.
2.24.
пиренилметиламина
и
пиренильного
конъюгата Pyr(rA)15 на SWCNT-COOH по
данным
флуоресцентной
спектроскопии.
Концентрация
1-пиренилметиламина
и
олигонуклеотида 1 мкM. Условия: 10 мМ
Трис-HCl, pH 7.5, 1 мМ Na2EDTA, 0.1 М NaCl;
комнатная температура.
Сравнение изотерм адсорбции 1-пиренилметиламина и пиренильного конъюгата
Pyr(rA)15 на поверхности SWCNT-COOH (рис. 2.24) показало, что 1-пиренилметиламин
адсорбируется на поверхности SWCNT более эффективно, чем пиренильный конъюгат
олигонуклеотида, очевидно, вследствие меньшего размера молекул.
Для определения влияния длины и природы олигонуклеотида на эффективность сорбции
конъюгата
был
проведен
гомоолигорибонуклеотидов
анализ
изотерм
Pyr(rA)15,
адсорбции
Pyr(rA)20
пиренильных
и
конъюгатов
Pyr(rA)25
и
гомоолигодезоксирибонуклеотидов Pyr(dA)20 и Pyr(dA)25 различной длины на поверхности
SWCNT-COOH (рис. 2.25). Было показано, что эффективность адсорбции модельных
пиренильных конъюгатов уменьшается с увеличением длины олигонуклеотида. Сравнение
изотерм адсорбции для олигонуклеотидов разной природы не выявило существенных различий
в эффективности адсорбции олигорибо- и олигодезоксирибонуклеотидов на поверхности
SWCNT.
а
б
Рис. 2.25. Изотермы адсорбции пиренильных конъюгатов олигорибонуклеотидов Pyr(rA)15,
Pyr(rA)20, Pyr(rA)25 (а) и олигодезоксирибонуклеотидов Pyr(dA)20, Pyr(dA)25 (б) на SWCNTCOOH по данным флуоресцентной спектроскопии. Концентрация олигонуклеотидов 1 мкM.
Условия: 10 мМ Трис-HCl, pH 7.5, 1 мМ Na2EDTA, 0.1 М NaCl; комнатная температура.
100
Поскольку введение объемных функциональных групп может негативно отражаться на
полноте сорбции пиренильных конъюгатов на поверхности SWCNT, было проведено сравнение
изотерм адсорбции пиренильных конъюгатов олигонуклеотидов на SWCNT-COOH
и
флуоресцеин-модифицированных SWCNT разного типа (рис. 2.26). Из приведенных данных
видно, что эффективность адсорбции олигонуклеотидов на SWCNT-COOH и SWCNT-HMDAFITC оказалась выше, чем на SWCNT-PEG-FITC и SWCNT-PAMAM-FITC, вероятно
вследствие стерических затруднений, вызванных введением на поверхность SWCNT объемных
органических групп. Данное явление наблюдали во всем диапазоне концентраций SWCNT. Тем
не менее, следует отметить, что независимо от типа функционализации модифицированные
SWCNT эффективно адсорбируют пиренильные конъюгаты олигонуклеотидов.
Рис. 2.26. Изотермы адсорбции пиренильного
конъюгата Pyrd22 на SWCNT-COOH,
SWCNT-HMDA-FITC,
SWCNT-PAMAMFITC и SWCNT-PEG-FITC по данным
флуоресцентной
спектроскопии.
Концентрация олигонуклеотидов 1 мкM.
Условия: 10 мМ Трис-HCl, pH 7.5, 1 мМ
Na2EDTA,
0.1
М
NaCl;
комнатная
температура.
Как уже упоминалось ранее (см. раздел 2.2), при конструировании пиренильных
конъюгатов олигонуклеотидов в состав олигонуклеотидов вводили гексаэтиленгликолевый
линкер с целью обеспечения конформационной подвижности остатка пирена и доступности
олигонуклеотида,
сорбированного
на
поверхности
SWCNT,
для
взаимодействий
с
комплементарной последовательностью и белковыми комплексами. Было изучено влияние
наличия линкера на эффективность образования нековалентных гибридов пиренильных
конъюгатов олигонуклеотидов с SWCNT. Сравнение изотерм адсорбции показало, что
эффективность адсорбции пиренильных конъюгатов, содержащих линкер, выше на всем
участке изотермы в сравнении с эффективностью адсорбции пиренильных конъюгатов без
линкера (рис. 2.27).
101
Изотермы
адсорбции
Рис.
2.27.
пиренильных
конъюгатов
Pyrd22,
PyrHEGd22, PyrHEGd17 на SWCNTпо
данным
флуоресцентной
COOH
спектроскопии.
Концентрация
олигонуклеотидов 1 мкM. Условия: 10 мМ
Трис-HCl, pH 7.5, 1 мМ Na2EDTA, 0.1 М
NaCl; комнатная температура.
Результаты сравнительного анализа изотерм адсорбции показали, что увеличение длины
олигонуклеотида,
а
также
присутствие
функциональных
групп
(гексаметилендиамин,
полиэтиленгликоль, дендример) в сайтах ковалентной модификации концов нанотрубок и
дефектов их поверхности могут снижать эффективность адсорбции пиренильных конъюгатов
олигонуклеотидов. Наличие гидрофильного гексаэтиленгликолевого линкера в составе
пиренильного конъюгата олигонуклеотида облегчает адсорбцию пиренильных конъюгатов
олигонуклеотидов на поверхности SWCNT.
Важным параметром SWCNT как носителя НК является его емкость по отношению к
транспортируемому соединению. Исходя из данных о тушении флуоресценции остатков пирена
в составе олигонуклеотидов при адсорбции на поверхности модифицированных SWCNT была
проведена оценка емкости углеродных нанотрубок как транспортеров олигонуклеотидов.
Емкость SWCNT-COOH составила 20-35 мкмоль/г для олигодезоксирибонуклеотидов и 30-50
мкмоль/г
для
олигорибонуклеотидов.
Полученные
значения
емкости
сопоставимы
с
литературными данными по электростатическому связыванию НК аминомодифицированными
SWCNT (~30 нмоль/г по данным работы [31]). Введение органических функциональных групп
на поверхность SWCNT уменьшает эффективность адсорбции на поверхности нанотрубок;
емкость в таком случае составляет 1-20 мкмоль/г.
Таким
образом,
результаты
анализа
изотерм
адсорбции
свидетельствуют
о
перспективности использования флуоресцеин-модифицированных SWCNT в качестве носителя
для пиренильных конъюгатов олигонуклеотидов и, потенциально, в качестве их транспортеров
в клетки. Высокая емкость нанотрубок позволит использовать их в малых количествах и тем
самым минимизировать возможную токсичность наноконструкции.
На данном этапе работы было проведено сравнительное изучение формирования
нековалентных гибридов модифицированных SWCNT с гомо- и гетероолигонуклеотидами. С
102
помощью метода построения изотерм адсорбции была проведена оценка влияния различных
факторов на эффективность адсорбции пиренильных конъюгатов олигонуклеотидов на
поверхности
транспортеров
нанотрубок,
а также определена емкость
олигонуклеотидов.
Полученные
SWCNT как
результаты
были
потенциальных
использованы
для
конструирования более сложных гибридных наноконструкций, содержащих НК-комплексы, на
следующем этапе работы.
2.4. Мультифункциональные гибриды НК-комплексов с одностенными
углеродными нанотрубками
Важной
областью
применения
гибридов
модифицированных
SWCNT
с
олигонуклеотидами является доставка терапевтических НК в клетки для направленного
подавления экспрессии целевых белков за счет деградации кодирующих их мРНК. Создание
новых терапевтических наноконструкций на основе НК и CNT требует исследования не только
формирования гибридов олигонуклеотидов с CNT, но и ассоциации олигонуклеотидов в НКкомплексы на поверхности CNT, приводящей к формированию многокомпонентных гибридных
конструкций. Действительно, применение одноцепочечных олигонуклеотидов вызывающих
деградацию мРНК гена-мишени, таких как антисенс-олигонуклеотиды и НКзимы, требует
создания значительной их концентрации в клетке. Существенно более активны малые
интерферирующие РНК, запускающие в клетке механизм РНК-интерференции. Малые
интерферирующие РНК (siРНК) – это короткие (19-23 п.н.) дцРНК с выступающими на 3′концах двумя нуклеотидами, они являются медиаторами процесса РНК-интерференции, в ходе
которого происходит специфическая деградация мРНК гена-мишени [291,418]. Углеродные
нанотрубки находят применение в качестве нанотранспортеров siРНК в клетки (см. раздел
1.2.1.3), но в то же время использование гибридов siРНК с SWCNT и MWCNT для
направленного подавления экспрессии генов-мишеней ограничено, за редкими исключениями,
невысокой емкостью CNT как носителей siРНК, недостаточным разнообразием методов
иммобилизации siРНК на поверхности CNT, методов контролируемой сборки гибридов и
подходов к получению гибридов, содержащих репортерные группы на поверхности CNTтранспортера. В связи с этим, актуальной задачей является разработка новых методов
контролируемой сборки гибрида siРНК с CNT, обеспечивающих высокую эффективность
модификации поверхности CNT молекулами НК и возможность мониторинга пронкновения
гибридных наноконструкций в клетку и дальнейшей судьбы CNT-транспортера. Решение этой
задачи требует детального исследования ассоциации олигонуклеотидов в НК-комплекс на
поверхности CNT.
103
На основании полученных данных, полученных в данной работе при исследовании
формирования мультифункциональных гибридов олигонуклеотидов с SWCNT, нами была
предложена
стратегия
создания
гибридов
siРНК-содержащих
конструкций
с
модифицированными SWCNT. В качестве объекта была выбрана siРНК, направленная на
участок 557-577 н. мРНК гена множественной лекарственной устойчивости mdr1, как
обладающая наибольшей активностью по сравнению с siРНК, направленными на другие
участки той же мРНК [419,420]. Для введения siРНК на поверхность SWCNT нами предложено
два альтернативных способа. Первый предполагает введение якорной группы по 5′-концу сенсцепи siРНК для иммобилизации конструкции на поверхности SWCNT (рис. 2.28а); известно,
что такая модификация не приводит к потере активности siРНК [421], напротив, способствует
правильному включению антисенс-цепи в мультибелковый комплекс RISC (RNA-induced
silencing complex) [422]. Второй подход – более сложный и предусматривает использование 5′пиренсодержащего
олигодезоксирибонуклеотида-коннектора
PyrHEGd17
[423],
последовательность которого комплементарна удлиненной с 3′-конца смысловой или
антисмысловой цепи siРНК (рис. 2.28б). Удлинение одной из цепей siРНК не влияет на ее
биологическую активность [423] и в то же время обеспечивает ее иммобилизацию на
поверхности SWCNT без дополнительных химических модификаций. Наличие в структуре
гибрида химерного РНК/ДНК дуплекса дает возможность высвобождения siРНК в клетке под
действием РНКазы Н. В качестве платформы для создания гибридов с siРНК-содержащими НКкомплексами были использованы два типа модифицированных SWCNT, а именно, SWCNTCOOH и SWCNT-PEG-FITC. Оба типа модифицированных SWCNT формировали весьма
стабильные суспензии. SWCNT-COOH содержали карбоксильные группы в сайтах окисления
нанотрубок по концам или местам дефектов поверхности, SWCNT-PEG-FITC содержали
высокогидрофильные
фрагменты
полиэтиленгликоля
для
потенциального
увеличения
биосовместимости наноконструкции, а также репортерные группы (флуоресцеин), ковалентно
введенные в сайты окисления поверхности нанотрубок. Такой выбор нанотрубок-платформы
позволил провести сравнительное изучение формирования гибридов НК-конструкций с SWCNT
разных типов модификации.
104
Рис. 2.28. Варианты конструирования гибридов НК-конструкций содержащих анти-mdr1-siРНК
с SWCNT: непосредственная иммобилизация пирен-модифицированной siРНК на SWCNT (а),
иммобилизация анти-mdr1-siРНК, содержащего одну удлиненную цепь, посредством пиренмодифицированного олигодезоксирибонуклеотида-коннектора на SWCNT (б).
Последовательности
олигорибонуклеотидов
и
олигодезоксирибонуклеотидов-
компонентов НК-конструкций, использованные в работе, представлены в таблице 2.5.
Таблица 2.5. Олигонуклеотиды-компоненты анти-mdr1-siРНК-содержащих НК-конструкций
1
Шифр
Последовательность олигонуклеотида1
mdr1-As
5′-r(AUAUACAACUUGUCAAGCCAA)
mdr1-S
5′-r(GGCUUGACAAGUUGUAUAUGG)
Pyrmdr1-S
5′-PyrCH2NHpr(GGCUUGACAAGUUGUAUAUGG)
mdr1-LS
5′-r(GGCUUGACAAGUUGUAUAUGGGGAGCAUGACCACGG)
mdr1-LAs
5′-r(AUAUACAACUUGUCAAGCCAAGGAGCAUGACCACGG)
PyrHEGd17
5′-PyrCH2NHpHEGpd(АACCGTGGTCATGCTCC)
Pyr – остаток пирена, r – олигорибонуклеотид, d – олигодезоксирибонуклеотид, р – фосфатная
группа.
105
Были синтезированы смысловая (mdr1-S) и антисмысловая (mdr1-As) цепи анти-mdr1siРНК, удлиненные с 3′-конца цепи siРНК (mdr1-LS, mdr1-LAs), а также пиренильные
конъюгаты
сенс-цепи
siРНК
(Pyrmdr1-S)
и
олигодезоксирибонуклеотида-коннектора
(PyrHEGd17). С их использованием получали пиренсодержащую siРНК (Pyrmdr1-S/mdr1-As)
и НК-комплексы олигодезоксирибонуклеотида-коннектора и siРНК (PyrHEGd17/mdr1LS/mdr1-As и PyrHEGd17/mdr1-LAs/mdr1-S), которые были иммобилизованы на поверхности
модифицированных SWCNT.
2.4.1. Гибриды НК-дуплексов с модифицированными одностенными углеродными
нанотрубками
Изучение процесса формирования многокомпонентных гибридных наноконструкций,
содержащих НК-комплексы, безусловно вызывает большой интерес, не только теоретический,
как способ изучения взаимодействия НК с наноматериалами, но и практический, как путь
оптимизации получения гибридных наноматериалов с заданными свойствами. В то же время,
несмотря
на
важность
данной
проблемы,
детального
изучения
взаимодействия
олигонуклеотидов на поверхности CNT, за исключением работ [112,113,119], а также
взаимодействия НК-комплексов с поверхностью CNT до сих пор проведено не было. На
сегодняшний день основной массив данных о гибридизации олигонуклеотидов на поверхности
CNT и о формировании НК-комплексов с CNT получен в работах по созданию систем детекции
НК с использованием CNT, несущих НК-зонды (см. раздел 1.2.2), а также в работах по
созданию наноассоциатов из CNT и НК (см. раздел 1.2.3). Данные эти, по большей части, носят
феноменологический и утилитарный характер и не могут быть использованы для
конструирования многокомпонентных гибридов НК-комплексов с углеродными нанотруками.
Получение многокомпонентного гибрида НК-SWCNT требует оптимизации условий его
формирования. На данном этпе работы оптимизировали условия получения гибридов
пиренсодержащей
siРНК
(Pyrmdr1-S/mdr1-As)
и
дуплексов
пиренсодержащего
олигодезоксирибонуклеотида-коннектора и удлиненной сенс- или антисенс-цепи анти-mdr1siРНК (PyrHEGd17/mdr1-LS и PyrHEGd17/mdr1-LAs) с SWCNT-COOH и SWCNT-PEG-FITC.
Основными параметрами, определяющими эффективность формирования гибрида являются
концентрации компонентов, условия сборки, а также очередность смешивания компонентов.
Нами было опробовано два типа условий сборки гибридов: отжиг (инкубация реакционной
смеси в течение 5 мин при 95 °C, затем медленное охлажение до комнатной температуры) и
обработка реакционной смеси ультразвуком в течение 30 мин. Ультразвуковая обработка
106
коротких олигонуклеотидов не приводит к их разрушению, а также не вызывает окисления
азотистых оснований или образования АP-сайтов в олигонуклеотидах (см. разделы 2.3.2, 2.3.3).
Для образования дуплекса на поверхности SWCNT использовали три варианта
последовательной сборки гибрида - вариант «mix-and-go», алгоритмический и иерархический
варианты. Вариант «mix-and-go» подразумевает смешивание всех компонентов с дальнейшей
обработкой образцов, алгоритмический вариант сборки – получение предформированного НКдуплекса с его последующей иммобилизацией на SWCNT, иерархический вариант сборки получение предформированного гибрида SWCNT с пиренильным конъюгатом олигонуклеотида
с последующим взаимодействием с комплементарным олигонуклеотидом, что приводит
к
формированию НК-дуплекса на поверхности SWCNT (рис. 2.29).
Алгоритмическая
сборка
“Mix-and-go”
Иерархическая
сборка
Рис. 2.29. Варианты сборки гибрида НК-дуплекса с SWCNT.
На первом этапе подбора условий формирования гибридов НК-дуплексов с
модифицированными
оптимизировали
SWCNT
концентрационные
соотношения
олигонуклеотидных компонентов гибридов в условиях отжига и ультразвуковой обработки.
Данная часть работы была выполнена с использованием SWCNT-COOH как носителя НКдуплексов. Формирование гибридов дуплексов олигонуклеотидов на поверхности SWCNTCOOH в каждом из описанных вариантов сборки проводили в буфере состава 50 мМ Tрис-HCl,
pH 7.5, 200 мМ KCl, 10 мМ MgCl2 при содержании SWCNT-COOH 20 мг/л, концентрации
удлиненной сенс- или антисенс-цепи анти-mdr1-siРНК mdr1-LS или mdr1-LAs 0.5 мкМ и
концентрации пиренсодержащего олигодезоксирибонуклеотида-коннектора PyrHEGd17 0.251.25 мкМ. Образование гибридов дуплексов с SWCNT подтверждали с помощью
электрофоретического
радиоавтографической
анализа
в
12%-ном
визуализацией
нативном
5′-[32P]-меченого
ПААГ
с
последующей
олигорибонуклеотида,
комплементарного пиренильному конъюгату, иммобилизованному на поверхности нанотрубок.
107
контроли
отжиг
УЗ-обработка
.1.25мкМ
.1.25мкМ
0.25мкМ
0.25мкМ
C(PyrHEGd17)
C(PyrHEGd17)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
III
II
I
Рис. 2.30. Электрофореграмма гибридов SWCNT-СOOH с дуплексом олигонуклеотидов
PyrHEGd17/mdr1-LS, полученных иерархической сборкой. I - свободный mdr1-LS, II дуплекс PyrHEGd17/mdr1-LS, III - гибрид SWCNT-COOH с mdr1-LS или с дуплексом
PyrHEGd17/mdr1-LS. Концентрация mdr1-LS – 0.5 мкМ, содержание SWCNT-COOH – 20
мг/л. Контроли: дорожка 1 - mdr1-LS, дорожки 2,3 - смесь SWCNT-COOH с mdr1-LS, дорожки
4,5 - дуплекс PyrHEGd17/mdr1-LS. Условия: 5′-[32P]-меченый mdr1-LS; буфер: 50 мМ TрисHCl, pH 7.5, 200 мМ KCl, 10 мМ MgCl2; 12%-ный ПААГ (акриламид:N,N′метиленбисакриламид (29:1), 50 мМ Трис-борат, рН 8.3, 10 мМ MgCl2). Дорожки 2,4,6-10 –
отжиг, дорожки 3,5,11-15 – обработка ультразвуком.
На электрофореграммах наблюдали высокоподвижные радиоактивно меченые полосы,
соответствующие свободному олигорибонуклеотиду и дуплексу пиренильного конъюгата с
комплементарным
олигонуклеотидом,
а
также
полосы
на
старте,
которые
могут
соответствовать как гибриду SWCNT-COOH с НК-дуплексом, так и гибриду SWCNT-COOH с
радиоактивно меченым олигонуклеотидом. На рис. 2.30 приведен типичный радиоавтограф
электрофореграммы
гибридов
SWCNT-COOH
c
НК-дуплексом
PyrHEGd17/mdr1-LS,
полученных при различной концентрации пиренсодержащего олигодезоксирибонуклеотидаконнектора в условиях иерархической сборки. С увеличением концентрации пиренильного
конъюгата PyrHEGd17 наблюдали увеличение интенсивности радиоактивного сигнала,
соответствующего свободному НК-дуплексу в растворе, что означает, что увеличение
концентрации пиренильного конъюгата не увеличивает количество адсорбированного
108
олигонуклеотида mdr1-LS на поверхности SWCNT-COOH, а значит, не способствует
увеличению эффективности формирования гибрида.
Результаты сравнительного анализа эффективностей формирования гибридов НКдуплексов с SWCNT в разных условиях сборки представлены на рис. 2.31. Долю
олигонуклеотида в составе гибрида с SWCNT-COOH определяли как отношение полосы на
старте, соответствующей гибриду, к общему радиоактивному сигналу на дорожке.
120
Эффективность формирования
гибрида (%)
0.25мкМ
100
1.25мкМ
0.25мкМ
C(PyrHEGd17)
1.25мкМ
C(PyrHEGd17)
80
60
40
20
0
Mix-and-go
отжиг
Алгоритмическая сборка
УЗ-обработка
Иерархическая сборка
Рис. 2.31. Сравнение эффективности формирования гибрида дуплекса PyrHEGd17/mdr1-LS с
SWCNT-COOH. Условия – см. рис. 2.30.
Из представленных данных видно, что алгоритмический и иерархический варианты
сборки гибридов приводят к более эффективному формированию гибрида НК-дуплекса с
SWCNT-COOH, чем вариант «mix-and-go». Кроме того, в условиях «mix-and-go»-сборки
гибрида может происходить нежелательная адсорбция удлиненной сенс- или антисенс-цепи
анти-mdr1-siРНК mdr1-LS или mdr1-LAs на поверхности SWCNT-COOH, что не дает
возможности адекватно оценить эффективность формирования гибрида доступными методами.
В
условиях
отжига
изменение
соотношения
компонентов
гибрида
не
влияет
на
алгоритмический и иерархический варианты сборки, в отличие от ультразвуковой обработки.
Следует отметить, что для серий, в которых был проведен отжиг НК-дуплекса в присутствии
SWCNT-COOH, наблюдали более высокую степень включения дуплекса в состав гибрида, чем
при УЗ-обработке гибрида. Данное явление может свидетельствовать о том, что отжиг является
более подходящим способом иммобилизации дуплекса на поверхности SWCNT-COOH. Можно
сделать вывод, что оптимальными условиями сборки являются алгоритмическая или
иерархическая сборка гибрида в эквимолярных соотношениях компонентов в условиях отжига.
109
Эти оптимизированные условия использовали в дальнейшей работе для сравнительного анализа
формирования гибридов НК-дуплексов с SWCNT-COOH и SWCNT-PEG-FITC.
контроли
отжиг
УЗ-обработка
1.25мкМ
0.25мкМ
1
2
3
4
5
6
C(PyrHEGd17)
7
8
9
1.25мкМ
0.25мкМ
10
C(PyrHEGd17)
11 12 13
14
15
Рис. 2.32. Электрофореграмма гибридов SWCNT-COOH с олигонуклеотидами PyrHEGd17 и
(dA)25, полученных иерархической сборкой. Концентрация (dA)25 – 0.5 мкМ. Контроли:
дорожка 1 - свободный (dA)25, дорожки 2,3 - смесь SWCNT-COOH и олигонуклеотида (dA)25,
дорожки 4,5 - смесь олигонуклеотидов PyrHEGd17 и (dA)25. Условия: 5′-[32P]-меченый (dA)25;
буфер: 50 мМ Tрис-HCl, pH 7.5, 200 мМ KCl, 10 мМ MgCl2; 12%-ный ПААГ (акриламид:N,N′метиленбисакриламид (29:1), 50 мМ Трис-борат, рН 8.3, 10 мМ MgCl2). Дорожки 2,4,6-10 –
отжиг, дорожки 3,5,11-15 – обработка ультразвуком.
Специфичность
подтверждена
с
формирования
помощью
некомплементарный
гибрида
контрольного
с
SWCNT-COOH
эксперимента,
олигонуклеотиду-коннектору
в
НК-дуплексами
котором
PyrHEGd17
была
использовали
модельный
олигодезоксирибонуклеотид (dA)25 (рис. 2.32). Было показано, что олигонуклеотид (dA)25
адсорбируется на поверхности нанотрубок, не содержащих конъюгата PyrHEGd17 (см.
дорожки 2,3 на рис. 2.32), но не адсорбируется на поверхности нанотрубок, насыщенных
конъюгатом PyrHEGd17. Полученные результаты позволяют однозначно интерпретировать
данные о накоплении радиоактивного сигнала на старте в условиях алгоритмической и
иерархической сборки
гибридов (см. рис. 2.30) как свидетельство образования искомого
гибрида НК-дуплекса с SWCNT-COOH.
Для сравнительного анализа эффективности сборки гибридов SWCNT с анти-mdr1-siРНК
(Pyrmdr1-S/mdr1-As),
а
также
с
компонентами
трехкомпонентного
НК-комплекса,
110
содержащего анти-mdr1-siРНК, дуплексами «олигонуклеотид-коннектор – удлиненная сенсили
антисенс-цепь
использовали
анти-mdr1-siРНК» (PyrHEGd17/mdr1-LS
метод
сравнения
изотерм
адсорбции,
и
PyrHEGd17/mdr1-LAs)
полученных
по
результатам
электрофоретического разделения реакционных смесей с последующей визуализацией методом
радиоавтографии.
По аналогии с построением изотерм адсорбции индивидуальных олигонуклеотидов,
(раздел 3.3.1.), в образцах изменяли содержание SWCNT-COOH от 0 мг/л до 128 мг/л при
фиксированной концентрации НК-дуплекса. Образцы анализировали в 12%-ном нативном
ПААГ
с
последующей
радиоавтографической
визуализацией
5′-[32P]-меченого
олигорибонуклеотида – антисенс-цепи анти-mdr1-siРНК mdr1-As или удлиненной сенс- или
антисенс-цепи анти-mdr1-siРНК mdr1-LS или mdr1-LAs. На электрофореграммах наблюдали
полосы, соответствующие олигорибонуклеотидам mdr1-LS или mdr1-LAs (I) и НК-дуплексу
PyrHEGd17/mdr1-LS или PyrHEGd17/mdr1-LAs (II), а также полосы на старте (III),
соответствующие гибридам этих НК-дуплексов с модифицированными SWCNT. На рис. 2.33
представлена характерная электрофореграмма.
128 мг/л
0 мг/л
Содержание SWCNT
1
2
3
4 5
6 7
8
9 10 11 12 13 14 15 16 17
III
II
I
Рис. 2.33. Электрофореграмма гибрида SWCNT-COOH с дуплексом PyrHEGd17/mdr1-LS,
полученного алгоритмической сборкой в условиях отжига. I - mdr1-LS, II - дуплекс
PyrHEGd17/mdr1-LS, III - гибрид SWCNT-COOH с дуплексом PyrHEGd17/mdr1-LS.
Концентрация дуплекса PyrHEGd17/mdr1-LS – 1 мкМ. Контроли: дорожка 1 - свободный
mdr1-LS, дорожка 2 - смесь SWCNT-COOH с mdr1-LS, дорожка 3 - дуплекс
PyrHEGd17/mdr1-LS. Условия: 5′-[32P]-меченый mdr1-LS; буфер: 50 мМ Tрис-HCl, pH 7.5,
200 мМ KCl, 10 мМ MgCl2; 12%-ный ПААГ (акриламид:N,N′-метиленбисакриламид (29:1), 50
мМ Трис-борат, рН 8.3, 10 мМ MgCl2).
С увеличением содержания SWCNT-COOH наблюдали уменьшение интенсивности
радиоактивного сигнала, соответствующего свободному дуплексу, что свидетельствует об
увеличении
эффективности
адсорбции
НК-дуплекса
на
поверхности
SWCNT.
Для
сравнительного исследования сорбции дуплексов на поверхности модифицированных SWCNT
111
были
построены
изотермы
адсорбции.
Аналогично
построению
изотерм
адсорбции
пиренильных конъюгатов олигонуклеотидов на поверхности модифицированных SWCNT, за
характеристику эффективности формирования гибрида НК-комплекса принимали долю
олигонуклеотида
или
НК-комплекса,
адсорбированного
на
поверхности
нанотрубок,
выраженную в процентах. Долю адсорбированного олигонуклеотида рассчитывали как
отношение радиоактивного сигнала на старте к радиоактивности на соответствующей дорожке
(см. раздел 3.3).
Алгоритмический метод сборки гибрида дает возможность сопоставления изотерм
адсорбции, полученных независимыми методами: электрофоретическим и спектроскопическим.
Было
проведено
сравнение
изотерм
адсорбции
НК-дуплексов
анти-mdr1-siРНК,
PyrHEGd17/mdr1-LS или PyrHEGd17/mdr1-LAs на поверхности SWCNT-COOH, полученных
по данным флуоресцентной спектроскопии и электрофоретического разделения с последующей
визуализацией компонентов методом радиоавтографии. Установлено, что изотермы адсорбции,
полученные двумя независимыми методами, сопоставимы в рамках стандартной ошибки
измерения (рис. 2.34) так же, как и изотермы адсорбции олигонуклеотидов (см. раздел 2.3.7).
Рис. 2.34. Изотермы адсорбции дуплекса PyrHEGd17/mdr1-LS на SWCNT-COOH, полученные
по данным флуоресцентной спектроскопии и электрофоретического анализа. Концентрация
дуплекса PyrHEGd17/mdr1-LS 1 мкМ. Условия электрофоретического анализа: 5′-[32P]меченый mdr1-LS; буфер: 50 мМ Tрис-HCl, pH 7.5, 200 мМ KCl, 10 мМ MgCl2; 12%-ный ПААГ
(акриламид:N,N′-метиленбисакриламид (29:1), 50 мМ Трис-борат, рН 8.3, 10 мМ MgCl2).
Условия флуоресцентной спектроскопии: длина волны возбуждения – 345 нм, длина волны
испускания – 380 нм, буфер: 50 мМ Tрис-HCl, pH 7.5, 200 мМ KCl, 10 мМ MgCl2, комнатная
температура.
Было проведено сравнение алгоритмического и иерархического вариантов сборки путем
построения изотерм адсорбции анти-mdr1-siРНК и НК-дуплексов PyrHEGd17/mdr1-LS или
PyrHEGd17/mdr1-LAs на поверхности SWCNT-COOH (рис. 2.35). Из полученных данных,
112
можно заключить, что алгоритмический вариант сборки является более эффективным,
вследствие достижения большей сорбции дуплекса при меньшем содержании SWCNT-COOH.
При использовании иерархического варианта сборки эффективность сорбции дуплексов
олигонуклеотидов оказалась ниже в обоих случаях. Наиболее вероятным объяснением
наблюдаемых различий может служить меньшая доступность 17-звенного олигонуклеотида
PyrHEGd17, иммобилизованного на поверхности SWCNT-COOH для взаимодействия с 36звенными олигонуклеотидами mdr1-LS или mdr1-LAs в условиях иерархической сборки. При
сборке анти-mdr1-siРНК Pyrmdr1-S/mdr1-As на поверхности нанотрубок не было выявлено
существенных различий эффективности алгоритмического и иерархического вариантов.
Емкость SWCNT-COOH как носителей НК-дуплексов при алгоритмической сборке составила
около 20 мкмоль/г, при иерархической – около 10 мкмоль/г.
а
б
Рис. 2.35. Сборка гибридов PyrHEGd17/mdr1-LS, PyrHEGd17/mdr1-LAs (а) и Pyrmdr1S/mdr1-As (б) с SWCNT-COOH: изотермы адсорбции олигорибонуклеотидов mdr1-LS, или
mdr1-As на гибриде PyrHEGd17+SWCNT-COOH (а) или Pyrmdr1-S+SWCNT-COOH (б)
(иерархическая сборка) или дуплексов PyrHEGd17/mdr1-LS, PyrHEGd17/mdr1-LAs (а) и
Pyrmdr1-S/mdr1-As (б) на SWCNT-COOH (алгоритимческая сборка). Концентрация
олигонуклеотидных компонентов 1 мкМ. Условия: 5′-[32P]-меченый mdr1-LS, mdr1-LAs (а,б),
mdr1-As (в); буфер: 50 мМ Tрис-HCl, pH 7.5, 200 мМ KCl, 10 мМ MgCl2; 12%-ный ПААГ
(акриламид:N,N′-метиленбисакриламид (29:1), 50 мМ Трис-борат, рН 8.3, 10 мМ MgCl2).
Другим типом модифицированных SWCNT, использованных в работе для получения
гибридов
с
НК-дуплексами,
были
флуоресцеин-содержащие
полиэтиленгликоль-
модифицированные нанотрубки SWCNT-PEG-FITC. Аналогично сборке гибридов дуплексов
PyrHEGd17/mdr1-LS или PyrHEGd17/mdr1-LAs с SWCNT-COOH, алгоритмический вариант
сборки гибрида с SWCNT-PEG-FITC оказался более эффективным, чем иерархический вариант
сборки (рис. 2.36). Для обоих вариантов сборки наличие объемных функциональных групп
затрудняло формирование гибрида при содержании модифицированных SWCNT до 30 мг/л, в
113
области более высоких концентраций формирование гибрида НК-дуплекса с SWCNT-PEG-FITC
проходило лишь на 10-20% менее эффективно, чем с SWCNT-COOH (ср. рис. 2.35а и 2.36а).
Аналогично предыдущему случаю, наблюдали различия в эффективности формирования
гибридов SWCNT-PEG-FITC с НК-дуплексами PyrHEGd17/mdr1-LS и PyrHEGd17/mdr1-LAs.
Формирование гибридов анти-mdr1-siРНК Pyrmdr1-S/mdr1-As с SWCNT-PEG-FITC также
протекает менее эффективно, чем с SWCNT-COOH, что можно объяснить стерическими
затруднениями при адсорбции остатков пирена на поверхности SWCNT-PEG-FITC в условиях
алгоритмической сборки. В то же время, иерархический вариант сборки был менее эффективен,
чем алгоритмический, очевидно, вследствие мешающего влияния функциональных групп на
доступность иммобилизованного на поверхности нанотрубок олигонуклеотида Pyrmdr1-S для
взаимодействия с комплементарным олигонуклеотидом mdr1-As.
а
б
Рис. 2.36. Сборка гибридов PyrHEGd17/mdr1-LS, PyrHEGd17/mdr1-LAs (а) и Pyrmdr1S/mdr1-As (б) с SWCNT-PEG-FITC: изотермы адсорбции олигорибонуклеотидов mdr1-LS, или
mdr1-As на гибриде PyrHEGd17+SWCNT-PEG-FITC (а) или Pyrmdr1-S+SWCNT-PEG-FITC
(б) (иерархическая сборка) или дуплексов PyrHEGd17/mdr1-LS, PyrHEGd17/mdr1-LAs (а) и
Pyrmdr1-S/mdr1-As (б) на SWCNT-PEG-FITC (алгоритмическая сборка). Концентрация
олигонуклеотидных компонентов 1 мкМ. Условия: 5′-[32P]-меченый mdr1-LS, mdr1-LAs (а),
mdr1-As (б), буфер: 50 мМ Tрис-HCl, pH 7.5, 200 мМ KCl, 10 мМ MgCl2; 12%-ный ПААГ
(акриламид:N,N′-метиленбисакриламид (29:1), 50 мМ Трис-борат, рН 8.3, 10 мМ MgCl2).
Таким образом, были получены гибриды пиренсодержащей анти-mdr1-siРНК (Pyrmdr1S/mdr1-As) и дуплексов «олигонуклеотид-коннектор – удлиненная сенс- или антисенс-цепь
анти-mdr1-siРНК»
(PyrHEGd17/mdr1-LS
и
PyrHEGd17/mdr1-LAs)
с
двумя
типами
модифицированных одностенных углеродных нанотрубок, SWCNT-COOH и SWCNT-PEGFITC, проведено сравнительное изучение влияния параметров сборки на эффективность
формирования гибридов. Показано, что использование отжига для получения гибридов более
эффективно по сравнению с обработкой ультразвуком, а алгоритмический (иммобилизация
предварительно полученного НК-дуплекса на поверхности модифицированных SWCNT) и
114
иерархический (взаимодействие иммобилизованного на поверхности модифицированных
SWCNT олигонуклеотида с комплементарным олигонуклеотидом, находящимся в растворе)
подходы более эффективны по сравнению с «mix-and-go»-подходом (одновременное
смешивание всех компонентов гибрида). Алгоритмический и иерархический подходы были
одинаково эффективны при формировании гибридов пиренсодержащей анти-mdr1-siРНК с
модифицированными SWCNT, в то же время, при формировании гибридов дуплексов
«олигонуклеотид-коннектор – удлиненная сенс- или антисенс-цепь анти-mdr1-siРНК» с
модифицированными SWCNT алгоритмический подход оказался более эффективным.
Сравнительный анализ эффективности формирования гибридов НК-дуплексов с SWCNT-COOH
и SWCNT-PEG-FITC показал, что наличие объемных функциональных групп затрудняет
формирование гибридов на 10-20% в при содержании модифицированных SWCNT более 30
мг/л. Полученные результаты были использованы на следующем этапе работы для получения
гибридов
трехкомпонентных
НК-комплексов,
содержащих
анти-mdr1-siРНК,
с
модифицированными SWCNT.
2.4.2.
Гибриды
трехкомпонентных
НК-комплексов
с
модифицированными
одностенными углеродными нанотрубками
Нам представляется интересным использование разных вариантов строения siРНКсодержащих НК-комплексов с целью сравнительного изучения в будущем биологической
активности гибрида этих НК-комплексов с модифицированными SWCNT. Использование
удлиненной
с
3′-конца
смысловой
цепи
siРНК
в
совокупности
с
пониженной
термостабильностью дуплекса с 5′-конца обеспечивает однозначность выбора антисмысловой
цепи в качестве направляющей (рис. 2.37а) [421,422,424]. В то же время, можно ожидать, что и
конструкция, содержащая удлиненную с 3′-конца антисмысловую цепь siРНК (рис. 2.37б),
будет обладать биологической активностью.
Основываясь на результатах по сборке гибридов НК-дуплексов с модифицированными
SWCNT, полученных в предыдущем разделе, провели постадийное изучение формирования
гибрида трехкомпонентного НК-комплекса, содержащего анти-mdr1-siРНК, с одностенными
углеродными нанотрубками. На первом этапе, аналогично получению гибридов НК-дуплексов с
модифицированными SWCNT, проводили оптимизацию условий получения гибридов SWCNTCOOH с трехкомпонентными НК-комплексами пиренильного конъюгата олигонуклеотидаконнектора PyrHEGd17 и анти-mdr1-siРНК.
115
а
б
Рис. 2.37. НК-комплекс, содержащий анти-mdr1 siРНК с удлиненной смысловой (a) или
антисмысловой (б) цепью и пиренсодержащий олигодезоксирибонуклеотид-коннектор.
Для формирования гибрида трехкомпонентного НК–комплекса на поверхности SWCNTCOOH использовали три варианта последовательной сборки гибрида - вариант «mix-and-go»,
алгоритмический и иерархический варианты. Алгоритмический вариант сборки гибрида
SWCNT-COOH
с
трехкомпонентным
НК-комплексом
подразумевал
получение
предформированного НК-комплекса с его последующим смешиванием с SWCNT-COOH, а
иерархический вариант сборки - получение предформированного гибрида SWCNT-COOH с
олигонуклеотидом-коннектором PyrHEGd17 с последующим добавлением к нему siРНК,
содержащей одну удлиненную цепь (mdr1-LS/mdr1-As или mdr1-LAs/mdr1-S) (рис. 2.38).
“Mix-and-go”
Алгоритмическая
сборка
Иерархическая
сборка
Рис. 2.38. Варианты сборки гибрида трехкомпонентного НК-комплекса с SWCNT.
На первом этапе подбора условий формирования гибридов трехкомпонентных НКкомплексов
с
SWCNT-COOH,
аналогично
получению
гибридов
НК-дуплексов
с
116
модифицированными
SWCNT
(см.
раздел
2.4.1),
оптимизировали
концентрационные
соотношения олигонуклеотидных компонентов гибридов в условиях отжига и ультразвуковой
обработки. Формирование гибридов трехкомпонентных НК-комплексов на поверхности
SWCNT-COOH в каждом из описанных вариантов сборки проводили в буфере состава 50 мМ
Tрис-HCl, pH 7.5, 200 мМ KCl, 10 мМ MgCl2 при содержании SWCNT-COOH 20 мг/л,
концентрации удлиненной сенс- или антисенс-цепи анти-mdr1-siРНК mdr1-LS или mdr1-LAs
0.5 мкМ, концентрации антисенс- или сенс-цепи анти-mdr1-siРНК mdr1-As или mdr1-S 0.5
мкМ и концентрации пиренсодержащего олигодезоксирибонуклеотида-коннектора PyrHEGd17
0.5-1.5 мкМ. Образование гибридов дуплексов с SWCNT подтверждали с помощью
электрофоретического
анализа
в
12%-ном
нативном
ПААГ
с
последующей
радиоавтографической визуализацией 5′-[32P]-меченого олигорибонуклеотида mdr1-LS или
mdr1-LAs.
0.5мкМ
1.5мкМ
C(PyrHEGd17)
0.5мкМ
1.5мкМ
C(PyrHEGd17)
Рис. 2.39. Электрофореграмма гибридов SWCNT-COOH с трехкомпонентным НК-комплексом
PyrHEGd17/mdr1-LS/mdr1-As полученных иерархической сборкой. I - свободный mdr1-LS, II
– дуплекс mdr1-LS/mdr1-As или трехкомпонентной НК-комплекс PyrHEGd17/mdr1-LS/mdr1As, III - гибрид SWCNT-COOH с трехкомпонентным НК-комплексом. Концентрация mdr1-LS и
mdr1-As - 0.5 мкМ, содержание SWCNT-COOH – 20 мг/л. Контроли: дорожка 1 - mdr1-LS,
дорожка 2 – дуплекс PyrHEGd17/mdr1-LS, 3 - дуплекс mdr1-LS/mdr1-As, дорожка 4 – смесь
SWCNT-COOH c mdr1-LS. Условия: 5′-[32P]-меченый mdr1-LS; буфер: 50 мМ Tрис-HCl, pH
7.5, 200 мМ KCl, 10 мМ MgCl2; 12%-ный ПААГ (акриламид:N,N′-метиленбисакриламид (29:1),
50 мМ Трис-борат, рН 8.3, 10 мМ MgCl2). Дорожки 2-7 – отжиг, дорожки 8-10 – УЗ-обработка.
На электрофореграммах наблюдали высокоподвижные радиоактивно меченые полосы,
соответствующие олигонуклеотидным компонентам гибридов – дуплексам PyrHEGd17/mdr1LS, PyrHEGd17/mdr1-LAs, mdr1-LS/mdr1-As, mdr1-LAs/mdr1-S или трехкомпонентным
117
комплексам PyrHEGd17/mdr1-LS/mdr1-As или PyrHEGd17/mdr1-LAs/mdr1-S, в зависимости
от способа сборки гибридов - а также полосы на старте, которые могут соответствовать как
гибриду SWCNT-COOH с трехкомпонентным НК-комплексом, так и гибриду SWCNT-COOH с
радиоактивно меченым олигонуклеотидом. На рис. 2.39 приведен типичный радиоавтограф
электрофореграммы гибридов SWCNT-COOH c НК-комплексом PyrHEGd17/mdr1-LS/mdr1As,
полученных
при
различной
концентрации
пиренсодержащего
олигодезоксирибонуклеотида-коннектора в условиях иерархической сборки. С увеличением
концентрации пиренильного конъюгата олигонуклеотида, иммобилизованного на SWCNTCOOH, наблюдали увеличение интенсивности радиоактивного сигнала, соответствующего
свободному НК-дуплексу в растворе.
По аналогии с получением гибридов НК-дуплексов с SWCNT-COOH (см. раздел 2.4.1)
был
проведен
сравнительный
анализ
эффективности
формирования
гибрида
трехкомпонентного НК-комплекса с SWCNT в разных условиях сборки (рис. 2.40). На
гистограмме представлена эффективность связывания олигорибонуклеотида mdr1-As в гибрид
трехкомпонентного НК-комплекса PyrHEGd17/mdr1-LS/mdr1-As с SWCNT-COOH. Долю
олигонуклеотида в составе гибрида с SWCNT-COOH определяли как отношение полосы на
старте, соответствующей гибриду, к общему радиоактивному сигналу на дорожке.
1.5мкМ
Эффективность формирования
гибрида (%)
100
0.5мкМ
1.5мкМ
0.5мкМ
C(PyrHEGd17)
C(PyrHEGd17)
80
60
40
20
0
отжиг
Mix-and-go
Алгоритмическая сборка
УЗ-обработка
Иерархическая сборка
Рис. 2.40. Сравнение эффективности формирования гибрида трехкомпонентного НК-комплекса
PyrHEGd17/mdr1-LS/mdr1-As с SWCNT-COOH. Условия – см. рис. 2.39.
Данные, представленные на гистограмме, свидетельствуют о том, что алгоритмический
вариант сборки гибрида НК-комплекса с нанотрубками является более эффективным.
Аналогично сборке гибрида НК-дуплекса с SWCNT-COOH в условиях отжига происходит
118
наибольшее включение олигорибонуклеотидов mdr1-LS или mdr1-LAs в состав гибрида.
Оптимальными условиями сборки гибрида НК-комплекса с SWCNT-COOH является
алгоритмическая
сборка
в
условиях
отжига
с
избытком
пиренильного
конъюгата
олигонуклеотида-коннектора по отношению к другим компонентам НК-комплекса.
По аналогии с методом, описанным в разделе 2.4.1, для сравнительного изучения
эффективности сборки гибрида трехкомпонентных НК-комплексов c модифицированными
SWCNT использовали метод построения изотерм адсорбции. Для получения гибридов
использовали алгоритмический и иерархический варианты сборки, описанные выше. Изотермы
адсорбции были построены для двух типов НК-комплексов, содержащих удлиненную сенсPyrHEGd17/mdr1-LS/mdr1-As или антисенс-цепь PyrHEGd17/mdr1-LAs/mdr1-S анти-mdr1siРНК, на поверхности SWCNT-COOH и SWCNT-PEG-FITC (рис. 2.41).
а
б
Рис. 2.41. Сборка гибридов PyrHEGd17/mdr1-LS/mdr1-As и PyrHEGd17/mdr1-LAs/mdr1-S с
SWCNT-COOH (а) и SWCNT-PEG-FITC (б): изотермы адсорбции дуплексов mdr1-LS/mdr1-As
или mdr1-LAs/mdr1-S на гибридах PyrHEGd17+SWCNT-COOH и PyrHEGd17+SWCNT-PEGFITC (иерархическая сборка) или трехкомпонентных НК-комплексов PyrHEGd17/mdr1LS/mdr1-As и PyrHEGd17/mdr1-LAs/mdr1-S на SWCNT-COOH и SWCNT-PEG-FITC
(алгоритмическая сборка). Концентрация олигонуклеотидных компонентов 1 мкМ. Условия: 5′[32P]-меченый mdr1-LS или mdr1-LAs; буфер: 50 мМ Tрис-HCl, pH 7.5, 200 мМ KCl, 10 мМ
MgCl2; 12%-ный ПААГ (акриламид:N,N′-метиленбисакриламид (29:1), 50 мМ Трис-борат, рН
8.3, 10 мМ MgCl2).
Для трехкомпонентного НК-комплекса алгоритмический вариант сборки гибрида как с
SWCNT-COOH, так и с SWCNT-PEG-FITC оказался более эффективным, чем иерархический
вариант сборки. Аналогично адсорбции дуплексов на поверхности SWCNT, вероятной
причиной различий является меньшая доступность олигонуклеотида PyrHEGd17 для
взаимодействия с siРНК mdr1-LS/mdr1-As или mdr1-LAs/mdr1-S в условиях иерархической
сборки. Следует отметить, что на поверхности SWCNT-COOH адсорбируется большее
количество НК-комплекса, чем на поверхности SWCNT-PEG-FITC. Как и в случае адсорбции
индивидуальных олигонуклеотидов на поверхности SWCNT, данное явление может быть
119
объяснено стерическими затруднениями, обусловленными наличием органических групп на
поверхности SWCNT-PEG-FITC.
Таким образом, изучены закономерности формирования гибрида углеродных нанотрубок с
трехкомпонентным НК-комплексом, содержащим siРНК. На основании сравнительного анализа
изотерм адсорбции установлено, что алгоритмический вариант сборки является оптимальным
для формирования гибридов модифицированных SWCNT как с дуплексами олигонуклеотидов,
так и с трехкомпонентными НК-комплексами.
2.4.3. Исследование возможности высвобождения siРНК из состава нековалентного
гибрида под действием РНКазы Н
В
структуре
нековалентных
гибридов
НК-дуплексов
PyrHEGd17/mdr1-LS
и
PyrHEGd17/mdr1-LAs и трехкомпонентных НК-комплексов PyrHEGd17/mdr1-LS/mdr1-As и
PyrHEGd17/mdr1-LAs/mdr1-S с SWCNT присутствует химерный РНК/ДНК-дуплекс, который
подразумевает возможность расщепления РНК в его составе под действием РНКазы Н [425–
427] и последующее высвобождение siРНК. Для доказательства этой возможности в работе
было проведено сравнительное изучение возможности расщепления РНК РНКазой Н E. coli в
химерном
РНК/ДНК-дуплексе
в
составе
НК-дуплексов
PyrHEGd17/mdr1-LS
и
PyrHEGd17/mdr1-LAs, а также трехкомпонентных НК-комплексов PyrHEGd17/mdr1LS/mdr1-As и PyrHEGd17/mdr1-LAs/mdr1-S, как в растворе, так и на поверхности
одностенных углеродных нанотрубок. В качестве носителя НК-конструкций использовали
SWCNT-COOH. Анализ гидролиза РНК в химерных РНК/ДНК-дуплексах проводили с
использованием 5′-[32P]-меченых производных олигонуклеотидов mdr1-LS и mdr1-LAs.
Нековалентные
гибриды
дуплексов
олигонуклеотидов
PyrHEGd17/mdr1-LS
и
PyrHEGd17/mdr1-LAs в растворе или в составе гибридов с SWCNT-COOH инкубировали в
присутствии РНКазы Н при 37 °С. Отобранные через 0, 5, 10, 15, 30, 60, 90, 120 мин пробы
наносили на 15%-ный денатурирующий ПААГ и проводили электрофоретическое разделение с
последующей визуализацией радиоактивно меченых полос методом радиоавтографии. В
качестве контролей использовали олигонуклеотиды mdr1-LS и mdr1-LAs, а также их дуплексы
с PyrHEGd17 (рис. 2.42). Через 5 мин инкубации свободных дуплексов PyrHEGd17/mdr1-LS и
PyrHEGd17/mdr1-LAs регистрировали полное расщепление РНК в химерном РНК/ДНКдуплексе, в то время как в составе гибрида с SWCNT-COOH степень расщепления РНК через 3
ч составила 70 %.
120
Рис. 2.42. Расщепление РНК в дуплексе PyrHEGd17/mdr1-LS в растворе (а) и в составе
гибрида с SWCNT-COOH (б). I – Удлиненная сенс-цепь siРНК mdr1-LS, II – продукты
расщепления. К1 - mdr1-LS; К2 – дуплекс PyrHEGd17/mdr1-LS. Концентрация
олигонуклеотидных компонентов 1 мкМ, содержание SWCNT-COOH – 100 мг/л. Условия: 5′[32P]-меченый mdr1-LS; буфер: 20 мМ Трис-HCl (pH 7.8), 40 мМ KCl, 8 мМ MgCl2, 1 мМ DTT;
2.5 ед.акт. РНКазы H E. coli; 37 °C; 15%-ный ПААГ (акриламид:N,N′-метиленбисакриламид
(29:1), 8 М мочевина, 50 мМ Трис-борат, рН 8.3, 0.1 мМ Na2EDTA).
Аналогичным образом было проведено исследование расщепление удлиненной цепи
siРНК в составе трехкомпонентного НК-комплекса и в составе гибрида трехкомпонентного НКкомплекса с SWCNT-COOH. Отобранные через 0, 5, 10, 15, 30, 60, 90, 120, 180, 240 мин пробы
наносили на 15%-ный денатурирующий ПААГ и проводили электрофоретическое разделение.
В качестве контролей использовали олигонуклеотиды mdr1-LS и mdr1-LAs, а также
соответствующие трехкомпонентные НК-комплексы (рис. 2.43).
Рис. 2.43. Расщепление РНК в трехкомпонентном НК-комплексе PyrHEGd17/mdr1-LS/mdr1As в растворе (а) и в составе гибрида с SWCNT-COOH (б). I – Удлиненная сенс-цепь siРНК
mdr1-LS, II – продукты расщепления. К1 - mdr1-LS; К2 – трехкомпонентной комплекс.
Концентрация олигонуклеотидных компонентов 1 мкМ, содержание SWCNT-COOH – 100 мг/л.
Условия: 5′-[32P]-меченый mdr1-LS; буфер: 20 мМ Трис-HCl (pH 7.8), 40 мМ KCl, 8 мМ MgCl2,
1 мМ DTT; 2.5 ед.акт. РНКазы H E. coli; 37 °C; 15%-ный ПААГ (акриламид:N,N′метиленбисакриламид (29:1), 8 М мочевина, 50 мМ Трис-борат, рН 8.3, 0.1 мМ Na2EDTA).
121
Как и в случае дуплекса, процесс расщепления РНК РНКазой Н в составе гибрида
трехкомпонентного комплекса с SWCNT идет значительно медленнее по сравнению с не
иммобилизованным комплексом. Через 6 часов инкубации степень расщепления РНК составила
лишь 30%, в то время как, в свободном НК-комплексе полное расщепление РНК в РНК/ДНКдуплексе регистрировали уже через 15 минут инкубации с ферментом. Расщепление РНК в
составе дуплекса PyrHEGd17/mdr1-LS происходило заментно быстрее, чем в составе
трехкомпонентного НК-комплекса PyrHEGd17/mdr1-LS/mdr1-As (ср. рис. 2.42а и 2.43а), что
вероятно, связано с меньшей доступностью для РНКазы Н химерного РНК/ДНК дуплекса в
составе трехкомпонентного комплекса. Аналогичные результаты получали и в случае гибрида
трехкомпонентного комплекса «олигонуклеотид-коннектор - удлиненная антисенс-цепь антиmdr1-siРНК – сенс-цепь анти-mdr1-siРНК» PyrHEGd17/mdr1-LAs/mdr1-S.
Полученные результаты свидетельствуют о том, что углеродные нанотрубки затрудняют
расщепление РНК в составе гибрида дуплекса или трехкомпонентного НК-комплекса с
SWCNT-COOH. Возможно, данное явление обусловлено укладкой олигонуклеотидов на
поверхности SWCNT, что препятствует их связыванию с РНКазой Н. Другим возможным
объяснением снижения активности РНКазы Н в присутствии SWCNT может быть ее частичная
адсорбция на поверхности SWCNT, что препятствует гидролизу РНК.
В данном разделе нами были определены оптимальные условия формирования гибрида
трехкомпонентного НК-комплекса, содержащего siРНК, с модифицированными SWCNT и
продемонстрирована возможность высвобождения siРНК из гибрида под действием РНКазы Н.
Таким образом, нами был разработан подход к получению нековалентных гибридов антиmdr1-siРНК
и
анти-mdr1-siРНК-содержащих
трехкомпонентных
НК-комплексов
с
модифицированными одностенными углеродными нанотрубками.
2.5.
Исследование
биосовместимости
и
взаимодействия
с
клетками
модифицированных одностенных углеродных нанотрубок и их гибридов с
олигонуклеотидами
Критическим параметром для применения CNT-содержащих наноконструкций в
биологических системах является их биосовместимость. Как было упомянуто в обзоре
литературы (см. п. 1.2.1.1), функционализация CNT органическими молекулами снижает их
цитотоксические и генотоксические эффекты. В то же время, токсичность CNT после
функционализации олигонуклеотидами остается недостаточно исследованой. В рамках данной
работы было проведено сравнительное изучение биосовместимости модифицированных
SWCNT и их гибридов с олигонуклеотидами (совместно с ЛБНК ИХБФМ СО РАН), а также
122
исследование взаимодействия полученных гибридов с клетками линий HeLa, KB-3-1 и KB-8-5
(совместно с ГМИ ИХБФМ СО РАН). В качестве объекта для оценки токсичности были
выбраны окисленные одностенные углеродные нанотрубки SWCNT-COOH, одностенные
углеродные нанотрубки, несущие остатки флуоресцеина, присоединенные посредством
полиэтиленгликолевого линкера SWCNT-PEG-FITC, и их гибриды с пиренильным конъюгатом
олигонуклеотида-коннектора
PyrHEGd17.
Данный
олигонуклеотид
был
выбран
для
исследований биосовместимости гибридов, поскольку он не имеет комплементарной
последовательности в геноме человека [423] и, таким образом, не проявляет биологической
активности.
2.5.1. Исследование цитотоксичности одностенных углеродных нанотрубок и их
гибридов с олигонуклеотидами
Для определения цитотоксичности модифицированных нанотрубок и их гибридов с
олигонуклеотидами применяли MTT-тест [428]. Несмотря на некоторую неточность, связанную
с занижением данных о жизнеспособности клеток вследствие адсорбции красителя на
поверхности нанотрубок (см. раздел 1.2.1.1.1), этот метод дает результаты, пригодные для
оценки динамики жизнеспособности клеток при экспозиции с SWCNT в разных концентрациях,
а также для сравнения токсичности нанотрубок разной степени модификации.
Для обоих типов модифицированных SWCNT и их гибридов с олигонуклеотидами
наблюдали стандартный для CNT дозо-зависимый профиль цитотоксичности (рис. 2.44).
Полученные результаты демонстрируют различную чувствительность клеточных линий по
отношению к SWCNT. Так, клетки HeLa демонстрируют наименьшую чувствительность, а KB3-1 – наибольшую (токсическая концентрация IC50 для этой линии составила 4.3 мг/л SWCNTCOOH и 19.3 мг/л SWCNT-PEG-FITC).
а
б
Рис. 2.44. Профили жизнеспособности клеток линий HeLa, KB-3-1 и KB-8-5 при экспозиции с
SWCNT-COOH (а) и SWCNT-PEG-FITC (б).
123
Влияние
иммобилизации
олигонуклеотида
на
поверхности
SWCNT
на
их
цитотоксичность оценивали с использованием клеток линии KB-8-5 как демонстрирующих
промежуточную чувствительность к SWCNT. Значения IC50 для гибридов SWCNT-COOH и
SWCNT-PEG-FITC не были достигнуты в диапазоне концентраций до 100 мг/л (рис. 2.45).
Отметим, что в большинстве работ по применению CNT для доставки НК in vitro рабочие
концентрации нанотрубок лежат в области 1-10 мг/л. Полученные нами данные демонстрируют
высокую биосовместмость гибридов олигонуклеотидов с SWCNT-COOH и SWCNT-PEG-FITC
и возможность их использования в биологических системах.
Рис. 2.45. Профили жизнеспособности
клеток линии KB-8-5 при экспозиции с
SWCNT-COOH, SWCNT-PEG-FITC и их
гибридом с PyrHEGd17.
Данные по жизнеспособности клеток линий HeLa, KB-3-1 и KB-8-5 при экспозиции с
функционализированными SWCNT коррелируют с данными, полученными в экспериментах на
других клеточных культурах [133,180,213,269]. Некоторые различия, показанные в нашей
работе, могут быть объяснены влиянием индивидуальных особенностей клеточных линий и
отличиями в способе функционализации и в морфологии образцов SWCNT.
2.5.2.
Ультраструктурное
исследование
взаимодействия
модифицированных
одностенных углеродных нанотрубок и их гибридов с олигонуклеотидами с
клетками
Важной характеристикой нанотранспортера НК в клетки является механизм его
проникновения через клеточную мембрану. Для CNT показан ряд механизмов проникновения,
как энергозависимых, так и энерго-независимых. Основной вклад в реализацию того или иного
механизма вносит размер наночастиц и природа функциональных групп на их поверхности. Для
изучения взаимодействия гибридных SWCNT-наноконструкций, полученных в данной работе, с
поверхностью клеток использовали метод ПЭМ-исследования ультратонких срезов. Объектом
124
исследования служили клетки линии KB-8-5 после экспозиции с SWCNT-COOH, SWCNT-PEGFITC и их гибридами с олигонуклеотидами.
Обработка клеток KB-8-5 модифицированными SWCNT не вызывала видимого
поражения клеток. В препаратах как обработанных, так и необработанных нанотрубками клеток
наблюдали большие ядра с высоким содержанием эухроматина и одним-двумя хорошо
развитыми ядрышками. Цитоплазма содержала овальной формы митохондрии, большое
количество свободных рибосом, несколько цистерн эндоплазматического ретикулума и
относительно небольшой комплекс Гольджи. В большинстве клеток эндосомы и лизосомы
были представлены редко (рис. 2.46а). Некоторые клетки в препаратах находились на разных
стадиях митоза, что также свидетельствует о низкой токсичности модифицированных SWCNT
(рис. 2.46б).
б
а
Рис. 2.46. Клетки линии KB-8-5 после 4 ч инкубации с гибридом SWCNT-PEG-FITC с
PyrHEGd17: здоровая клетка с большим ядром и двумя развитыми ядрышками (а), клетка в
митозе (б). Изображения получены методом ПЭМ-исследования ультратонких срезов.
Очевидно,
индивидуальные
нанотрубки
и
небольшие
их
пучки
невозможно
визуализировать в ультратонких срезах, соответственно, наблюдали только агрегаты
нанотрубок диаметром 3-10 нм и длиной до 1 мкм. Наряду с агрегатами нанотрубок на срезах
наблюдали также небольшое количество наночастиц, по-видимому, соответствующих
аморфному углероду.
Во всех образцах наблюдали адсорбцию модифицированных SWCNT на поверхности
клеток и выростах цитоплазмы (рис. 2.47). Следует отметить, что при контакте с SWCNT не
происходит изменения цитоплазмы ни в зоне адсорбции нанотрубок на мембране, ни в других
областях клетки. Адсорбция SWCNT-COOH и их гибридов с олигонуклеотидами на
125
поверхности клеток наблюдалась чаще по сравнению с SWCNT-PEG-FITC. Наблюдали также
эндоцитозные пузырьки и эндосомы, содержащие углеродные наноконструкции.
а
б
г
в
Рис. 2.47. Клетки линии KB-8-5 после взаимодействия с модифицированными SWCNT и их
гибридами с PyrHEGd17: наночастицы между двумя клетками (а), адсорбция SWCNT на
поверхности клеток выростах цитоплазмы (б-г). Тонкими стрелками показаны пучки
нанотрубок, толстыми стрелками показана плазматическая мембрана. Кольцами выделены
эндоцитозные пузырьки, содержащие SWCNT. Клетки обрабатывали гибридом SWCNT-COOH
с PyrHEGd17 (а), SWCNT-COOH (б), SWCNT-PEG-FITC (в), гибридом SWCNT-PEG-FITC с
PyrHEGd17 (г). Изображения получены методом ПЭМ-исследования ультратонких срезов.
Таким образом, ультраструктурное исследование показало, что функционализированные
SWCNT и их гибриды с олигонуклеотидами после адсорбции на поверхности клеток линии KB8-5 не влияют на морфологию клеток и не блокируют митотическое деление не менее, чем в
течение 4 ч инкубации. Нанотрубки взаимодействуют с плазматической мембраной и
проникают внутрь клеток без видимого повреждения клеточных структур.
Полученные результаты демонстрируют высокую биосовместимость гибридов SWCNT с
пиренильными конъюгатами олигонуклеотидов и возможность их проникновения в клетки.
Несмотря на то, что в данном направлении работы необходимо проведение дополнительных
исследований,
полученные
предварительные
результаты
демонстрируют
возможность
применения созданных гибридных CNT-НК-наноконструкций в качестве транспортеров
терапевтических НК в клетки.
126
2.6.
Гибриды
вертикально
пиренильных
конъюгатов
ориентированными
олигорибонуклеотидов
многостенными
с
углеродными
нанотрубками для детекции РНК
Задача детекции НК в биологических образцах представляет собой актуальную задачу
современной молекулярной биологии и фундаментальной и клинической медицины. Создание
CNT-содержащих электрохимических биосенсоров является многообещающим направлением
развития области анализа специфических последовательностей НК [429]. Поиск наиболее
дешевого и простого способа получения таких электрохимических биосенсоров без потери их
чувствительности
является
актуальным
направлением
исследований
[383].
Как
уже
упоминалось в обзоре литературы (см. раздел 1.2.2.1), весьма перспективным с точки зрения
соотношения экономичности и чувствительности является использование электродов,
содержащих массивы вертикально ориентированных CNT, выращенных непосредственно на
проводящей подложке [430–433]. Поскольку интенсивность электрохимического отклика
зависит от количества олигонуклеотидного зонда, иммобилизованного на поверхности
электрода, методы, позволяющие увеличить количество молекул зондов на поверхности CNT,
представляются весьма полезными. Специфическое взаимодействие и образование комплекса
детектируемой НК с зондом в составе гибрида приводит к изменению электронной структуры
CNT, что позволяет конвертировать гибридизацию НК в удобный для регистрации сиквенсспецифический электрохимический сигнал [434]. К настоящему моменту предложено
несколько способов электрохимической регистрации процесса гибридизации, в частности,
импидиметрические, амперометрические, потенциометрические или вольтамперометрические
методы [13,306,344]. Несмотря на достаточно большой объем работ, посвященных детекции НК
с использованием различных электрохимических методов, емкостные характеристики CNTэлектродов в процессе гибридизации НК-зонда с НК-мишенью до сих пор оставались
недостаточно исследованными.
Данный раздел посвящен изучению емкостных характеристик гибридных электродов,
представляющих собой вертикально ориентированные многостенные углеродные нанотрубки
(MWCNT), выращенные на кремниевой подложке, с нековалентно иммобилизованными на
поверхности
олигорибонуклеотидными
зондами,
при
взаимодействии
с
модельными
олигорибонуклеотидами-мишенями. Работа выполнялась совместно с Лабораторией физикохимии наноматериалов ИНХ СО РАН.
127
2.6.1. Получение и характеризация гибридных электродов
Полученные в данной работе гибридные электроды представляют собой каркас,
состоящий из массива вертикально ориентированных MWCNT - преобразователя электродных
процессов в электрический сигнал - и иммобилизованного на нем олигонуклеотидного зонда,
обеспечивающего селективность электрода к детектируемой НК в растворе.
Массив вертикально ориентированных MWCNT выращивали на кремниевой подложке
CVD-методом. Ориентацию CNT перпендикулярно поверхности подложки подтверждали путем
исследования скола образца методом растровой электронной микроскопии (рис. 2.48).
Нанотрубки имели диаметр ~60 нм, что указывает на их многослойную структуру.
а
б
Рис. 2.48. РЭМ-изображения массивов MWCNT, выращенных на кремниевой подложке:
обзорная фотография (а), увеличенное изображение, демонстрирующее пористость материала
(б).
Ввиду того, что задачей данной части работы было изучение емкостных характеристик
гибридных электродов и исследование возможности создания систем электрохимической
детекции НК на их основе, в работе использовали модельные олигонуклеотиды: зонды p(rA)10 и
Pyr(rA)10, олигонуклеотиды p(rU)12 в качестве комплементарной мишени и p(rC)8 в качестве
некомплементарной.
Гибридные
электроды
p(rA)10/MWCNT
и
Pyr(rA)10/MWCNT
получали
путем
нековалентной иммобилизации олигонуклеотидного зонда - декарибонуклеотида (pA)10 или его
5′-пиренильного производного Pyr(rA)10, на поверхность MWCNT. Иммобилизация зонда
происходила за счет стэкинг-взаимодействий гетероциклических оснований зонда или
ароматической системы остатка пирена в составе олигонуклеотидного зонда с поверхностью
нанотрубки. Следует отметить, что использование конъюгатов такого строения для
модификации
электродов
ранее
не
было
описано.
Доля
иммобилизованных
олигорибонуклеотидных зондов p(rA)10 или Pyr(rA)10 на поверхности ориентированных
128
MWCNT, определенная из соотношения оптических плотностей раствора до и после инкубации
с массивом MWCNT, составила 50 - 90%.
б
a
a
Рис. 2.49. Схематическое изображение электродного контакта (а) и трехэлектродной ячейки (б).
Обозначения: 1 – проводящий клей, 2 – гибридный электрод, 3 – мембрана из
полипропиленового волокна, 4 – вспомогательный электрод, 5 – электрод сравнения, 6 – штанга
штатива, 7 – рабочий электрод, 8 – изолятор, 9 – фиксатор электродов, 10 – фторопластовый
цилиндр, 11 – стеклянный бюкс.
Измерение электрохимических свойств полученных гибридных электродов проводили
методом
циклической
вольтамперометрии
с
линейной
разверткой
потенциала
в
трехэлектродной ячейке с хлорсеребряным электродом сравнения. Конструкция ячейки
представлена на рисунке 2.49. На основе полученных данных строили циклические
вольтамперограммы, по которым определяли кинетические изменения электрохимических
свойств гибридных электродов.
Циклические
Рис.
2.50.
вольтаммограммы
MWCNTэлектрода и гибридных электродов
p(rA)10
/MWCNT
и
Pyr(rA)10/MWCNT при скорости
развертки 20 мВ/с. Условия: 10 мМ
какодилат натрия, рН 7.4, 0.1 М
NaCl, 1 мМ Na2EDTA, комнатная
температура.
MWCNT
p(rA)10/MWCNT
0,10
Pyr(rA)10/MWCNT
Ток (мА)
0,05
0,00
-0,05
-0,10
0
200
400
600
800
1000
Напряжение (мВ)
Для гибридных электродов p(rA)10/MWCNT и Pyr(rA)10/MWCNT вольтамперограммы,
зарегистрированные при циклировании электрода в какодилатном буфере, представлены на
рисунке 2.50. Кривые имеют стандартную для углеродных материалов форму. Отсутствие
129
пиков, соответствующих каким-либо реакциям, указывает, что общая емкость электрода
определяется только емкостью двойного слоя, образующегося на поверхности MWCNT.
Исследование
2.6.2.
взаимодействия
модельных
гомоолигорибонуклеотидов-
мишеней с гибридными электродами
Регистрировали циклические вольтамперограммы гибридных электродов в диапазоне [0;
1] В; скорость развертки потенциала составляла 20 мВ/с. Из данных ЦВА рассчитывали
значения абсолютной емкости электрода и относительного изменения емкости. Добавление в
ячейку олигонуклеотида-мишени приводило к изменению формы и площади кривых ЦВА, и,
следовательно, к изменению емкости электрода.
При
циклировании
гибридного
электрода
в
p(rA)10/MWCNT
присутствии
комплементарного олигорибонуклеотида-мишени p(rU)12 регистрировали резкое увеличение
емкости (на 70%) с последующим уменьшением до исходного значения. В присутствии
некомплементарного олигорибонуклеотида-мишени p(rC)8 регистрировали рост емкости
(~20%) с последующим выходом значений емкости на плато. Через 30 циклов (около 3000 с) в
обоих случаях происходит стабилизация значений силы тока и емкости электрода. На рисунке
2.51 представлены профили изменения относительного изменения емкости электрода
p(rA)10/MWCNT в ходе циклирования.
Основываясь на описанных выше экспериментальных наблюдениях и учитывая
литературные данные о взаимодействии одно- и двуцепочечных олигонуклеотидов с MWCNT
[84,
320,
366,
421,
иммобилизованного
на
422],
можно
поверхности
предложить
MWCNT
следующую
схему
олигонуклеотидного
взаимодействия
зонда
p(rA)10
и
комплементарной мишени p(rU)12 (рис. 2.51в). При добавлении мишени в ячейку формируется
дуплекс с иммобилизованным на MWCNT олигонуклеотидным зондом, что приводит к
увеличению заряда на поверхности электрода, и как следствие, к увеличению его ёмкости.
Образующийся дуплекс p(rA)10/p(rU)12 отделяется от поверхности MWCNT [84,330,373]; этому
процессу соответствует уменьшение емкости в связи с уменьшением заряда электрода. Кроме
того необходимо учитывать процесс адсорбции комплементарной мишени p(rU)12 на
поверхности MWCNT без образования дуплекса. Некомплементарный олигонуклеотид-мишень
p(rC)8
не способен образовать дуплекс с иммобилизованным олигонуклеотидным зондом
p(rA)10 и частично адсорбируется на поверхности MWCNT за счет стэкинг-взаимодействий
гетероциклических оснований с поверхностью [415,435], что приводит к увеличению заряда
поверхности и, следовательно, к увеличению емкости электрода.
130
а
0,15
б
p(rA)10/MWCNT
p(rA)10/MWCNT + p(rU)12
0,10
p(rA)10/MWCNT
0,7
p(rA)10/MWCNT + p(rU)12
0,6
p(rA)10/MWCNT + p(rC)8
p(rA)10/MWCNT + p(rC)8
(C-C0)/C0
0,5
0,05
Ток (мА)
0,8
0,00
0,4
0,3
0,2
0,1
-0,05
0,0
-0,1
-0,10
0
200
400
600
800
1000
0
5
10
15
20
25
30
Номер цикла
Напряжение (мВ)
Дуплекс
зонд-мишень
в
Зонд
Мишень
Электрод
Рис. 2.51. Циклические вольтаммограммы гибридных электродов p(rA)10/MWCNT в
присутствии олигонуклеотидов-мишеней p(rU)12 и p(rC)8 (a), зависимость относительного
изменения емкости модифицированного электрода p(rA)10/MWCNT в присутствии p(rU)12 и
p(rC)8 (б), предполагаемая схема взаимодействия p(rA)10, иммобилизованного на поверхности
MWCNT, с комплементарным олигонуклеотидом p(rU)12 (в). Условия: 10 мМ какодилат
натрия, рН 7.4, 0.1 М NaCl, 1 мМ Na2EDTA; скорость развертки 20 мВ/с; комнатная
температура. Концентрация олигонуклеотида-мишени 10 мкМ; олигонуклеотид-мишень
добавляли на 3-м цикле.
При
циклировании
гибридного
электрода
Pyr(rA)10/MWCNT
в
присутствии
комплементарного олигонуклеотида-мишени p(rU)12 регистрировали увеличение площади
гистерезиса в течение первых трех циклов после добавления мишени с последующей
стабилизацией ее значений (рис. 2.52). При циклировании электродов в присутствии
некомплементарного олигонуклеотида-мишени p(rC)8 не наблюдали существенных изменений
площади гистерезиса. Для этого электрода с учетом данных, полученных в работе [172], о
возможности взаимодействия зонда, иммобилизованного посредством пиренильной якорной
группы на поверхности CNT, с комплементарным олигонуклеотидом, нами была предложена
другая схема взаимодействия гибридного электрода с мишенью. После добавления в ячейку
комплементарного олигонуклеотида-мишени (pU)12 образующийся дуплекс Pyr(rA)10/p(rU)12
удерживается на поверхности MWCNT за счет пиренильной якорной группы в структуре зонда
131
[172], что приводит к накоплению заряда на поверхности электрода, выражающемуся в росте
емкости
(рис.
2.52).
Незначительное
увеличение
емкости
гибридного
электрода
Pyr(rA)10/MWCNT при добавлении в ячейку некомплементарного олигонуклеотида-мишени
p(rC)8 так же, как и электрода p(rA)10/MWCNT, вероятно, связано с неспецифической
адсорбцией мишени на поверхности MWCNT.
а
0,3
б
Pyr(rA)10/MWCNT
Pyr(rA)9/MWCNT + p(rU)12
0,4
Pyr(rA)9/MWCNT + p(rC)8
0,2
0,3
(C-C0)/C0
Ток (мА)
0,1
0,0
Pyr(rA)10/MWCNT
Pyr(rA)10/MWCNT + p(rC)8
-0,1
0,1
-0,2
0,0
0
200
400
600
800
1000
Pyr(rA)10/MWCNT + p(rU)12
0,2
0
2
Напряжение (мВ)
6
8
10
12
14
16
Номер цикла
Дуплекс пиренильного
конъюгата зонда с мишенью
Пиренильный
конъюгат зонда
в
4
Мишень
Якорная группа
(остаток пирена)
Электрод
Рис. 2.52. Циклические вольтамперограммы гибридных электродов Pyr(rA)10/MWCNT в
присутствии олигонуклеотидов-мишеней p(rU)12 и p(rC)8 (a), зависимость относительного
изменения емкости модифицированного электрода Pyr(rA)10/MWCNT в присутствии p(rU)12 и
p(rC)8 (б), предполагаемая схема взаимодействия Pyr(rA)10, иммобилизованного на
поверхности MWCNT, с комплементарным олигонуклеотидом p(rU)12 (в). Условия: 10 мМ
какодилат натрия, рН 7.4, 0.1 М NaCl, 1 мМ Na2EDTA; скорость развертки 20 мВ/с; комнатная
температура. Концентрация олигонуклеотида-мишени 10 мкМ; олигонуклеотид-мишень
добавляли на 3-м цикле.
Таким образом, гибридные электроды, содержащие олигонуклеотидные зонды,
иммобилизованные на поверхности массива вертикально ориентированных многостенных
углеродных
нанотрубок,
демонстрируют
различный
электрохимический
отклик
при
взаимодействии с олигонуклеотидом-мишенью в зависимости от способа иммобилизации
зонда. Электрохимическая емкость гибридного электрода, содержащего немодифицированный
олигонуклеотидный зонд, иммобилизованный за счет взаимодействия гетероциклических
оснований, резко увеличивается при добавлении комплементарной мишени, однако, при
длительном циклировании постепенно снижается до исходных значений. Емкость гибридных
132
электродов,
содержащих
пиренильный
конъюгат
олигонуклеотидного
зонда,
иммобилизованный за счет взаимодействия якорной группы с поверхностью нанотрубки, также
увеличивается при добавлении комплементарной мишени, но с течением времени остается на
высоком уровне. Для электродов обоих типов наблюдали различные профили изменения
емкости при циклировании в присутствии комплементарной и некомплементарной мишени.
Следует отметить, что специфичный электрохимический отклик гибридных электродов
наблюдается в отсутствие электрохимических меток, что значительно упрощает процесс
детекции.
Были получены и охарактеризованы гибридные электроды на основе вертикально
ориентированных MWCNT, содержащих олигорибонуклеотидные зонды, иммобилизованные
на поверхность нанотрубок как напрямую, так и посредством пиренильных «якорных» групп.
Введение якорной группы позволяет закрепить дуплекс, образующийся в результате
гибридизации олигонуклеотидного зонда с олигонуклеотидом-мишенью, на поверхности
углеродной нанотрубки. Изучены электрохимические свойства полученных электродов,
продемонстрировано изменение их емкостных характеристик в процессе циклирования в
присутствии комплементарного и некомплементарного олигонуклеотида-мишени. Показано,
что
гибридный
электрод,
содержащий
олигонуклеотидный
зонд,
иммобилизованный
посредством пиренильной якорной группы, обладает большей селективностью и большей
стабильностью сигнала в течение анализа. В перспективе предложенный метод может быть
использован для специфической безметочной детекции РНК и ДНК.
*
*
*
В данной работе был развит подход к получению мультифункциональных гибридов
нуклеиновых кислот с углеродными нанорубками, основанный на использовании остатков
пирена в качестве якорных групп для иммобилизации НК-конструкций на поверхности
нанотрубок. Данный подход ранее не применялся для получения мультифункциональных
гибридов углеродных нанотрубок с НК, а также для сборки многокомпонентных НКкомплексов
на
поверхности
нанотрубок.
Были
разработаны
новые
методы
оценки
эффективности формирования гибридов пиренильных конъюгатов олигонуклеотидов с
модифицированными одностенными углеродными нанотрубками. Показано, что основной
вклад в эффективность адсорбции пиренильных конъюгатов олигонуклеотидов на поверхности
одностенных углеродных нанотрубок вносит тип химической модификации нанотрубок, а
также длина олигонуклеотида. Разработаны и оптимизированы подходы к сборке НКкомплексов на поверхности модифицированных одностенных углеродных нанотрубок.
133
Продемонстрировано высвобождение siРНК из гибрида трехкомпонентного НК-комплекса с
модифицированными одностенными углеродными нанотрубками под действием РНКазы Н.
Показана низкая цитотоксичность гибридных конструкций на основе одностенных углеродных
нанотрубок в широком диапазоне концентраций, продемонстрировано их проникновение через
клеточную мембрану путем эндоцитоза. Продемонстрировано специфичное распознавание
модельного олигонуклеотида-мишени за счет изменения емкостных характеристик гибридного
электрода из вертикально ориентированных многостенных углеродных нанотрубок и
олигонуклеотида-зонда. Показано, что наличие пиренильного остатка в структуре зонда
позволяет улучшить аналитический сигнал.
Полученные данные демонстрируют перспективность гибридных материалов на основе
углеродных нанотрубок и нуклеиновых кислот как средств доставки терапевтических НК в
клетки и элементов распознавания последовательностей НК в сенсорных устройствах.
134
Глава 3. Экспериментальная часть
3.1. Исходные материалы
Реактивы
В работе были использованы следующие реактивы и растворители: пивалоилхлорид,
имидазол,
треххлористый
трифенилфосфин,
фосфор,
дихлоруксусная
кислота,
4-(N,N-диметил)аминопиридин,
гексаметилендиамин,
2,2′-дипиридилдисульфид,
цетилтриметиламмоний бромид, N,N,N′,N′-тетраметилэтилендиамин, солянокислый цистеин,
краситель
«Stains-all»,
изотиоцианат
1-трет-бутилоксикарбониламино-6-аминогексан,
флуоресцеина, краситель метиленовый синий (Fluka, Швейцария), ксиленцианол FF,
бромфеноловый синий, мочевина, динатриевая соль N,N,N′,N′-этилендиаминтетрауксусной
кислоты, метиламин, нингидрин (Merck, Германия), трис-(оксиметил)аминометан, перхлорат
натрия, О,О′-бис-(3-аминопропил)полиэтиленгликоль, хлорид магния, культуральные среды
DMEM и IMDM (Sigma-Aldrich, США), γ-[32P]-ATP, [32P]pCp (4000 Ки/моль, “Биосан”, Россия),
акриламид,
N,N′-метиленбисакриламид,
персульфат
аммония,
эмбриональная
телячья
сыворотка (ICN, США), гидрохлорид 1-пиренилметиламина, 4,4′-диметокситритилхлорид, 2,2′сульфонилдиэтанол,
гексаэтиленгликоль,
(диметиламино)пропил]карбодиимида,
перхлорат
лития,
полиамидоаминовый
гидрохлорид
дендример
1-этил-3-[3-
G3.0
(Aldrich,
Германия), ацетонитрил, хлористый метилен, пиридин (Panreac, Испания), трифторуксусная
кислота, глицерин, дитиотреит (Acros Organics, США), какодилат натрия (Prolabo, Франция),
диметилсульфоксид (ос. ч.) и другие реактивы и растворители отечественного и импортного
производства.
Углеродные нанотрубки
В работе использовали одностенные углеродные нанотрубки длиной до 2 мкм (Carbolex,
США) и массивы вертикально ориентированных многостенных углеродных длиной 500 мкм
нанотрубок,
выращенных
на
кремниевой
подложке
(Лаборатория
физико-химии
наноматериалов ИНХ СО РАН, Новосибирск).
Ферменты
В работе использовали щелочную фосфатазу E.coli (КФ 3.1.3.1) (34 ед.акт./мл) (НПО
«Биолар», Латвия), фосфодиэстеразу I (ФДЭ) (КФ 3.1.4.1) (0.9 ед.акт/мл) (Sigma, США),
полинуклеотидкиназу фага T4 (КФ 2.7.1.78) (10000 ед.акт/мл), РНК-лигазу фага T4 (КФ 6.5.1.3)
(10 ед. акт/мкл), РНКазу Н E.coli (КФ 3.1.26.4) (5 ед. акт/мкл) (Fermentas, Латвия).
135
Олигонуклеотиды
Олигодезоксирибонуклеотиды
и
олигорибонуклеотиды
были
синтезированы
в
лаборатории химии РНК ИХБФМ СО РАН. Полимерсвязанные защищенные олигонуклеотиды
были
получены на
синтезаторе ASM-800 («Биоссет»,
Россия) Воробьевой
М.А.
с
использованием оптимизированных для данного синтезатора протоколов твердофазного
фосфитамидного метода (табл.3.1).
Таблица 3.1. Последовательности полимерсвязанных олигонуклеотидов, использованных в
работе
Последовательность олигонуклеотида1
Шифр
5′-pr(CCCCCCCC)
p(rC)8
5′-pr(UUUUUUUUUUUU)
p(rU)12
5′-pr(AAAAAAAAAA)
p(rA)10
5′-r(AAAAAAAAAAAAAAA)
(rA)15
5′-r(AAAAAAAAAAAAAAAAAAAA)
(rA)20
5′-r(AAAAAAAAAAAAAAAAAAAAAAAAA)
(rA)25
5′-d(AAAAAAAAAAAAAAA)
(dA)15
5′-d(AAAAAAAAAAAAAAAAAAAA)
(dA)20
d22
5′-d(ACCCTGAAGTTCCGGCAAGCTG)
d17
5′-d(АACCGTGGTCATGCTCC)
5′-r(AUAUACAACUUGUCAAGCCAA)
mdr1-As
5′-r(GGCUUGACAAGUUGUAUAUGG)
mdr1-S
5′-r(GGCUUGACAAGUUGUAUAUGGGGAGCAUGACCACGG)
mdr1-LS
5′-r(AUAUACAACUUGUCAAGCCAAGGAGCAUGACCACGG)
mdr1-LAs
1
p - Фосфатная группа, r – рибонуклеотиды, d – дезоксирибонуклеотиды.
3.2. Основные методы работы
Анализ и идентификацию органических синтонов осуществляли с помощью ТСХ на
пластинках DC-Alufolien Kieselgel 60 F254 (Merck, Германия) в системах растворителей: (А)
100% диэтиловый эфир; (Б) этанол-хлористый метилен, содержащий 0.2% TEA, 4:6; (В) этанолхлористый метилен, содержащий 0.2% ТЕА, 0.5:9.5; (Г) этанол-хлористый метилен,
содержащий 0.2% ТЕА 1:9. Для адсорбционной хроматографии использовали сорбент Silica gel
(230-400 меш, 60 Å) (Sigma, США).
Концентрирование
растворов
органических
синтонов
после
выделения
распределительной колоночной хроматографией осуществляли на вакуумном ротационном
136
испарителе Rotavapor RE (Büchi, Швейцария) при давлении 10-15 мм.рт.ст. и температуре до 40
ºС.
Растворы олигонуклеотидов, их производных, углеродных нанотрубок, их гибридов
готовили на деионизованной воде с удельным сопротивлением 18.2 МОм/см, полученной с
помощью прибора Millipore Simplicity (Millipore, США). Измерение pH буферных растворов
проводили с использованием pH-метра Microprocessor pH Meter pH 211 (Hanna Instruments,
Германия).
Центрифугирование
растворов
олигонуклеотидов,
их
производных,
углеродных
нанотрубок, их гибридов с олигонуклеотидами осуществляли на центрифуге Eppendorf
MiniSpin (Eppendorf, Германия).
Перемешивание растворов олигонуклеотидов, их производных, углеродных нанотрубок,
их гибридов с олигонуклеотидами при постоянной температуре проводили в термомиксере
Eppendorf Termomixer Comfort (Eppendorf, Германия).
Концентрирование растворов олигонуклеотидов и их производных осуществляли на
вакуумном испарителе Speed-Vac Concentrator SVC-100H (Savant, США).
Измерение оптической плотности растворов олигонуклеотидов и их производных
проводили с использованием прибора Nanodrop 1000 (Thermo Fisher Scientific, США).
Осаждение олигонуклеотидов и их производных в виде литиевых солей проводили
добавлением десятикратного избытка 2%-ного раствора NaClO4 в ацетоне с последующим
выдерживанием при -20 °С не менее 1 ч. Выпавший осадок отделяли центрифугированием,
промывали ацетоном и сушили на воздухе.
Электрофоретическое
денатурирующих
условиях
разделение
проводили
олигонуклеотидов
в
15%-ном
и
их
ПААГ
производных
в
(акриламид:N,N′-
метиленбисакриламид (29:1), 8 М мочевина, 50 мМ Трис-борат, рН 8.3, 0.1 мМ Na2EDTA) при
напряжении 50 В/см. Аналитический электрофорез проводили в ПААГ толщиной 0.4 мм,
препаративный - 0.8 мм. Образцы наносили на гель в растворе 0.05% ксиленцианола FF и 0.05%
бромфенолового синего в 8М-ном растворе мочевины.
Электрофоретический анализ нековалентных гибридов SWCNT с дуплексами НК
проводили
в
нативном
12%-ном
полиакриламидном
геле
(акриламид:N,N′-
метиленбисакриламид (30:1), 10 мМ MgCl2,50 мМ Трис-борат, рН 8.3) толщиной 0.4 мм при
напряжении до 50 В/см и температуре до 20°С. Образцы наносили на гель в растворе 0.05%
ксиленцианола FF и 0.05% бромфенолового синего в 50%-ном глицерине.
Для окрашивания геля и визуализации производных олигонуклеотидов использовали
раствор, приготовленный из 50 мг «Stains-all» и 100 мл смеси формамид:вода (1:1). После
окрашивания осуществляли высвечивание избытка красителя. Высушивание аналитических
137
полиакриламидных гелей проводили с использованием прибора Gel Dryer Model 583 (BioRad,
США).
Радиоактивные
аналитические
полиакриламидные
гели
после
высушивания
экспонировали в кассете с фоточувствительным экраном (BioRad, США), который затем
сканировали с использованием сканера Pharos FX (BioRad, США) и обрабатывали с
использованием программного обеспечения Quantity One (BioRad, США)
Выделение олигонуклеотидов после проведения препаративного электрофореза
После проведения препаративного разделения вырезали полосу, соответствующую
основному продукту синтеза, наблюдаемую в УФ-свете в геле, наложенном на пластинку
DC-Alufolien Kieselgel 60 F254. Олигодезоксирибонуклеотиды и их конъюгаты из ПААГ
элюировали тремя порциями по 600 мкл 0.3 М водным раствором NaClO4 при комнатной
температуре. Олигорибонукелотиды из ПААГ элюировали двумя порциями по 600 мкл 0.3 М
водным раствором NaClO4 при комнатной температуре. Супернатант отбирали, добавляли
раствор 3 М NaClO4 (1/10 объема элюента) и обессоливали на фазе Preparative C18 (Waters,
США).
Обессоливание олигонуклеотидов и их производных
Обессоливание олигонуклеотидов и их производных проводили на фазе Preparative C18
25Å 50-105 µm (Waters, США). К 500 мкл фазы Preparative C18 добавляли 1.5 мл 50% CH3CN
(водн.), оставляли на 30 мин. В наконечник пипетки объемом 200 мкл помещали фильтр из
стекло бумаги, на который наносили 100-150 мкл взвеси фазы. К наконечнику с фазой
присоединяли обрезанный наконечник пипетки объемом 1 мл. Промывали фазу 300 мкл 50%
CH3CN (водн.), затем 450 мкл 0.05M NaClO4 (водн.). Олигонуклеотид в водном растворе 0.3 M
NaClO4 наносили на фазу. Промывали фазу 450 мкл 0.05M NaClO4 (водн.). Олигонуклеотид
элюировали двумя порциями по 150 мкл 50% CH3CN (водн.), осаждали в виде натриевых солей.
Расчет
коэффициентов
молярного
поглощения
олигонуклеотидов
и
их
производных
Коэффициенты молярного поглощения олигонуклеотидов при 260 нм рассчитывали с
учетом гипохромного эффекта по формуле [436]:
ε=2·(ε1,2+ε2,3+...+εn-1,n)-ε2-ε3-...-εn-1,
где εi– коэффициент молярного поглощения нуклеотида; εi-1,i– коэффициент молярного
поглощения для пары нуклеотидов.
138
Коэффициенты молярного поглощения пиренильных конъюгатов олигонуклеотидов
рассчитывали
сложением
рассчитанных
коэффициентов
молярного
поглощения
олигонуклеотидов при 260 нм и коэффициента молярного поглощения пирена при 260 нм
(εPyr=24000л/моль·см) по данным работы [437].
Анализ строения олигонуклеотидов и их конъюгатов
Анализ гомогенности олигонуклеотидов проводили методом денатурирующего гельэлектрофореза
в
ПААГ
как
описано
выше.
Аналитическую
обращенно-фазовую
хроматографию производных олигонуклеотидов проводили на хроматографе «Альфахром»
(Эконова, Россия) с использованием колонки Prontosil C-18 AQ (2.0x75 мм, Masherey-Nagel,
Германия) в градиенте концентрации CH3CN (0-50%) в 0.02 М ацетате натрия (pH 7.0), при
40°C. Количественные хроматографические данные в режиме детекции на шести длинах волн
спектрофотометрическим детектором хроматографа «Милихром» были получены и обработаны
с помощью программы Мультихром (ЛИН СО РАН).
Для подтверждения строения пиренильных производных олигонуклеотидов был
использован
метод
MALDI
TOF
масс-спектрометрии.
Масс-спектры
получены
с
использованием прибора Autoflex Speed (Bruker Daltonics, Германия) в центре массспектрометрического анализа ИХБФМ СО РАН.
Радиоактивное мечение олигонуклеотидов
Введение радиоактивной метки на 5′-конец олигонуклеотида осуществляли в 15 мкл
буфера (50 мМ Трис-HCl (pH 7.6), 10 мМ MgCl2 и 5 мМ DTT) с 10%-ным DMSO, 0.1 мКи [γ32
P]-АТФ (4000 Ки/моль, «Биосан», Россия) и 20 ед. акт. Т4-полинуклеотидкиназы при
концентрации олигонуклеотида 28 мкМ (0.1 о.е.) в течение 2 ч при 37 °С, далее к реакционной
смеси добавляли 1 мкл (10 мМ) АТФ, 1 мкл (10 ед. акт.) Т4-полинуклеотидкиназы и
выдерживали в течение 1 ч при 37 °C.
Введение радиоактивной метки на 3′-конец олигонуклеотида осуществляли в 20 мкл
буфера (50 мМ Трис-HCl (pH 7.6), 10 мМ MgCl2, 10 мМ DTT, 1 мМ АТФ) с 10%-ным DMSO,
0.1 мКи [32P]pCp (4000 Ки/моль, «Биосан», Россия) и 10 ед. акт. Т4-РНК-лигазы при
концентрации олигонуклеотида 28 мкМ (0.1 о.е.) в течение 3 ч при 37 °С.
Радиоактивно меченый продукт выделяли в 15%-ном ПААГ толщиной 0.4 мм в
денатурирующих условиях как описано выше. Визуализацию продуктов мечения проводили с
использованием радиоавтографии на пленку CP-BU (Agfa, Бельгия). Зоны, соответствующие
меченым олигонуклеотидам, вырезали из геля. Элюцию олигонуклеотидов из ПААГ
проводили, как описано выше. Олигонуклеотиды осаждали в виде натриевых солей.
139
Получение НК-комплексов
Раствор, содержащий олигонуклеотиды-компоненты НК-комплекса в буфере состава 50
мМ Tрис-HCl (pH 7.5), 200 мМ KCl, 10 мМ MgCl2 инкубировали 5 мин при 95 °С и медленно
охлаждали до комнатной температуры.
Ультразвуковая обработка растворов одностенных углеродных нанотрубок
Ультразвуковую обработку растворов углеродных нанотрубок и их гибридов с
олигонуклеотидами проводили в ультразвуковой бане SONOREX SUPER RK 31 H Bandolin
Electronic (Германия). Пиковая мощность ультразвука составляла до 240 Вт, частота – 35 КГц.
Приготовление растворов одностенных углеродных нанотрубок
Готовили раствор углеродных нанотрубок (1 мг/мл), обрабатывали ультразвуком в
течение 30 мин. Разбавлением получали растворы с концентрациями углеродных нанотрубок
равными 256 мг/л, 64 мг/л и 16 мг/л. После разбавления растворы SWCNT обрабатывали в
ультразвуковой бане в течение 15 мин. Из полученных растворов отбирали объемы,
содержащие необходимые количества SWCNT.
Определение
содержания
первичных
аминогрупп
в
модифицированных
одностенных углеродных нанотрубках
Определение содержания первичных аминогрупп проводили путем реакции с
нингидрином (тест Кайзера) по аналогии с [400]. Навеску модифицированных SWCNT (2 мг)
помещали в пластиковую пробирку типа Eppendorf объемом 0.6 мл, диспергировали в 100 мкл
5%-ного раствора нингидрина в C2H5OH ультразвуковой обработкой в течение 5 мин.
Реакционную смесь нагревали 10 мин при 100 °C. Углеродный материал осаждали
центрифугированием (14000 g), промывали осадок порциями по 100 мкл C2H5OH до
исчезновения окраски супернатанта; спиртовые фракции объединяли. Аналогичным образом
готовили холостую пробу, не содержащую нанотрубок. Измеряли значение оптического
поглощения раствора окрашенного продукта реакции на длине волны 570 нм относительно
холостой пробы. Из данных измерений рассчитывали удельное содержание первичных
аминогрупп на единицу массы модифицированных SWCNT. Среднее значение удельного
содержания аминогрупп вычисляли по результатам трех измерений.
Получение
гибридов
углеродными нанотрубками
НК-дуплексов
с
модифицированными
одностенными
140
а) Способ «mix-and-go». К раствору модифицированных SWCNT в буфере состава 50
мМ Tрис-HCl (pH 7.5), 200 мМ KCl, 10 мМ MgCl2 добавляли растворы 5′-пиренильного
конъюгата олигонуклеотида Pyrmdr1-S или PyrHEGd17 и комплементарного олигонуклеотида
mdr1-As или mdr1-LS (mdr1-LAs), соответственно. Реакционную смесь обрабатывали
ультразвуком в течение 30 мин или инкубировали 5 мин при 95 °С и медленно охлаждали до
комнатной температуры.
б) Алгоритмический способ.
К раствору модифицированных SWCNT добавляли
раствор НК-дуплекса Pyrmdr1-S/mdr1-As, PyrHEGd17/mdr1-LS или PyrHEGd17/mdr1-LAs,
полученного, как описано выше. Реакционную смесь обрабатывали ультразвуком в течение 30
мин или инкубировали 5 мин при 95 °С и медленно охлаждали до комнатной температуры.
в) Иерархический способ. К раствору SWCNT, насыщенных 5′-пиренильным
конъюгатом олигонуклеотида Pyrmdr1-S или PyrHEGd17 (см. раздел 3.3), в буфере состава 50
мМ Tрис-HCl (pH 7.5), 200 мМ KCl, 10 мМ MgCl2 добавляли раствор комплементарного
олигонуклеотида mdr1-As или mdr1-LS (mdr1-LAs), соответственно. Реакционную смесь
обрабатывали ультразвуком в течение 30 мин или инкубировали 5 мин при 95 °С и медленно
охлаждали до комнатной температуры.
Получение гибридов трехкомпонентных НК-комплексов с модифицированными
одностенными углеродными нанотрубками
а) Способ «mix-and-go». К раствору модифицированных SWCNT в буфере состава 50
мМ Tрис-HCl (pH 7.5), 200 мМ KCl, 10 мМ MgCl2 добавляли растворы 5′-пиренильного
конъюгата олигонуклеотида PyrHEGd17 и олигонуклеотидов mdr1-As и mdr1-LS или mdr1-S
и mdr1-LAs, соответственно. Реакционную смесь обрабатывали ультразвуком в течение 30 мин
или инкубировали 5 мин при 95 °С и медленно охлаждали до комнатной температуры.
б) Алгоритмический способ.
раствор
трехкомпонентного
PyrHEGd17/mdr1-Las/mdr1-S,
К раствору модифицированных SWCNT добавляли
НК-комплекса
полученного,
как
PyrHEGd17/mdr1-LS/mdr1-As
описано
выше.
Реакционную
или
смесь
обрабатывали ультразвуком в течение 30 мин или инкубировали 5 мин при 95 °С и медленно
охлаждали до комнатной температуры.
в) Иерархический способ. К раствору SWCNT, насыщенных 5′-пиренильным
конъюгатом олигонуклеотида PyrHEGd17 (см. раздел 3.3), в буфере состава 50 мМ Tрис-HCl
(pH 7.5), 200 мМ KCl, 10 мМ MgCl2 добавляли растворы олигонуклеотидов mdr1-As и mdr1-LS
или mdr1-S и mdr1-LAs, соответственно. Реакционную смесь обрабатывали ультразвуком в
течение 30 мин или инкубировали 5 мин при 95 °С и медленно охлаждали до комнатной
температуры.
141
Методы анализа SWCNT и их гибридов с олигонуклеотидами
Измерение
электрокинетического
потенциала
SWCNT
и
их
гибридов
с
олигонуклеотидами проводили с использованием анализатора размера частиц Zetasizer Nano ZS
(Malvern Instruments, Великобритания) в кюветах с электродами DTS1060 C.
Исследования SWCNT и их гибридов с олигонуклеотидами методом ПЭМ без
контрастирования были проведены В. И. Зайковским (Институт катализа СО РАН). Образцы
для исследований закрепляли на стандартные медные сетки, которые помещали в держатель и
вводили в камеру образцов электронного микроскопа. Изображения получали на электронном
микроскопе JEM-2010 (JEOL, Япония) с разрешением по решетке 0.14 нм при ускоряющем
напряжении 150 кВ.
Исследования SWCNT и их гибридов с олигонуклеотидами методом ПЭМ с
контрастированием проводили в Группе микроскопических исследований ИХБФМ СО РАН.
Медную сетку, покрытую формваром, помещали на каплю раствора SWCNT с концентрацией
25 мг/л на 90 с. Затем сетку помещали на каплю растовра контрастирующего агента (0.5%-ного
ацетата уранила или 2%-ной фосфорно-вольфрамовой кислоты) на 5 с. Избыток жидкости
удаляли фильтровальной бумагой. Изображения получали на электронном микроскопе
JEM-1400 (JEOL, Япония), оснащенном цифровой камерой Veleta (SIS, Германия), при
ускоряющем напряжении 80 кВ.
Исследования модифицированных углеродных нанотрубок методом инфракрасной
спектроскопии были проведены Л. А. Шелудяковой (ИНХ СО РАН) с использованием ИКфурье спектрометра Scimitar FTS 2000 (Digilab, Австралия). Образцы готовили в виде таблеток,
запрессованных с КBr.
Структурные свойства модифицированных SWCNT были исследованы с помощью
метода
комбинационного
рассеяния
света
В.
А.
Володиным
(Институт
физики
полупроводников СО РАН). Было использовано оборудование Научно-образовательного
комплекса «Наносистемы и современные материалы» Новосибирского Государственного
Университета – спектрометр с трехкомпонентным монохроматором T64000 (Horiba Jobin Yvon,
Италия). Спектры комбинационного рассеяния света регистрировали при комнатной
температуре в геометрии обратного рассеяния, для возбуждения использовали линия Ar+ лазера
с длиной волны 514.5 нм. Спектральное разрешение составляло не более 1 см-1. В качестве
детектора использовали кремниевую матрицу фотоприемников, охлаждаемую жидким азотом.
Применяли приставку для микроскопических исследований комбинационного рассеяния света.
Мощность лазерного пучка, доходящего до образца, составляла 2-3 мВт. Для того, чтобы
142
минимизировать нагрев структур под лазерным пучком, образец помещали чуть ниже фокуса и
размер пятна составлял 4-5 микрон.
Элементный анализ модифицированных SWCNT был проведен в Центре коллективного
пользования «Химический сервисный центр СО РАН» с использованием CHN-анализатора
Carlo Erba 1106 (Carlo Erba, Италия).
Термогравиметрический анализ модифицированных SWCNT был проведен в Институте
неорганической химии СО РАН с использованием термоанализатора TG 209 F1 (NETZSCH,
Германия). Термограммы были получены в инертной атмосфере в потоке гелия при скорости
нагрева 10 °С/мин.
Ориентацию MWCNT перпендикулярно поверхности подложки подтверждали путем
исследования скола образца методом растровой электронной микроскопии с использованием
микроскопа JEOL JSM-6700 F (JEOL, Япония) в ИНХ СО РАН.
Спектральные методы
Спектры флуоресценции записывали на спектрофлуориметре Cary Eclipse (Varian Inc.,
США) в кварцевых кюветах (длина оптического пути 3 мм) при комнатной температуре. Для
гибридов модифицированных SWCNT с пиренильными конъюгатами олигонуклеотидов
записывали спектры флуоресценции при возбуждении светом с длиной волны 345 нм. Для
флуоресцеинсодержащих SWCNT и их гибридов также записывали спектры флуоресценции
при возбуждении светом с длиной волны 499 нм.
Cпектры оптического поглощения в УФ и видимой области записывали на
спектрофотометре Shimadzu UV-vis-2100 (Kyoto, Япония) в кварцевых кюветах (длина
оптического пути 1 мм) при комнатной температуре.
Электрохимические измерения
Вольтамперные характеристики MWCNT-электродов регистрировали с использованием
потенциостата Elins P-30S (ООО «Элинс», Россия), работающего в потенциодинамическом
режиме, управляемого программным пакетом PSPack (ООО «Элинс», Россия). Потенциал
измеряли
относительно
хлорсеребряного
электрода
сравнения
ЭСр–10102/3.5
(НПО
"Измерительная техника ИТ", Россия). Скорость развертки потенциала составляла 20 мВ/с.
143
3.3. Методики эксперимента
Получение карбоксимодифицированных SWCNT (SWCNT-COOH)
Окисление проводили по аналогии с методом, предложенным в работе [394]. Навеску
SWCNT (500 мг) помещали в круглодонную колбу, приливали 200 мл 70%-ной HNO3.
Кипятили при температуре 115 °C до прекращения выделения NO2.
Фильтрование проводили с помощью вакуумного водоструйного насоса через
политетрафторэтиленовый фильтр (Millipore, США) с диаметром пор 0.2 мкм. Осадок
углеродного материала промывали на фильтре до pH 5.5 - 6.0, SWCNT-COOH смывали с
фильтра ультразвуковой обработкой в ацетоне, сушили на воздухе, затем над P2O5 при 2-5
мм.рт.ст.
Получение гексаметилендиамин-модифицированных SWCNT (SWCNT-HMDA)
а) Активация карбоксильных групп и присоединение Boc-HMDA. Навеску SWCNTCOOH (10 мг) помещали в пластиковую пробирку типа Eppendorf объемом 1.5 мл,
диспергировали в 300 мкл DMF ультразвуковой обработкой в течение 5 мин. К взвеси
нанотрубок добавляли раствор 5 мг EDC (26.2 мкмоль) в 200 мкл DMF. Реакционную смесь
перемешивали 3 ч при 45 °C, добавляли 10 мкл Boc-HMDA (45 мкмоль). Продолжали
перемешивание в течение 6 ч, затем выдерживали при комнатной температуре в течение 16 ч.
Углеродный материал осаждали добавлением 10-кратного избытка 2.5%-ного водного раствора
C2H5OH с последующим центрифугированием (14000 g), промывали 2.5%-ным водным
раствором C2H5OH (6 раз по 1 мл), сушили при 1-2 мм.рт.ст. над P2O5.
б) Удаление защитных групп. 500 мкл 10%-ного раствора трифторуксусной кислоты
CF3COOH в диоксане охлаждали во льду до 0 °С, и добавляли к порошку SWCNT-HMDA-Boc.
Реакционную смесь перемешивали 1 ч при комнатной температуре. Нейтрализовали избыток
кислоты добавлением 100 мкл триэтиламина. Углеродный материал осаждали добавлением 10кратного избытка смеси C2H5OH:C2H5OC2H5 (1:1 v/v) с последующим центрифугированием
(14000 g), промывали смесью C2H5OH:эфир (1:1 v/v) (5 раз по 1 мл), сушили на воздухе, а затем
при 1-2 мм.рт.ст. над P2O5.
Получение полиэтиленгликоль-модифицированных SWCNT (SWCNT-PEG)
а) Активация карбоксильных групп SWCNT-COOH. Навеску SWCNT-COOH (10 мг)
помещали в пластиковую пробирку типа Eppendorf объемом 2 мл, диспергировали в 500 мкл
H2O ультразвуковой обработкой в течение 30 мин. К взвеси нанотрубок добавляли раствор 5 мг
EDC (26.2 мкмоль) в 200 мкл H2O. Реакционную смесь выдерживали при перемешивании при
температуре 37 °C в течение 2.5 ч.
144
б) Присоединение О,О′′-бис-(3-аминопропил)полиэтиленгликоля. К реакционной
смеси приливали раствор 3.5 мг H2N-(PEG1500)-NH2 в 200 мкл раствора H2O:TEA (95:5 v/v).
Реакционную смесь выдерживали при перемешивании в термомиксере при температуре 37 °C в
течение 3 ч, а затем выдерживали при комнатной температуре без перемешивания в течение 2
сут. Модифицированные SWCNT осаждали добавлением 10-кратного избытка смеси
С2H5OH:CH3C(O)CH3:H2O (95:2.5:2.5 v/v/v) с последующим центрифугированием, промывали
смесью С2H5OH:CH3C(O)CH3:H2O (95:2.5:2.5 v/v/v) до отсутствия следов SWCNT в
супернатанте, осадок сушили на воздухе, а затем над P2O5 при 2-5 мм.рт.ст. в течение 1-2 ч.
Получение SWCNT, модифицированных полиамидоаминовыми дендримерами
(SWCNT-PAMAM)
Модификацию SWCNT проводили по аналогии с методикой, описанной в работе [398].
Навеску SWCNT-COOH (10 мг) помещали в пластиковую пробирку типа Eppendorf объемом 1.5
мл, диспергировали в 300 мкл DMF ультразвуковой обработкой в течение 5 мин. К взвеси
нанотрубок приливали раствор 5 мг EDC (26.2 мкмоль) в 200 мкл DMF. Реакционную смесь
выдерживали при перемешивали 3 ч при 45 °C. Затем взвесь нанотрубок приливали к смеси 150
мкл 20%-ного раствора PAMAM (3.45 мкмоль) в CH3OH и 100 мкл абсолютного DMF.
Реакционную смесь перемешивали в термомиксере при температуре 50°C в течение 6 ч.
Углеродный материал осаждали добавлением 10-кратного избытка смеси C2H5OH:C2H5OC2H5
(1:1
v/v)
с
последующим
центрифугированием
(14000
g),
промывали
смесью
C2H5OH:C2H5OC2H5 (1:1 v/v) (5 раз по 1 мл), сушили на воздухе, а затем при 1-2 мм.рт.ст. над
P2O5.
Получение флуоресцентных гексаметилендиамин-модифицированных SWCNT
(SWCNT-HMDA-FITC) и дендример-модифицированных SWCNT (SWCNT-PAMAMFITC) (вариант 1)
Присоединение флуоресцеина к аминомодифицированным SWCNT проводили по
аналогии с методикой, описанной в работе [275]. Предварительно высушенную навеску
SWCNT-HMDA или SWCNT-PAMAM (5 мг) помещали в пластиковую пробирку типа
Eppendorf объемом 1.5 мл, диспергировали в 200 мкл абсолютного DMF с добавлением 5 мкл
сухого TEA, добаляли раствор 2.5 мг FITC (6.4 мкмоль) в 200 мкл абсолютного DMF.
Реакционную смесь перемешивали 4 ч при комнатной температуре. Углеродный материал
осаждали добавлением 10-кратного избытка смеси C2H5OH:эфир (1:1 v/v) с последующим
центрифугированием (14000 g), промывали смесью C2H5OH:эфир (1:1 v/v) до исчезновения
флуоресценции раствора. Флуоресценцию раствора регистрировали с использованием
145
трансиллюминатора TCP-20.LC (Vilber Lourmat, Франция). Продукт сушили на воздухе, а затем
при 1-2 мм.рт.ст. над P2O5.
Получение флуоресцентных дендример-модифицированных SWCNT (SWCNTPAMAM-FITC) (вариант 2)
а) Активация карбоксильных групп SWCNT-COOH. Навеску SWCNT-COOH (5 мг)
помещали в пластиковую пробирку типа Eppendorf объемом 1.5 мл, диспергировали в 100 мкл
DMF ультразвуковой обработкой в течение 5 мин. К взвеси нанотрубок приливали раствор 2.5
мг EDC (13.1 мкмоль) в 200 мкл DMF. Реакционную смесь перемешивали 3 ч при 45 °C.
б) Получение конъюгата полиамидоаминового дендримера с флуоресцеином
(PAMAM-FITC). Присоединеие флуоресцеина к полиамидоаминовому дендримеру проводили
по аналогии с [402]. К смеси 15 мкл 20%-ного раствора PAMAM (0.75 мкмоль) в CH3OH и 200
мкл абс. DMF с добавлением 5 мкл абс. TEA добавляли раствор 2 мг FITC (5.1 мкмоль) в 400
мкл абс. DMF порциями по 25 мкл каждые 10 мин. По окончании добавления реакционную
смесь перемешивали 1 ч при 45 °C. Конъюгат PAMAM-FITC вводили в реакцию с SWCNTCOOH без предварительного выделения.
в) Присоединение конъюгата PAMAM-FITC к активированным SWCNT-COOH.
Взвесь нанотрубок после активации приливали к раствору конъюгата PAMAM-FITC.
Реакционную смесь выдерживали при перемешивании в термомиксере при температуре 45 °C в
течение 4 ч. Углеродный материал осаждали центрифугированием (14000 g), промывали
смесью C2H5OH:эфир (1:1 v/v), процедуру повторяли до исчезновения флуоресценции раствора.
Флуоресценцию раствора регистрировали с использованием трансиллюминатора TCP-20.LC
(Vilber Lourmat, Франция). Продукт сушили на воздухе, а затем при 1-2 мм.рт.ст. над P2O5.
Получение флуоресцентных полиэтиленгликоль-модифицированных SWCNT-PEGFITC
Предварительно высушенную навеску SWCNT-PEG (5 мг) помещали в пластиковую
пробирку типа Eppendorf объемом 2 мл, диспергировали в 100 мкл абс. DMSO с добавлением 10
мкл TEA ультразвуковой обработкой в течение 2 ч. Затем добавляли раствор 0.4 мг FITC (1.5
мкмоль) в 100 мкл абс. DMSO. Реакционную смесь обрабатывали ультразвуком в течение 3 ч,
затем инкубировали 16 ч при перемешивании в термомиксере при комнатной температуре.
Углеродный материал осаждали добавлением 10-кратного избытка ацетона с последующим
центрифугированием (14000 g), супернатант удаляли, осадок растворяли в 50 мкл C2H5OH,
повторно осаждали 3-кратным избытком ацетона, процедуру повторяли до исчезновения
флуоресценции раствора. Флуоресценцию раствора регистрировали с использованием
146
трансиллюминатора TCP-20.LC (Vilber Lourmat, Франция). Продукт сушили на воздухе, а затем
при 1-2 мм.рт.ст. над P2O5.
Синтез [2-[2-(4,4′-диметокситритилокси)этил]сульфонил]этанола (DMTr-SDE)
Получение проводили по аналогии с методами, предложенными в работе [409]. Раствор
сульфонилдиэтанола (65%-ный водный, 1.9 мл, 10 ммоль) три раза упаривали с абс. пиридином
для удаления следов влаги. Полученное масло растворяли в 15 мл абс. пиридина и к раствору в
течение 3 ч по каплям добавляли раствор диметокситритилхлорида (1.7 г, 5 ммоль) в 15 мл абс.
пиридина. Контроль степени превращения осуществляли методом ТСХ (система А).
Реакционную смесь упаривали досуха, растворяли в СН2Сl2, содержащем 0.2% ТEA и
экстрагировали два раза 5%-ным раствором NaHCO3 и один раз водой, органический слой
сушили безводным Na2SO4 и упаривали досуха. Продукт выделяли хроматографей на
силикагеле, используя линейный градиент концентрации C2H5OH (0-10%) в СН2Сl2,
содержащем 0.2% ТEA, и собирая продукт, обладающий меньшим Rf. Хроматографически
гомогенный продукт упаривали досуха. Rf = 0.2 (в системе А), выход 50%.
Синтез
Н-фосфоната
[2-[2-(4,4′-диметокситритилокси)этил]сульфонил]-этанола
(DMTr-SDE-pH)
H-Фосфонат синтезировали по аналогии с [410]. Навеску имидазола (1.73 г, 25.4 ммоль)
растворяли в 100 мл абс. CH3CN (колбу предварительно заполняли аргоном). Раствор
охлаждали во льду до 0 °C и при охлаждении и перемешивании добавляли PCl3 (0.69 мл, 7.9
ммоль) и TEA (3.65 мл, 26.3 ммоль), продолжая перемешивание в течение 25 мин. К
полученной суспензии триимидазолида фосфора в течение 1 ч по каплям добавляли раствор [2[2-(4,4′-диметокситритилокси)этил]сульфонил]этанола (0.8 г, 1.75 ммоль) в 50 мл абс. CH3CN.
Реакцию вели при перемешивании в течение 2 ч при комнатной температуре. Контроль степени
превращения осуществляли методом ТСХ (система Б). После окончания реакции реакционную
смесь разлагали добавлением 15 мл H2O, упаривали досуха, растворяли в СН2Сl2, содержащем
0.2% ТEA и экстрагировали один раз насыщенным раствором NaHCO3 и один раз водой,
органический слой сушили безводным Na2SO4 и упаривали до масла. Продукт выделяли
хроматографией на силикагеле, используя линейный градиент концентрации C2H5OH (0-40%) в
СН2Сl2,
содержащем
0.2%
ТEA,
и
собирая
продукт,
обладающий
меньшим
Rf.
Хроматографически гомогенный продукт упаривали с СН2Сl2, C2H5OH, CH3CN, СН2Сl2 до
твердой пенки. Rf = 0.1 (в системе Б); выход 66%.
147
Синтез О-(4,4′-диметокситритил) гексаэтиленгликоля (DMTr-HEG)
Получение проводили по аналогии с [411,412]. Гексаэтиленгликоль (0.95 мл, 3.75 ммоль)
два раза упаривали с абсолютным пиридином для удаления следов влаги. Полученное масло
растворяли в 15 мл абс. пиридина и к раствору в течение 1 ч по каплям добавляли раствор 4,4′О-диметокситритилхлорида (1 г, 3 ммоль) в 20 мл абс. пиридина. Реакцию вели при
перемешивании в течение 1 ч при комнатной температуре. Контроль степени превращения
осуществляли методом ТСХ (система Б). Реакционную смесь упаривали досуха, растворяли в
СН2Сl2, содержащем 0.2% ТEA и экстрагировали
5%-ным раствором NaСl и водой,
органический слой сушили безводным сульфатом натрия и упаривали досуха. Выделение
проводили хроматографией на силикагеле, используя линейный градиент концентрации
C2H5OH (0-10%) в СН2Сl2, содержащем 0.2% ТЕА и собирая продукт, обладающий меньшим Rf.
Хроматографически гомогенный продукт упаривали до образования густого масла. Rf = 0.4 (в
системе В), выход 50%.
Синтез H-фосфоната O-(4,4′-диметокситритил)гексаэтиленгликоля (DMTr-HEGpH)
H-Фосфонат получали по аналогии с [411,412]. Навеску имидазола (1.35 г, 19.9 ммоль)
растворяли в 25 мл абс. CH3CN (колбу предварительно заполняли аргоном). Раствор охлаждали
во льду до 0 °C и при охлаждении и перемешивании добавляли PCl3 (0.54 мл, 6.2 ммоль) и TEA
(2.8 мл, 20 ммоль), продолжая перемешивание в течение 15 мин. К полученной суспензии
триимидазолида
фосфора
в
течение
30
мин
по
каплям
добавляли
раствор
O-(4,4′-диметокситритил)гексаэтиленгликоля (0.8 г, 1.37 ммоль) в 20 мл абс. CH3CN. Реакцию
вели при перемешивании в течение 90 мин при комнатной температуре. Контроль степени
превращения осуществляли методом ТСХ (система Г). После окончания реакции реакционную
смесь разлагали добавлением 15 мл H2O, реакционную смесь упаривали досуха, растворяли в
СН2Сl2, содержащем 0.2% ТEA и экстрагировали два раза 5%-ным раствором NaCl и один раз
водой, органический слой сушили безводным Na2SO4 и упаривали до масла. Затем проводили
хроматографию на силикагеле, используя линейный градиент концентрации C2H5OH (0-30%) в
СН2Сl2,
содержащем
0.2%
ТEA,
и
собирая
продукт,
обладающий
меньшим
Rf.
Хроматографически гомогенный продукт упаривали до масла. Rf = 0.3 (в системе Г); выход
83%.
148
Получение
олигонуклеотидов,
содержащих
5′′-фосфат
5′′-
и
гексаэтиленгликольфосфат
Полимер-связанный олигонуклеотид пересыпали в пробирку типа Eppendorf объемом
600 мкл и проводили операции согласно протоколу (табл. 3.2). Для получения 5′гексаэтиленгликольфосфатсодержащих олигонуклеотидов синтетический цикл (операции 1-7)
повторяли дважды: в первом использовали H-фосфонат гексаэтиленгликоля DMTr-HEG-pH, во
втором – H-фосфонат сульфонилдиэтанола DMTr-SDE-pH.
Таблица 3.2. Протокол введения гексаэтиленгликольфосфата на 5′-конец олигонуклеотида,
присоединенного к полимерному носителю
Операция
Реагенты, растворитель, время
Синтетический цикл
1. Промывка
2×250 мкл CH3CNабс
2. Дозирование мономеров и
конденсирующего реагента
2×150 мкл 0.05 М раствора (5 мкмоль)
Н-фосфоната DMTr-SDE-pH или DMTrHEG-pH в CH3CN:Py (1:1) и 3 мкл (25 мкмоль)
PivCl
3. Конденсация
3 мин
4. Промывка
2×250 мкл CH3CNабс
5. Деблокирование
200 мкл 2% CHCl2COOH в СH2Cl2; 2 мин
5×100 мкл 2% CHCl2COOH в СH2Cl2
6. Промывка
2×250 мкл CH3CNабс
2×250 мкл ацетона
7. Сушка полимера
Окончание синтеза
1. Окисление
0.2 М I2 в Py:H2O (98:2); 30 мин
2. Промывка
5×300 мкл ацетона
Деблокирование защитных групп полимерсвязанных олигодезоксирибонуклеотидов и
отделение их от полимерного носителя проводили, обрабатывая полимерный носитель 1.5 мл
конц. NH3 (водн.) в течение 16 ч при 55 ºС. Раствор упаривали до половины объема на
вакуумном
испарителе
Speed-Vac
Concentrator,
полимер
промывали
смесью
C2H5OH:CH3CN:H2O (1:1:1 v/v/v), объединенные супернатанты упаривали досуха. Остаток
после упаривания растворяли в 100 мкл воды и переосаждали в виде натриевой соли.
149
Для деблокирования защитных групп полимерсвязанных олигорибонуклеотидов и
отделения их от полимерного носителя к полимеру добавляли 300 мкл 40%-ного CH3NH2
(водн.), перемешивали 15 мин при 65 °С. Раствор отделяли от полимерного носителя,
упаривали досуха на вакуумном испарителе Speed-Vac Concentrator. К сухому остатку
добавляли 200 мкл свежеприготовленной смеси NMP:TEA:TEA⋅⋅3HF (6:4:3 v/v/v) и
выдерживали при перемешивании в термомиксере при 65 ºС в течение 1.5 ч. Далее
реакционную смесь охлаждали до комнатной температуры, олигонуклеотид осаждали
добавлением 300 мкл этокситриметилсилана. Центрифугировали, удаляли супернатант,
промывали осадок эфиром и сушили на воздухе. Осадок растворяли в 100 мкл воды и
переосаждали в виде натриевой соли.
Синтез 5′-монопиренильных конъюгатов олигонуклеотидов
Для получения олигонуклеотидов в форме цетилтриметиламмониевой соли к примерно 5
ОЕ (около 1 мкмоль) олигонуклеотида, растворенного в 50 мкл воды, добавляли 8%-ный
водный раствор цетилтриметиламмонийбромида по 1-2 мкл до прекращения выпадения осадка.
Центрифугировали, супернатант удаляли, осадок сушили над P2O5 в течение 1-2 ч. Добавляли 5
мг (41 мкмоль) DMAP в 50 мкл абс. DMSO, 5.3 мг (25 мкмоль) PPh3 в 25 мкл абс. DMSO, 6.8 мг
(25 мкмоль) (PyS)2 в 25 мкл абс. DMSO и перемешивали 15 мин при 56 ºС. Активированный
олигонуклеотид осаждали 2%-ным NaClO4 в ацетоне, промывали осадок ацетоном. Растворяли
в 5 мкл H2O и добавляли раствор 2 мг (7.3 мкмоль) гидрохлорида 1-пиренилметиламина в смеси
20 мкл абс. DMSO и 5 мкл ТЕА. Реакцию проводили при перемешивании в течение 2 ч при 56
ºС. Реакционную смесь осаждали 2%-ным NaClO4 в ацетоне, промывали осадок ацетоном.
Сушили
на
воздухе.
5′-Монопиренильные
конъюгаты
олигонуклеотидов
выделяли
препаративным электрофорезом в 15%-ном денатурирующем ПААГ (см. табл. 2.4).
Исследование флуоресцентных свойств модифицированных SWCNT-PEG-FITC
Готовили растворы объемом 256 мкл с содержанием SWCNT от 0.5 до 128 мг/л в
какодилатном буфере (10 мМ какодилат натрия, 1 мМ Na2EDTA, 0.1 М NaCl, pH 5.5; 6.0; 6.5;
7.0) или в буфере Трис-HCl (10 мМ Трис, 1 мМ Na2EDTA, 0.1 М NaCl, pH 7.5; 8.0; 8.5; 8.9).
Растворы обрабатывали ультразвуком в течение 30 мин. Записывали спектры флуоресценции
растворов SWCNT при возбуждении светом с длиной волны 495 нм в диапазоне 508-550 нм
150
Насыщение поверхности модифицированных одностенных углеродных нанотрубок
пиренильным конъюгатом олигонуклеотида
К раствору модифицированных SWCNT (1 мкг, 500 мкл, 200 мг/л) добавляли раствор 5′пиренильного конъюгата олигонуклеотида до концентрации 5 мкМ и обрабатывали
ультразвуком в течение 30 мин, затем раствор замораживали, затем центрифугировали (14000
g) при комнатной температуре до обесцвечивания супернатанта, отбирали супернатант. Осадок
гибрида модифицированных SWCNT с олигонуклеотидом промывали аналогичным образом 3
раза по 500 мкл H2O. Полученный осадок гибрида использовали в дальнейших экспериментах.
Вытеснение пиренильных конъюгатов олигонуклеотидов с поверхности SWCNT
метиленовым синим
Немодифицированные SWCNT (1 мг) обрабатывали ультразвуком в 1 мл H2O в течение
30 мин. Отбирали объемы, содержащие ~1 мкг SWCNT (~ 1 мкл), добавляли 4 мкл раствора
пиренильного конъюгата олигонуклеотида Pyrd22 (3.3⋅10-10 моль, 8.2⋅10-5 М) и обрабатывали
ультразвуком в течение 30 мин до растворения SWCNT. Добавляли раствор метиленового
синего до концентрации 0; 0.005; 0.01; 0.05; 0.1; 0.5%. Раствор обрабатывали ультразвуком 30
мин, добавляли буфер для нанесения, затем наносили на 15%-ный денатурирующий ПААГ для
электрофоретического
анализа.
Электрофоретическое
разделение
и
визуализацию
окрашиванием геля красителем «Stains-All» проводили, как описано выше.
Вытеснение пиренильных конъюгатов олигонуклеотидов с поверхности SWCNT
пиренбутановой кислотой
К
раствору
3′-[32P]-меченого
олигонуклеотида
Pyrmdr1-S
(1
мкл,
110
мкМ
олигонуклеотида, ~ 100 имп) добавляли 10 мкл взвеси SWCNT-COOH (256 мг/л), обрабатывали
ультразвуком 30 мин. Полученный таким образом раствор гибрида добавляли в растворы
пиренбутановой кислоты с концентрацией 10 нМ – 10 мМ в буфере Трис-HCl (1 мМ Трис-HCl,
pH 7.5, 0.1 мМ Na2EDTA, 10 мМ NaCl) до концентрации 25 мг/л. Образцы обрабатывали
ультразвуком 30 мин, наносили на 12%-ный нативный ПААГ для электрофоретического
разделения с последующей радиоавтографией как описано выше.
Изучение стабильности олигонуклеотидов при их обработке ультразвуком в
присутствии SWCNT
К раствору 5′-[32P]-меченого олигонуклеотида d22 или d17 (5 мкл, ~100 мкМ
олигонуклеотида, ~ 400 имп) добавляли 5 мкл взвеси SWCNT (~ 2.5 мкг) в H2O, полученной
ультразвуковой обработкой 0.5 мг SWCNT в 1 мл в течение 30 мин. Полученную смесь, а также
151
контрольный образец, не содержащий SWCNT, обрабатывали ультразвуком в течение 90 мин. В
качестве контролей также использовали растворы олигонуклеотидов с добавлением и без
добавления SWCNT, не подвергавшиеся ультразвуковой обработке.
Отбирали по 5 мкл каждого раствора, приливали 50 мкл 10%-ного водного раствора
пиперидина. Реакционную смесь выдерживали в термостате при температуре 95 °C. Затем
осаждали олигонуклеотиды в виде литиевых солей, растворяли в 10 мкл H2O. Отбирали объемы
растворов олигонуклеотидов, как обработанных пиперидином, так и контрольных, содержащие
~20 имп радиоактивно меченого олигонуклеотида, добавляли буфер для нанесения и наносили
на 15%-ный денатурирующий ПААГ для электрофоретического разделения с последующей
радиоавтографией, как описано выше.
Изучение
стабильности
гетероциклических
оснований
олигонуклеотидов
в
условиях формирования гибридов с SWCNT
Для выявления возможных продуктов окисления в процессе ультразвуковой обработки в
присутствии SWCNT, олигонуклеотид d22 или d17 (~ 0.3 ОЕ260 в 9 мкл), после
соответствующей обработки, а также контрольные образцы, подвергали исчерпывающему
ферментативному гидролизу смесью ФДЭ и щелочной фосфатазы. Для этого к раствору
исследуемого олигонуклеотида добавляли 5 мкл буфера (0.1 М Трис-НCl, pH 7.8, 5 мМ MgCl2),
ФДЭ (0.01 ед.акт.) в 10 мкл буфера (0.02 М Трис-НCl, рН 7.8) в 50%-ном глицерине и
щелочную фосфатазу (0.34 ед.акт.) в 10 мкл Н2О. Смесь инкубировали 5 ч при 37ºС, после чего
инактивировали ферменты нагреванием реакционной смеси до 90°С и анализировали
нуклеозидный состав гидролизата методом офВЭЖХ. В качестве маркеров использовали
дезоксирибонуклеозиды.
Исследование стабильности олигонуклеотидов в культуральной среде, содержащей
10%-ную эмбриональную телячью сыворотку, в присутствии и в отсутствие SWCNT
К раствору 5′-[32P]-меченого олигонуклеотида d22 или d17 (~500 мкМ олигонуклеотида,
~ 200 имп) добавляли 1 мкл взвеси SWCNT (около 0.5 мкг), полученной ультразвуковой
обработкой 0.5 мг SWCNT в 1 мл H2O в течение 30 мин. Полученную смесь, а также
контрольный образец, не содержащий SWCNT, обрабатывали ультразвуком в течение 30 минут.
В качестве контролей также использовали растворы олигонуклеотида с добавлением и без
добавления SWCNT, не подвергавшиеся ультразвуковой обработке.
К растворам добавляли по 45 мкл культуральной среды IMDM, содержащей 10%-ную
эмбриональную телячью сыворотку, прогретую 1 ч при 56 °С. Инкубировали растворы при 37
°С. Отбирали аликвоты через 0, 5, 10, 15, 30 мин и 1, 2, 4, 6, 24 ч после добавления среды с
152
сывороткой, добавляли раствор stop-mix (8 М мочевина, 50 мМ Na2EDTA, 89 мМ Трис-борат,
pH 8.3, 0.1% SDS) и наносили на 15%-ный денатурирующий ПААГ для электрофоретического
разделения с последующей визуализацией, как описано выше.
Измерение электрокинетического потенциала модифицированных SWCNT и их
гибридов с олигонуклеотидами
Для исследования зависимости электрокинетического потенциала от рН раствора
готовили образцы объемом 600 мкл с содержанием SWCNT 64 мг/л в какодилатном буфере (1
мМ какодилат натрия, 0.1 мМ Na2EDTA, 0.01 М NaCl, pH 5.5; 6.0; 6.5; 7.0) или буфере Трис-HCl
(1мМ Трис-HCl, 0.1 мМ Na2EDTA, 0.01 М NaCl, pH 7.5; 8.0; 8.5; 8.9). Для исследования
зависимости электрокинетического потенциала от содержания SWCNT в растворе готовили
серии из 14 образцов по методике, представленной выше. Значения электрокинетического
потенциала получали путем регистрации обратного рассеяния света наночастицами при
приложении электрического поля. Каждое измерение включало 100 циклов, период релаксации
– 60 сек. Результаты представляли в виде среднего значения по результатам пяти повторений.
Построение изотерм адсорбции пиренильных конъюгатов олигонуклеотидов или
НК-комплексов на поверхности модифицированных одностенных углеродных нанотрубок
по данным флуоресцентной спектроскопии
Для построения изотерм адсорбции пиренильных конъюгатов олигонуклеотидов на
поверхности
модифицированных
одностенных
углеродных
нанотрубок
растворы
5′-
пиренильного конъюгата олигонуклеотида в концентрации 1 мкМ в буфере Трис-HCl (1 мМ
Трис-HCl, pH 7.5, 0.1 мМ Na2EDTA, 0.01 М NaCl) объемом 256 мкл, содержащие от 0.5 до 128
мкг модифицированных SWCNT, обрабатывали ультразвуком в течение 30 мин. Аналогично
готовили контрольный раствор пиренильного конъюгата олигонуклеотида без добавления
SWCNT.
Для построения изотерм адсорбции НК-дуплексов или трехкомпонентных НКкомплексов на поверхности модифицированных одностенных углеродных нанотрубок растворы
НК-комплекса (1 мкМ каждой цепи), полученного как описано выше, в буфере Трис-HCl (1 мМ
Трис-HCl, pH 7.5, 0.1 мМ Na2EDTA, 0.01 М NaCl) объемом 256 мкл, содержащие от 0.5 до 128
мкг модифицированных SWCNT, обрабатывали ультразвуком в течение 30 мин. Аналогично
готовили контрольный раствор НК-комплекса без добавления SWCNT.
Записывали
спектры
флуоресценции
растворов
нековалентных
гибридов
олигонуклеотидов или НК-комплексов с модифицированными SWCNT при возбуждении
светом с длиной волны 345 нм в диапазоне 360-450 нм. В случае использования
153
флуоресцентных SWCNT запись спектров флуоресценции проводили также при возбуждении
светом с длиной волны 499 нм в диапазоне 508-550 нм.
Из данных об изменении интенсивности флуоресценции пиренильных остатков в
зависимости от увеличения содержания SWCNT рассчитывали долю олигонуклеотида или НКкомплекса, адсорбированного на поверхности нанотрубок:
адс
где
адс
–
доля
пиренильного
= 1−
∙ 100%
конъюгата
адсорбированного на поверхности нанотрубок;
олигонуклеотида
или
НК-комплекса,
– интенсивность флуоресценции остатков
пирена в растворе нековалентного гибрида на длине волны 380 нм;
– интенсивность
флуоресценции контрольного раствора пиренильного конъюгата олигонуклеотида в отсутствие
SWСNT на длине волны 380 нм. Результаты представляли в виде среднего значения по
результатам трех повторений.
Построение изотерм адсорбции пиренильных конъюгатов олигонуклеотидов или
НК-комплексов на поверхности модифицированных одностенных углеродных нанотрубок
по данным электрофоретического анализа
Для построения изотерм адсорбции пиренильных конъюгатов олигонуклеотидов на
поверхности модифицированных одностенных углеродных нанотрубок растворы 3′-[32P]pCpмеченого 5′-пиренильного конъюгата олигонуклеотида в концентрации 1 мкМ (20 имп на
образец) в буфере Трис-HCl (1 мМ Трис-HCl, pH 7.5, 0.1 мМ Na2EDTA, 0.01 М NaCl) объемом
10 мкл, содержащие от 0.5 до 128 мкг модифицированных SWCNT, обрабатывали ультразвуком
в течение 30 мин. Аналогично готовили контрольный раствор пиренильного конъюгата
олигонуклеотида без добавления SWCNT.
Для построения изотерм адсорбции НК-дуплексов или трехкомпонентных НКкомплексов на поверхности модифицированных одностенных углеродных нанотрубок растворы
5′-[32P]-меченого
НК-комплекса
(1
мкМ
каждой
цепи,
активность
5′-[32P]-меченого
олигонуклеотида – 20 имп на образец), полученного как описано выше, в буфере Трис-HCl (1
мМ Трис-HCl, pH 7.5, 0.1 мМ Na2EDTA, 0.01 М NaCl) объемом 256 мкл, содержащие от 0.5 до
128 мкг модифицированных SWCNT, обрабатывали ультразвуком в течение 30 мин.
Аналогично готовили контрольный раствор НК-комплекса без добавления SWCNT.
Контроли и серию образцов анализировали в 12%-ном нативном ПААГ с последующей
радиавтографией. Для определения доли адсорбированного олигонуклеотида радиоавтограф
геля переводили в цифровую форму и анализировали в программном пакете QuantityOne
154
(BioRad, США). Из полученных данных рассчитывали рассчитывали долю олигонуклеотида
или НК-комплекса, адсорбированного на поверхности нанотрубок:
адс
где
адс
–
доля
пиренильного
=
Σ
∙ 100%
конъюгата
олигонуклеотида
адсорбированного на поверхности нанотрубок;
соответствующей гибриду;
Σ
или
НК-комплекса,
– интенсивность засветки полосы,
- общая интенсивность на дорожке. Результаты представляли в
виде среднего значения по результатам трех повторений.
Исследование зависимости эффективности формирования гибридов НК-дуплексов
с SWCNT-COOH от соотношения концентраций олигонуклеотидных компонентов
Гибрид SWCNT-COOH c НК-дуплексами Pyrmdr1-S/mdr1-As, PyrHEGd17/mdr1-LS
или PyrHEGd17/mdr1-LAs получали в буфере состава 50 мМ Tрис-HCl (pH 7.5), 200 мМ KCl,
10 мМ MgCl2 способом «mix-and-go», алгоритмическим и иерархическим способами, как
описано выше. Концентрацию 5′-пиренильного конъюгата Pyrmdr1-S или PyrHEGd17
варьировали от 0.25 мкМ до 1.25 мкМ, концентрация 5′-[32P]-меченого олигонуклеотида mdr1As, mdr1-LS или mdr1-LAs составляла 0.5 мкМ, его активность составляла 20 имп на образец.
Содержание SWCNT-COOH в растворе составляло 20 мг/л. Образцы обрабатывали
ультразвуком в течение 30 мин или инкубировали 5 мин при 95 °С и медленно охлаждали до
комнатной
температуры.
Аналогичным
образом
готовили
контрольные
образцы,
не
ПААГ
для
содержащие SWCNT.
Контроли
и
серии
образцов
наносили
на
12%-ный
нативный
электрофоретического анализа. Визуализацию радиоактивных полиакриламидных гелей
проводили, как описано выше. Для определения доли адсорбированного НК-комплекса
радиоавтограф геля переводили в цифровую форму и анализировали в программном пакете
QuantityOne (BioRad, США).
Исследование
зависимости
эффективности
формирования
гибридов
трехкомпонентных НК-комплексов с SWCNT-COOH от соотношения концентраций
олигонуклеотидных компонентов
Гибрид SWCNT-COOH c трехкомпонентными НК-комплексами PyrHEGd17/mdr1LS/mdr1-As или PyrHEGd17/mdr1-LAs/mdr1-S получали в буфере состава 50 мМ Tрис-HCl
(pH 7.5), 200 мМ KCl, 10 мМ MgCl2 способом «mix-and-go», алгоритмическим и иерархическим
способами, как описано выше. Концентрацию 5′-пиренильного конъюгата PyrHEGd17
варьировали от 0.5 мкМ до 1.5 мкМ, концентрация 5′-[32P]-меченого олигонуклеотида mdr1-LS
155
или mdr1-LAs составляла 0.5 мкМ, его активность составляла 20 имп на образец, концентрация
олигонуклеотида mdr1-As или mdr1-S также составляла 1 мкМ. Содержание SWCNT-COOH в
растворе составляло 20 мг/л. Образцы обрабатывали ультразвуком в течение 30 мин или
инкубировали 5 мин при 95 °С и медленно охлаждали до комнатной температуры.
Аналогичным образом готовили контрольные образцы, не содержащие SWCNT.
Контроли
и
серии
образцов
наносили
на
12%-ный
нативный
ПААГ
для
электрофоретического анализа. Визуализацию радиоактивных полиакриламидных гелей
проводили, как описано выше. Для определения доли адсорбированного НК-комплекса
радиоавтограф геля переводили в цифровую форму и анализировали в программном пакете
QuantityOne (BioRad, США).
Гидролиз РНК в составе химерного РНК/ДНК дуплекса под действием РНКазы Н в
присутствии и в отсутствие SWCNT
Готовили раствор (20 мкл) НК-дуплекса (PyrHEGd17/mdr1-LS или PyrHEGd17/mdr1LAs),
трехкомпонентного
PyrHEGd17/mdr1-Las/mdr1-S),
НК-комплекса
или
их
(PyrHEGd17/mdr1-LS/mdr1-As
гибридов
с
SWCNT-COOH
или
полученных
алгоритмическим способом, как описано выше, в буфере состава 20 мМ Трис-HCl (pH 7.8),
40 мМ KCl, 8 мМ MgCl2, 1 мМ DTT. Концентрация олигонуклеотидов составляла 1 мкМ
каждой цепи, суммарная активность 5′-[32P]-меченого олигорибонуклеотида mdr1-LS или
mdr1-LAs составляла 100 имп. Содержание SWCNT составляло 100 мкг/мл. Добавляли 2.5
ед.акт. РНКазы Н E. coli и инкубировали реакционную смесь при 37 ºС. Отбирали аликвоты (2
мкл) через 0, 5, 10, 15, 30, 45, 60, 90, 120, 180, 240 мин после добавления РНКазы Н, добавляли
раствор для ингибирования РНКазной активности (50 мМ Na2EDTA, 0.05% ксиленцианола FF и
0.05% бромфенолового синего в 8 М мочевине) и наносили на 15%-ный денатурирующий
ПААГ для электрофоретического анализа с последующей визуализацией, как описано выше.
Для определения процента расщепления радиоавтограф геля переводили в цифровую форму и
анализировали в программном пакете QuantityOne (BioRad, США).
Исследование цитотоксичности модифицированных одностенных нанотрубок и их
гибридов с олигонуклеотидами
Оценка цитотоксичности SWCNT и их гибридов с олигонуклеотидами была проведена
А. В. Филатовым (ЛБНК ИХБФМ СО РАН) с испльзованием MTT-теста [428]. Клетки линий
HeLa, KB-3-1, KB-8-5 рассевали в лунки 96-луночного планшета (3000 клеток на лунку) и
культивировали в 100 мкл среды DMEM с добавлением 10%-ной эмбриональной телячьей
сыворотки в течение суток при 37 °C в присутствии 5% CO2. Среду в лунках заменяли на 150
156
мкл DMEM без сыворотки, но содержащей модифицированные SWCNT или их гибриды с
олигонуклеотидами,
полученные
насыщением
поверхности
нанотрубок
пиренильным
конъюгатом олигонуклеотида, как описано выше, в концентрации 0.001 – 100 мг/л. Клетки
инкубировали с SWCNT в течение 4 ч, затем добавляли 150 мкл среды DMEM с добавлением
30%-ной эмбриональной телячьей сыворотки и инкубировали еще 20 ч. Добавляли MTT до
концентрации 0.5 мг/л и через 3 ч измеряли оптическое поглощение образцов на длине волны
570 нм с использованием сканера Multiscan RC (Labsystems, Финляндия). Все эксперименты
проводили в четырех повторениях. Результаты представляли в виде процентного содержания
живых клеток в сравнении с контролем.
Исследование взаимодействия модифицированных SWCNT и их гибридов с
олигонуклеотидами с клетками линии KB-8-5
Исследование взаимодействия SWCNT и их гибридов с олигонуклеотидами с клетками
линии KB-8-5 методом ПЭМ было проведено д.б.н., проф. Е. И. Рябчиковой (ГМИ ИХБФМ СО
РАН). Клетки культивировали в 6-луночных планшетах до получения монослоя, как описано
выше, затем среду в лунках заменяли на DMEM без сыворотки, но содержащую SWCNTCOOH, SWCNT-PEG-FITC или их гибриды с PyrHEGd17, полученные насыщением
поверхности нанотрубок пиренильным конъюгатом олигонуклеотида, как описано выше, в
концентрации 10 мг/л и инкубировали в течение 4 ч при 37 °C. Клеточный монослой
обрабатывали трипсином, образующуюся клеточную суспензию центрифугировали 5 мин при
5000 об/мин для создания плотного осадка. Осадок фиксировали 4%-ным параформальдегидом
и готовили для получения ультратонких срезов с использованием стандартных методик.
Ультратонкие срезы получали с использованием ультрамикротома EM UC7 (Leica, Германия),
окрашивали ацетатом уранила и цитратом свинца с использованием стандартных методик и
исследовали с использованием просвечивающего электронного микроскопа JEM-1400 (JEOL,
Япония), оснащенном цифровой камерой Veleta (SIS, Германия), при ускоряющем напряжении
80 кВ.
Получение
гибридных
электродов,
содержащих
многостенные
углеродные
нанотрубки
Массивы ориентированных MWCNT были получены в Лаборатории физико-химии
наноматериалов ИНХ СО РАН аэрозольным CVD методом на кремниевых подложках размером
5х5 мм посредством разложения 2%-ного раствора ферроцена в толуоле при температуре 800
°С по [438]. Для получения электрода одну из сторон кремниевой подложки и ее боковые
поверхности очищали от углеродного материала, к чистой кремниевой поверхности с
157
использованием проводящего серебряного клея прикрепляли проволоку-токосъемник из
нержавеющей стали.
Гибридные
электроды
получали
путем
нековалентной
иммобилизации
олигонуклеотидных зондов на поверхности вертикально ориентированных многостенных
MWCNT на поверхности электрода. Электрод помещали в 200 мкл 10 мкМ водного раствора
олигонуклеотида-зонда или его пиренильного конъюгата. Иммобилизацию олигонуклеотидных
зондов на поверхность MWCNT проводили при перемешивании (600 об/мин) при комнатной
температуре
в
течение
18
ч.
Долю
сорбированного
олигонуклеотида
определяли
спектрофотометрически по уменьшению оптической плотности раствора на длине волны 260
нм после иммобилизации олигонуклеотидного зонда. Гибридные электроды промывали водой и
сушили в вакууме над P2O5 в течение 2 ч.
Исследование электрохимческого отклика гибридных электродов
Вольтамперные характеристики измеряли на потенциостате Elins P-30S, управляемом
программным обеспечением PSPack2 (Elins, Россия), работающем в потенциодинамическом
режиме, при комнатной температуре. Для измерений была выбрана область потенциального
окна [0; 1] В. Потенциал измеряли относительно хлорсеребряного электрода сравнения.
Скорость развертки потенциала составляла 20 мВ/с. После 3-5 циклов в ячейку добавляли
раствор аналита до концентрации 10 мкМ. В качестве аналитов использовали растворы
олигорибонуклеотидов-мишеней в какодилатном буфере, контрольные измерения проводили в
какодилатном буфере, не содержащем олигонуклеотидов. Емкость электрода определяли как
отношение площади вольтамперной кривой к скорости развертки потенциала. Относительное
изменение емкости электрода рассчитывали по формуле Cэф = (C – C0)/C0, где C0 – ёмкость
электрода на первом цикле, C – текущая ёмкость.
158
Выводы
1. Получены и охарактеризованы химически модифицированные одностенные углеродные
нанотрубки, содержащие остатки флуоресцеина, введенные ковалентно на концы
нанотрубок
посредством
различных
аминолинкеров
(гексаметилендиамин,
полиамидоаминовый дендример, диамино-полиэтиленгликоль).
2. Разработан подход к получению мультифункциональных гибридов углеродных
нанотрубок с олигонуклеотидами, основанный на нековалентном взаимодействии 5′монопиренильных конъюгатов олигорибонуклеотидов и олигодезоксирибонуклеотидов с
химически
модифицированными
углеродными
нанотрубками.
Методом
электрофоретического светорассеяния продемонстрирована стабильность растворов
полученных гибридов.
3. Разработаны методы оценки эффективности формирования гибридов пиренильных
конъюгатов олигонуклеотидов с одностенными углеродными нанотрубками по данным
флуоресцентной спектроскопии и электрофоретического анализа. Показано, что
основной вклад в эффективность адсорбции пиренильных конъюгатов олигонуклеотидов
на поверхности одностенных углеродных нанотрубок вносит тип химической
модификации нанотрубок, а также длина олигонуклеотида.
4. Разработаны новые подходы к сборке гибридов siРНК и НК-комплексов, содержащих
siРНК, с модифицированными одностенными углеродными нанотрубками. Показано,
что оптимальным является алгоритмический вариант сборки гибрида, подразумевающий
взаимодействие
предформированного
НК-комплекса
с
модифицированными
углеродными нанотрубками.
5. Показана способность РНКазы H расщеплять РНК в составе химерного РНК/ДНКдуплекса, иммобилизованного на поверхности одностенных углеродных нанотрубок.
Продемонстрировано высвобождение siРНК из гибрида siРНК-содержащего НКкомплекса с модифицированными одностенными углеродными нанотрубками.
6. Продемонстрирована биосовместимость модифицированных одностенных углеродных
нанотрубок и их гибридов с пиренильными конъюгатами олигонуклеотидов на
культурах клеток HeLa, KB-3-1, KB-8-5. Методом ПЭМ показано, что конструкции на
основе модифицированных одностенных углеродных нанотрубок способны проникать
через клеточную мембрану путем эндоцитоза и накапливаться в эндосомах.
7. На модельной системе показано, что нековалентные гибриды олигорибонуклеотидов и
их 5′-монопиренильных конъюгатов с вертикально ориентированными многостенными
углеродными нанотрубками могут быть использованы как электроды для специфичного
159
распознавания комплементарного олигорибонуклеотида за счет изменения емкостных
характеристик электрода, при этом наличие пиренильного остатка в структуре зонда
позволяет улучшить аналитический сигнал.
160
Список литературы
1.
Bottini M., Rosato N., Bottini N. PEG-modified carbon nanotubes in biomedicine: current status
and challenges ahead // Biomacromolecules. - 2011. - V. 12. - N. 10. - P. 3381–3393.
2.
Wu H.-C., Chang X., Liu L., Zhao F., Zhao Y. Chemistry of carbon nanotubes in biomedical
applications // J. Mater. Chem. - 2010. - V. 20. - N. 6. - P. 1036–1052.
3.
Wei W., Sethuraman A., Jin C., Monteiro-Riviere N.A., Narayan R.J. Biological properties of
carbon nanotubes // J. Nanosci. Nanotechnol. - 2007. - V. 7. - N. 4-5. - P. 1284–1297.
4.
Kelkar S.S., Reineke T.M. Theranostics: combining imaging and therapy // Bioconjugate Chem.
- 2011. - V. 22. - N. 10. - P. 1879–1903.
5.
Yun Y., Dong Z., Shanov V., Heineman W.R., Halsall H.B., Bhattacharya A., Conforti L.,
Narayan R.K., Ball W.S., Schulz M.J. Nanotube electrodes and biosensors // Nano Today. 2007. - V. 2. - N. 6. - P. 30–37.
6.
Wang J. Carbon-nanotube based electrochemical biosensors: a review // Electroanalysis. - 2005.
- V. 17. - N. 1. - P. 7–14.
7.
Kirkpatrick D.L., Weiss M., Naumov A., Bartholomeusz G., Weisman R.B., Gliko O. Carbon
nanotubes: solution for the therapeutic delivery of siRNA? // Materials. - 2012. - V. 5. - N. 2. P. 278–301.
8.
Tasis D., Tagmatarchis N., Bianco A., Prato M. Chemistry of carbon nanotubes // Chem. Rev. 2006. - V. 106. - N. 3. - P. 1105–1136.
9.
Karousis N., Tagmatarchis N., Tasis D. Current progress on the chemical modification of
carbon nanotubes // Chem. Rev. - 2010. - V. 110. - N. 9. - P. 5366–5397.
10.
Eder D. Carbon nanotube-inorganic hybrids // Chem. Rev. - 2010. - V. 110. - N. 3. - P. 1348–
1385.
11.
Raffa V., Ciofani G., Vittorio O., Riggio C., Cuschieri A. Physicochemical properties affecting
cellular uptake of carbon nanotubes // Nanomedicine. - 2009. - V. 5. - N. 1. - P. 89–97.
12.
Jacobs C.B., Peairs M.J., Venton B.J. Review: Carbon nanotube based electrochemical sensors
for biomolecules // Anal. Chim. Acta. - 2010. - V. 662. - N. 2. - P. 105–127.
13.
Bonanni A., del Valle M. Use of nanomaterials for impedimetric DNA sensors: a review //
Anal. Chim. Acta. - 2010. - V. 678. - N. 1. - P. 7–17.
14.
Li J., Ng H.T., Chen H. Carbon nanotubes and nanowires for biological sensing. // Methods
Mol. Biol. / ed. Vo-Dinh T. Totowa, NJ: Humana Press. - 2005. - V. 300. - P. 191–223.
15.
Klumpp C., Kostarelos K., Prato M., Bianco A. Functionalized carbon nanotubes as emerging
nanovectors for the delivery of therapeutics // Biochim. Biophys. Acta. - 2006. - V. 1758. - N. 3.
- P. 404–412.
161
16.
Prato M., Kostarelos K., Bianco A. Functionalized carbon nanotubes in drug design and
discovery // Acc. Chem. Res. - 2008. - V. 41. - N. 1. - P. 60–68.
17.
Lemek T., Mazurkiewicz J., Stobinski L., Lin H.M., Tomasik P. Non-covalent functionalization
of multi-walled carbon nanotubes with organic aromatic compounds // J. Nanosci. Nanotechnol.
- 2007. - V. 7. - N. 9. - P. 3081–3088.
18.
Yang K., Wu W., Jing Q., Zhu L. Aqueous adsorption of aniline, phenol, and their substitutes
by multi-walled carbon nanotubes. // Environ. Sci. Technol. - 2008. - V. 42. - N. 21. - P. 7931–
7936.
19.
Chen W., Duan L., Zhu D. Adsorption of polar and nonpolar organic chemicals to carbon
nanotubes. // Environ. Sci. Technol. - 2007. - V. 41. - N. 24. - P. 8295–8300.
20.
Gotovac S., Honda H., Hattori Y., Takahashi K., Kanoh H., Kaneko K. Effect of nanoscale
curvature of single-walled carbon nanotubes on adsorption of polycyclic aromatic
hydrocarbons. // Nano Lett. - 2007. - V. 7. - N. 3. - P. 583–587.
21.
Kuo C.-Y., Wu C.-H., Wu J.-Y. Adsorption of direct dyes from aqueous solutions by carbon
nanotubes: determination of equilibrium, kinetics and thermodynamics parameters. // Coll. Surf.
Sci. - 2008. - V. 327. - N. 2. - P. 308–315.
22.
Pan B., Xing B. Adsorption mechanisms of organic chemicals on carbon nanotubes // Environ.
Sci. Technol. - 2008. - V. 42. - N. 24. - P. 9005–9013.
23.
Iijima S. Helical microtubules of graphitic carbon // Nature. - 1991. - V. 354. - N. 6348. - P. 56–
58.
24.
Pillai S.K., Ray S.S., Moodley M. Purification of single-walled carbon nanotubes // J. Nanosci.
Nanotechnol. - 2007. - V. 7. - N. 9. - P. 3011–3047.
25.
Wang W., Fernando K.A., Lin Y., Meziani M.J., Veca L.M., Cao L., Zhang P., Kimani M.M.,
Sun Y.P. Metallic single-walled carbon nanotubes for conductive nanocomposites // J. Am.
Chem. Soc. - 2008. - V. 130. - N. 4. - P. 1415–1419.
26.
Tu X., Zheng M. A DNA-based approach to the carbon nanotube sorting problem // Nano Res. 2008. - V. 1. - N. 3. - P. 185–194.
27.
Liao H., Paratala B., Sitharaman B., Wang Y. Applications of carbon nanotubes in biomedical
studies. // Methods Mol. Biol. - 2011. - V. 726. - P. 223–241.
28.
Kuznetsova A., Popova I., Yates Jr. J.T., Bronikowski M.J., Huffman C.B., Liu J., Smalley
R.E., Hwu H.H., Chen J.G. Oxygen-containing functional groups on single-wall carbon
nanotubes: NEXAFS and vibrational spectroscopic studies // J. Am. Chem. Soc. - 2001. - V.
123. - N. 43. - P. 10699–10704.
162
29.
Zhang J., Zou H., Qing Q., Yang Y., Li Q., Liu Z., Guo X., Du Z. Effect of chemical oxidation
on the structure of single-walled carbon nanotubes // J. Phys. Chem. B. - 2003. - V. 107. - N. 16.
- P. 3712–3718.
30.
Lakshminarayanan P. V, Toghiani H., Pittman C. U. J. Nitric acid oxidation of vapor grown
carbon nanofibers // Carbon. - 2004. - V. 42. - N. 12-13. - P. 2433–2442.
31.
Yang X.Y., Liu Z.F., Mao J., Wang S.J., Ma Y.F., Chen Y.S. The preparation of functionalized
single walled carbon nanotubes as high efficiency DNA carriers // Chin. Chem. Lett. - 2007. V. 18. - N. 12. - P. 1551–1553.
32.
Zhang Z., Yang X., Zhang Y., Zeng B., Wang S., Zhu T., Roden R.B., Chen Y., Yang R.
Delivery of telomerase reverse transcriptase small interfering RNA in complex with positively
charged single-walled carbon nanotubes suppresses tumor growth // Clin. Cancer Res. - 2006. V. 12. - N. 16. - P. 4933–4939.
33.
Krajcik R., Jung A., Hirsch A., Neuhuber W., Zolk O. Functionalization of carbon nanotubes
enables non-covalent binding and intracellular delivery of small interfering RNA for efficient
knock-down of genes // Biochem. Biophys. Res. Commun. - 2008. - V. 369. - N. 2. - P. 595–
602.
34.
Pan B.F., Cui D.X., Xu P., Huang T., Li Q., He R., Gao F. Cellular uptake enhancement of
polyamidoamine dendrimer modified single walled carbon nanotubes // J. Biomed. Pharm. Eng.
- 2007. - V. 1. - N. 1. - P. 13–16.
35.
Pan B., Cui D., Xu P., Chen H., Liu F., Li Q., Huang T., You X., Shao J., Bao C., Gao F., He
R., Shu M., Ma Y. Design of dendrimer modified carbon nanotubes for gene delivery // Chin. J.
Cancer Res. - 2007. - V. 19. - N. 1. - P. 1–6.
36.
Gu L., Elkin T., Jiang X., Li H., Lin Y., Qu L., Tzeng T.R., Joseph R., Sun Y.P. Single-walled
carbon nanotubes displaying multivalent ligands for capturing pathogens // Chem. Commun. 2005. - N. 7. - P. 874–876.
37.
Gu L., Luo P.G., Wang H., Meziani M.J., Lin Y., Veca L.M., Cao L., Lu F., Wang X., Quinn
R.A., Wang W., Zhang P., Lacher S., Sun Y.P. Single-walled carbon nanotube as a unique
scaffold for the multivalent display of sugars // Biomacromolecules. - 2008. - V. 9. - N. 9. - P.
2408–2418.
38.
Gromov A., Dittmer S., Svensson J., Nerushev O., Perez-García S.A., Licea-Jiménez L.,
Rychwalski R., Campbell E.E.B. Covalent amino-functionalisation of single-wall carbon
nanotubes // J. Mater. Chem. - 2005. - V. 15. - N. 15. - P. 3334–3339.
39.
Mateo-Alonso A., Bonifazi D., Prato M. Functionalization and applications of [60]fullerene //
Carbon Nanotechnology / ed. Dai L. Elsevier B.V. - 2006. - P. 155–189.
163
40.
Bianco A., Kostarelos K., Prato M. Applications of carbon nanotubes in drug delivery // Curr.
Opin. Chem. Biol. - 2005. - V. 9. - N. 6. - P. 674–679.
41.
Georgakilas V., Kordatos K., Prato M., Guldi D.M., Holzinger M., Hirsch A. Organic
functionalization of carbon nanotubes // J. Am. Chem. Soc. - 2002. - V. 124. - N. 5. - P. 760–
761.
42.
Georgakilas V., Tagmatarchis N., Pantarotto D., Bianco A., Briand J.P., Prato M. Amino acid
functionalisation of water soluble carbon nanotubes // Chem. Commun. - 2002. - N. 24. - P.
3050–3051.
43.
Kumar I., Rana S., Rode C. V, Cho J.W. Functionalization of single-walled carbon nanotubes
with azides derived from amino acids using click chemistry // J. Nanosci. Nanotechnol. - 2008. V. 8. - N. 7. - P. 3351–3356.
44.
Campidelli S., Ballesteros B., Filoramo A., Diaz D.D., de la Torre G., Torres T., Rahman G.M.,
Ehli C., Kiessling D., Werner F., Sgobba V., Guldi D.M., Cioffi C., Prato M., Bourgoin J.P.
Facile decoration of functionalized single-wall carbon nanotubes with phthalocyanines via
“click chemistry” // J. Am. Chem. Soc. - 2008. - V. 130. - N. 34. - P. 11503–11509.
45.
Hirsch A. Functionalization of Single-Walled Carbon Nanotubes // Angew. Chem. Int. Ed. 2002. - V. 41. - N. 11. - P. 1853–1859.
46.
Star A., Stoddart J.F., Steuerman D., Diehl M., Boukai A., Wong E.W., Yang X., Chung S.W.,
Choi H., Heath J.R. Preparation and Properties of Polymer-Wrapped Single-Walled Carbon
Nanotubes // Angew. Chem. Int. Ed. - 2001. - V. 40. - N. 9. - P. 1721–1725.
47.
Kam N.W., O’Connell M., Wisdom J.A., Dai H. Carbon nanotubes as multifunctional biological
transporters and near-infrared agents for selective cancer cell destruction // Proc. Natl. Acad.
Sci. U. S. A. - 2005. - V. 102. - N. 33. - P. 11600–11605.
48.
Liu Z., Li X., Tabakman S.M., Jiang K., Fan S., Dai H. Multiplexed multicolor Raman imaging
of live cells with isotopically modified single walled carbon nanotubes // J. Am. Chem. Soc. 2008. - V. 130. - N. 41. - P. 13540–13541.
49.
Cherukuri P., Gannon C.J., Leeuw T.K., Schmidt H.K., Smalley R.E., Curley S.A., Weisman
R.B. Mammalian pharmacokinetics of carbon nanotubes using intrinsic near-infrared
fluorescence // Proc. Natl. Acad. Sci. U. S. A. - 2006. - V. 103. - N. 50. - P. 18882–18886.
50.
Liu Z., Davis C., Cai W., He L., Chen X., Dai H. Circulation and long-term fate of
functionalized, biocompatible single-walled carbon nanotubes in mice probed by Raman
spectroscopy // Proc. Natl. Acad. Sci. U. S. A. - 2008. - V. 105. - N. 5. - P. 1410–1415.
51.
Liu Z., Chen K., Davis C., Sherlock S., Cao Q., Chen X., Dai H. Drug delivery with carbon
nanotubes for in vivo cancer treatment // Cancer Res. - 2008. - V. 68. - N. 16. - P. 6652–6660.
164
52.
Fernando K.A., Lin Y., Wang W., Kumar S., Zhou B., Xie S.Y., Cureton L.T., Sun Y.P.
Diminished band-gap transitions of single-walled carbon nanotubes in complexation with
aromatic molecules // J. Am. Chem. Soc. - 2004. - V. 126. - N. 33. - P. 10234–10235.
53.
Nakashima N., Tomonari Y., Murakami H. Water-Soluble Single-Walled Carbon Nanotubes via
Noncovalent Sidewall-Functionalization with a Pyrene-Carrying Ammonium Ion // Chem. Lett.
- 2002. - V. 31. - N. 6. - P. 638–639.
54.
Tomonari Y., Murakami H., Nakashima N. Solubilization of single-walled carbon nanotubes by
using polycyclic aromatic ammonium amphiphiles in water--strategy for the design of highperformance solubilizers // Chem. Eur. J. - 2006. - V. 12. - N. 15. - P. 4027–4034.
55.
Satishkumar B.C., Brown L.O., Gao Y., Wang C.C., Wang H.L., Doorn S.K. Reversible
fluorescence quenching in carbon nanotubes for biomolecular sensing // Nat. Nanotechnol. 2007. - V. 2. - N. 9. - P. 560–564.
56.
Cordella F., De Nardi M., Menna E., Hébert C., Loi M.A. Tuning the photophysical properties
of soluble single-wall carbon nanotube derivatives by co-functionalization with organic
molecules // Carbon. - 2009. - V. 47. - N. 5. - P. 1264–1269.
57.
Kavakka J.S., Heikkinen S., Kilpelainen I., Mattila M., Lipsanen H., Helaja J. Noncovalent
attachment of pyro-pheophorbide a to a carbon nanotube // Chem. Commun. - 2007. - N. 5. - P.
519–521.
58.
Zhao Y.L., Hu L., Gruner G., Stoddart J.F. A tunable photosensor // J. Am. Chem. Soc. - 2008. V. 130. - N. 50. - P. 16996–17003.
59.
Bahun G.J., Wang C., Adronov A. Solubilizing single-walled carbon nanotubes with pyrenefunctionalized block copolymers // J. Pol. Sci. A. - 2006. - V. 44. - N. 6. - P. 1941–1951.
60.
Petrov P., Stassin F., Pagnoulle C., Jerome R. Noncovalent functionalization of multi-walled
carbon nanotubes by pyrene containing polymers // Chem. Commun. - 2003. - N. 23. - P. 2904–
2905.
61.
Lou X., Daussin R., Cuenot S., Duwez A.S., Pagnoulle C., Detrembleur C., Bailly C., Jerome R.
Synthesis of pyrene-containing polymers and noncovalent sidewall functionalization of
multiwalled carbon nanotubes // Chem. Mater. - 2004. - V. 16. - N. 21. - P. 4005–4011.
62.
Chen G., Wright P.M., Geng J., Mantovani G., Haddleton D.M. Tunable thermoresponsive
water-dispersed multiwalled carbon nanotubes // Chem. Commun. - 2008. - N. 9. - P. 1097–
1099.
63.
Chen R.J., Zhang Y., Wang D., Dai H. Noncovalent sidewall functionalization of single-walled
carbon nanotubes for protein immobilization // J. Am. Chem. Soc. - 2001. - V. 123. - N. 16. - P.
3838–3839.
165
64.
Holder P.G., Francis M.B. Integration of a self-assembling protein scaffold with water-soluble
single-walled carbon nanotubes // Angew. Chem. Int. Ed. - 2007. - V. 46. - N. 23. - P. 4370–
4373.
65.
Cai H., Cao X., Jiang Y., He P., Fang Y. Carbon nanotube-enhanced electrochemical DNA
biosensor for DNA hybridization detection // Anal. Bioanal. Chem. - 2003. - V. 375. - N. 2. - P.
287–293.
66.
Yang X., Lu Y., Ma Y., Liu Z., Du F., Chen Y. DNA electrochemical sensor based on an adduct
of single-walled carbon nanotubes and ferrocene // Biotechnol. Lett. - 2007. - V. 29. - N. 11. - P.
1775–1779.
67.
Düzgün A., Maroto A., Mairal T., O’Sullivan C., Rius F.X. Solid-contact potentiometric
aptasensor based on aptamer functionalized carbon nanotubes for the direct determination of
proteins // Analyst. - 2010. - V. 135. - N. 5. - P. 1037–1041.
68.
Zhang Q.D., Piro B.B., Noel V., Reisberg S., Pham M.-C., Noël V. Functionalization of singlewalled carbon nanotubes for direct and selective electrochemical detection of DNA // Analyst. 2011. - V. 136. - N. 5. - P. 1023–1028.
69.
Zhao C., Qu K., Xu C., Ren J., Qu X. Triplex inducer-directed self-assembly of single-walled
carbon nanotubes: a triplex DNA-based approach for controlled manipulation of nanostructures
// Nucleic Acids Res. - 2011. - V. 39. - N. 9. - P. 3939–3948.
70.
He P., Dai L. Aligned carbon nanotube-DNA electrochemical sensors // Chem. Commun. 2004. - N. 3. - P. 348–349.
71.
Wang S.G., Wang R., Sellin P.J., Zhang Q. DNA biosensors based on self-assembled carbon
nanotubes // Biochem. Biophys. Res. Commun. - 2004. - V. 325. - N. 4. - P. 1433–1437.
72.
Berti F., Eisenkolbl C., Minocci D., Nieri P., Rossi A.M., Mascini M., Marrazza G.
Cannabinoid receptor gene detection by electrochemical genosensor // J. Electroanal. Chem. 2011. - V. 656. - N. 1-2. - P. 55–60.
73.
Dinh P., Hieu N. Van, Duc N., Le A., Anh M., Tam P.D., Van Hieu N., Chien N.D., Anh Tuan
M. DNA sensor development based on multi-wall carbon nanotubes for label-free influenza
virus (type A) detection // J. Immunol. Methods. - 2009. - V. 350. - N. 1-2. - P. 118–124.
74.
Guo M., Chen J., Liu D., Nie L., Yao S. Electrochemical characteristics of the immobilization
of calf thymus DNA molecules on multi-walled carbon nanotubes // Bioelectrochemistry. 2004. - V. 62. - N. 1. - P. 29–35.
75.
Williams K.A.K., Veenhuizen P.T.M.P., de la Torre B.G., Eritja R., Dekker C. Nanotechnology:
Carbon nanotubes with DNA recognition // Nature. - 2002. - V. 420. - N. 6917. - P. 761.
166
76.
Baker S.E., Cai W., Lasseter T.L., Weidkamp K.P., Hamers R.J. Covalently bonded adducts of
deoxyribonucleic acid (DNA) oligonucleotides with single-wall carbon nanotubes: synthesis
and hybridization // Nano Lett. - 2002. - V. 2. - N. 12. - P. 1413–1417.
77.
Moghaddam M.J., Taylor S., Gao M., Huang S., Dai L., McCall M.J. Highly efficient binding of
DNA on the sidewalls and tips of carbon nanotubes using photochemistry // Nano Lett. - 2004. V. 4. - N. 1. - P. 89–93.
78.
Moghaddam M.J., Yang W., Bojarski B., Gengenbach T.R., Gao M., Zareie H., McCall M.J.
Azide photochemistry for facile modification of graphitic surfaces: preparation of DNA-coated
carbon nanotubes for biosensing. // Nanotechnology. - 2012. - V. 23. - N. 42. - P. 425503.
79.
Zheng M., Jagota A., Semke E.D., Diner B.A., McLean R.S., Lustig S.R., Richardson R.E.,
Tassi N.G. DNA-assisted dispersion and separation of carbon nanotubes. // Nat. Mater. - 2003. V. 2. - N. 5. - P. 338–342.
80.
Zheng M., Jagota A., Strano M.S., Santos A.P., Barone P., Chou S.G., Diner B.A., Dresselhaus
M.S., McLean R.S., Onoa G.B., Samsonidze G.G., Semke E.D., Usrey M., Walls D.J. Structurebased carbon nanotube sorting by sequence-dependent DNA assembly // Science. - 2003. - V.
302. - N. 5650. - P. 1545–1548.
81.
Chen R.J., Zhang Y. Controlled precipitation of solubilized carbon nanotubes by delamination
of DNA // J. Phys. Chem. B. - 2006. - V. 110. - N. 1. - P. 54–57.
82.
Haggenmueller R., Rahatekar S.S., Fagan J.A., Chun J., Becker M.L., Naik R.R., Krauss T.,
Carlson L., Kadla J.F., Trulove P.C., Fox D.F., Delong H.C., Fang Z., Kelley S.O., Gilman J.W.
Comparison of the quality of aqueous dispersions of single wall carbon nanotubes using
surfactants and biomolecules // Langmuir. - 2008. - V. 24. - N. 9. - P. 5070–5078.
83.
Liang Z., Lao R., Wang J., Liu Y., Wang L., Huang Q., Song S., Li G., Fan C. Solubilization of
single-walled carbon nanotubes with single- stranded DNA generated from asymmetric PCR //
Int. J. Mol. Sci. - 2007. - V. 8. - N. 7. - P. 705–713.
84.
Vogel S.R., Muller K., Plutowski U., Kappes M.M., Richert C. DNA-carbon nanotube
interactions and nanostructuring based on DNA // Phys. Status Solidi B. - 2007. - V. 244. - N.
11. - P. 4026–4029.
85.
Johnson R.R., Johnson A.T., Klein M.L. Probing the structure of DNA-carbon nanotube hybrids
with molecular dynamics // Nano Lett. - 2008. - V. 8. - N. 1. - P. 69–75.
86.
Johnson R.R., Kohlmeyer A., Johnson a T.C., Klein M.L. Free energy landscape of a DNAcarbon nanotube hybrid using replica exchange molecular dynamics. // Nano Lett. - 2009. - V.
9. - N. 2. - P. 537–541.
167
87.
Stepanian S.G., Karachevtsev M. V, Glamazda A.Y., Karachevtsev V.A., Adamowicz L.
Raman spectroscopy study and first-principles calculations of the interaction between nucleic
acid bases and carbon nanotubes // J. Phys. Chem. A. - 2009. - V. 113. - N. 15. - P. 3621–3629.
88.
Johnson R.R., Johnson A.T.C., Klein M.L. The nature of DNA-base–carbon-nanotube
interactions // Small. - 2010. - V. 6. - N. 1. - P. 31–34.
89.
Karachevtsev M. V, Karachevtsev V. a. Peculiarities of homooligonucleotides wrapping around
carbon nanotubes: molecular dynamics modeling. // J. Phys. Chem. B. - 2011. - V. 115. - N. 29.
- P. 9271–9279.
90.
Karachevtsev M. V, Gladchenko G.O., Plokhotnichenko A.M., Leontiev V.S., Karachevtsev V.
a. Adsorption of biopolymers on SWCNT: ordered poly(rC) and disordered poly(rI). // J. Phys.
Chem. B. - 2013. - V. 117. - N. 9. - P. 2636–2644.
91.
Karachevtsev M. V, Gladchenko G.O., Karachevtsev V.A. Comparison of poly(rI) and poly(rA)
adsorption on carbon Nanotubes // Nanomaterials imaging techniques, surface studies, and
applications / ed. Fesenko O., Yatsenko L., Brodin M. Springer New York. - 2013. - V. 146. - P.
275–290.
92.
Albertorio F., Hughes M.E., Golovchenko J.A., Branton D. Base dependent DNA-carbon
nanotube
interactions:
activation
enthalpies
and
assembly-disassembly
control
//
Nanotechnology. - 2009. - V. 20. - N. 39. - P. 395101.
93.
Hain T.C., Kröker K., Stich D.G., Hertel T. Influence of DNA conformation on the dispersion
of SWNTs: single-strand DNA vs. hairpin DNA // Soft Matter. - 2012. - V. 8. - N. 10. - P.
2820–2823.
94.
Muller K., Malik S., Richert C., Müller K. Sequence-specifically addressable hairpin
DNA−single-walled carbon nanotube complexes for nanoconstruction // ACS Nano. - 2010. - V.
4. - N. 2. - P. 649–656.
95.
Guéron M., Leroy J.-L. The i-motif in nucleic acids // Curr. Opin. Struct. Biol. - 2000. - V. 10. N. 3. - P. 326–331.
96.
Zhao C., Ren J., Qu X. Single-walled carbon nanotubes binding to human telomeric i-motif
DNA under molecular-crowding conditions: more water molecules released. // Chem. Eur. J. 2008. - V. 14. - N. 18. - P. 5435–5439.
97.
Li X., Peng Y., Ren J., Qu X. Carboxyl-modified single-walled carbon nanotubes selectively
induce human telomeric i-motif formation // Proc. Natl. Acad. Sci. U. S. A. - 2006. - V. 103. N. 52. - P. 19658–19663.
98.
Peng Y., Li X., Ren J., Qu X. Single-walled carbon nanotubes binding to human telomeric imotif DNA: significant acceleration of S1 nuclease cleavage rate // Chem. Commun. - 2007. N. 48. - P. 5176–5178.
168
99.
Peng Y., Wang X., Xiao Y., Feng L., Zhao C., Ren J., Qu X. i-Motif quadruplex DNA-based
biosensor for distinguishing single- and multiwalled carbon nanotubes. // J. Am. Chem. Soc. 2009. - V. 131. - N. 38. - P. 13813–13818.
100. Zhao C., Peng Y., Song Y., Ren J., Qu X. Self-assembly of single-stranded RNA on carbon
nanotube: polyadenylic acid to form a duplex structure // Small. - 2008. - V. 4. - N. 5. - P. 656–
661.
101. Contreras-Torres F.F., Martínez-Lorán E. DNA insertion in and wrapping around carbon
nanotubes // Wiley Interdiscip. Rev. Comput. Mol. Sci. - 2011. - V. 1. - N. 6. - P. 902–919.
102. Roxbury D., Tu X., Zheng M., Jagota A. Recognition ability of DNA for carbon nanotubes
correlates with their binding affinity. // Langmuir. - 2011. - V. 27. - N. 13. - P. 8282–8293.
103. Neihsial S., Periyasamy G., Samanta P.K., Pati S.K. Understanding the binding mechanism of
various chiral SWCNTs and ssDNA: a computational study. // J. Phys. Chem. B. - 2012. - V.
116. - N. 51. - P. 14754–14759.
104. Kim S.S., Hisey C.L., Kuang Z., Comfort D. a, Farmer B.L., Naik R.R. The effect of single wall
carbon nanotube metallicity on genomic DNA-mediated chirality enrichment. // Nanoscale. 2013. - V. 5. - N. 11. - P. 4931–4936.
105. Liu R., Chen Z., Zhao F., Chang X., Zu Y., Gao X. Sorting the unique chirality, right handed
single wall carbon nanotubes via the dye modified ssDNA // J. Nanosci. Nanotechnol. - 2011. V. 11. - N. 9. - P. 7587–7592.
106. Tu X., Hight Walker A.R., Khripin C.Y., Zheng M. Evolution of DNA sequences toward
recognition of metallic armchair carbon nanotubes. // J. Am. Chem. Soc. - 2011. - V. 133. - N.
33. - P. 12998–13001.
107. Roxbury D., Mittal J., Jagota A. Molecular-basis of single-walled carbon nanotube recognition
by single-stranded DNA. // Nano Lett. - 2012. - V. 12. - N. 3. - P. 1464–1469.
108. Roxbury D., Jagota A., Mittal J. Structural characteristics of oligomeric DNA strands adsorbed
onto single-walled carbon nanotubes. // J. Phys. Chem. B. - 2013. - V. 117. - N. 1. - P. 132–140.
109. Roxbury D., Jagota A., Mittal J. Sequence-Specific Self-Stitching Motif of Short SingleStranded DNA on a Single-Walled Carbon Nanotube // J. Am. Chem. Soc. - 2011. - V. 133. - N.
34. - P. 13545–13550.
110. Asada Y., Sugai T., Kitaura R., Shinohara H. Chromatographic length separation and
photoluminescence study on DNA-wrapped single-wall and double-wall carbon nanotubes // J.
Nanomater. - 2009. - V. 2009. - P. 1–8.
111. Khripin C.Y., Arnold-Medabalimi N., Zheng M. Clustering of DNA-wrapped carbon nanotubes
for facile length fractionation // ACS Nano. - 2011. - V. 5. - N. 10. - P. 8258–8266.
169
112. Karachevtsev V.A., Gladchenko G.O., Karachevtsev M. V, Valeev V.A., Leontiev V.S., Lytvyn
O.S. Adsorption of poly(rA) on the carbon nanotube surface and its hybridization with poly(rU).
// Chemphyschem. - 2008. - V. 9. - N. 14. - P. 2010–2018.
113. Jeng E.S., Barone P.W., Nelson J.D., Strano M.S. Hybridization kinetics and thermodynamics
of DNA adsorbed to individually dispersed single-walled carbon nanotubes // Small. - 2007. V. 3. - N. 9. - P. 1602–1609.
114. Santosh M., Panigrahi S., Bhattacharyya D., Sood A.K., Maiti P.K. Unzipping and binding of
small interfering RNA with single walled carbon nanotube: A platform for small interfering
RNA delivery // J. Chem. Phys. - 2012. - V. 136. - N. 6. - P. 65106–65110.
115. Milowska K., Gabryelak T. Reactive oxygen species and DNA damage after ultrasound
exposure // Biomol. Eng. - 2007. - V. 24. - N. 2. - P. 263–267.
116. Гроховский С.Л. Специфичность расщепления ДНК ультразвуком // Молекулярн.
Биология. - 2006. - V. 40. - N. 2. - P. 317–325.
117. Petersen E.J., Tu X., Dizdaroglu M., Zheng M., Nelson B.C. Protective roles of single-wall
carbon nanotubes in ultrasonication-induced DNA base damage. // Small. - 2013. - V. 9. - N. 2.
- P. 205–208.
118. Tu X., Manohar S., Jagota A., Zheng M. DNA sequence motifs for structure-specific
recognition and separation of carbon nanotubes // Nature. - 2009. - V. 460. - N. 7252. - P. 250–
253.
119. Yamamoto Y., Fujigaya T., Niidome Y., Nakashima N. Fundamental properties of oligo doublestranded DNA/single-walled carbon nanotube nanobiohybrids. // Nanoscale. - 2010. - V. 2. - N.
9. - P. 1767–1772.
120. Ovadekova R., Jantova S., Letasiova S., Stepanek I., Labuda J. Nanostructured electrochemical
DNA biosensors for detection of the effect of berberine on DNA from cancer cells // Anal.
Bioanal. Chem. - 2006. - V. 386. - N. 7-8. - P. 2055–2062.
121. Viswanathan S., Radecka H., Radecki J. Electrochemical biosensor for pesticides based on
acetylcholinesterase immobilized on polyaniline deposited on vertically assembled carbon
nanotubes wrapped with ssDNA. // Biosens. Bioelectron. - 2009. - V. 24. - N. 9. - P. 2772–
2777.
122. Zeng G., Li Z., Tang L., Wu M., Lei X., Liu Y., Liu C., Pang Y., Zhang Y. Gold
nanoparticles/water-soluble carbon nanotubes/aromatic diamine polymer composite films for
highly sensitive detection of cellobiose dehydrogenase gene // Electrochim. Acta. - 2011. - V.
56. - N. 13. - P. 4775–4782.
170
123. Tian J., Zhao H., Liu M., Chen Y., Quan X. Detection of influenza A virus based on
fluorescence resonance energy transfer from quantum dots to carbon nanotubes. // Anal. Chim.
Acta. - 2012. - V. 723. - P. 83–87.
124. Wu Y., Phillips J.A., Liu H., Yang R., Tan W. Carbon nanotubes protect DNA strands during
cellular delivery // ACS Nano. - 2008. - V. 2. - N. 10. - P. 2023–2028.
125. Lee H., Mijovic J. Bio-nano complexes: DNA/surfactant/single-walled carbon nanotube
interactions in electric field // Polymer. - 2009. - V. 50. - N. 3. - P. 881–890.
126. Lu Q., Moore J.M., Huang G., Mount A.S., Rao A.M., Larcom L.L., Ke P.C. RNA polymer
translocation with single-walled carbon nanotubes // Nano Lett. - 2004. - V. 4. - N. 12. - P.
2473–2477.
127. Ikeda A., Hamano T., Hayashi K., Kikuchi J. Water-solubilization of nucleotides-coated singlewalled carbon nanotubes using a high-speed vibration milling technique // Org. Lett. - 2006. V. 8. - N. 6. - P. 1153–1156.
128. Nepal D., Sohn J.I., Aicher W.K., Lee S., Geckeler K.E. Supramolecular conjugates of carbon
nanotubes and DNA by a solid-state reaction // Biomacromolecules. - 2005. - V. 6. - N. 6. - P.
2919–2922.
129. Yang J., Yang T., Feng Y., Jiao K. A DNA electrochemical sensor based on nanogold-modified
poly-2,6-pyridinedicarboxylic acid film and detection of PAT gene fragment. // Anal. Biochem.
- 2007. - V. 365. - N. 1. - P. 24–30.
130. Wang X., Ren J., Qu X. Targeted RNA interference of cyclin A2 mediated by functionalized
single-walled carbon nanotubes induces proliferation arrest and apoptosis in chronic
myelogenous leukemia K562 cells // ChemMedChem. - 2008. - V. 3. - N. 6. - P. 940–945.
131. Kam N.W., Liu Z., Dai H. Functionalization of carbon nanotubes via cleavable disulfide bonds
for efficient intracellular delivery of siRNA and potent gene silencing // J. Am. Chem. Soc. 2005. - V. 127. - N. 36. - P. 12492–12493.
132. Delogu L.G., Magrini A., Bergamaschi A., Rosato N., Dawson M.I., Bottini N., Bottini M.
Conjugation of antisense oligonucleotides to PEGylated carbon nanotubes enables efficient
knockdown of PTPN22 in T lymphocytes // Bioconjugate Chem. - 2009. - V. 20. - N. 3. - P.
427–431.
133. Zhang T., Tang M., Kong L., Li H., Zhang T., Zhang S., Xue Y., Pu Y. Comparison of
cytotoxic and inflammatory responses of pristine and functionalized multi-walled carbon
nanotubes in RAW 264.7 mouse macrophages. // J. Hazard. Mater. - 2012. - V. 219-220. - P.
203–212.
171
134. Montes-Fonseca S.L., Orrantia-Borunda E., Duarte-Möller A., Luna-Velasco A., RománAguirre M., González Horta C., Sánchez-Ramírez B. Cytotoxicity of carbon nanotubes on J774
macrophages is a purification-dependent effect // J. Nanomater. - 2012. - V. 2012. - P. 1–7.
135. Prato M., Kostarelos K., Bianco A. Functionalized carbon nanotubes in drug design and
discovery // Acc. Chem. Res. - 2007. - V. 41. - N. 1. - P. 60–68.
136. Lacerda L., Bianco A., Prato M., K. K. Carbon nanotube cell translocation and delivery of
nucleic acids in vitro and in vivo // J. Mater. Chem. - 2008. - N. 18. - P. 17–22.
137. Menard-Moyon C., Kostarelos K., Prato M., Bianco A. Functionalized carbon nanotubes for
probing and modulating molecular functions // Chem. Biol. Cell Press. - 2010. - V. 17. - N. 2. P. 107–115.
138. Bianco A., Hoebeke J., Godefroy S., Chaloin O., Pantarotto D., Briand J.P., Muller S., Prato M.,
Partidos C.D. Cationic carbon nanotubes bind to CpG oligodeoxynucleotides and enhance their
immunostimulatory properties // J. Am. Chem. Soc. - 2005. - V. 127. - N. 1. - P. 58–59.
139. Partidos C.D., Hoebeke J., Wieckowski S., Chaloin O., Bianco A., Moreau E., Briand J.-P.,
Desgranges C., Muller S. Immunomodulatory consequences of ODN CpG-polycation
complexes // Methods. - 2009. - V. 49. - N. 4. - P. 328–333.
140. Podesta J.E., Al-Jamal K.T., Herrero M.A., Tian B., Ali-Boucetta H., Hegde V., Bianco A.,
Prato M., Kostarelos K. Antitumor activity and prolonged survival by carbon-nanotubemediated therapeutic siRNA silencing in a human lung xenograft model // Small. - 2009. - V. 5.
- N. 10. - P. 1176–1185.
141. Herrero M.A., Toma F.M., Al-Jamal K.T., Kostarelos K., Bianco A., Da Ros T., Bano F.,
Casalis L., Scoles G., Prato M. Synthesis and characterization of a carbon nanotube-dendron
series for efficient siRNA delivery // J. Am. Chem. Soc. - 2009. - V. 131. - N. 28. - P. 9843–
9848.
142. Pantarotto D., Singh R., McCarthy D., Erhardt M., Briand J.P., Prato M., Kostarelos K., Bianco
A. Functionalized carbon nanotubes for plasmid DNA gene delivery // Angew. Chem. Int. Ed. 2004. - V. 43. - N. 39. - P. 5242–5246.
143. Singh R., Pantarotto D., McCarthy D., Chaloin O., Hoebeke J., Partidos C.D., Briand J.P., Prato
M., Bianco A., Kostarelos K. Binding and condensation of plasmid DNA onto functionalized
carbon nanotubes: toward the construction of nanotube-based gene delivery vectors // J. Am.
Chem. Soc. - 2005. - V. 127. - N. 12. - P. 4388–4396.
144. Klumpp C., Lacerda L., Chaloin O., Da Ros T., Kostarelos K., Prato M., Bianco A.
Multifunctionalised cationic fullerene adducts for gene transfer: design, synthesis and DNA
complexation // Chem. Commun. - 2007. - N. 36. - P. 3762–3764.
172
145. Varkouhi A.K., Foillard S., Lammers T., Schiffelers R.M., Doris E., Hennink W.E., Storm G.
SiRNA delivery with functionalized carbon nanotubes // Int. J. Pharm. - 2011. - V. 416. - N. 2. P. 419–425.
146. Cha T.-G., Baker B.A., Sauffer M.D., Salgado J., Jaroch D., Rickus J.L., Porterfield D.M., Choi
J.H. Optical nanosensor architecture for cell-signaling molecules using DNA aptamer-coated
carbon nanotubes // ACS Nano. - 2011. - V. 5. - N. 5. - P. 4236–4244.
147. Chhikara B.S., Misra S.K., Bhattacharya S. CNT loading into cationic cholesterol suspensions
show improved DNA binding and serum stability and ability to internalize into cancer cells. //
Nanotechnology. - 2012. - V. 23. - N. 6. - P. 065101.
148. Zhang H., Baker B. a, Cha T.-G., Sauffer M.D., Wu Y., Hinkson N., Bork M. a, McShane C.M.,
Choi K.-S., McMillin D.R., Choi J.H. DNA oligonucleotide templated nanohybrids using
electronic type sorted carbon nanotubes for light harvesting // Adv. Mater. - 2012. - V. 24. - N.
40. - P. 5447–5451.
149. Rege K., Viswanathan G., Zhu G., Vijayaraghavan A., Ajayan P.M., Dordick J.S. In vitro
transcription and protein translation from carbon nanotube-DNA assemblies // Small. - 2006. V. 2. - N. 6. - P. 718–722.
150. Chung C.-L., Gautier C., Campidelli S., Filoramo A. Hierarchical functionalisation of singlewall carbon nanotubes with DNA through positively charged pyrene // Chem. Commun. - 2010.
- V. 46. - N. 35. - P. 6539–6541.
151. McCarroll J., Baigude H., Yang C., Rana T.M. Nanotubes functionalized with lipids and natural
amino acid dendrimers: a new strategy to create nanomaterials for delivering systemic RNAi //
Bioconjugate Chem. - 2010. - V. 21. - N. 1. - P. 56–63.
152. Liu Y., Wu D.C., Zhang W.D., Jiang X., He C.B., Chung T.S., Goh S.H., Leong K.W.
Polyethylenimine-grafted multiwalled carbon nanotubes for secure noncovalent immobilization
and efficient delivery of DNA // Angew. Chem. Int. Ed. - 2005. - V. 44. - N. 30. - P. 4782–
4785.
153. Galandová J., Ovádeková R., Ferancová A., Labuda J. Disposable DNA biosensor with the
carbon nanotubes-polyethyleneimine interface at a screen-printed carbon electrode for tests of
DNA layer damage by quinazolines // Anal. Bioanal. Chem. - 2009. - V. 394. - N. 3. - P. 855–
861.
154. Luque G.L., Ferreyra N.F., Granero A., Bollo S., Rivas G. a. Electrooxidation of DNA at glassy
carbon electrodes modified with multiwall carbon nanotubes dispersed in polyethylenimine //
Electrochim. Acta. - 2011. - V. 56. - N. 25. - P. 9121–9126.
173
155. Cai D., Doughty A. C., Potocky B. T., Dufort J. F., Huang Z., Blair D., Kempa K., Ren Z.F.,
Chiles T.C. Carbon nanotube-mediated delivery of nucleic acids does not result in non-specific
activation of B lymphocytes // Nanotechnology. - 2007. - N. 36. - P. 365101.
156. Guo M., Chen J., Nie L., Yao S. Electrostatic assembly of calf thymus DNA on multi-walled
carbon nanotube modified gold electrode and its interaction with chlorpromazine hydrochloride
// Electrochim. Acta. - 2004. - V. 49. - N. 16. - P. 2637–2643.
157. Yang J., Jiao K., Yang T. A DNA electrochemical sensor prepared by electrodepositing zirconia
on composite films of single-walled carbon nanotubes and poly(2,6-pyridinedicarboxylic acid),
and its application to detection of the PAT gene fragment // Anal. Bioanal. Chem. - 2007. - V.
389. - N. 3. - P. 913–921.
158. Ahmed M., Jiang X., Deng Z., Narain R. Cationic glyco-functionalized single-walled carbon
nanotubes as efficient gene delivery vehicles // Bioconjugate Chem. - 2009. - V. 20. - N. 11. - P.
2017–2022.
159. Galandova J., Ziyatdinova G., Labuda J. Disposable electrochemical biosensor with multiwalled
carbon nanotubes-chitosan composite layer for the detection of deep DNA damage. // Anal. Sci.
- 2008. - V. 24. - N. 6. - P. 711–716.
160. So H.M., Park D.W., Jeon E.K., Kim Y.H., Kim B.S., Lee C.K., Choi S.Y., Kim S.C., Chang
H., Lee J.O. Detection and titer estimation of Escherichia coli using aptamer-functionalized
single-walled carbon-nanotube field-effect transistors // Small. - 2008. - V. 4. - N. 2. - P. 197–
201.
161. Yim T.J., Liu J., Lu Y., Kane R.S., Dordick J.S. Highly active and stable DNAzyme-carbon
nanotube hybrids // J. Am. Chem. Soc. - 2005. - V. 127. - N. 35. - P. 12200–12201.
162. Liu Z., Galli F., Waterreus W.-J., Meulenbroek E., Koning R.I., Lamers G.E.M., Olsthoorn
R.C.L., Pannu N., Oosterkamp T.H., Koster A.J., Dame R.T., Abrahams J.P. Single-walled
carbon nanotubes as scaffolds to concentrate DNA for the study of DNA-protein interactions. //
Chemphyschem. - 2012. - V. 13. - N. 6. - P. 1569–1575.
163. Bianco A., Kostarelos K., Partidos C.D., Prato M. Biomedical applications of functionalised
carbon nanotubes // Chem. Commun. - 2005. - V. 41. - N. 5. - P. 571–577.
164. Lyonnais S., Goux-Capes L., Escude C., Cote D., Filoramo A., Bourgoin J.P. DNA-carbon
nanotube conjugates prepared by a versatile method using streptavidin-biotin recognition //
Small. - 2008. - V. 4. - N. 4. - P. 442–446.
165. Lyonnais S., Chung C.-L., Goux-Capes L., Escudé C., Piétrement O., Baconnais S., Le Cam E.,
Bourgoin J.-P., Filoramo A. A three-branched DNA template for carbon nanotube self-assembly
into nanodevice configuration. // Chem. Commun. - 2009. - N. 6. - P. 683–685.
174
166. Liu Z., Tabakman S.M., Chen Z., Dai H. Preparation of carbon nanotube bioconjugates for
biomedical applications. // Nat. Protoc. - 2009. - V. 4. - N. 9. - P. 1372–1382.
167. Liu Z., Winters M., Holodniy M., Dai H. siRNA delivery into human T cells and primary cells
with carbon-nanotube transporters // Angew. Chem. Int. Ed. - 2007. - V. 46. - N. 12. - P. 2023–
2027.
168. Lanner J.T., Bruton J.D., Assefaw-Redda Y., Andronache Z., Zhang S.J., Severa D., Zhang
Z.B., Melzer W., Zhang S.L., Katz A., Westerblad H. Knockdown of TRPC3 with siRNA
coupled to carbon nanotubes results in decreased insulin-mediated glucose uptake in adult
skeletal muscle cells // FASEB J. - 2009. - V. 23. - N. 6. - P. 1728–1738.
169. Taft B.J., Lazareck A.D., Withey G.D., Yin A., Xu J.M., Kelley S.O. Site-specific assembly of
DNA and appended cargo on arrayed carbon nanotubes // J. Am. Chem. Soc. - 2004. - V. 126. N. 40. - P. 12750–12751.
170. So H.M., Won K., Kim Y.H., Kim B.K., Ryu B.H., Na P.S., Kim H., Lee J.O. Single-walled
carbon nanotube biosensors using aptamers as molecular recognition elements // J. Am. Chem.
Soc. - 2005. - V. 127. - N. 34. - P. 11906–11907.
171. Maehashi K., Katsura T., Kerman K., Takamura Y., Matsumoto K., Tamiya E. Label-free
protein biosensor based on aptamer-modified carbon nanotube field-effect transistors // Anal.
Chem. - 2007. - V. 79. - N. 2. - P. 782–787.
172. Baek Y.-K., Jung D.-H., Yoo S.M., Shin S., Kim J.-H., Jeon H.-J., Choi Y.-K., Lee S.Y., Jung
H.-T. Label-free detection of DNA hybridization using pyrene-functionalized single-walled
carbon nanotubes: effect of chemical structures of pyrene molecules on DNA sensing
performance // J. Nanosci. Nanotechnol. - 2011. - V. 11. - N. 5. - P. 4210–4216.
173. Schmucker W., Klumpp S., Hennrich F., Kappes M., Wagenknecht H.-A. A simple pyrene
“click”-type modification of DNA affects solubilisation and photoluminescence of singlewalled carbon nanotubes // RSC Adv. - 2013. - V. 3. - N. 18. - P. 6331–6333.
174. Taghdisi S.M., Lavaee P., Ramezani M., Abnous K. Reversible targeting and controlled release
delivery of daunorubicin to cancer cells by aptamer-wrapped carbon nanotubes. // Eur. J. Pharm.
Biopharm. - 2011. - V. 77. - N. 2. - P. 200–206.
175. Кузнецова
С.А.,
Орецкая
Т.С.
Нанотранспортные
системы
адресной
доставки
нуклеиновых кислот в клетки // Рос. Нанотехнол. - 2010. - V. 5. - N. 9-10. - P. 40–52.
176. Vashist S.K., Zheng D., Pastorin G., Al-Rubeaan K., Luong J.H.T., Sheu F.-S. Delivery of
drugs and biomolecules using carbon nanotubes // Carbon. - 2011. - V. 49. - N. 13. - P. 4077–
4097.
177. Petersen E.J., Zhang L., Mattison N.T., O’Carroll D.M., Whelton A.J., Uddin N., Nguyen T.,
Huang Q., Henry T.B., Holbrook R.D., Chen K.L. Potential release pathways, environmental
175
fate, and ecological risks of carbon nanotubes. // Environ. Sci. Technol. - 2011. - V. 45. - N. 23.
- P. 9837–9856.
178. Petersen E.J., Henry T.B. Methodological considerations for testing the ecotoxicity of carbon
nanotubes and fullerenes: review. // Environ. Toxicol. Chem. - 2012. - V. 31. - N. 1. - P. 60–72.
179. Love S.A., Maurer-Jones M.A., Thompson J.W., Lin Y.-S., Haynes C.L. Assessing nanoparticle
toxicity. // Annu. Rev. Anal. Chem. - 2012. - V. 5. - P. 181–205.
180. Wörle-Knirsch J.M., Pulskamp K., Krug H.F. Oops they did it again! Carbon nanotubes hoax
scientists in viability assays. // Nano Lett. - 2006. - V. 6. - N. 6. - P. 1261–1268.
181. Zhang Y., Ali S.F., Dervishi E., Xu Y., Li Z., Casciano D., Biris A.S. Cytotoxicity effects of
graphene and single-wall carbon nanotubes in neural phaeochromocytoma-derived PC12 cells //
ACS Nano. - 2010. - V. 4. - N. 6. - P. 3181–3186.
182. Ravichandran P., Periyakaruppan A., Sadanandan B., Ramesh V., Hall J.C., Jejelowo O.,
Ramesh G.T. Induction of apoptosis in rat lung epithelial cells by multiwalled carbon
nanotubes. // J. Biochem. Mol. Toxicol. - 2009. - V. 23. - N. 5. - P. 333–344.
183. Zhu L., Chang D.W., Dai L., Hong Y. DNA damage induced by multiwalled carbon nanotubes
in mouse embryonic stem cells // Nano Lett. - 2007. - V. 7. - N. 12. - P. 3592–3597.
184. Ghosh M., Chakraborty A., Bandyopadhyay M., Mukherjee A. Multi-walled carbon nanotubes
(MWCNT): induction of DNA damage in plant and mammalian cells. // J. Hazard. Mater. 2011. - V. 197. - P. 327–336.
185. Magrez A., Kasas S., Salicio V., Pasquier N., Seo J.W., Celio M., Catsicas S., Schwaller B.,
Forro L. Cellular toxicity of carbon-based nanomaterials // Nano Lett. - 2006. - V. 6. - N. 6. - P.
1121–1125.
186. Zeni O., Scarfì M. DNA damage by carbon nanotubes using the single cell gel electrophoresis
technique // Carbon Nanotubes: Methods and Protocols / ed. Balasubramanian K., Burghard M.
Humana Press. - 2010. - V. 625. - P. 109–119.
187. Mu Q., Du G., Chen T., Zhang B., Yan B. Suppression of human bone morphogenetic protein
signaling by carboxylated single-walled carbon nanotubes // ACS Nano. - 2009. - V. 3. - N. 5. P. 1139–1144.
188. Zhang D., Yi C., Zhang J., Chen Y., Yao X., Yang M. The effects of carbon nanotubes on the
proliferation and differentiation of primary osteoblasts // Nanotechnology. - 2007. - N. 47. - P.
475102.
189. Tian F., Cui D., Schwarz H., Estrada G.G., Kobayashi H. Suppression of human bone
morphogenetic protein signaling by carboxylated single-walled carbon nanotubes // Toxicol.
Vitr. - 2006. - V. 20. - N. 7. - P. 1202–1212.
176
190. Zhang D., Yi C., Qi S., Yao X., Yang M. Effects of carbon nanotubes on the proliferation and
differentiation of primary osteoblasts // Carbon Nanotubes: Methods and Protocols / ed.
Balasubramanian K., Burghard M. Humana Press. - 2010. - V. 625. - P. 41–53.
191. Zhang L.W., Zeng L., Barron A.R., Monteiro-Riviere N.A. Biological interactions of
functionalized single-wall carbon nanotubes in human epidermal keratinocytes // Int. J. Toxicol.
- 2007. - V. 26. - N. 2. - P. 103–113.
192. Liu D., Yi C., Zhang D., Zhang J., Yang M. Inhibition of proliferation and differentiation of
mesenchymal stem cells by carboxylated carbon nanotubes // ACS Nano. - 2010. - V. 4. - N. 4. P. 2185–2195.
193. Zhang L., Alizadeh D., Badie B. Carbon nanotube uptake and toxicity in the brain // Carbon
Nanotubes: Methods and Protocols / ed. Balasubramanian K., Burghard M. Humana Press. 2010. - V. 625. - P. 55–65.
194. Fraczek-Szczypta A., Menaszek E., Syeda T.B., Misra A., Alavijeh M., Adu J., Blazewicz S.
Effect of MWCNT surface and chemical modification on in vitro cellular response. // J.
Nanopart. Res. - 2012. - V. 14. - N. 10. - P. 1181.
195. Yoon H., Kim J.H., Lee N., Kim B.G., Jang J. A novel sensor platform based on aptamerconjugated polypyrrole nanotubes for label-free electrochemical protein detection //
Chembiochem. - 2008. - V. 9. - N. 4. - P. 634–641.
196. Sato Y., Yokoyama A., Shibata K., Akimoto Y., Ogino S., Nodasaka Y., Kohgo T., Tamura K.,
Akasaka T., Uo M., Motomiya K., Jeyadevan B., Ishiguro M., Hatakeyama R., Watari F., Tohji
K. Influence of length on cytotoxicity of multi-walled carbon nanotubes against human acute
monocytic leukemia cell line THP-1 in vitro and subcutaneous tissue of rats in vivo. // Mol.
Biosyst. - 2005. - V. 1. - N. 2. - P. 176–182.
197. Poland C.A., Duffin R., Kinloch I., Maynard A., Wallace W.A., Seaton A., Stone V., Brown S.,
Macnee W., Donaldson K. Carbon nanotubes introduced into the abdominal cavity of mice
show asbestos-like pathogenicity in a pilot study // Nat. Nanotechnol. - 2008. - V. 3. - N. 7. - P.
423–428.
198. Ali-Boucetta H., Nunes A., Sainz R., Herrero M.A., Tian B., Prato M., Bianco A., Kostarelos K.
Asbestos-like pathogenicity of long carbon nanotubes alleviated by chemical functionalization //
Angew. Chem. Int. Ed. - 2013. - V. 52. - N. 8. - P. 2274–2278.
199. Cui H.-F., Vashist S.K., Al-Rubeaan K., Luong J.H.T., Sheu F.-S. Interfacing carbon nanotubes
with living mammalian cells and cytotoxicity issues // Chem. Res. Toxicol. - 2010. - V. 23. - N.
7. - P. 1131–1147.
200. Lacerda L., Bianco A., Prato M., Kostarelos K. Carbon nanotubes as nanomedicines: from
toxicology to pharmacology // Adv. Drug Deliv. Rev. - 2006. - V. 58. - N. 14. - P. 1460–1470.
177
201. Singh R., Pantarotto D., Lacerda L., Pastorin G., Klumpp C., Prato M., Bianco A., Kostarelos K.
Tissue biodistribution and blood clearance rates of intravenously administered carbon nanotube
radiotracers // Proc. Natl. Acad. Sci. U. S. A. - 2006. - V. 103. - N. 9. - P. 3357–3362.
202. Hu H., Bhowmik P., Zhao B., Hamon M.A., Itkis M.E., Haddon R.C. Determination of the
acidic sites of purified single-walled carbon nanotubes by acid–base titration // Chem. Phys.
Lett. - 2001. - V. 345. - N. 1-2. - P. 25–28.
203. Wang X., Xia T., Ntim S.A., Ji Z., George S., Meng H., Zhang H., Castranova V., Mitra S., Nel
A.E. Quantitative techniques for assessing and controlling the dispersion and biological effects
of multiwalled carbon nanotubes in mammalian tissue culture cells. // ACS Nano. - 2010. - V. 4.
- N. 12. - P. 7241–7252.
204. Kalbacova M., Broz A., Kromka A., Babchenko O., Kalbac M. Controlled oxygen plasma
treatment of single-walled carbon nanotube films improves osteoblastic cells attachment and
enhances their proliferation // Carbon. - 2011. - V. 49. - N. 9. - P. 2926–2934.
205. Dumortier H., Lacotte S., Pastorin G., Marega R., Wu W., Bonifazi D., Briand J.-P., Prato M.,
Muller S., Bianco A. Functionalized carbon nanotubes are non-cytotoxic and preserve the
functionality of primary immune cells. // Nano Lett. - 2006. - V. 6. - N. 7. - P. 1522–1528.
206. Wick P., Manser P., Limbach L.K., Dettlaff-Weglikowska U., Krumeich F., Roth S., Stark W.J.,
Bruinink A. The degree and kind of agglomeration affect carbon nanotube cytotoxicity //
Toxicol. Lett. - 2007. - V. 168. - N. 2. - P. 121–131.
207. Firme C.P., Bandaru P.R. Toxicity issues in the application of carbon nanotubes to biological
systems. // Nanomed. Nanotechnol. Biol. Med. - 2010. - V. 6. - N. 2. - P. 245–256.
208. Delogu L.G., Venturelli E., Manetti R., Carru C., Madeddu R., Murgia L., Sgarrella F., Bianco
A. Ex vivo impact of functionalized carbon nanotubes on human immune cells // Nanomedicine.
- 2012. - V. 7. - N. 2. - P. 231–243.
209. Nimmagadda A., Thurston K., Nollert M.U., McFetridge P.S. Chemical modification of SWNT
alters in vitro cell-SWNT interactions. // J. Biomed. Mater. Res. A. - 2006. - V. 76. - N. 3. - P.
614–625.
210. Neves L.F., Tsai T.-W., Palwai N.R., Martyn D.E., Tan Y., Schmidtke D.W., Resasco D.E.,
Harrison R.G. Non-covalent Attachment of Proteins to Single-Walled Carbon Nanotubes //
Carbon Nanotubes: Methods and Protocols / ed. Balasubramanian K., Burghard M. - 2010. - V.
625. - N. 625. - P. 3–8.
211. Cui D. Advances and prospects on biomolecules functionalized carbon nanotubes // J. Nanosci.
Nanotechnol. - 2007. - V. 7. - N. 4-5. - P. 1298–1314.
178
212. Ge C., Du J., Zhao L., Wang L., Liu Y., Li D., Yang Y., Zhou R., Zhao Y., Chai Z., Chen C.
Binding of blood proteins to carbon nanotubes reduces cytotoxicity. // Proc. Natl. Acad. Sci. U.
S. A. - 2011. - V. 108. - N. 41. - P. 16968–16973.
213. Zhang Y., Xu Y., Li Z., Chen T., Lantz S.M., Howard P.C., Paule M.G., Slikker W., Watanabe
F., Mustafa T., Biris A.S., Ali S.F. Mechanistic toxicity evaluation of uncoated and PEGylated
single-walled carbon nanotubes in neuronal PC12 cells. // ACS Nano. - 2011. - V. 5. - N. 9. - P.
7020–7033.
214. Becker M.L., Fagan J.A., Gallant N.D., Bauer B.J., Bajpai V., Hobbie E.K., Lacerda S.H.,
Migler K.B., Jakupciak J.P. Length-dependent uptake of DNA-wrapped single-walled carbon
nanotubes // Adv. Mater. - 2007. - V. 19. - N. 7. - P. 939–945.
215. Bartholomeusz G., Cherukuri P., Kingston J. In vivo therapeutic silencing of hypoxia-inducible
factor 1 alpha (HIF-1 alpha) using single-walled carbon nanotubes noncovalently coated with
siRNA // Nano Res. - 2009. - V. 2. - N. 4. - P. 279–291.
216. Kang S., Pinault M., Pfefferle L.D., Elimelech M. Single-walled carbon nanotubes exhibit
strong antimicrobial activity // Langmuir. - 2007. - V. 23. - N. 17. - P. 8670–8673.
217. Kang S., Herzberg M., Rodrigues D.F., Elimelech M. Antibacterial effects of carbon nanotubes:
size does matter! // Langmuir. - 2008. - V. 24. - N. 13. - P. 6409–6413.
218. Nepal D., Balasubramanian S., Simonian A.L., Davis V.A. Strong antimicrobial coatings:
single-walled carbon nanotubes armored with biopolymers // Nano Lett. - 2008. - V. 8. - N. 7. P. 1896–1901.
219. Liu S., Wei L., Hao L., Fang N., Chang M.W., Xu R., Yang Y., Chen Y. Sharper and faster
“nano darts” kill more bacteria: a study of antibacterial activity of individually dispersed
pristine single-walled carbon nanotube // ACS Nano. - 2009. - V. 3. - N. 12. - P. 3891–3902.
220. Dong L., Henderson A., Field C. Antimicrobial activity of single-walled carbon nanotubes
suspended in different surfactants // J. Nanotechnol. - 2012. - V. 2012. - P. 1–7.
221. Li M., Huang C.P. The responses of Ceriodaphnia dubia toward multi-walled carbon nanotubes:
Effect of physical–chemical treatment // Carbon. - 2011. - V. 49. - N. 5. - P. 1672–1679.
222. Vecitis C.D., Zodrow K.R., Kang S., Elimelech M. Electronic-structure-dependent bacterial
cytotoxicity of single-walled carbon nanotubes // ACS Nano. - 2010. - V. 4. - N. 9. - P. 5471–
5479.
223. Tong Z., Bischoff M., Nies L.F., Myer P., Applegate B., Turco R.F. Response of soil
microorganisms to As-produced and functionalized single-wall carbon nanotubes (SWNTs). //
Environ. Sci. Technol. - 2012. - V. 46. - N. 24. - P. 13471–13479.
224. Baik K.Y., Park S.Y., Heo K., Lee K.-B., Hong S. Carbon nanotube monolayer cues for
osteogenesis of mesenchymal stem cells. // Small. - 2011. - V. 7. - N. 6. - P. 741–745.
179
225. Usui Y., Aoki K., Narita N., Murakami N., Nakamura I., Nakamura K., Ishigaki N., Yamazaki
H., Horiuchi H., Kato H., Taruta S., Kim Y.A., Endo M., Saito N. Carbon nanotubes with high
bone-tissue compatibility and bone-formation acceleration effects // Small. - 2008. - V. 4. - N. 2.
- P. 240–246.
226. Sirivisoot S., Webster T.J. Multiwalled carbon nanotubes enhance electrochemical properties of
titanium to determine in situ bone formation // Nanotechnology. - 2008. - N. 29. - P. 295101.
227. Nayak T.R., Jian L., Phua L.C., Ho H.K., Ren Y., Pastorin G. Thin films of functionalized
multiwalled carbon nanotubes as suitable scaffold materials for stem cells proliferation and bone
formation // ACS Nano. - 2010. - V. 4. - N. 12. - P. 7717–7725.
228. Nayagam D. a X., Williams R. a, Chen J., Magee K. a, Irwin J., Tan J., Innis P., Leung R.T.,
Finch S., Williams C.E., Clark G.M., Wallace G.G. Biocompatibility of immobilized aligned
carbon nanotubes. // Small. - 2011. - V. 7. - N. 8. - P. 1035–1042.
229. Singh M.K., Gracio J., LeDuc P., Gonçalves P.P., Marques P. a a P., Gonçalves G., Marques F.,
Silva V.S., Capela e Silva F., Reis J., Potes J., Sousa A. Integrated biomimetic carbon nanotube
composites for in vivo systems. // Nanoscale. - 2010. - V. 2. - N. 12. - P. 2855–2863.
230. Ryoo S.-R., Kim Y.-K., Kim M.-H., Min D.-H. Behaviors of NIH-3T3 fibroblasts on
graphene/carbon nanotubes: proliferation, focal adhesion, and gene transfection studies // ACS
Nano. - 2010. - V. 4. - N. 11. - P. 6587–6598.
231. Martinelli V., Cellot G., Toma F.M., Long C.S., Caldwell J.H., Zentilin L., Giacca M., Turco
A., Prato M., Ballerini L., Mestroni L. Carbon nanotubes promote growth and spontaneous
electrical activity in cultured cardiac myocytes. // Nano Lett. - 2012. - V. 12. - N. 4. - P. 1831–
1838.
232. Mooney E., Dockery P., Greiser U., Murphy M., Barron V. Carbon nanotubes and mesenchymal
stem cells: biocompatibility, proliferation and differentiation // Nano Lett. - 2008. - V. 8. - N. 8.
- P. 2137–2143.
233. Namgung S., Baik K.Y., Park J., Hong S. Controlling the growth and differentiation of human
mesenchymal stem cells by the arrangement of individual carbon nanotubes. // ACS Nano. 2011. - V. 5. - N. 9. - P. 7383–7390.
234. Chen Y.-S., Hsiue G.-H. Directing neural differentiation of mesenchymal stem cells by
carboxylated multiwalled carbon nanotubes. // Biomaterials. - 2013. - V. 34. - N. 21. - P. 4936–
4944.
235. Jan E., Kotov N.A. Successful differentiation of mouse neural stem cells on layer-by-layer
assembled single-walled carbon nanotube composite // Nano Lett. - 2007. - V. 7. - N. 5. - P.
1123–1128.
180
236. Zang R., Yang S.-T. Multiwalled carbon nanotube-coated polyethylene terephthalate fibrous
matrices for enhanced neuronal differentiation of mouse embryonic stem cells // J. Mater.
Chem. B. - 2013. - V. 1. - N. 5. - P. 646.
237. Liu Z., Cai W., He L., Nakayama N., Chen K., Sun X., Chen X., Dai H. In vivo biodistribution
and highly efficient tumour targeting of carbon nanotubes in mice // Nat. Nanotechnol. - 2007. V. 2. - N. 1. - P. 47–52.
238. Deng X., Yang S., Nie H., Wang H., Liu Y. A generally adoptable radiotracing method for
tracking carbon nanotubes in animals // Nanotechnology. - 2008. - V. 19. - N. 7. - P. 75101.
239. Al-Jamal K.T., Nunes A., Methven L., Ali-Boucetta H., Li S., Toma F.M., Herrero M.A., AlJamal W.T., ten Eikelder H.M.M., Foster J., Mather S., Prato M., Bianco A., Kostarelos K.
Degree of chemical functionalization of carbon nanotubes determines tissue distribution and
excretion profile. // Angew. Chem. Int. Ed. - 2012. - V. 51. - N. 26. - P. 6389–6393.
240. Guo J., Zhang X., Li Q., Li W. Biodistribution of functionalized multiwall carbon nanotubes in
mice // Nucl. Med. Biol. - 2007. - V. 34. - N. 5. - P. 579–583.
241. Pietroiusti A., Massimiani M., Fenoglio I., Colonna M., Valentini F., Palleschi G., Camaioni A.,
Magrini A., Siracusa G., Bergamaschi A., Sgambato A., Campagnolo L. Low doses of pristine
and oxidized mammalian embryonic development // ACS Nano. - 2011. - V. 5. - N. 6. - P.
4624–4633.
242. Riehemann K. Nanotoxicity: how the body develops a way to reduce the toxicity of carbon
nanotubes. // Small. - 2012. - V. 8. - N. 13. - P. 1970–1972.
243. Ravelli D., Merli D., Quartarone E., Profumo A., Mustarelli P., Fagnoni M. PEGylated carbon
nanotubes: preparation, properties and applications // RSC Adv. - 2013. - V. 3. - N. 33. - P.
13569–13582.
244. Schipper M.L., Nakayama-Ratchford N., Davis C.R., Kam N.W., Chu P., Liu Z., Sun X., Dai
H., Gambhir S.S. A pilot toxicology study of single-walled carbon nanotubes in a small sample
of mice // Nat. Nanotechnol. - 2008. - V. 3. - N. 4. - P. 216–221.
245. Yang S.-T., Wang H., Meziani M.J., Liu Y., Wang X., Sun Y.-P. Biodefunctionalization of
functionalized single-walled carbon nanotubes in mice // Biomacromolecules. - 2009. - V. 10. N. 7. - P. 2009–2012.
246. Pescatori M., Bedognetti D., Venturelli E., Ménard-Moyon C., Bernardini C., Muresu E., Piana
A., Maida G., Manetti R., Sgarrella F., Bianco A., Delogu L.G. Functionalized carbon
nanotubes as immunomodulator systems // Biomaterials. - 2013. - V. 34. - N. 18. - P. 4395–
4403.
181
247. Villa C.H., McDevitt M.R., Escorcia F.E., Rey D.A., Bergkvist M., Batt C.A., Scheinberg D.A.
Synthesis and biodistribution of oligonucleotide-functionalized, tumor-targetable carbon
nanotubes // Nano Lett. - 2008. - V. 8. - N. 12. - P. 4221–4228.
248. Sacchetti C., Rapini N., Magrini A., Cirelli E., Bellucci S., Mattei M., Rosato N., Bottini N.,
Bottini M. In vivo targeting of intratumor regulatory T cells using PEG-modified single-walled
carbon nanotubes // Bioconjugate Chem. - 2013. - V. 24. - N. 6. - P. 852–858.
249. Monteiro-Riviere N.A., Inman A.O. Challenges for assessing carbon nanomaterial toxicity to
the skin // Carbon. - 2006. - V. 44. - N. 6. - P. 1070–1078.
250. Kolosnjaj-tabi J., Hartman K.B., Boudjemaa S., Ananta J.S., Morgant G., Szwarc H., Wilson
L.J., Moussa F. In Vivo behavior of large doses of single-walled carbon nanotubes after oral and
intraperitoneal administration to swiss mice // ACS Nano. - 2010. - V. 4. - N. 3. - P. 1481–1492.
251. Muller J., Huaux F., Lison D. Respiratory toxicity of carbon nanotubes: How worried should we
be? // Carbon. - 2006. - V. 44. - N. 6. - P. 1048–1056.
252. Chou C.C., Hsiao H.Y., Hong Q.S., Chen C.H., Peng Y.W., Chen H.W., Yang P.C. Singlewalled carbon nanotubes can induce pulmonary injury in mouse model // Nano Lett. - 2008. - V.
8. - N. 2. - P. 437–445.
253. Lam C.W., James J.T., McCluskey R., Hunter R.L. Pulmonary toxicity of single-wall carbon
nanotubes in mice 7 and 90 days after intratracheal instillation // Toxicol. Sci. - 2004. - V. 77. N. 1. - P. 126–134.
254. Grubek-Jaworska H., Nejman P., Czumińska K., Przybyłowski T., Huczko a., Lange H.,
Bystrzejewski M., Baranowski P., Chazan R. Preliminary results on the pathogenic effects of
intratracheal exposure to one-dimensional nanocarbons // Carbon. - 2006. - V. 44. - N. 6. - P.
1057–1063.
255. Tyurina Y.Y., Kisin E.R., Murray A., Tyurin V.A., Kapralova V.I., Sparvero L.J., Amoscato
A.A., Samhan-Arias A.K., Swedin L., Lahesmaa R., Fadeel B., Shvedova A.A., Kagan V.E.
Global phospholipidomics analysis reveals selective pulmonary peroxidation profiles upon
inhalation of single-walled carbon nanotubes // ACS Nano. - 2011. - V. 5. - N. 9. - P. 7342–
7353.
256. Legramante J.M., Sacco S., Crobeddu P., Magrini A., Valentini F., Palleschi G., Pallante M.,
Balocchi R., Iavicoli I., Bergamaschi A., Galante A., Campagnolo L., Pietroiusti A. Changes in
cardiac autonomic regulation after acute lung exposure to carbon nanotubes: implications for
occupational exposure // J. Nanomater. - 2012. - V. 2012. - P. 1–9.
257. Li R., Wang X., Ji Z., Sun B., Zhang H., Chang C.H., Lin S., Meng H., Liao Y.-P., Wang M., Li
Z., Hwang A. a, Song T.-B., Xu R., Yang Y., Zink J.I., Nel A.E., Xia T. Surface charge and
182
cellular processing of covalently functionalized multiwall carbon nanotubes determine
pulmonary toxicity. // ACS Nano. - 2013. - V. 7. - N. 3. - P. 2352–2368.
258. Ren J., Shen S., Wang D., Xi Z., Guo L., Pang Z., Qian Y., Sun X., Jiang X. The targeted
delivery of anticancer drugs to brain glioma by PEGylated oxidized multi-walled carbon
nanotubes modified with angiopep-2. // Biomaterials. - 2012. - V. 33. - N. 11. - P. 3324–3333.
259. Yang S.-T., Fernando K.A.S., Liu J.-H., Wang J., Sun H.-F., Liu Y., Chen M., Huang Y., Wang
X., Wang H., Sun Y.-P. Covalently PEGylated carbon nanotubes with stealth character in vivo //
Small. - 2008. - V. 4. - N. 7. - P. 940–944.
260. Raffa V., Ciofani G., Nitodas S., Karachalios T., Dalessandro D., Masini M., Cuschieri A. Can
the properties of carbon nanotubes influence their internalization by living cells? // Carbon. 2008. - V. 46. - N. 12. - P. 1600–1610.
261. Mao H., Kawazoe N., Chen G. Uptake and intracellular distribution of collagen-functionalized
single-walled carbon nanotubes. // Biomaterials. - 2013. - V. 34. - N. 10. - P. 2472–2479.
262. Porter A.E., Gass M., Muller K., Skepper J.N., Midgley P.A., Welland M. Direct imaging of
single-walled carbon nanotubes in cells // Nat. Nanotechnol. - 2007. - V. 2. - N. 11. - P. 713–
717.
263. Cherukuri P., Bachilo S.M., Litovsky S.H., Weisman R.B. Near-infrared fluorescence
microscopy of single-walled carbon nanotubes in phagocytic cells. // J. Am. Chem. Soc. - 2004.
- V. 126. - N. 48. - P. 15638–15639.
264. Bussy C., Cambedouzou J., Lanone S., Leccia E., Heresanu V., Pinault M., Mayne-L’hermite
M., Brun N., Mory C., Cotte M., Doucet J., Boczkowski J., Launois P. Carbon nanotubes in
macrophages: imaging and chemical analysis by X-ray fluorescence microscopy // Nano Lett. 2008. - V. 8. - N. 9. - P. 2659–2663.
265. Kang B., Yu D.-C., Chang S.-Q., Chen D., Dai Y.-D., Ding Y. Intracellular uptake, trafficking
and subcellular distribution of folate conjugated single walled carbon nanotubes within living
cells. // Nanotechnology. - 2008. - V. 19. - N. 37. - P. 375103.
266. Jin H., Heller D.A., Sharma R., Strano M.S. Size-dependent cellular uptake and expulsion of
single-walled carbon nanotubes: single particle tracking and a generic uptake model for
nanoparticles. // ACS Nano. - 2009. - V. 3. - N. 1. - P. 149–158.
267. Bhattacharya S., Roxbury D., Gong X., Mukhopadhyay D., Jagota A. DNA conjugated
SWCNTs enter endothelial cells via Rac1 mediated macropinocytosis. // Nano Lett. - 2012. - V.
12. - N. 4. - P. 1826–1830.
268. Kam N.W.S., Liu Z., Dai H. Carbon nanotubes as intracellular transporters for proteins and
DNA: an investigation of the uptake mechanism and pathway // Angew. Chem. Int. Ed. - 2006. V. 45. - N. 4. - P. 577–581.
183
269. Ma X., Zhang L.-H., Wang L.-R., Xue X., Sun J.-H., Wu Y., Zou G., Wu X., Wang P.C.,
Wamer W.G., Yin J.-J., Zheng K., Liang X.-J. Single-walled carbon nanotubes alter cytochrome
c electron transfer and modulate mitochondrial function. // ACS Nano. - 2012. - V. 6. - N. 12. P. 10486–10496.
270. Neves V., Gerondopoulos A., Heister E., Tîlmaciu C., Flahaut E., Soula B., Silva S.R.P.,
McFadden J., Coley H.M. Cellular localization, accumulation and trafficking of double-walled
carbon nanotubes in human prostate cancer cells // Nano Res. - 2012. - V. 5. - N. 4. - P. 223–
234.
271. Mu Q., Broughton D.L., Yan B. Endosomal leakage and nuclear translocation of multiwalled
carbon nanotubes: developing a model for cell uptake. // ACS Nano. - 2009. - V. 9. - N. 12. - P.
4370–4375.
272. Ali-Boucetta H., Al-Jamal K.T., Müller K.H., Li S., Porter A.E., Eddaoudi A., Prato M., Bianco
A., Kostarelos K. Cellular uptake and cytotoxic impact of chemically functionalized and
polymer-coated carbon nanotubes // Small. - 2011. - V. 7. - N. 22. - P. 3230–3238.
273. Al-Jamal K.T., Nerl H., Muller K.H., Ali-Boucetta H., Li S., Haynes P.D., Jinschek J.R., Prato
M., Bianco A., Kostarelos K., Porter A.E. Cellular uptake mechanisms of functionalised multiwalled carbon nanotubes by 3D electron tomography imaging // Nanoscale. - 2011. - V. 3. - N.
6. - P. 2627–2635.
274. Lopez C.F., Nielsen S.O., Moore P.B., Klein M.L. Understanding nature’s design for a
nanosyringe // Proc. Natl. Acad. Sci. U. S. A. - 2004. - V. 101. - N. 13. - P. 4431–4434.
275. Pantarotto D., Briand J.-P.P., Prato M., Bianco A. Translocation of bioactive peptides across
cell membranes by carbon nanotubes // Chem. Commun. - 2004. - V. 40. - N. 1. - P. 16–17.
276. Pogodin S., Baulin V.A. Can a carbon nanotube pierce through a phospholipid bilayer? // ACS
Nano. - 2010. - V. 4. - N. 9. - P. 5293–5300.
277. Cheng C., Müller K.H., Koziol K.K.K., Skepper J.N., Midgley P.A., Welland M.E., Porter A.E.
Toxicity and imaging of multi-walled carbon nanotubes in human macrophage cells. //
Biomaterials. - 2009. - V. 30. - N. 25. - P. 4152–4160.
278. Cheung W., Pontoriero F., Taratula O., Chen A.M., He H. DNA and carbon nanotubes as
medicine // Adv. Drug Deliv. Rev. - 2010. - V. 62. - N. 6. - P. 633–649.
279. Yang W., Thordarson P., Gooding J.J., Ringer P. S., Braet F. Carbon nanotubes for biological
and biomedical applications // Nanotechnology. - 2007. - N. 41. - P. 412001.
280. Foldvari M., Bagonluri M. Carbon nanotubes as functional excipients for nanomedicines: I.
Pharmaceutical properties // Nanomed. Nanotechnol. Biol. Med. - 2008. - V. 4. - N. 3. - P. 173–
182.
184
281. Foldvari M., Bagonluri M. Carbon nanotubes as functional excipients for nanomedicines: II.
Drug delivery and biocompatibility issues // Nanomed. Nanotechnol. Biol. Med. - 2008. - V. 4. N. 3. - P. 183–200.
282. Qiao W., Wang B., Wang Y., Yang L., Zhang Y., Shao P. Cancer therapy based on
nanomaterials and nanocarrier systems // J. Nanomater. - 2010. - V. 2010. - P. 796303.
283. Lay C.L., Liu J., Liu Y. Functionalized carbon nanotubes for anticancer drug delivery // Expert
Rev. Med. Devices. - 2011. - V. 8. - N. 5. - P. 561–566.
284. Guo J., Bourre L., Soden D.M., O’Sullivan G.C., O’Driscoll C. Can non-viral technologies
knockdown the barriers to siRNA delivery and achieve the next generation of cancer
therapeutics? // Biotechnol. Adv. - 2011. - V. 29. - N. 4. - P. 402–417.
285. Kesharwani P., Gajbhiye V., Jain N.K. A review of nanocarriers for the delivery of small
interfering RNA // Biomaterials. - 2012. - V. 33. - N. 29. - P. 7138–7150.
286. Harvey J., Dong L., Kim K., Hayden J., Wang J. Uptake of single-walled carbon nanotubes
conjugated with DNA by microvascular endothelial cells // J. Nanotechnol. - 2012. - V. 2012. P. 1–7.
287. Liu Q., Chen B., Wang Q., Shi X., Xiao Z., Lin J., Fang X. Carbon nanotubes as molecular
transporters for walled plant cells. // Nano Lett. - 2009. - V. 9. - N. 3. - P. 1007–1010.
288. Fujigaya T., Yamamoto Y., Kano A., Maruyama A., Nakashima N. Enhanced cell uptake via
non-covalent decollation of a single-walled carbon nanotube-DNA hybrid with polyethylene
glycol-grafted poly(l-lysine) labeled with an Alexa-dye and its efficient uptake in a cancer cell.
// Nanoscale. - 2011. - V. 3. - N. 10. - P. 4352–4358.
289. Liu M., Chen B., Xue Y., Huang J., Zhang L., Huang S., Li Q., Zhang Z. Polyamidoaminegrafted multiwalled carbon nanotubes for gene delivery: synthesis, transfection and intracellular
trafficking. // Bioconjugate Chem. - 2011. - V. 22. - N. 11. - P. 2237–2243.
290. Sanz V., Tilmacîu C., Soula B., Flahaut E., Coley H.M., Silva S.R.P., McFadden J.
Chloroquine-enhanced gene delivery mediated by carbon nanotubes // Carbon. - 2011. - V. 49. N. 15. - P. 5348–5358.
291. Jeong J.H., Mok H., Oh Y.-K., Park T.G. siRNA conjugate delivery systems. // Bioconjugate
Chem. - 2009. - V. 20. - N. 1. - P. 5–14.
292. Juliano R., Alam M.R., Dixit V., Kang H. Mechanisms and strategies for effective delivery of
antisense and siRNA oligonucleotides // Nucleic Acids Res. - 2008. - V. 36. - N. 12. - P. 4158–
4171.
293. Wang X., Song Y., Ren J., Qu X. Knocking-down cyclin A2 by siRNA suppresses apoptosis
and switches differentiation pathways in K562 cells upon administration with doxorubicin //
PLoS One. - 2009. - V. 4. - N. 8. - P. e6665.
185
294. Pan B., Cui D., Xu P., Ozkan C., Feng G., Ozkan M., Huang T., Chu B., Li Q., He R., Hu G.
Synthesis and characterization of polyamidoamine dendrimer-coated multi-walled carbon
nanotubes and their application in gene delivery systems // Nanotechnology. - 2009. - V. 20. N. 12. - P. 125101.
295. Al-Jamal K., Toma F., Yilmazer A., Ali-Boucetta H., Nunes A., Herrero M., Tian B., Eddaoudi
A., Al-Jamal W., Bianco A., Prato M., Kostarelo K. Enhanced cellular internalization and gene
silencing with a series of cationic dendron-multiwalled carbon nanotube:siRNA complexes. //
FASEB J. FASEB. - 2010. - V. 24. - N. 11. - P. 4354–4365.
296. Foillard S., Zuber G., Doris E. Polyethylenimine-carbon nanotube nanohybrids for siRNAmediated gene silencing at cellular level // Nanoscale. - 2011. - V. 3. - N. 4. - P. 1461–1464.
297. Wang L., Shi J., Zhang H., Li H., Gao Y., Wang Z., Wang H., Li L., Zhang C., Chen C., Zhang
Z., Zhang Y. Synergistic anticancer effect of RNAi and photothermal therapy mediated by
functionalized single-walled carbon nanotubes. // Biomaterials. - 2013. - V. 34. - N. 1. - P. 262–
274.
298. Chen H., Ma X., Li Z., Shi Q., Zheng W. Functionalization of single-walled carbon nanotubes
enables efficient intracellular delivery of siRNA targeting MDM2 to inhibit breast cancer cells
growth // Biomed. Pharmacother. - 2012. - V. 66. - N. 5. - P. 334–338.
299. Qiao J., Hong T., Triana T.S., Guo H., Chung D.H., Xu Y.-Q. Magneto-fluorescent carbon
nanotube-mediated siRNA for gastrin-releasing peptide receptor silencing in neuroblastoma //
RSC Adv. - 2013. - V. 3. - N. 14. - P. 4544–4551.
300. Al-Jamal K.T., Gherardini L., Bardi G., Nunes A., Guo C., Bussy C., Herrero M.A., Bianco A.,
Prato M., Kostarelos K., Pizzorusso T. Functional motor recovery from brain ischemic insult by
carbon nanotube-mediated siRNA silencing // Proc. Natl. Acad. Sci. U. S. A. - 2011. - V. 108. N. 27. - P. 1–6.
301. Neagoe I.B., Braicu C., Matea C., Bele C., Florin G., Gabriel K., Veronica C., Irimie A.
Efficient siRNA delivery system using carboxylated single-wall carbon nanotubes in cancer
treatment // J. Biomed. Nanotechnol. - 2012. - V. 8. - N. 4. - P. 567–574.
302. Neves V., Heister E., Costa S., Tîlmaciu C., Flahaut E., Soula B., Coley H.M., McFadden J.,
Silva S.R. Design of double-walled carbon nanotubes for biomedical applications. //
Nanotechnology. - 2012. - V. 23. - N. 36. - P. 365102.
303. Roy S., Gao Z. Nanostructure-based electrical biosensors // Nano Today. - 2009. - V. 4. - N. 4. P. 318–334.
304. So H., Park D., Chang H., Lee J. Carbon nanotube biosensors with aptamers as molecular
recognition elements // Carbon Nanotubes: Methods and Protocols / ed. Balasubramanian K.,
Burghard M. Totowa, NJ: Humana Press. - 2010. - V. 625. - N. 3. - P. 239–249.
186
305. Luong J.H.T., Male K.B., Hrapovic S. Carbon nanotube-based elecrtochemical biosensing
platforms: fundamentals, applications and future possibilities // Recent Pat. Biotechnol. - 2007. V. 1. - P. 181–191.
306. Rivas G.A., Rubianes M.D., Rodríguez M.C., Ferreyra N.F., Luque G.L., Pedano M.L.,
Miscoria S.A., Parrado C. Carbon nanotubes for electrochemical biosensing // Talanta. - 2007. V. 74. - N. 3. - P. 291–307.
307. Lin Y., Yantasee W., Wang J. Carbon nanotubes (CNTs) for the development of
electrochemical biosensors // Front. Biosci. - 2005. - V. 10. - N. 1. - P. 492–505.
308. Kichambare P.D., Star A., Kumar C.S.S.R. Biosensing using carbon nanotube field-effect
transistors // Nanomater. Biosens. / ed. Kumar C.S.S.R. Weinheim: Willey-VCH. - 2007. - N. 8.
- P. 1–26.
309. Chen Z., Zhang X., Yang R., Zhu Z., Chen Y., Tan W. Single-walled carbon nanotubes as
optical materials for biosensing // Nanoscale. - 2011. - V. 3. - N. 5. - P. 1949–1956.
310. Wang J. Nanomaterial-based electrochemical biosensors // Analyst. - 2005. - V. 130. - N. 4. - P.
421–426.
311. He P., Xu Y., Fang Y. Applications of carbon nanotubes in electrochemical DNA biosensors //
Microchim. Acta. - 2006. - V. 152. - N. 3. - P. 175–186.
312. Torres-Chavolla E., Alocilja E.C. Aptasensors for detection of microbial and viral pathogens //
Biosens. Bioelectron. - 2009. - V. 24. - N. 11. - P. 3175–3182.
313. Ye J.-S., Sheu F.-S., Kumar C.S.S.R. Carbon nanotube-based sensor // Nanomater. Biosens. /
ed. Kumar C.S.S.R. Weinheim: Willey-VCH. - 2007. - N. 8. - P. 27–55.
314. Dolatabadi J.E.N., Mashinchian O., Ayoubi B., Jamali A.A., Mobed A., Losic D., Omidi Y., de
la Guardia M. Optical and electrochemical DNA nanobiosensors // Trends Anal. Chem. - 2011.
- V. 30. - N. 3. - P. 459–472.
315. Niu S., Zhao M., Ren R., Zhang S. Carbon nanotube-enhanced DNA biosensor for DNA
hybridization detection using manganese(II)-Schiff base complex as hybridization indicator // J.
Inorg. Biochem. - 2009. - V. 103. - N. 1. - P. 43–49.
316. Caliskan A., Erdem A., Karadeniz H. Direct DNA hybridization on the single-walled carbon
nanotubes modified sensors detected by voltammetry and electrochemical impedance
spectroscopy // Electroanalysis. - 2009. - V. 21. - N. 19. - P. 2116–2124.
317. Ye Y., Ju H. Rapid detection of ssDNA and RNA using multi-walled carbon nanotubes
modified screen-printed carbon electrode // Biosens. Bioelectron. - 2005. - V. 21. - N. 5. - P.
735–741.
187
318. Yang T., Zhang W., Du M., Jiao K. A PDDA/poly(2,6-pyridinedicarboxylic acid)-CNTs
composite film DNA electrochemical sensor and its application for the detection of specific
sequences related to PAT gene and NOS gene // Talanta. - 2008. - V. 75. - N. 4. - P. 987–994.
319. Singh R., Dhand C., Sumana G., Verma R., Sood S., Gupta R.K., Malhotra B.D.
Polyaniline/carbon nanotubes platform for sexually transmitted disease detection // J. Mol.
Recognit. - 2010. - V. 23. - N. 5. - P. 472–479.
320. Yang Y., Wang Z., Yang M., Li J., Zheng F., Shen G., Yu R. Electrical detection of
deoxyribonucleic
acid
hybridization
based
on
carbon-nanotubes/nano
zirconium
dioxide/chitosan-modified electrodes // Anal. Chim. Acta. - 2007. - V. 584. - N. 2. - P. 268–274.
321. Yang T., Zhou N., Zhang Y., Zhang W., Jiao K., Li G. Synergistically improved sensitivity for
the detection of specific DNA sequences using polyaniline nanofibers and multi-walled carbon
nanotubes composites // Biosens. Bioelectron. - 2009. - V. 24. - N. 7. - P. 2165–2170.
322. Zhang Y., Zhang K., Ma H. Electrochemical DNA biosensor based on silver
nanoparticles/poly(3-(3-pyridyl) acrylic acid)/carbon nanotubes modified electrode // Anal.
Biochem. - 2009. - V. 387. - N. 1. - P. 13–19.
323. Zhu N., Lin Y., Yu P., Su L., Mao L. Label-free and sequence-specific DNA detection down to
a picomolar level with carbon nanotubes as support for probe DNA // Anal. Chim. Acta. - 2009.
- V. 650. - N. 1. - P. 44–48.
324. Niu S., Han B., Cao W., Zhang S. Sensitive DNA biosensor improved by Luteolin copper(II) as
indicator based on silver nanoparticles and carbon nanotubes modified electrode // Anal. Chim.
Acta. - 2009. - V. 651. - N. 1. - P. 42–47.
325. Joiner C.S., Gruner G., Star A. Nanotube sensor for DNA detection. US: Nanomix, Inc. - 2007.
- N. 11/212,026.
326. So H.M., Lee J.O., Kim Y.H., Won K., Chang H., Ryu B.H., Kong J., Choi Y. Carbon nanotube
biosensors with aptamers as molecular recognition elements and method for sensing target
material using the same. USA. - 2008.
327. Kurkina T., Vlandas A., Ahmad A., Kern K., Balasubramanian K. Label-free detection of few
copies of DNA with carbon nanotube impedance biosensors // Angew. Chem. Int. Ed. - 2011. V. 50. - N. 16. - P. 3710–3714.
328. Weizmann Y., Chenoweth D.M., Swager T.M. DNA-CNT nanowire networks for DNA
detection // J. Am. Chem. Soc. - 2011. - V. 133. - N. 10. - P. 3238–3241.
329. Wang J., Liu G., Lin Y., Kumar C.S.S.R. Nanotubes, nanowires and nanocantilevers in
biosensor developement // Nanomater. Biosens. / ed. Kumar C.S.S.R. Weinheim: Willey-VCH.
- 2007. - N. 8. - P. 56–100.
188
330. Zhang X., Jiao K., Liu S., Hu Y. Readily reusable electrochemical DNA hybridization biosensor
based on the interaction of DNA with sngle-walled carbon nanotubes // Anal. Chem. - 2009. V. 81. - N. 15. - P. 6006–6012.
331. Li X.M., Zhan Z.M., Ju H.Q., Zhang S.S. Label-free electrochemical detection of short
sequences related to the hepatitis B virus using 4,4’-diaminoazobenzene based on multiwalled
carbon nanotube-modified GCE // Oligonucleotides. - 2008. - V. 18. - N. 4. - P. 321–327.
332. Santiago-Rodríguez
L.,
Vargas-Barbosa
N.M.,
Sanchez-Pomales
G.,
Cabrera
C.R.
Bioelectrochemical sensing based on single stranded deoxyribonucleic acid-carbon nanotubes
covalently attached on gold electrodes // J. Nanosci. Nanotechnol. - 2009. - V. 9. - N. 4. - P.
2450–2455.
333. Santiago-Rodríguez L., Sánchez-Pomales G., Cabrera C.R. Single-walled carbon nanotubes
modified gold electrodes as an impedimetric DNA sensor // Electroanalysis. - 2010. - V. 22. - N.
4. - P. 399–405.
334. Li J., Ng H.T., Cassell A., Fan W., Chen H., Ye Q., Koehne J., Han J., Meyyappan M. Carbon
nanotube nanoelectrode array for ultrasensitive DNA detection // Nano Lett. - 2003. - V. 3. - N.
5. - P. 597–602.
335. Koehne J., Chen H., Li J., Cassell A.M., Ye Q., Tee H., Han J., Meyyappan M. Ultrasensitive
label-free DNA analysis using an electronic chip based on carbon nanotube nanoelectrode
arrays // Nanotechnology. - 2003. - V. 14. - N. 12. - P. 1239.
336. Li J., Meyyappan M., Cassell A.M. Biochemical sensors using carbon nanotubes arrays: letter
US7939734 B1 USA. US, US: NASA. - 2011.
337. Arumugam P.U., Chen H., Siddiqui S., Weinrich J.A.P., Jejelowo A., Li J., Meyyappan M.
Wafer-scale fabrication of patterned carbon nanofiber nanoelectrode arrays: A route for
development of multiplexed, ultrasensitive disposable biosensors // Biosens. Bioelectron. 2009. - V. 24. - N. 9. - P. 2818–2824.
338. Star A., Tu E., Niemann J., Gabriel J.C., Joiner C.S., Valcke C. Label-free detection of DNA
hybridization using carbon nanotube network field-effect transistors // Proc. Natl. Acad. Sci. U.
S. A. - 2006. - V. 103. - N. 4. - P. 921–926.
339. Sorgenfrei S., Chiu C., Gonzalez R.L., Yu Y.-J., Kim P., Nuckolls C., Shepard K.L. Label-free
single-molecule detection of DNA-hybridization kinetics with a carbon nanotube field-effect
transistor // Nat. Nanotechnol. - 2011. - V. 6. - N. 2. - P. 126–132.
340. Lee K.-J., So H.-M., Kim B.-K., Kim D., Jang J.-H., Kong K.-J., Chang H., Lee J.-O. Single
nucleotide polymorphism detection using Au-decorated single-walled carbon nanotube field
effect transistors // J. Nanomater. - 2011. - V. 2011. - P. 105138.
189
341. Dastagir T., Forzani E.S., Zhang R., Amlani I., Nagahara L.A., Tsui R., Tao N. Electrical
detection of hepatitis C virus RNA on single wall carbon nanotube-field effect transistors //
Analyst. - 2007. - V. 132. - N. 8. - P. 738–740.
342. Ko J.W., Woo J.-M., Jinhong A., Cheon J.H., Lim J.H., Kim S.H., Chun H., Kim E., Park Y.J.
Multi-order dynamic range DNA sensor using a gold decorated SWCNT random network //
ACS Nano. - 2011. - V. 5. - N. 6. - P. 4365–4372.
343. Mir M., Martínez-Rodríguez S., Castillo-Fernández O., Homs-Corbera A., Samitier J.
Electrokinetic techniques applied to electrochemical DNA biosensors // Electrophoresis. - 2011.
- V. 32. - N. 8. - P. 811–821.
344. Erdem A. Nanomaterial-based electrochemical DNA sensing strategies // Talanta. - 2007. - V.
74. - N. 3. - P. 318–325.
345. Bekyarova E., Haddon R.C., Parpura V., Kumar C.S.S.R. Biofunctionalization of carbon
nanotubes // Biofunctionalization of nanomaterials / ed. Kumar C.S.S.R. Weinheim: WilleyVCH. - 2007. - N. 1. - P. 41–71.
346. Bonanni A., Esplandiu M.J., del Valle M. Impedimetric genosensing of DNA polymorphism
correlated to cystic fibrosis: a comparison among different protocols and electrode surfaces //
Biosens. Bioelectron. - 2010. - V. 26. - N. 4. - P. 1245–1251.
347. Roy S., Vedala H., Roy A.D., Kim D.-H.H., Doud M., Mathee K., Shin H.K., Shimamoto N.,
Prasad V., Choi W. Direct electrical measurements on single-molecule genomic DNA using
single-walled carbon nanotubes // Nano Lett. - 2008. - V. 8. - N. 1. - P. 26–30.
348. Bonanni A., Esplandiu M.J., del Valle M. Impedimetric genosensors employing COOHmodified carbon nanotube screen-printed electrodes // Biosens. Bioelectron. - 2009. - V. 24. - N.
9. - P. 2885–2891.
349. Zhu N., Gao H., Xu Q., Lin Y., Su L., Mao L. Sensitive impedimetric DNA biosensor with
poly(amidoamine) dendrimer covalently attached onto carbon nanotube electronic transducers
as the tether for surface confinement of probe DNA // Biosens. Bioelectron. - 2010. - V. 25. - N.
6. - P. 1498–1503.
350. Truong T.N., Tran D.L., Vu T.H., Tran V.H., Duong T.Q., Dinh Q.K., Tsukahara T., Lee Y.H.,
Kim J.S. Multi-wall carbon nanotubes (MWCNTs)-doped polypyrrole DNA biosensor for labelfree detection of genetically modified organisms by QCM and EIS // Talanta. - 2010. - V. 80. N. 3. - P. 1164–1169.
351. Patel M.K., Ali M.A., Srivastava S., Agrawal V.V., Ansari S.G., Malhotra B.D. Magnesium
oxide grafted carbon nanotubes based impedimetric genosensor for biomedical application. //
Biosens. Bioelectron. - 2013. - V. 50. - P. 406–413.
190
352. Kim J., Elsnab J., Gehrke C., Li J., Gale B.K. Microfluidic integrated multi-walled carbon
nanotube (MWCNT) sensor for electrochemical nucleic acid concentration measurement //
Sens. Actuat. B. - 2013. - V. 185. - P. 370–376.
353. Wang S., Li L., Jin H., Yang T., Bao W., Huang S., Wang J. Electrochemical detection of
hepatitis B and papilloma virus DNAs using SWCNT array coated with gold nanoparticles. //
Biosens. Bioelectron. - 2013. - V. 41. - P. 205–210.
354. Tran H. V, Piro B., Reisberg S., Tran L.D., Duc H.T., Pham M.C. Label-free and reagentless
electrochemical detection of microRNAs using a conducting polymer nanostructured by carbon
nanotubes: Application to prostate cancer biomarker miR-141 // Biosens. Bioelectron. - 2013. V. 49. - P. 164–169.
355. Никитина И.И., Бондарь О.В., Хазихаметова Р.Р., Алимова Ф.К., Абдуллин Т.И.
Электрохимические ДНК-сенсоры на основе углеродных нанотрубок: обзор // Уч. Зап.
Каз. Гос. Ун-та. - 2007. - V. 149. - N. 3. - P. 115–129.
356. Абдуллин Т.И., Бондарь О.В., Ризванов А.А., Никитина И.И. Биосенсоры на основе
углеродных нанотрубок для характеристики структуры ДНК // Прикл. Биохим.
Микробиол. - 2009. - V. 45. - N. 2. - P. 252–256.
357. Shi J., Cha T.-G., Claussen J.C., Diggs A.R., Choi J.H., Porterfield D.M. Microbiosensors based
on DNA modified single-walled carbon nanotube and Pt black nanocomposites. // Analyst. 2011. - V. 136. - N. 23. - P. 4916–4924.
358. Zeng X., Li X., Liu X., Liu Y., Luo S., Kong B., Yang S., Wei W. A third-generation hydrogen
peroxide biosensor based on horseradish peroxidase immobilized on DNA functionalized
carbon nanotubes. // Biosens. Bioelectron. - 2009. - V. 25. - N. 4. - P. 896–900.
359. Jyothirmayee Aravind S.S.S., Ramaprabhu S. Noble metal dispersed multiwalled carbon
nanotubes immobilized ss-DNA for selective detection of dopamine // Sens. Actuat. B. - 2011. V. 155. - N. 2. - P. 679–686.
360. Zhou P., He L., Gan G., Ni S., Li H., Li W. Fabrication and evaluation of [Co(phen)2L]3+modified DNA-MWCNT and SDS-MWCNT electrodes for electrochemical detection of 6mercaptopurine // J. Electroanal. Chem. - 2012. - V. 665. - P. 63–69.
361. Brahman P.K., Dar R.A., Pitre K.S. DNA-functionalized electrochemical biosensor for
detection of vitamin B1 using electrochemically treated multiwalled carbon nanotube paste
electrode by voltammetric methods // Sens. Actuat. B. - 2013. - V. 177. - P. 807–812.
362. Lu X., Dong X., Zhang K., Zhang Y. An ultrasensitive electrochemical mercury(ii) ion
biosensor based on a glassy carbon electrode modified with multi-walled carbon nanotubes and
gold nanoparticles // Anal. Methods. - 2012. - V. 4. - N. 10. - P. 3326–3331.
191
363. Tombelli S., Mascini M. Aptamers as molecular tools for bioanalytical methods. // Curr. Opin.
Mol. Ther. - 2009. - V. 11. - N. 2. - P. 179–188.
364. So H.-M., Lee J.-O., Kim Y.H., Won K., Chang H., Riu B.H., Kong K.-J., Choi Y. Carbon
nanotube biosensors with aptamers as molecular recognition elements and method for sensing
target material using the same: letter US 7854826 B2 USA. KR. - 2010.
365. Liu S., Zhang X., Luo W., Wang Z., Guo X., Steigerwald M.L., Fang X. Single-molecule
detection of proteins using aptamer-functionalized molecular electronic devices // Angew.
Chem. Int. Ed. - 2011. - V. 50. - N. 11. - P. 2496–2502.
366. Kerman K., Morita Y., Takamura Y., Tamiya E. Escherichia coli single-strand binding proteinDNA interactions on carbon nanotube-modified electrodes from a label-free electrochemical
hybridization sensor. // Anal. Bioanal. Chem. - 2005. - V. 381. - N. 6. - P. 1114–1121.
367. Zelada-Guillen G.A., Riu J., Duzgun A., Rius F.X. Immediate detection of living bacteria at
ultralow concentrations using a carbon nanotube based potentiometric aptasensor // Angew.
Chem. Int. Ed. - 2009. - V. 48. - N. 40. - P. 7334–7337.
368. Liu X., Li Y., Zheng J., Zhang J., Sheng Q. Carbon nanotube-enhanced electrochemical
aptasensor for the detection of thrombin. // Talanta. - 2010. - V. 81. - N. 4-5. - P. 1619–1624.
369. Wu Z., Zhen Z., Jiang J.-H., Shen G.-L., Yu R.-Q. Terminal protection of small-moleculelinked DNA for sensitive electrochemical detection of protein binding via selective carbon
nanotube assembly. // J. Am. Chem. Soc. - 2009. - V. 131. - N. 34. - P. 12325–12332.
370. Chiu C.F., Dementev N., Borguet E. Fluorescence quenching of dyes covalently attached to
single-walled carbon nanotubes. // J. Phys. Chem. A. - 2011. - V. 115. - N. 34. - P. 9579–9584.
371. Yang R., Jin J., Chen Y., Shao N., Kang H., Xiao Z., Tang Z., Wu Y., Zhu Z., Tan W. Carbon
nanotube-quenched fluorescent oligonucleotides: probes that fluoresce upon hybridization // J.
Am. Chem. Soc. - 2008. - V. 130. - N. 26. - P. 8351–8358.
372. Nakayama-Ratchford N., Bangsaruntip S., Sun X., Welsher K., Dai H. Noncovalent
functionalization of carbon nanotubes by fluorescein-polyethylene glycol: supramolecular
conjugates with pH-dependent absorbance and fluorescence. // J. Am. Chem. Soc. - 2007. - V.
129. - N. 9. - P. 2448–2449.
373. Jung S., Cha M., Park J., Jeong N., Kim G., Park C., Ihm J., Lee J. Dissociation of single-strand
DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing // J. Am. Chem.
Soc. - 2010. - V. 132. - N. 32. - P. 10964–10966.
374. Liu Y., Wang Y., Jin J., Wang H., Yang R., Tan W. Fluorescent assay of DNA hybridization
with label-free molecular switch: reducing background-signal and improving specificity by
using carbon nanotubes. // Chem. Commun. - 2009. - V. 45. - N. 6. - P. 665–667.
192
375. Yang R., Tang Z., Yan J., Kang H., Kim Y., Zhu Z., Tan W. Noncovalent assembly of carbon
nanotubes and single-stranded DNA : an effective sensing platform for probing biomolecular
interactions // Anal. Chem. - 2008. - V. 80. - N. 19. - P. 7408–7413.
376. Ding X., Li H., Deng L., Peng Z., Chen H., Wang D. A novel homogenous detection method
based on the self-assembled DNAzyme labeled DNA probes with SWNT conjugates and its
application in detecting pathogen. // Biosens. Bioelectron. - 2011. - V. 26. - N. 11. - P. 4596–
4600.
377. Wang Y., Zhou D.-M., Wu Z., Tang L.-J., Jiang J.-H. Terminal protection of small moleculelinked ssDNA-SWNT nanoassembly for sensitive detection of small molecule and protein
interaction // Chin. Chem. Lett. - 2013. - V. 24. - N. 2. - P. 107–110.
378. Zhang Y., Li B., Yan C., Fu L. One-pot fluorescence detection of multiple analytes in
homogenous solution based on noncovalent assembly of single-walled carbon nanotubes and
aptamers // Biosens. Bioelectron. - 2011. - V. 26. - N. 8. - P. 3505–3510.
379. Chen H., Wang J., Liang G., Zhang P., Kong J. A novel exonuclease III aided amplification
method for sensitive nucleic acid detection based on single walled carbon nanotube induced
quenching. // Chem. Commun. - 2012. - V. 48. - N. 2. - P. 269–271.
380. Gao X., Xing G., Yang Y., Shi X., Liu R., Chu W., Jing L., Zhao F., Ye C., Yuan H., Fang X.,
Wang C., Zhao Y. Detection of trace Hg2+ via induced circular dichroism of DNA wrapped
around single-walled carbon nanotubes // J. Am. Chem. Soc. - 2008. - V. 130. - N. 29. - P.
9190–9191.
381. Zhang J., Boghossian A. a, Barone P.W., Rwei A., Kim J.-H., Lin D., Heller D. a, Hilmer A.J.,
Nair N., Reuel N.F., Strano M.S. Single molecule detection of nitric oxide enabled by d(AT)15
DNA adsorbed to near infrared fluorescent single-walled carbon nanotubes. // J. Am. Chem.
Soc. - 2011. - V. 133. - N. 3. - P. 567–581.
382. Karachevtsev V.A., Glamazda A.Y., Leontiev V.S., Lytvyn O.S., Dettlaff-Weglikowska U.
Glucose sensing based on NIR fluorescence of DNA-wrapped single-walled carbon nanotubes //
Chem. Phys. Lett. - 2007. - V. 435. - N. 1-3. - P. 104–108.
383. Fam D.W.H., Palaniappan A., Tok A.I.Y., Liedberg B., Moochhala S.M. A review on
technological aspects influencing commercialization of carbon nanotube sensors // Sens. Actuat.
B. - 2011. - V. 157. - N. 1. - P. 1–7.
384. Li Y., Han X., Deng Z. Grafting single-walled carbon nanotubes with highly hybridizable DNA
sequences: potential building blocks for DNA-programmed material assembly // Angew. Chem.
Int. Ed. - 2007. - V. 46. - N. 39. - P. 7481–7484.
385. Cheng E., Li Y., Yang Z., Deng Z., Liu D. DNA-SWNT hybrid hydrogel // Chem. Commun. 2011. - V. 47. - N. 19. - P. 5545–5547.
193
386. Sonay A.Y., Culha M. DNA-mediated self-assembly of single-walled carbon nanotubes into
nanorings. // Small. - 2013. - V. 9. - N. 12. - P. 2059–2063.
387. Han S., Maune H.T., Barish R.D., Bockrath M., Goddard W. a. DNA-linker-induced surface
assembly of ultra dense parallel single walled carbon nanotube arrays. // Nano Lett. - 2012. - V.
12. - N. 3. - P. 1129–1135.
388. Xu P.F., Noh H., Lee J.H., Cha J.N. DNA mediated assembly of single walled carbon
nanotubes: role of DNA linkers and annealing // Phys. Chem. Chem. Phys. - 2011. - V. 13. - N.
21. - P. 10004–10008.
389. Eskelinen A.P., Kuzyk A., Kaltiaisenaho T.K., Timmermans M.Y., Nasibulin A.G., Kauppinen
E.I., Torma P. Assembly of Single-Walled Carbon Nanotubes on DNA-Origami Templates
through Streptavidin-Biotin Interaction // Small. - 2011. - V. 7. - N. 6. - P. 746–750.
390. Maune H.T., Han S.-P., Barish R.D., Bockrath M., Iii W. a G., Rothemund P.W.K., Winfree E.
Self-assembly of carbon nanotubes into two-dimensional geometries using DNA origami
templates. // Nat. Nanotechnol. - 2010. - V. 5. - N. 1. - P. 61–66.
391. Mangalum A., Rahman M., Norton M.L. Site-specific immobilization of single-walled carbon
nanotubes onto single and one-dimensional DNA origami. // J. Am. Chem. Soc. - 2013. - V.
135. - N. 7. - P. 2451–2454.
392. Zhao Z., Liu Y., Yan H. DNA-mediated self-assembly of single-walled carbon nanotubes into
nanorings. // Org. Biomol. Chem. - 2013. - V. 11. - N. 4. - P. 596–598.
393. Lam C.-W., James J.T., McCluskey R., Cowper S., Balis J., Muro-Cacho C. Pulmonary toxicity
of simulated lunar and Martian dusts in mice: I. Histopathology 7 and 90 days after intratracheal
instillation. // Inhal. Toxicol. - 2002. - V. 14. - N. 9. - P. 901–916.
394. Sudibya H.G., Ma J., Dong X., Ng S., Li L.J., Liu X.W., Chen P. Interfacing glycosylated
carbon-nanotube-network devices with living cells to detect dynamic secretion of biomolecules
// Angew. Chem. Int. Ed. - 2009. - V. 48. - N. 15. - P. 2723–2726.
395. Montesa I., Munoz E., Benito A.M., Maser W.K., Martinez M.T. FTIR and thermogravimetric
analysis of biotin-functionalized single-walled carbon nanotubes // J. Nanosci. Nanotechnol. 2007. - V. 7. - N. 10. - P. 3473–3476.
396. Gonzalez M., Tort N., Benito A.M., Maser W., Marco M.P., Martinez M.T. Non-specific
adsorption of streptavidin on single walled carbon nanotubes // J. Nanosci. Nanotechnol. - 2009.
- V. 9. - N. 10. - P. 6149–6156.
397. Jimeno A., Goyanes S., Eceiza A., Kortaberria G., Mondragon I., Corcuera M.A. Effects of
amine molecular structure on carbon nanotubes functionalization // J. Nanosci. Nanotechnol. 2009. - V. 9. - N. 10. - P. 6222–6227.
194
398. Shi X., Wang S.H., Shen M., Antwerp M.E., Chen X., Li C., Petersen E.J., Huang Q., Weber
W.J., Baker Jr. J.R. Multifunctional dendrimer-modified multiwalled carbon nanotubes:
synthesis, characterization, and in vitro cancer cell targeting and imaging // Biomacromolecules.
- 2009. - V. 10. - N. 7. - P. 1744–1750.
399. Huang W., Lin Y., Taylor S., Gaillard J., Rao A.M., Sun Y.P. Sonication-assisted
functionalization and solubilization of carbon nanotubes // Nano Lett. - 2002. - V. 2. - N. 3. - P.
231–234.
400. Sarin V.K., Kent S.B., Tam J.P., Merrifield R.B. Quantitative monitoring of solid-phase peptide
synthesis by the ninhydrin reaction // Anal. Biochem. - 1981. - V. 117. - N. 1. - P. 147–157.
401. Cheng J., Fernando K.A.S., Veca L.M., Sun Y.-P., Lamond A.I., Lam Y.W., Cheng S.H.
Reversible accumulation of PEGylated single-walled carbon nanotubes in the mammalian
nucleus // ACS Nano. - 2008. - V. 2. - N. 10. - P. 2085–2094.
402. Majoros I.J., Myc A., Thomas T., Mehta C.B., Baker Jr. J.R. PAMAM dendrimer-based
multifunctional conjugate for cancer therapy: synthesis, characterization, and functionality //
Biomacromolecules. - 2006. - V. 7. - N. 2. - P. 572–579.
403. Bandow S., Asaka S., Saito Y., Rao A.M., Grigorian L., Richter E., Eklund P.C. Effect of the
growth temperature on the diameter distribution and chirality of single-wall carbon nanotubes //
Phys. Rev. Lett. - 1998. - V. 80. - N. 17. - P. 3779–3782.
404. Thomsen C., Reich S. Raman Scattering in Carbon Nanotubes // Light Scatt. Solid IX / ed.
Cardona M., Merlin R. Springer Berlin / Heidelberg. - 2007. - V. 108. - P. 115–234.
405. Andrada D.M., Vieira H.S., Oliveira M.M., Santos A.P., Yin L., Saito R., Pimenta M.A., Fantini
C., Furtado C.A. Dramatic increase in the Raman signal of functional groups on carbon
nanotube surfaces // Carbon. - 2013. - V. 56. - P. 235–242.
406. Glory J., Mierczynska A., Pinault M., Mayne-L’Hermite M., Reynaud C. Dispersion study of
long and aligned multi-walled carbon nanotubes in water // J. Nanosci. Nanotechnol. - 2007. V. 7. - N. 10. - P. 3458–3462.
407. Wang D., Ji W.X., Li Z.C., Chen L. A biomimetic “polysoap” for single-walled carbon
nanotube dispersion // J. Am. Chem. Soc. - 2006. - V. 128. - N. 20. - P. 6556–6557.
408. Blanch A.J., Lenehan C.E., Quinton J.S. Optimizing Surfactant Concentrations for Dispersion
of Single-Walled Carbon Nanotubes in Aqueous Solution // J. Phys. Chem. B. - 2010. - V. 114.
- N. 30. - P. 9805–9811.
409. Horn T., Urdea M.S. A chemical 5’-phosphorylation of oligodeoxyribonucleotides that can be
monitored by trityl cation release // Tetrahedron Lett. - 1986. - V. 27. - N. 39. - P. 4705–4708.
195
410. Garegg P.J., Lidh I., Regberg T., Stawinski J., Stromberg R., Henrichson C. Nucleoside Hphosphonates. IV. Automated solid phase synthesis of oligoribonucleotides by the
hydrogenphosphonate approach. // Tetrahedron Lett. - 1986. - V. 27. - N. 34. - P. 4055–4058.
411. Королева О.Н., Волков Е.М., Друца В.Л. Конструирование смешанных полимеров на
основе ДНК с консенсусными элементами промоторов, разделенных ненуклеотидными
участками. // Биоорган. Химия. - 1994. - V. 20. - N. 4. - P. 430–432.
412. Novopashina D.S., Sinyakov A.N., Ryabinin V.A., Venyaminova A.G., Halby L., Sun J.-S.,
Boutorine A.S. Sequence-specific conjugates of oligo(2′-O-methylribonucleotides) and hairpin
oligocarboxamide minor-groove binders: design, synthesis, and binding studies with doublestranded DNA // Chem. Biodiv. - 2005. - V. 2. - N. 7. - P. 936–952.
413. Zarytova V.F., Godovikova T.S., Kutyavin I. V, Khalimskaya L.M. Reactive oligonucleotide
derivatives as affinity reagents and probes in molecular biology // Biophosphates and their
analogues, synthesis, structure, metabolism and activity / ed. Bruzik K.S., Stec W.S.
Amsterdam: Elsevier. - 1987. - P. 149–164.
414. Новопашина Д.С., Тоцкая О.С., Холодарь С.А., Мещанинова М.И., Веньяминова А.Г.
Олиго(2’-О-метилрибонуклеотиды) и их производные. III. 5'-Моно- и 5'-бис-пиренильные
конъюгаты олиго(2'-О-метилрибонуклеотидов) и их 3'-модифицированных аналогов:
синтез и свойства. // Биоорган. химия. - 2008. - V. 34. - N. 5. - P. 671–682.
415. Müller K., Richert C. The unlikely surfactant: DNA as a ligand for single-walled carbon
nanotubes // Carbon Nanotubes / ed. Marulanda J.M. In-Tech. - 2010. - P. 749–766.
416. Yang K., Wang X., Zhu L., Xing B. Competitive sorption of pyrene, phenanthrene, and
naphthalene on multiwalled carbon nanotubes // Environ. Sci. Technol. - 2006. - V. 40. - N. 18.
- P. 5804–5810.
417. Позмогова Г.Е., Чувилин А.Н., Смирнов И.П., Зайцева М.А., Татаринова О.Н., Говорун
В.М. Получение и свойства ассоциатов наночастиц никеля с ss-ДНК и белками // Рос.
Нанотехнол. - 2008. - V. 3. - N. 5-6. - P. 198–204.
418. Aigner A. Gene silencing through RNA interference (RNAi) in vivo: strategies based on the
direct application of siRNAs. // J. Biotechnol. - 2006. - V. 124. - N. 1. - P. 12–25.
419. Logashenko E.B., Vladimirova A. V, Repkova M.N., Venyaminova A.G., Chernolovskaya E.L.,
Vlassov V. V. Silencing of MDR 1 gene in cancer cells by siRNA. // Nucleosides Nucleotides
Nucl. Acids. - 2004. - V. 23. - N. 6-7. - P. 861–866.
420. Круглова Н.С., Мещанинова М.И., Веньяминова А.Г., Зенкова М.А., Власов В.В.,
Черноловская Е.Л. Холестерин-модифицированные малые интерферирующие РНК,
направленные на мРНК гена MDR1: внутриклеточная доставка и биологическая
активность // Молекулярн. Биология. - 2010. - V. 44. - N. 2. - P. 284–293.
196
421. De Paula D., Bentley M.V.L.B., Mahato R.I. Hydrophobization and bioconjugation for
enhanced siRNA delivery and targeting // RNA. - 2007. - V. 13. - N. 4. - P. 431–456.
422. Kubo T., Zhelev Z., Ohba H., Bakalova R. Chemically modified symmetric and asymmetric
duplex RNAs: an enhanced stability to nuclease degradation and gene silencing effect. //
Biochem. Biophys. Res. Commun. - 2008. - V. 365. - N. 1. - P. 54–61.
423. Zhang K., Wang Q., Xie Y., Mor G., Sega E., Low P.S., Huang Y. Receptor-mediated delivery
of siRNAs by tethered nucleic acid base-paired interactions. // RNA. - 2008. - V. 14. - N. 3. - P.
577–583.
424. Tijsterman M., Plasterk R.H.A. Dicers at RISC: The Mechanism of RNAi // Cell. - 2004. - V.
117. - N. 1. - P. 1–3.
425. Goodwin E.C., Rottman F.M. The use of RNase H and poly(A) junction oligonucleotides in the
analysis of in vitro polyadenylation reaction products. // Nucleic Acids Res. - 1992. - V. 20. - N.
4. - P. 916.
426. Shibahara S., Mukai S., Nishiharal T., Inoue H., Ohtsuka E., Morisawa H. Site-directed
cleavage of RNA // Nucleic Acids Res. - 1987. - V. 15. - N. 11. - P. 4403–4415.
427. Donis-Keller H. Site specific enzymatic cleavage of RNA // Nucleic Acids Res. - 1979. - V. 7. N. 1. - P. 179–192.
428. Carmichael J., DeGraff W.G., Gazdar A.F., Minna J.D., Mitchell J.B. Evaluation of a
Tetrazolium-based Semiautomated Colorimetric Assay: Assessment of Chemosensitivity
Testing // Cancer Res. - 1987. - V. 47. - N. 4. - P. 936–942.
429. Vashist S.K., Zheng D., Al-Rubeaan K., Luong J.H.T., Sheu F.-S. Advances in carbon nanotube
based electrochemical sensors for bioanalytical applications. // Biotechnol. Adv. - 2011. - V. 29.
- N. 2. - P. 169–188.
430. Yan Y., Chan-Park M.B., Zhang Q. Advances in carbon-nanotube assembly // Small. - 2007. V. 3. - N. 1. - P. 24–42.
431. Huang L., Jia Z., O’Brien S. Orientated assembly of single-walled carbon nanotubes and
applications // J. Mater. Chem. - 2007. - V. 17. - N. 37. - P. 3863–3874.
432. Shah R., Zhang X., Talapatra S. Electrochemical double layer capacitor electrodes using aligned
carbon nanotubes grown directly on metals // Nanotechnology. - 2009. - V. 20. - N. 39. - P.
395202.
433. Diao P., Liu Z. Vertically aligned single-walled carbon nanotubes by chemical assembly –
methodology, properties, and applications // Adv. Mater. - 2010. - V. 22. - N. 13. - P. 1430–
1449.
434. Palecek E., Bartosik M. Electrochemistry of nucleic acids // Chem. Rev. - 2012. - V. 112. - N. 6.
- P. 3427–3481.
197
435. Sánchez-Pomales G., Pagán-Miranda C., Santiago-Rodríguez L., Cabrera C.R. DNA-wrapped
carbon nanotubes: from synthesis to applications // Carbon Nanotubes / ed. Marulanda J.M. InTech. - 2010. - P. 721–748.
436. Borer P.N. Optical properties of nucleic acids, absorption and circular dichroism spectra. //
Handbook of Biochemistry and Molecular Biology, 3rd Edn. / ed. Fasman G.D. Cleveland, OH:
CRC Press. - 1975. - V. V.1.
437. Добриков М.И., Гайдамаков С.А., Кошкин А.А., Гуйнутдинов Т.И., Лукъянчук Н.П.,
Шишкин Г.В., Власов В.В. Сенсибилизированная фотомодификация ДНК бинарными
системами
I.
Синтез
олигонуклеотидных
реагентов,
влияние
их
строения
на
эффективность модификации мишени // Биоорган. химия. - 1997. - V. 23. - N. 3. - P. 191–
199.
438. Kudashov A.G., Kurenya A.G., Okotrub A. V., Gusel’nikov A. V., Danilovich V.S., Bulusheva
L.G. Synthesis and structure of films consisting of carbon nanotubes oriented normally to the
substrate // Tech. Phys. - 2007. - V. 52. - N. 12. - P. 1627–1631.