RU 2 518 301 C1

РОССИЙСКАЯ ФЕДЕРАЦИЯ
(19)
RU
(11)
(51) МПК
C12Q 1/68
(13)
2 518 301
C1
(2006.01)
ФЕДЕРАЛЬНАЯ СЛУЖБА
ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ
(12) ОПИСАНИЕ
(21)(22) Заявка:
ИЗОБРЕТЕНИЯ К ПАТЕНТУ
2012155611/10, 21.12.2012
(24) Дата начала отсчета срока действия патента:
21.12.2012
(45) Опубликовано: 10.06.2014 Бюл. № 16
(56) Список документов, цитированных в отчете о
поиске: LOUGHLIN J. ET AL., Differential
C 1
2 5 1 8 3 0 1
R U
(54) СПОСОБ ОПРЕДЕЛЕНИЯ ГЕНОТИПА ЧЕЛОВЕКА ПО ПОЛИМОРФИЗМУ В ГЕНЕ
КОЛЛАГЕНА II ТИПА COL2A1 C>A (RS1635529)
(57) Реферат:
Изобретение относится к биотехнологии и
состава: COL2_29s TCTTGCCCAAAGGCTAGGCGпредставляет собой способ определения генотипа
GA, COL2_29a CCAGAGGGCGAGAAAGAAACGA,
человека по полиморфизму в гене коллагена II
COL2_29p1
AAAAAGGAAAGTTTATC-FAM,
типа COL2A1 С>А (rs1635529). Данный способ
COL2_29p2
AAAAAGGAACGTTTATC-HEX,
может быть использован при диагностике
COL2_29pq BHQ 1-TTTGGATTTTCACTCTCTT-3′заболеваний пародонта в ротовой полости.
(P), где FAM - означает флуоресцентный
Способ включает снятие кривых плавления с
краситель FAM, HEX - означает флуоресцентный
флуоресцентно-меченными аллель-специфичными
краситель HEX, BHQ1 - означает присоединенный
олигонуклеотидными пробами. Используют
к 5′-концевому нуклеотиду темновой гаситель
общую для всех аллелей пару праймеров,
флуоресценции. Относят образец к гомозиготе
отличающиеся
для
каждого
аллеля
или гетерозиготе по данному аллелю по анализу
флуоресцентно-меченные аллель-специфичные
форм кривых плавления ДНК, а именно по
олигонуклеотидные пробы и универсальный
максимуму первой производной графиков
олигонуклеотид,
меченный
гасителем
флуоресценции. Предложенное изобретение
флуоресценции, следующего нуклеотидного
позволяет
более
доступно
проводить
Стр.: 1
C 1
Адрес для переписки:
117585, Москва, Варшавское ш., 125ж, корп. 6,
Закрытое акционерное общество "Научнопроизводственная фирма ДНК-Технология",
для Елисеевой Екатерины Викторовны
2 5 1 8 3 0 1
allelic expression of the type octeoarthritis
cartilage. Am. J. Hum. Genet. 1995, v.56, р.11861199. US 0005948611 A1 (THOMAS
JEFFERSON UNIVERSITY), 07.09.1999, фиг.
2, описание к фиг. 2. US 0007718366 B2
(NATIONAL HEALTH RESEARCH
INSTITUTES), 18.05.2010, колонка 15. . US
0005874212 A1 (THOMAS JEFFERSON
UNIVERSITY), (см. прод.)
(73) Патентообладатель(и):
Закрытое акционерное общество "Научнопроизводственная фирма ДНК-Технология"
(RU)
R U
Приоритет(ы):
(22) Дата подачи заявки: 21.12.2012
(72) Автор(ы):
Ребриков Денис Владимирович (RU),
Зорина Оксана Александровна (RU),
Петрухина Наталия Борисовна (RU),
Борискина Ольга Андреевна (RU),
Беркутова Ирина Сергеевна (RU),
Аймадинова Нелли Камильевна (RU)
исследования по определению полиморфизма в
гене коллагена II типа COL2A1 С>А (rs1635529)
генотипа человека. 1 ил., 2 табл.
R U
2 5 1 8 3 0 1
C 1
C 1
2 5 1 8 3 0 1
R U
(56) (продолжение):
23.02.1999, фиг. 3, описание к фиг. 3. . RU 2249210 C2 (ГУН "РОССИЙСКИЙ НАУЧНОИССЛЕДОВАТЕЛЬСКИЙ ИНСТИТУТ ТРАВМАТОЛОГИИ И ОРТОПЕДИИ ИМ. Р.Р.
ВРЕДЕНА" (RU)), 27.03.2005, с. 1 описания
Стр.: 2
RUSSIAN FEDERATION
(19)
RU
(11)
(51) Int. Cl.
C12Q 1/68
(13)
2 518 301
C1
(2006.01)
FEDERAL SERVICE
FOR INTELLECTUAL PROPERTY
(12) ABSTRACT
(21)(22) Application:
OF INVENTION
2012155611/10, 21.12.2012
(24) Effective date for property rights:
21.12.2012
(45) Date of publication: 10.06.2014 Bull. № 16
C 1
2 5 1 8 3 0 1
(54) METHOD OF DETERMINING HUMAN GENOTYPE ON POLYMORPHISM IN TYPE II COLLAGEN
GENE COL2A1 C>A (RS1635529)
(57) Abstract:
FIELD: biotechnology.
EFFECT: proposed invention enables to carry out
SUBSTANCE: invention is a method of determining
studies more accessibly to determine the polymorphism
the human genotype on polymorphism in type II collain the type II collagen gene COL2A1 of human genogen gene COL2A1 C>A (rs1635529). This method can
type.
be used in diagnostics of periodontal disease in the oral
1 dwg, 2 tbl
cavity. The method comprises taking of the melting
curves with fluorescently labelled allele-specific
oligonucleotide samples. The pair of primers common
to all alleles is used, fluorescently labelled allele-specific oligonucleotide samples different for each allele and
a universal oligonucleotide labelled with fluorescence
extinguisher of the following nucleotide composition:
COL2_29s
TCTTGCCCAAAGGCTAGGCGGA,
COL2_29a
CCAGAGGGCGAGAAAGAAACGA,
COL2_29p1
AAAAAGGAAAGTTTATC-FAM,
COL2_29p2
AAAAAGGAACGTTTATC-HEX,
COL2_29pq BHQ 1-TTTGGATTTTCACTCTCTT-3'(P), where FAM is a fluorescent dye FAM, HEX is a
fluorescent dye HEX, BHQ1 is dark fluorescence extinguisher attached to the 5'-terminal nucleotide. The
sample refers to homozygote or heterozygote for this
allele by analysis of DNA melting curves forms,
namely, the maximum of the first derivative of the fluorescence graphs.
Стр.: 3
C 1
R U
(73) Proprietor(s):
Zakrytoe aktsionernoe obshchestvo "Nauchnoproizvodstvennaja firma DNK-Tekhnologija"
(RU)
2 5 1 8 3 0 1
Mail address:
117585, Moskva, Varshavskoe sh., 125zh, korp. 6,
Zakrytoe aktsionernoe obshchestvo "Nauchnoproizvodstvennaja firma DNK-Tekhnologija", dlja
Eliseevoj Ekateriny Viktorovny
R U
Priority:
(22) Date of filing: 21.12.2012
(72) Inventor(s):
Rebrikov Denis Vladimirovich (RU),
Zorina Oksana Aleksandrovna (RU),
Petrukhina Natalija Borisovna (RU),
Boriskina Ol'ga Andreevna (RU),
Berkutova Irina Sergeevna (RU),
Ajmadinova Nelli Kamil'evna (RU)
RU
5
10
15
20
25
30
35
40
45
2 518 301 C1
1. Область техники
Предложенный способ относится к области медицины, биологии и биотехнологии
и может быть использован при диагностике заболеваний пародонта в ротовой полости,
прогнозирования тяжести и скорости прогрессии заболевания и алгоритма лечения
заболевания в зависимости от индивидуального генетического профиля пациента.
На протяжении многих лет заболевания пародонта стабильно занимают по
распространенности одно из ведущих мест в мире. Несмотря на широкое развитие
инструментальных и лабораторных методов исследования ранняя и точная диагностика
различных стоматологических заболеваний до сих пор остается крайне актуальным
вопросом.
Известно, что развитие и течение любого заболевания бактериальной природы
определяется силой ответной реакции организма, которая, в свою очередь, зависит не
только от приобретенного иммунитета, но в значительной степени определяется
генотипом человека. За последние 10-15 лет получены первые результаты по
идентификации генетических маркеров пародонтита. Установлена ассоциация с
пародонтитом полиморфных локусов генов цитокинов, коллагена 1 типа, антигенов
HLA, рецептора витамина D, ряда ферментов и регуляторных молекул (Brett P.M. et al.,
2005; Agrawal A.A. et al., 2006; Tervonen T. et al., 2007; Wagner J. et al., 2007; Pirhan D. et al.,
2007; Scarel-Caminaga R.M. et al., 2011).
Коллагены составляют основу соединительной ткани организма и обеспечивают ее
прочность и эластичность. Последние работы указывают на возможную взаимосвязь
полиморфизма коллагенов с развитием заболеваний соединительной ткани, таких как
остеопороз, остеоартрит, фиброз подслизистой и т.п. Kuivaniemi с соавторами
проанализировали 278 полиморфных локусов в генах коллагена I, II, III, IX, X и XI
типов у 317 пациентов. В результате было сделано заключение, что отдельные варианты
коллагена способствуют развитию некоторых заболеваний костей, хрящей и
кровеносных сосудов.
Статистически значимые отличия по частоте встречаемости генотипов были
обнаружены для полиморфизма в гене коллагена COL2A1 С>A (rs1635529). Частота
встречаемости аллеля С была достоверно выше в основной группе по сравнению с
контролем. Гомозиготный вариант СС в исследованном локусе у пациентов с
пародонтитом встречался в 1,5 раза чаще, чем в группе здоровых лиц (Зорина, 2011).
2. Уровень техники
Широко распространен способ определения типа нуклеотида, находящегося в
определенном месте ДНК, основанный на использовании аллель-специфичных
праймеров с регистрацией результатов ПЦР по окончании реакции с помощью
электрофореза. При использовании ПЦР с регистрацией результатов в ходе реакции
известны различные способы определения генотипа исследуемого образца.
Существуют различные способы, позволяющие определить тип нуклеотида,
находящегося в определенном месте ДНК, основанные на использовании аллельспецифичных праймеров с регистрацией результатов ПЦР непосредственно в ходе
реакции с помощью использования флуоресцентно-меченных проб (олигонуклеотидов)
(Andreas R. Tobler at all, ″THE SNPlex Genotiping System: A Flexible and Scalable Platform
for SNP Genotyping″, Journal of Biomolecular Techniques, V. 16, issue 4, Desember 2005).
Например, в наборах производства Applied Biosystems используют одну пару
праймеров для каждого аллеля и два зонда с различными флуорецентными метками,
в зависимости от генотипа аллеля фиксируют разгорание различных меток (″TaqMan
SNP Genotyping Assays″, Applied Biosistems, Prodakt Bulletin, USA, 06/2006). Недостатком
Стр.: 4
RU
5
10
15
20
25
30
35
40
45
2 518 301 C1
способа, используемого в данных наборах, является сравнительно невысокая
достоверность результатов исследования из-за небольшой разницы между получаемыми
кривыми флуоресценции для разных аллелей.
Предлагаемым подходом к детекции генетического полиморфизма является
использование двух аллель-специфичных и меченных разными флуоресцентными
метками олигонуклеотидов, а также олигонуклеотида, несущего гаситель флуоресценции
и гибридизирующегося на матрицу рядом с аллель-специфичным олигонуклеотидом.
Гибридизация аллель-специфичного олигонуклеотида на матрицу ведет к переносу
энергии с находящегося на нем флуорофора-донора на гаситель флуоресценции
расположенного рядом «гасящего» олигонуклеотида. Регистрацию результатов
амплификации ведут по окончании ПНР путем снятия спектра флуоресценции при
изменении температуры реакционной смеси в диапазоне от 25 до 80 градусов по Цельсию
(так называемые «кривые плавления»). При получении графиков флуоресценции
возможен как нагрев, так и охлаждение реакционной смеси в указанном интервале
температур.
Предлагаемое изобретение делает определение вариабельных позиций в ДНК более
надежным и удешевляет подобные исследования благодаря использованию стандартного
оборудования.
3. Раскрытие изобретения
Техническим результатом, на достижение которого направлено предлагаемое
изобретение, является повышение доступности подобных исследований, поскольку
способ может быть осуществлен на стандартном известном оборудовании. Также он
обеспечивает возможность проводить исследование в одной пробирке, что снижает
затраты на исследование.
Использованный нами способ генотипирования является вариантом классического
метода «примыкающих проб». При определении замен одиночных нуклеотидов вначале
проводили ПЦР с праймерами, общими для обоих вариантов последовательности,
затем температуру реакционной смеси снижали для гибридизации полученной матрицы
с олигонуклеотидными пробами. Для определения варианта последовательности
использовали два типа олигонуклеотидов, гибридизирующихся на матрицу рядом. Один
из олигонуклеотидов метили флуорофором, другой - гасителем флуоресценции.
В реакции использовали один общий олигонуклеотид с гасителем флуоресценции и
пару аллель-специфичных (сиквенс-специфичных) олигонуклеотидов, несущих
флуорофор. Олигонуклеотидные пробы, соответствующие тому или иному варианту
последовательности, метили различными флуорофорами, что позволило определять
оба варианта в одной пробирке. Определение генотипа проводили после ПЦР и
гибридизации путем измерения уровня флуоресценции в ходе температурной денатурации
дуплексов олигонуклеотидов и полученных матриц (или наоборот - гибридизации).
Данное измерение проводили в режиме реального времени, его результатом являлись
кривые плавления.
Условия реакции подбирали так, чтобы максимизировать разницу в температурах
плавления совершенного и несовершенного дуплексов. Таким образом, если
анализируемый образец содержал только один вариант последовательности, т.е. был
гомозиготен по данному полиморфизму, температура плавления для пробы образующей
совершенный дуплекс была существенно выше, нежели для пробы образующей
несовершенный дуплекс. Если же анализировали гетерозиготный образец, температуры
плавления были практически одинаковы.
Указанный результат достигается путем использования при постановке ПЦР
Стр.: 5
RU
2 518 301 C1
флуоресцентно-меченных аллель-специфичных олигонуклеотидных проб и праймеров:
5
COL2J9s
TCTTGCCCAAAGGCTAGGCGGA
COL2_29a
CCAGAGGGCGAGAAAGAAACGA
COL2_29p1
AAAAAGGAAAGTTTATC-FAM
COL2_29p2
AAAAAGGAACGTTTATC-HEX
COL2_29pq
BHQ 1-TTTGGATTTTCACTCTCTT-3′-(P)
FAM - означает флуоресцентный краситель FAM, HEX - означает флуоресцентный
краситель HEX, BHQ1 - означает присоединенный к 5′-концевому нуклеотиду темновой
гаситель флуоресценции.
10
Состав амплификационной смеси (на одну реакцию)
Компонент
15
20
25
30
35
40
45
Концентрация
Объем
ПЦР - буфер*
1,25 кратный
18 мкл
смесь dNTP
0,25 мМ (каждого)
0,24 мкл
Праймеры
100 пМ/мкл
по 0,14 мкл
Олигонуклеотиды, меченные флуорофорами
100 пМ/мкл
по 0,07 мкл
Олигонуклеотид, меченный гасителем флуоресценции
100 пМ/мкл
0,14 мкл
Тод-полимераза
10 ед.
активности/мкл
0,5 мкл
Н2O (деионизированная)
-
до 30 мкл
Геномная ДНК
-
5 мкл
*Состав буфера для проведения ПЦР
84 mМ Трис-HCl рН 8,6
21 mM(NH4)2SO4
3,1 mМ MgCl2
0,003% Tween-20
0,003% NP-40
6,25% глицерин
4. Осуществление изобретения
В качестве материала для исследования рекомендуется использовать кровь, соскобы
буккального эпителия, биоптаты мягких тканей человека или иной стандартный
биологический материал. Выделение ДНК из биоматериала производится с
использованием комплекта реагентов для выделения ДНК (не является предметом
данного патента).
Полимеразную цепную реакцию и определение температуры плавления
олигонуклеотидных проб проводили с помощью детектирующего амплификатора
«ДТпрайм» (ООО «НПО ДНК-Технология», Россия). Использовали следующий
температурный режим амплификации: 94°С - 10 с, 64°С - 30 с в течение 50 циклов. По
завершении реакции амплификации реакционную смесь остужали до 25°С со скоростью
2°С/сек. Кривые плавления получали следующим образом: температуру реакционной
смеси повышали с 25°С до 75°С с шагом 1°С, измеряя уровень флуоресценции на каждом
шаге.
Результаты, т.е. отнесение образца к гомозиготе или гетерозиготе по данному аллелю,
оцениваются по форме кривых плавления ДНК (рис 1).
Список литературы
1. Agrawal А.А., Kapley A., Yeltiwar R.K. et al. Assessment of single nucleotide polymorphism
at IL-1A14845 and IL-1B13954 as genetic susceptibility test for chronic periodontitis in Maharashtrian ethnicity. // J. Periodontol. - 2006. - Vol.77. - P.1515-1521.
2. Brett P.M., Zygogianni P., Griffiths G.S. et al. Functional gene polymorphisms in aggressive
and chronic periodontitis. // J. Dent. Res. - 2005. - Vol.84, №12. - P.1149-1153.
3. Pirhan D., Atilla G., Emingil G. et al. Effect of MMP-1 promoter polymorphisms on GCF
MMP-1 levels and outcome of periodontal therapy in patients with severe chronic periodontitis.
Стр.: 6
RU
5
10
15
20
25
30
2 518 301 C1
// J. Clin. Periodontol. - 2008. - Vol.35, №10. - P.862-870.
4. Scarel-Caminaga R.M., Trevilatto P.C., Souza A.P. et al. Investigation of IL4 gene polymorphism in individuals with different levels of chronic periodontitis in a Brazilian population. // J.
Clin. Periodontol. - 2003. - Vol.30. - P.341-345.
5. Tervonen Т., Raunio Т., Knuuttila M. et al. Polymorphisms in the CD 14 and IL-6 genes
associated with periodontal disease. // J. Clin. Periodontol. - 2007. - Vol.34. - P.377-383.
6. Wagner J., Kaminski W.E., Aslanidis C. Prevalence of OPG and IL-1 gene polymorphisms
in chronic periodontitis. // J. Clin. Periodontol. - 2007. - Vol.34. - P.823-827.
7. Зорина O.A. Взаимосвязь качественного и количественного состава биоценозов
ротовой полости и индивидуального генетического профиля на фоне воспалительных
заболеваний пародонта. // Автореферат диссертации - М., 2011.
Формула изобретения
Способ определения генотипа человека по полиморфизму в гене коллагена II типа
COL2A1 С>А (rs1635529), основанный на снятии кривых плавления с флуоресцентномеченными аллель-специфичными олигонуклеотидными пробами, отличающийся тем,
что используют общую для всех аллелей пару праймеров, отличающиеся для каждого
аллеля флуоресцентно-меченные аллель-специфичные олигонуклеотидные пробы и
универсальный олигонуклеотид, меченный гасителем флуоресценции, следующего
нуклеотидного состава:
COL2_29s
TCTTGCCCAAAGGCTAGGCGGA
COL2_29a
CCAGAGGGCGAGAAAGAAACGA
COL2_29p1
AAAAAGGAAAGTTTATC-FAM
COL2_29p2
AAAAAGGAACGTTTATC-HEX
COL2_29pq
BHQ 1-TTTGGATTTTCACTCTCTT-3′-(P)
FAM - означает флуоресцентный краситель FAM, HEX - означает флуоресцентный
краситель HEX, BHQ1 - означает присоединенный к 5′-концевому нуклеотиду темновой
гаситель флуоресценции;
отнесение образца к гомозиготе или гетерозиготе по данному аллелю оценивается
по форме кривых плавления ДНК, по максимуму первой производной графиков
флуоресценции.
35
40
45
Стр.: 7