close

Вход

Забыли?

вход по аккаунту

...конкурентной процедуры в форме запроса предложений;pdf

код для вставкиСкачать
ПЕРВЫЙ САНКТ-ПЕТЕРБУРГСКИЙ ГОСУДАРСТВЕННЫЙ МЕДИЦИНСКИЙ
УНИВЕРСИТЕТ ИМЕНИ АКАДЕМИКА И.П. ПАВЛОВА
На правах рукописи
Горбунова Анна Валерьяновна
ПРОГНОСТИЧЕСКОЕ ЗНАЧЕНИЕ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИХ
ХАРАКТЕРИСТИК У БОЛЬНЫХ ХРОНИЧЕСКИМ МИЕЛОЛЕЙКОЗОМ
ПРИ АЛЛОГЕННОЙ ТРАНСПЛАНТАЦИИ ГЕМОПОЭТИЧЕСКИХ
СТВОЛОВЫХ КЛЕТОК
Специальность 14.01.21 - гематология и переливание крови
Диссертация на соискание ученой степени
кандидата биологических наук
Научный руководитель:
доктор медицинских наук, профессор
Мамаев Николай Николаевич
Санкт-Петербург - 2014
2
ОГЛАВЛЕНИЕ
ВВЕДЕНИЕ….………………………………………………………………………....4
ГЛАВА 1. МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЕ АСПЕКТЫ ПАТОГЕНЕЗА И
ТЕРАПИИ ХРОНИЧЕСКОГО МИЕЛОЛЕЙКОЗА (ОБЗОР ЛИТЕРАТУРЫ).......10
1.1.Клиническая и молекулярно-биологическая характеристика
хронического миелолейкоза………………………………………….……….10
1.1.1. Клиническая характеристика хронического миелолейкоза…...10
1.1.2. Молекулярная биология хронического миелолейкоз……….....12
1.1.3. Молекулярные механизмы прогрессии заболевания…..…..…..18
1.2. Ингибиторы тирозинкиназ в терапии хронического миелолейкоза…...22
1.2.1. Структура и механизм действия ингибиторов
тирозинкиназ.………………………………………………………...….22
1.2.2. Молекулярно-биологические механизмы резистентности к
ингибиторам тирозинкиназ………………………………………….….25
1.3. Аллогенная трансплантация гемопоэтических стволовых клеток при
хроническом миелолейкозе…………………………………………..……..…35
1.3.1. Эффективность и безопасность аллоТГСК………….…….…....35
1.3.2. Прогностические факторы, влияющие на исход
трансплантации…………………………………………….……………37
1.3.3. Роль аллогенной трансплантации в эпоху ингибиторов
тирозинкиназ………………………………………….…………...…….42
ГЛАВА 2. МЕТОДЫ ИССЛЕДОВАНИЯ И ХАРАКТЕРИСТИКА
ПАЦИЕНТОВ……….………….............................................................................…..46
2.1. Характеристика пациентов …………………………………………….....46
2.2. Метод исследования уровня относительной экспрессии транскриптов
химерного гена BCR-ABL………………..………………………..……….…..48
2.3. Методы исследования мутационного статуса гена BCR-ABL……….....50
2.4. Метод исследования уровня относительной экспрессии гена EVI1…...53
2.5. Статистическая обработка данных……………………………………....55
3
ГЛАВА 3. РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ ……………….……………………56
3.1. Молекулярно-генетические характеристики больных ХМЛ с
резистентностью к ингибиторам тирозинкиназ……………………………...56
3.1.1. Уровень экспрессии транскрипта р210 BCR-ABL ………....…...56
3.1.2. Коэкспрессия транскрипта р190 BCR-ABL...................................58
3.1.3. Спектр и частота мутаций в киназном домене гена BCRABL……………………………………………………………........….…60
3.1.4. Экспрессия гена EVI1………………………..…………………...68
3.2. Анализ влияния молекулярно-генетических факторов на эффективность
аллоТГСК у больных ХМЛ с резистентностью к ингибиторам
тирозинкиназ……………………………………………………………………72
3.2.1. Результаты аллоТГСК…………..…………………………….….73
3.2.2. Прогностическое значение уровня экспрессии транскрипта
р210 BCR-ABL …………………………………...……………………....74
3.2.3. Прогностическое значение коэкспрессии транскрипта р190
BCR-ABL …………………..………………………………………..……78
3.2.4. Прогностическое значение мутаций в киназном домене гена
BCR-ABL …...…………………………………………………………….83
3.2.5. Прогностическое значение уровня экспрессии гена EVI1……..93
ГЛАВА 4. ОБСУЖДЕНИЕ……......……………………………………..…….……102
ВЫВОДЫ…………………………………………...…………………..……………111
ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ ………………………………………...….113
СПИСОК СОКРАЩЕНИЙ …………………………………….…...………………114
СПИСОК ЛИТЕРАТУРЫ………………………………………..……………….....115
4
ВВЕДЕНИЕ
Актуальность темы исследования
Хронический миелолейкоз (ХМЛ) – это заболевание крови опухолевой
природы,
основным
проявлением
которого
является
пролиферация
гемопоэтических стволовых клеток, на начальных этапах заболевания способных
к созреванию. При ХМЛ в опухолевых клетках выявляется так называемая
Филадельфийская (Ph) хромосома (Nowell P.C. et al., 1960). Это специфическое
нарушение кариотипа возникает вследствие сбалансированной реципрокной
транслокации t(9;22)(q34;q11). На молекулярном уровне возникновение Phхромосомы приводит к возникновению химерного гена BCR-ABL, кодирующего
конститутивно активную тирозинкиназу (Melo J.V. et al., 2007). В ряде
экспериментов было продемонстрировано, что активность белка BCR-ABL
необходима для поддержания лейкемического фенотипа клеток (Daley G.Q. et al.,
1990; Kelliher M.A. et al., 1990; Heisterkamp N. et al., 1990).
Исследования патогенеза ХМЛ на молекулярном уровне позволили
подобрать низкомолекулярные соединения, способные специфически связываться
с белком BCR-ABL и подавлять его тирозинкиназную активность. Ингибиторы
тирозинкиназ
показали
чрезвычайно
высокую
эффективность
как
в
исследованиях in vitro и in vivo, так и в клинической практике. C 2001 года
ингибитор тирозинкиназ иматиниб используется в качестве первой линии терапии
при ХМЛ.
Открытие и внедрение в клиническую практику таргетных ингибиторов
тирозинкиназы BCR-ABL стало одним из наиболее заметных достижений в
современной онкологии. Тем не менее, терапия ингибиторами тирозинкиназ
эффективна далеко не у всех больных ХМЛ. Во-первых, не удается получить
стойких длительных ремиссий у пациентов в фазе акселерации и бластного криза.
Во-вторых, острой проблемой остается первичная и вторичная резистентность к
ингибиторам тирозинкиназ, развивающаяся в 20 – 30 % случаев (Cortes J. et al.,
2007; Kantarjian H. et al., 2007).
5
В настоящее время у больных ХМЛ в фазе акселерации и бластного криза, а
также при развитии резистентности к ингибиторам тирозинкиназ второго
поколения показано проведение аллогенной трансплантации гемопоэтических
стволовых клеток (аллоТГСК) периферической крови или костного мозга
(Gratwohl A. et al., 2006). АллоТГСК является одним из эффективных методов
лечения многих злокачественных заболеваний миелоидной и лимфоидной тканей
(Афанасьев Б.В. и соавт., 2002, 2007; Абдулкадыров K.M. и соавт., 2004;
Зубаровская Л.С. и соавт., 2001; Румянцев А.Г. и соавт., 2003; Савченко В.Г. и
соавт., 2010). Накопленный за более чем 30 лет опыт применения аллоТГСК в
практике лечения ХМЛ показал, что, несмотря на огромные достижения в
развитии таргетной терапии ХМЛ ингибиторами тирозинкиназ, аллоТГСК до сих
пор остается единственным методом, который позволяет достичь полного
излечения у больных ХМЛ.
На эффективность аллоТГСК у больных ХМЛ влияют как клинические
факторы, характеристики пациента и особенности режима трансплантации, так и
молекулярно-биологические
резистентности
к
свойства
ингибиторам
опухолевых
тирозинкиназ,
также
клеток.
как
и
Развитие
прогрессия
заболевания, ассоциированы с широким спектром молекулярно-биологических
изменений в лейкозных клетках. Наиболее изученным механизмом развития
резистентности к ингибиторам тирозинкиназ при ХМЛ считается появление
мутаций в киназном домене гена BCR-ABL. Частота мутаций BCR-ABL, по данным
разных исследований, варьирует от 30% до 90% в зависимости от фазы
заболевания и методов детекции мутации (Gorre M.E. et al., 2001; Hochhaus A. et
al., 2004). Молекулярно-биологические механизмы, ведущие к развитию
резистентности и прогрессии заболевания, во многом схожи между собой. В
частности, в проведенных в последнее время исследованиях была выявлена роль
гиперэкспрессии гена EVI1 как при прогрессии заболевания, так и при развитии
резистентности к ингибиторам тирозинкиназ (Ogawa S. et al., 1996, 1997; Paquette
R.L. et al., 2011; Daghistani M. et al., 2010). Показано, что гиперэкспрессия EVI1
ассоциирована с резистентностью к химиотерапии у больных острыми
6
миелоидными лейкозами и миелодиспластическим синдромом, а также с
прогрессией и переходом к метастазированию ряда солидных опухолей (Valk P.J.
et al., 2004; Groschel S. et al., 2010).
Прогностическое
значение
клинических
факторов
и
характеристик
пациентов в отношении эффективности аллоТГСК у больных ХМЛ изучено
достаточно подробно. В шкалу рисков входят стадия заболевания на момент
трансплантации,
возраст
пациента,
длительность
периода
болезни
до
трансплантации, а также тип донора и сочетание по полу донора и реципиента
(Gratwohl A. et al., 1998).
В то же время, прогностическое значение молекулярно-биологических
факторов, ассоциированных с прогрессией заболевания и резистентностью к
ингибиторам тирозинкиназ, в отношении эффективности аллоТГСК у больных
ХМЛ изучено значительно меньше. Так, немногочисленны и
противоречивы
данные о прогностическом значении мутаций в киназном домене гена BCR-ABL,
неясно
значение
уровня
экспрессии
гена
BCR-ABL.
Неясно
также
прогностическое значение уровня экспрессии гена EVI1 при аллоТГСК у больных
ХМЛ.
Цель исследования
Изучить молекулярно-генетические характеристики больных хроническим
миелолейкозом с резистентностью к ингибиторам тирозинкиназ и определить их
прогностическое значение при аллогенной трансплантации гемопоэтических
стволовых клеток.
Задачи исследования
1.
Изучить мутационный статус гена BCR-ABL и экспрессию его
транскриптов р210 и р190 у больных ХМЛ с резистентностью к ингибиторам
тирозинкиназ
2.
Исследовать
особенности
экспрессии
гена
EVI1
у
больных
хроническим миелолейкозом с резистентностью и с оптимальным ответом на
терапию ингибиторами тирозинкиназ
7
3.
Изучить взаимосвязь между уровнем экспрессии гена EVI1 и
структурным и функциональным состоянием гена BCR-ABL
4.
Оценить прогностическое значение наличия мутаций в гене BCR-ABL
и экспрессии его транскриптов при аллогенной трансплантации гемопоэтических
стволовых клеток у больных хроническим миелолейкозом
5.
Определить прогностическое значение гиперэкспрессии гена EVI1
при аллогенной трансплантации гемопоэтических стволовых клеток у пациентов с
хроническим миелолейкозом
Научная новизна исследования
Впервые установлено значение высокого уровня экспрессии гена EVI1 как
фактора, имеющего неблагоприятное прогностическое значение при аллоТГСК у
пациентов с ХМЛ, резистентных к ингибиторам тирозинкиназ в отношении
увеличения частоты пост-трансплантационных рецидивов. Впервые обнаружена
ассоциация между повышенным уровнем экспрессии гена EVI1 у больных ХМЛ и
предшествующей терапией ингибиторами тирозинкиназ второго поколения.
Впервые установлено, что повышенный уровень экспрессии EVI1 характерен для
пациентов с резистентностью к ингибиторам тирозинкиназ, не имеющих мутаций
в киназном домене гена BCR-ABL. Определены также спектр и частота мутаций в
киназном домене гена BCR-ABL, обнаружены ранее не описанные сложные
нарушения структуры (комплексные делеции) BCR-ABL, изучена динамика
возникновения мутантного клона и предложен метод более чувствительной
детекции мутации T315I.
Практическая значимость исследования
Определение уровня экспрессии гена EVI1 перед проведением аллоТГСК у
больных
ХМЛ
позволяет
осуществлять
дифференцированный
подход
к
планированию терапии в пред- и пост-трансплантационном периоде. В частности,
это открывает возможность для выявления пациентов с высоким риском развития
пост-трансплантационных рецидивов, которые нуждаются в своевременной
противорецидивной и иммуноадоптивной терапии.
8
Предложенный метод высокочувствительной детекции мутации T315I гена
BCR-ABL с помощью ПЦР в реальном времени позволяет выявить пациентов,
имеющих показания к проведению аллоТГСК, на несколько месяцев раньше, чем
это может быть сделано стандартным методом прямого секвенирования по
Сэнгеру.
Основные положения, выносимые на защиту
Высокий уровень экспрессии гена EVI1 характерен для резистентных к
терапии ингибиторами тирозинкиназ больных ХМЛ, не имеющих мутаций в
киназном домене гена BCR-ABL.
Высокий
уровень
экспрессии
гена
EVI1
имеет
неблагоприятное
прогностическое значение в отношении частоты развития рецидивов и
продолжительности безрецидивной выживаемости после аллоТГСК у больных
ХМЛ с резистентностью к ингибиторам тирозинкиназ.
Высокий уровень экспрессии гена EVI1 и поздняя стадия заболевания (фаза
акселерации
или
независимыми
бластный
криз)
предикторами
на
момент
менее
трансплантации
продолжительной
являются
безрецидивной
выживаемости.
Мутации в киназном домене гена BCR-ABL, в том числе T315I, а также
высокий уровень экспрессии BCR-ABL, в исследованной группе пациентов не
имели
негативного
прогностического
значения
в
отношении
общей
и
безрецидивной выживаемости после аллоТГСК у больных ХМЛ, резистентных к
ингибиторам тирозинкиназ.
Внедрение результатов исследования в практику
Основные положения диссертации внедрены в практическую и научноисследовательскую
работу
на
кафедре
гематологии,
трансфузиологии
и
трансплантации Первого Санкт-Петербургского государственного медицинского
университета имени академика И.П.Павлова и гематологического отделения
Санкт-Петербургского
государственного
бюджетного
здравоохранения "Детская городская больница №1".
учреждения
9
Апробация и реализация работы
Материалы диссертации представлены на IV симпозиуме «Трансплантация
гемопоэтических стволовых клеток», посвященном памяти Р.М. Горбачевой
(Санкт-Петербург, 2011), XIX Wilsede Meeting «Modern trends in human leukemia»
(Гамбург, 2012), 38 Annual Meeting of the European Group for Blood and Marrow
Transplantation (Женева, 2012), 39 Annual Meeting of the European Group for Blood
and Marrow Transplantation (Лондон, 2013), Всероссийской научно-практической
конференции
«Молекулярно-генетические
и
иммуногенетические
методы
диагностики в практике врача гематолога» (Санкт-Петербург, 2013).
По теме диссертации опубликовано 13 работ, в том числе 4 статьи в
журналах, рекомендованных ВАК.
Структура работы
Диссертационная работа изложена на 141 странице текста и состоит из
введения, главы обзора литературы, главы описания методики, главы результатов
исследования, главы обсуждения, выводов, практических рекомендаций и
библиографии. Список литературы включает 63 источника на русском языке и
194 источника на иностранном языке. Работа содержит 38 рисунков и 15 таблиц.
10
ГЛАВА 1. МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЕ АСПЕКТЫ
ПАТОГЕНЕЗА И ТЕРАПИИ ХРОНИЧЕСКОГО МИЕЛОЛЕЙКОЗА
(ОБЗОР ЛИТЕРАТУРЫ)
1.1.
Клиническая
и
молекулярно-биологическая
характеристика
хронического миелолейкоза
1.1.1. Клиническая характеристика хронического миелолейкоза
Хронический
миелолейкоз
(ХМЛ)
–
это
миелопролиферативное
заболевание, основным проявлением которого является клональная пролиферация
гемопоэтических стволовых клеток, на начальных этапах заболевания способных
к созреванию. Лейкемические клетки при ХМЛ характеризуются усилением
пролиферативной
активности,
сниженной
способностью
к
апоптозу
и
нарушением процессов дифференцировки (Волкова М.А. и соавт., 2010).
На долю ХМЛ приходится около 15% всех случаев заболеваний крови
опухолевой природы у взрослых. Заболеваемость ХМЛ достигает 1–1,5 на 100 000
населения. ХМЛ встречается во всех возрастных группах, однако у детей
заболевание встречается крайне редко, а медиана возраста больных на момент
диагноза составляет 50–60 лет (Cortes J. et al., 1996; Давыдов М.И. и соавт., 2009).
ХМЛ в своем развитии проходит 3 фазы – хроническую фазу (ХФ), фазу
акселерации (ФА) и бластный криз (БК).
В хронической фазе лейкемические клетки сохраняют способность к
дифференцировке, а также морфологическую и функциональную полноценность.
Незрелые клетки (бласты, промиелоциты, миелоциты, метамиелоциты) в
периферическои крови обнаруживаются, но преобладают зрелые элементы
миелоидного ростка. У подавляющего большинства пациентов (80%) заболевание
диагностируют в хронической фазе, несмотря на то, что в значительном числе
случаев оно протекает бессимптомно (Ломаиа Е.Г. и соавт., 2009).
С течением времени заболевание неизбежно прогрессирует в более
агрессивную форму. Характерными особенностями фазы акселерации являются
11
прогрессирующее нарушение дифференцировки, усиление пролиферативной
активности и подавление апоптоза в лейкозных клетках. В организме постепенно
накапливаются незрелые предшественники гранулоцитопоэза со склонностью к
образованию экстрамедуллярных очагов гемопоэза в разных органах и тканях.
Наряду с этим постепенно подавляются эритроцито- и мегакариоцитопоэз.
На стадии бластного криза зрелые клетки почти полностью вытесняются
либо миелоидными, либо лимфоидными бластными клетками. Миелоидный
вариант БК выявляют у 50% пациентов. Четверти пациентов свойственен
лимфоидный вариант БК, а у остальных 25% случаев четко определить линейную
принадлежность бластных клеток при БК не удается. Основными причинами
смерти больных в БК ХМЛ являются геморрагические и инфекционные
осложнения, а также полиорганная недостаточность, возникающая вследствие
нарастающей опухолевой интоксикации (Savage D.G. et al., 1997).
Для установления диагноза ХМЛ необходимо выявление ассоциированного
с
этим
заболеванием
специфического
генетического
нарушения,
ассоциированного с этим заболеванием - транслокации t(9;22)(q34;q11) и
соответствующего ей химерного гена BCR-ABL. Стандартное цитогенетическое
исследование позволяет обнаружить транслокацию t(9;22) у 95% пациентов с
ХМЛ (Домрачева Е.В. и соавт., 2005). С помощью методов ПЦР и FISH химерный
ген BCR-ABL детектируется почти у всех больных ХМЛ (Мисюрин A.B. и соавт.,
2007).
Терапия ХМЛ в настоящее время основана на применении ингибиторов
тирозинкиназ (ИТК) и аллогенной трансплантации гемопоэтических стволовых
клеток (аллоТГСК) (Туркина А.Г. и соавт., 2008; Ломаиа Е.Г. и соавт., 2009, 2010;
Волкова М.А. и соавт., 2010). В качестве первой линии терапии у пациентов в
хронической фазе используют ИТК первого поколения иматиниб. В случае
неудачи терапии иматинибом в качестве второй линии терапии используют ИТК
второго поколения дазатиниб и нилотиниб. Пациентам в фазе акселерации и
бластного криза или с резистентностью к ИТК показана аллоТГСК.
12
В современных условиях цитогенетические и молекулярно-биологические
методы исследования используются не только на этапе первичной диагностики
ХМЛ, но и при оценке уровня ответа на проводимую терапию. Так,
эффективность терапии определяют не только по достижению гематологического,
но цитогенетического и молекулярного ответов, причём с учетом сроков их
достижения. Полное отсутствие Ph-положительных клеток свидетельствует о
достижении полного цитогенетичекого ответа у больного. Критерием достижения
полного молекулярного ответа является неопределяемый с помощью метода
количественной ПЦР в реальном времени уровень экспрессии мРНК гена BCRABL (Мартынкевич И.С. и соавт., 2011, 2012).
1.1.2. Молекулярная биология хронического миелолейкоза
Опухолевые элементы больных хроническим миелолейкозом маркирует так
называемая Филадельфийская (Ph) хромосома (Nowell PC. et al., 1960). Это
специфическое нарушение кариотипа возникает вследствие сбалансированной
реципрокной
транслокации
t(9;22)(q34;q11).
На
молекулярном
уровне
возникновение Ph хромосомы приводит к возникновению химерного гена BCRABL, кодирующего конститутивно активную тирозинкиназу (Melo J.V. et al.,
2007). Это событие происходит в гемопоэтических стволовых клетках, дающих
начало как миелодному, так и лимфоидному росткам кроветворения (рис. 1).
Прогрессия заболевания и переход в стадию бластного криза связаны с
накоплением дополнительных мутаций в клетках-предшественниках миелодного
или лимфоидного ряда.
Онкоген BCR-ABL
В ряде экспериментов было продемонстрировано, что активность белка
BCR-ABL необходима и достаточна для поддержания лейкемического фенотипа
клеток (Daley G.Q. et al., 1990; Kelliher M.A. et al., 1990; Heisterkamp N. et al.,
1990). Так, было показано, что у мышей, трансформированных вирусным
вектором
c
человеческим
геном
BCR-ABL,
возникает
ХМЛ-подобное
миелопролиферативное заболевание (Daley GQ. et al., 1990). В то же время, у
13
мышей с экспрессией BCR-ABL c заменой лизина на аргинин в 1176 положении
(K1176)
в
АТФ-связывающем
кармане
ABL,
приводящей
к
потере
тирозинкиназной активности, развития миелопролиферативного заболевания не
происходит (Zhang X. et al., 1998), что свидетельствует о критической роли
тирозинкиназной активности BCR-ABL.
Рис. 1. Развитие хронического миелолейкоза (адаптировано из Ren et al., 2009)
При соединении генов BCR и ABL могут образовываться разные типы
химерных белков и транскриптов, в зависимости от точки разрыва в каждом из
этих двух генов (Телегеев Г.Д. и соавт., 1999; Богданов К.В. и соавт., 2003). Точки
разрыва в гене ABL обычно располагаются или перед экзоном 1b, или после
экзона 1a, или же между этими двумя экзонами. Разрывы в гене BCR происходят в
трех различных участках, имеющих значительную протяженность, что приводит,
соответственно, к образованию трёх различных по длине химерных транскриптов
14
(рис. 2). У большинства пациентов с ХМЛ и у одной трети пациентов с Phпозитивным В-ОЛЛ разрывы происходят между экзонами 12 и 16 (этот участок
обозначается как M-bcr), следствием чего является образование химерного белка
массой 210 кДа (p210 BCR-ABL). У двух третей больных Ph-позитивным В-ОЛЛ и
в редких случаях у больных ХМЛ разрыв располагается раньше, между экзонами
1 и 2 (участок m-bcr), что приводит к образованию более короткого химерного
белка с массой 190 кДа (p190 BCR-ABL). Наконец, разрыв в третьем участке (µbcr) гена BCR приводит к образованию самого длинного химерного белка, p230
BCR-ABL, встречающегося при хроническом нейтрофильном лейкозе.
Рис. 2. Химерный ген BCR-ABL, его транскрипты и белки. Адоптировано из
Barnes D.J. et al., 2002
Киназа ABL состоит из нескольких функциональных доменов и имеет
высокую степень гомологии с киназой SRC. Высоко консервативные домены SH2
(Src-homology-2) и SH3 служат сайтами связывания для SH3 доменов адаптерных
белков, таких как Crk, GRB2 и Nck. Далее следуют киназный домен, ДНКсвязывающий
домен,
актин-связывающий
домен
и
3
сигнала
ядерной
15
локализации, которые определяют локализацию белка в различных клеточных
компартментах в зависимости от внешних сигналов.
Протоонкоген с-ABL впервые был идентифицирован как нормальный
клеточный гомолог вирусного онкогена v-abl (вируса лейкоза мышей Абельсона
Ab-MuLV),
кодирующий
нерецепторную
тирозинкиназу.
Белок
ABL
экспрессируется во всех тканях животных на протяжении всей жизни, а его
наивысшая концентрация была отмечена в тимусе и селезенке. Белок ABL в
норме постоянно перемещается из цитоплазмы в ядро клетки и обратно,
передавая сигнал от рецепторов, расположенных на поверхности клетки. В ядре
ABL
вовлечен
в
процессы
регуляции
клеточного
цикла
и
ответа
на
генотоксический стресс. Слияние ABL c BCR приводит к прекращению миграции
белка и его постоянной локализации в цитоплазме, где он взаимодействует с
большим числом белков, вовлеченных в онкогенез.
Ген BCR кодирует белок, состоящий из нескольких функциональных
доменов, только один из которых, домен олигомеризации, входит в состав всех
химерных
Следствием
форм
BCR-ABL
слияния
ABL
и
с
абсолютно
доменом
необходим
для
олигомеризации
лейкемогенеза.
BCR
является
конститутивная активация тирозинкиназы ABL, вызванная димеризацией и
тетрамеризацией белка и последующим аутофосфорилированием по остаткам
тирозина (Pendergast AM. et al., 1991; Pendergast AM. et al., 1993). Другим
необходимым для лейкемогенеза элементом белка BCR является тирозин в
позиции 177, который фосфорилирован в лейкозных клетках и необходим для
связывания адаптерного белка GRB2. Белок GRB2, в свою очередь, связывается с
белком GAB2, формируя сложный белковый сигнальный комплекс, необходимый
для активации вовлеченных в онкогенез сигнальных путей RAS/MAPK и
PI3K/AKT. Было показано, что активация GAB2 является одним из механизмов
развития резистентности к ингибиторам тирозинкиназ и может служить мишенью
для терапии ХМЛ при развитии резистентности.
Взаимодействие онкобелка BCR-ABL с другими белками, локализованными
в цитоплазме, приводит к нарушению ряда ключевых процессов. Наиболее важны
16
для лейкозной трансформации нарушения в трех основных сигнальных путях.
Активация пути RAS/MAPK приводит к усилению пролиферации. Нарушения в
пути
JAK/STAT
ведут
к
увеличению
транскрипционной
активности,
а
результатом вовлечения в патологию пути PI3K/AKT является подавление
апоптоза (Melo J.V. et al., 2004).
Сигнальный путь PI3K/AKT/mTOR
Киназа BCR-ABL в составе комплекса с белками GRB2 и GAB2 активирует
сигнальный путь PI3K/AKT/mTOR, многие компоненты которого участвуют в
лейкозной трансформации клетки.
Киназа AKT регулирует активность многих белков, контролирующих
процессы апоптоза, в том числе Bad, caspase9, Mdm2 и Ask1 (Franke T.F. et al.,
1997). Фосфорилирование белка Bad препятствует связыванию и ингибированию
белка BCL-2, что приводит к подавлению апоптоза. Киназа AKT фосфорилирует
также семейство транскрипционных факторов FOXO, которые вовлечены в
контроль клеточного цикла и апоптоза (Ghaffari S. et al., 2003).
Белок mTOR представляет собой серин-треониновую киназу, конститутивно
активную в BCR-ABL позитивных клетках и играющую ключевую роль в
регуляции процессов трансляции и пролиферации клеток у млекопитающих.
Белок mTOR функционирует как отдельная каталитическая субъединица в
составе двух белковых комплексов, mTORC1 и mTORC2. Было показано, что
целый ряд ингибиторов mTOR (рапамицин, эверолимус, PP242 и OSI-027)
подавляет рост BCR-ABL позитивных клеточных линий, а также клеток,
полученных от пациентов с ХМЛ, независимо от их
чувствительности или
резистентности к иматинибу (Mohi M.G. et al., 2004; Mayerhofer M. et al., 2005;
Janes M.R. et al., 2010; Carayol N. et al., 2010). Ингибирующий эффект рапамицина
связан с остановкой клеточного цикла в G1 фазе и индукцией апоптоза. Кроме
того, рапамицин увеличивает выживаемость мышей с трансплантированными
BCR-ABL-положительными гемопоэтическими стволовыми клетками (Mohi M.G.
et al., 2004; Dengler J. et al., 2005; Mayerhofer M. et al., 2005). Комбинация
17
иматиниба и рапамицина эффективно подавляет рост клеточных линий,
резистентных к иматинибу (Ly C. et al., 2003).
Таким образом, через сигнальный путь PI3K/AKT/mTOR тирозинкиназа
BCR-ABL обеспечивает более продолжительное премя жизни лейкозных клеток и
экспансию опухолевого клона.
Сигнальный путь RAS/RAF/MAPK
В результате взаимодействия BCR-ABL с локализованными в цитоплазме
адапторными белками, образуется комплекс BCR-ABL/GRB2/SOS, который
стимулирует переход неактивной ГДФ-связывающей формы белка RAS в его
активное ГТФ-связывающее состояние (Puil L. et al., 1994). Активация RAS
вызывает конститутивную активацию всего сигнального пути RAS/RAF/MAPK с
вовлечением митоген-активирующей протеиназы ERK, что в свою очередь
приводит к активации факторов транскрипции JUN и FOS. Подавление
сигнального
пути
RAS/RAF/MAPK
ингибиторами
фарнесилтрансферазы
замедляет пролиферацию клеток линии к562 и CD34+ клеток, полученных от
пациентов в хронической фазе ХМЛ (Pellicano F. et al., 2011).
Сигнальный путь JAK/STAT
В BCR-ABL позитивных линиях клеток и клетках пациентов с ХМЛ была
обнаружена конститутивная активность транскрипционных факторов STAT1 и
STAT5, которые в нормальных клетках активны только после связывания
рецепторами цитокинов и активации ассоциированной с рецепторами киназы JAK
(Ilaria R.L. et al., 1996). В лейкозных же клетках активация STAT1 и STAT5
происходит независимо от киназы JAK, за счет связывания SH2 домена STAT с
фосфорилированными остатками тирозина на BCR-ABL (Carlesso N. et al., 1996),
что
приводит
к
независимости
клеток
от
цитокиновых
сигналов.
В
экспериментальной модели у мышей, трансфецированных вирусным вектором с
BCR-ABL,
потеря
STAT5a/b
предотвращает
развитие
ХМЛ-подобного
заболевания (Hoelbl A. et al., 2010; Walz C. et al., 2012). Хотя роль киназы JAK в
патогенезе ХМЛ до сих пор неясна, тем не менее, в экспериментах in vitro было
показано, что ингибиторы JAK2 (AG490, TG101209 и HBC) индуцируют апоптоз
18
в клетках, полученных от больных ХМЛ, а комбинация ингибиторов JAK2 и
иматиниба вызывает апоптоз в клетках пациентов даже в бластном кризе ХМЛ
(Calabretta B. et al., 2004).
Сигнальный путь WNT/β-катенина
Сигнальный путь Wnt/β-катенина играет ключевую роль в контроле
различных процессов гемопоэза, в том числе пролиферации и самообновления
клеток, а нарушения в этом сигнальном пути ассоциированы с развитием
заболеваний крови опухолевой природы (Jamieson C. et al., 2004). Важной
особенностью BCR-ABL
позитивных клеток является активация многих
компонентов пути Wnt/β-катенина, в том числе протоонкогена MYC, высокий
уровень экспрессии которого был отмечен у пациентов с ХМЛ, в особенности при
прогрессии заболевания и переходе в бластный криз (Sawyers C.L. et al., 1992). В
частности, было показано, что ингибитор Wnt/β-катенина AV65 подавляет
пролиферацию BCR-ABL позитивных линий клеток и индуцирует апоптоз
(Cattaneo F. et al., 2008).
Сигнальный путь Hedgehog
Сигнальный путь Hedgehog (Hh) играет важную роль в процессах
самовозобновления соматических стволовых клеток (Beachy P.A. et al., 2004).
Активация
белка
транскрипционных
SMO
способствует
факторов
семейства
перемещению
GLI,
в
которые
ядро
клетки
контролируют
пролиферацию посредством изменения уровня экспрессии генов CyclinD, c-MYC
и BCL2 (Regl G. et al., 2004). Уровень экспрессии SMO, а также GLI повышен у
пациентов с ХМЛ, как в хронической фазе, так и в бластном кризе. С другой
стороны, такие низкомолекулярные антагонисты, как SMO LDE225 и P-04449913
демонстрировали эффективность против ХМЛ в экспериментах и in vitro, и in
vivo (Jamieson CHM. et al., 2004; Zhang B. et al., 2010).
1.1.3. Молекулярные механизмы прогрессии заболевания
Прогрессия заболевания от хронической фазы в стадию акселерации и
бластного криза сопровождается значительными изменениями в базовых
биологических процессах – пролиферации, дифференцировке клеток, апоптозе и
19
клеточной адгезии (Shet A.S. et al., 2002; Calabretta B. et al., 2004). Эти
функциональные изменения вызывают значительные изменения в ответе
пациентов на терапию. Поэтому не удивительно, что результаты терапии ИТК и
аллоТГСК в бластном кризе и фазе акселерации значительно хуже, чем в
хронической
фазе
ХМЛ.
Так,
при
терапии
иматинибом
полного
цитогенетического ответа в хронической фазе достигают у 80% больных, в фазе
акселерации 40%, а в стадии бластного криза только у 20% пациентов (Druker
B.J. et al., 2001; O’Brien S.G. et al., 2003). Сходная тенденция выявлена при
аллоТГСК, где пятилетняя общая выживаемость в хронической фазе достигает
80%, в фазе акселерации 40%, а при БК 20% (Horowitz M.M. et al., 1996; Radich
J.P. et al., 2003).
Остановка дифференцировки клеток
Прогрессия
ХМЛ
сопровождается
переходом
от
полностью
дифференцированного зрелого состояния опухолевых клеток в хронической фазе
к недифферинцированным незрелым клеткам в фазе бластного криза. При этом
блокирование процессов дифференцировки может быть достигнуто изменением
активности
транскрипционных
факторов,
контролирующих
экспрессию
тканеспецифичных генов.
На сегодняшний день показано, что BCR-ABL изменяет активность многих
транскрипционных
факторов,
контролирующих
дифференцировку
гемопоэтических клеток, в том числе белка CEBPα (Perrotti D. et al., 2002). Как
известно, последний контролирует дифференцировку гранулоцитарных элементов
путём регуляции активности генов, необходимых для поздней дифференцировки
миелоидных клеток (Smith L. et al., 1996). Белок CEBPα присутствует в
нормальных CBFβ–SMMHC клетках костного мозга и в клетках пациентов с ХМЛ
в хронической фазе, но не обнаруживается в стадии бластного криза.
Установлено,
что
BCR-ABL
подавляет
синтез
белка
CEBPα
на
посттранскрипционном уровне, повышая стабильность регулятора трансляции
HNRNPE2 (Perrotti D. et al., 2002). В то же время, инактивирующие мутации в
20
гене CEBPα, которые характерны для острого миелоидного лейкоза и вызывают
сходные нарушения дифференцировки, при ХМЛ встречаются крайне редко
(Pabst T. et al., 2006).
Другим механизмом остановки дифференцировки клеток при миелоидном
варианте БК ХМЛ является образование химерных доминантно-негативных
транскрипционных факторов (Копнин Б.П. и соавт., 2004), которые напрямую
связаны с дополнительными нарушениями хромосом у пациентов с БК. В случае
транслокации t(3;21)(q26;q22), речь идёт о
транслокациях
t(8;21)(q22;q22)
химерном гене AML1–EVI1. При
и t(7;11)(p15;p15) возникают, соответственно,
химерные гены AML1–ETO и NUP98–HOXA9, в то время как при инверсии
inv(16)(p13;q22) образуется химерный ген. В связи с этим следует упомянуть, что
в экспериментальной модели с использованием ретровирусной трансформации и
трансплантации костного мозга у мышей было показано, что экспрессия
химерного гена AML1–EVI1 вызывает возникновение острого миелоидного
лейкоза, однако развитию заболевания предшествует длительный латентный
период. В то же время, коэкспрессия одновременно BCR-ABL и AML1–EVI1
вызывает быстрое развитие заболевания, сходного с бластной фазой ХМЛ
(Cuenco G. et al., 2001).
Блок дифференцировки в лимфоидном бластном кризе связан с изменением
в
активности
транскрипционных
факторов,
контролирующих
созревание
лимфоцитов. Один из них - транскрипционный фактор Ikaros, участвующий в
ранних процессах дифференцировки клеток лимфоидного ряда (Kirstetter P. et al.,
2002). Как показано недавно, делеции в гене, кодирующем Ikaros, ассоциированы
с прогрессией ХМЛ и вызывают остановку созревания В-лимфоцитов как при
лимфоидном варианте БК ХМЛ, так и при Ph+ ОЛЛ (Mullighan C.G. et al., 2008).
Инактивация генов-супрессоров опухолей
Одними из наиболее часто встречающихся соматических мутаций,
ассоциированных с миелоидным вариантом БК, являются мутации в гене
опухолевого супрессора p53, которые обнаруживаются у 25 – 30% пациентов. В
случае же лимфоидного варианта БК инактивация p53 происходит за счет делеции
21
второго экзона гена INK4A/ARF, обнаруживаемой у 50% пациентов (Sill H. et al.,
1995). Далее, у 18% пациентов с БК
и в фазе акселерации происходит
инактивация гена Rb за счет точечных его мутаций, делеций и/или подавления
экспрессии (Beck Z. et al., 2000). Сигнальный путь p53 играет ключевую роль в
ответе на терапию ИТК. Так, в BCR-ABL позитивных клетках воздействие
иматиниба приводит к активации p53, что является следствием подавления
киназы BCR-ABL (Wendel H.G. et al., 2006). В то же время, инактивация р53,
которая часто сопровождает прогрессию ХМЛ, блокирует ответ на иматиниб in
vitro и in vivo, не влияя при этом на ингибирование киназы BCR-ABL. Мутации и
другие нарушения в сигнальном пути р53 могут быть одним из механизмов
резистентности к ИТК у больных с БК ХМЛ (Wendel H.G. et al., 2006).
Генетическая нестабильность и нарушения репарации ДНК
Как известно, белок BCR-ABL индуцирует хронический оксидативный
стресс, возникновение двунитевых разрывов ДНК и приводит к усилению
мутагенеза в клетках (Kirstetter P. et al., 2002). Может быть поэтому у больных
ХМЛ
значительно повышена частота соматических мутаций, транзиций G/C-
>A/T и трансверсий G/C->T/A, в белок-кодирующих участках многих генов, в том
числе гена BCR-ABL (Mullighan C.G. et al., 2008). В свою очередь, генетическая
нестабильность способствует накоплению соматических мутаций и является, повидимому, непосредственной причиной прогрессии заболевания.
Амплификация BCR-ABL
При переходе заболевания из хронической фазы в фазу акселерации и
бластного криза у значительной части пациентов наблюдается амплификация гена
BCR-ABL, что приводит к еще большей активации сигнальных путей, связанных с
пролиферацией клеток и подавлением апоптоза (Gaiger A. et al., 1995; Guo JQ. et
al., 1991). Амплификация гена BCR-ABL характерна также для больных ХМЛ с
резистентностью к иматинибу (Куцев С.И. и соавт., 2009). Механизмы,
посредством которых достигается увеличение числа копий гена BCR-ABL,
включают как амплификацию участков ДНК, кодирующих ген BCR-ABL, так и
появление дополнительных Ph хромосом.
22
Дополнительные хромосомные нарушения
Прогрессия ХМЛ сопровождается появлением дополнительных хромосом в
клетках (Домрачева Е.В. и соавт., 2005; Мартынкевич И.С. и соавт., 2007; Куцев
С.И. и соавт., 2009; Виноградова О.Ю. и соавт., 2012). Некоторая часть из них,
скорее всего, являются лишь следствием генетической нестабильности в BCRABL позитивных клетках и не дают лейкозным клеткам никаких новых
преимуществ, в то время как другие принимают непосредственное участие в
лейкемогенезе и прогрессии заболевания. Так, изохромосома i(17q) встречается у
20% пациентов в бластном кризе ХМЛ и приводит к потере одной копии гена р53
(Fioretos T. et al., 1999). При БК ХМЛ также весьма распространена трисомия 8,
которую выявляют у 40% пациентов. В теоретическом отношении это важно,
поскольку в локусе 8q24 расположен онкоген MYC. По сравнению с хронической
фазой, гиперэкспрессия гена MYC при БК ХМЛ встречается чаще (Collins S. et al.,
1982; Radich J.P. et al., 2006). Транслокация t(3;21), приводящая к образованию
химерного гена AML1/EVI1, явление более редкое, однако гиперэкспрессия
онкогена EVI1 ассоциирована с прогрессией заболевания и особенно часто
встречается в фазе бластного криза ХМЛ (Mitani K. et al., 1994). Наконец, в фазе
бластного криза у 30% пациентов обнаруживают дополнительные Ph хромосомы,
что приводит к естественному увеличению числа копий гена BCR-ABL в клетке
(Collins S.J. et al., 1987).
1.2. Ингибиторы тирозинкиназ в терапии хронического миелолейкоза
1.2.1. Структура и механизм действия ингибиторов тирозинкиназ
Открытие и внедрение в клиническую практику таргетных ингибиторов
тирозинкиназы BCR-ABL стало одним из наиболее заметных достижений в
современной онкологии (Волкова М.А. и соавт., 2003). Иматиниб был открыт в
1996 году и доклинические исследования показали его чрезвычайно высокую
эффективность in vitro – рост колоний клеток костного мозга пациентов с ХМЛ
удавалось подавить на 92-98% (Druker B.J. et al., 1996). Первые сообщения о
23
клинической эффективности иматиниба у пациентов с ХМЛ появились в 2001
году (Druker B.J. et al., 2001). Однако, вскоре после этого были опубликованы
сообщения о развитии резистентности к иматинибу у пациентов, а также выявлен
один из основных молекулярных механизмов развития резистентности –
появление
мутаций
в
киназном
домене
BCR-ABL.
Чтобы
преодолеть
резистентность, были разработаны ИТК второго поколения, в том числе
дазатиниб, нилотиниб и бозутиниб, с помощью которых удалось успешно
преодолевать резистентность к иматинибу. Наконец, недавно появились ИТК
третьего поколения, в частности понатиниб, который позволяет достичь
молекулярного ответа даже у пациентов с панрезистентной ко всем остальным
ИТК мутацией T315I.
Многочисленными исследованиями установлено, что иматиниб блокирует
связывание АТФ тирозинкиназой BCR-ABL и подавляет ее киназную активность.
Таким образом прекращается активация BCR-ABL зависимых сигнальных путей
и подавляется избыточная пролиферация миелоидных клеток. Помимо BCR-ABL,
иматиниб ингибирует и другие киназы, в том числе c-Kit, PDGFR, DDR1 и NQO2.
Более чем десятилетний опыт клинического использования иматиниба показал
его высокую эффективность у пациентов в хронической фазе заболевания
(Туркина А.Г. и соавт., 2001, 2002, 2003, 2004; Волкова М.А. и соавт., 2003, 2004;
Ломаиа Е.Г. и соавт., 2005; Зарицкий А.Ю. и соавт., 2007).
Дазатиниб, один из ИТК второго поколения, был разработан для больных
ХМЛ или резистентных к иматинибу или плохо переносивших его (Волкова М.А.
и соавт., 2008; Хорошко H.Д. и соавт., 2008; Виноградова О.Ю. и соавт., 2009).
Молекулярная структура дазатиниба значительно отличается от структуры
иматиниба. Дазатиниб первоначально был разработан как ингибитор киназ
семейства SRC, однако было установлено, что он активен и в отношении киназы
BCR-ABL. Важной особенностью дазатиниба является то, что он способен
связываться с BCR-ABL, находящемся как в неактивной, так и в активной
конформации (Jabbour E. et al., 2009). С другой стороны, его способность
ингибировать киназы SRC может быть очень важна для преодоления
24
резистентности к иматинибу. Дело в том, что в ряде исследований была
обнаружена ассоциация активации SRC с развитием резистентности к иматинибу
(Donato N.J. et al., 2003; Wu J. et al., 2008). Кроме того, доклинические испытания
показали, что дазатиниб в 300 раз эффективнее подавляет тирозинкиназную
активность BCR-ABL, и кроме того, активен в отношении большинства
мутантных форм BCR-ABL, резистентных к иматинибу. Спектр киназ, активность
которых подавляется дазатинибом, довольно широк и включает помимо BCRABL также и такие киназы, как SRC, PDGFR, KIT, EPHA2.
Нилотиниб - ИТК второго поколения, структура которого близка к
структуре
иматиниба.
При
его
разработке
были
учтены
данные
кристаллографических исследований комплекса иматиниб-BCR-ABL и на
основании этих данных структура молекулы иматиниба была оптимизирована с
целью повышения аффинности иматиниба к BCR-ABL. В доклинических
исследованиях нилотиниб оказался в 30 раз более активен, чем иматиниб. Он не
подавляет киназы семейства SRC, но активен в отношении киназ с-KIT, PDGFR,
DDR1, NQO2, VEGF. Также как и иматиниб, нилотиниб способен связываться с
BCR-ABL только в неактивной конформации. Немаловажно и то, что активен в
отношении большинства мутантных форм BCR-ABL, резистентных к иматинибу
(Ломаиа Е.Г. и соавт., 2007).
Бозутиниб, также как дазатиниб и нилотиниб, относится к числу ИТК
второго поколения, способных подавлять активность большинства мутантных
форм BCR-ABL, устойчивых к иматинибу. В отличие от других ИТК, бозутиниб
не подавляет активности PDGFR и c-KIT. Его мишенями являются семейства
киназ ABL и SRC.
Понатиниб – ИТК третьего поколения, способный подавлять активность
большинства мутантных форм BCR-ABL, включая мутацию T315I. Структура
понатиниба была разработана с учетом стерических особенностей BCR-ABL с
мутацией T315I (O'Hare T. et al., 2009). Помимо BCR-ABL, понатиниб ингибирует
киназы VEGFR, PDGFR, FGFR, SRC, KIT, RET, и FLT3. Понатиниб получил
25
разрешение FDA для применения у пациентов с ХМЛ в ХФ, ФА и БК с
резистентностью или непереносимостью терапии другими ИТК.
1.2.2.
Молекулярно-биологические
механизмы
резистентности
к
ингибиторам тирозинкиназ
Иматиниб показал очень высокую эффективность в качестве первой линии
терапии ХМЛ. Однако, только небольшая часть пациентов достигает полного
молекулярного ответа при терапии иматинибом, в то время как у большинства из
них транскрипты BCR-ABL продолжают выявляться (Druker B.J. et al., 2006).
Поэтому у 20 – 30% пациентов в конечном счете развивается первичная или
вторичная резистентность к иматинибу. Более того, частота ответа на иматиниб у
пациентов в фазе акселерации и бластного криза значительно ниже, чем в
хронической фазе, а достигнутая ремиссия в подавляющем большинстве случаев
кратковременна (Druker B.J. et al., 2001). В настоящее время большинство
исследователей придерживается мнения о том, что резистентность к иматинибу и
другим ингибиторам тирозинкиназ обусловлена взаимодействием множества
клинических
и
молекулярно-биологических
приверженностью
к
лечению,
факторов,
биодоступностью,
в
том
числе
фармакодинамикой,
разнообразными генетическими изменениями.
Фармакокинетика
В нескольких исследованиях было продемонстрировано, что уровень
концентрации иматиниби в плазме крови пациентов значительно варьирует (le
Coutre. et al., 2003; Peng B. et al., 2004) и отмечена взаимосвязь между
концентрацией
иматиниба
в
плазме
и
частотой
цитогенетического
и
молекулярного ответа на терапию (Picard S. et al., 2007). Одной из причин
снижения концентрации иматиниба в плазме может быть генетический
полиморфизм ферментов цитохрома Р450 — изоферментов CYP3A4 и CYP3A5,
участвующих в метаболизме лекарственных препаратов (Picard S. et al., 2007).
Внутриклеточный транспорт иматиниба
26
Количество иматиниба в клетке также тесно связано с балансом между
поглощением препарата и его выведением. Иматиниб доставляется внутрь клетки
из межклеточного пространства транспортным белком hОСТ1, полиморфизмы
гена которого, а также уровень его экспрессии могут могут быть ответственны за
скорость поступления иматиниба в клетку. С другой стороны, выведение
иматиниба из клетки связано с активностью трансмембранного белка MDR1,
опосредующего множественную лекарственную резистентность к химиотерапии.
Между тем, уровень экспрессии MDR1 при БК ХМЛ, а также у пациентов с
резистентностью к ИТК, по сравнению с хронической фазой, значительно
повышен (Picard S. et al., 2007; Ставровская А.А. и соавт., 2008; Стромская Т.П. и
соавт., 2008).
Покоящиеся стволовые клетки ХМЛ
Популяция лейкозных клеток при ХМЛ неоднородна. Была обнаружена
небольшая субпопуляция так называемых покоящихся стволовых клеткок ХМЛ
(Lin-CD34+), которая составляет около 0,5% всех CD34+ клеток и обнаруживает
резистентность к иматинибу (Holtz M.S. et al., 2005). По-видимому, данное
обстоятельство обуславливает невозможность полного уничтожения лейкозного
клона клеток
и персистирование минимальной остаточной болезни у
большинства пациентов. Поэтому в последнее время много внимания уделяется
разработке новых подходов к терапии ХМЛ с использованием комбинированной
терапии, включающей ИТК и препараты с BCR-ABL независимым механизмом
действия.
Активация киназ семейства SRC
Киназа BCR-ABL активирует киназы LYN, HCK, и FGR, которые относятся
к семейству цитоплазматических нерецепторных киназ SRC (Hu Y. et al., 2004).
Было показано, что у пациентов с резистентностью к иматинибу, не имеющих
мутаций в гене BCR-ABL, уровень экспрессии киназы LYN значительно повышен
(Wu J. et al., 2008). Дазатиниб ингибирует киназы семейства SRC и поэтому
может быть особенно эффективен в группе пациентов с гиперэкспрессией LYN.
27
Амплификация гена BCR-ABL
Амплификация BCR-ABL была одним из первых обнаруженных механизмов
резистентности к иматинибу (Gorre M.E. et al., 2001). Кроме того, была выявлена
взаимосвязь между уровнем экспрессии BCR-ABL и мутациями BCR-ABL,
заключающаяся в том, что при нарастании уровня экспрессии мутации, в том
числе обуславливающие резистентность к иматинибу, возникают чаще (Barnes
D.J. et al., 2005).
Мутации в киназном домене гена BCR-ABL
Появление мутаций в киназном домене гена BCR-ABL наиболее изученный
механизм развития резистентности к ингибиторам тирозинкиназ при ХМЛ (Куцев
С.И. и соавт., 2008). Частота мутаций BCR-ABL по данным разных исследований
варьирует от 30% до 90%, завися от фазы заболевания и методов детекции
мутации (Gorre M.E. et al., 2001; Shah N.P. et al., 2002; Lowenberg B. et al., 2003;
Corbin A.S. et al., 2003; Gambacorti-Passerini C.B. et al., 2003; Hochhaus A. et al.,
2004; Hughes T. et al., 2006). Первой мутацией, описанной у пациентов с
резистентностью к иматинибу, была мутация T315I. Треонин в 315 положении
играет ключевую роль в связывании иматиниба, поскольку между ним и
молекулой иматиниба образуется водородная связь. При замене треонина на
изолейцин водородная связь не образуется и аффинность иматиниба к BCR-ABL
снижается. Кроме того, изолейцин представляет собой гораздо более крупную
молекулу, чем треонин, и поэтому стерически препятствует проникновению
иматиниба в сайт связывания (Р-петлю) (Gorre M.E. et al., 2001; Zhou T. et al.,
2007).
На сегодняшний день у больных ХМЛ, резистентных к ИТК, описано более
100 различных точечных мутаций, связанных с заменой
аминокислотных
остатков в киназном домене белка BCR-ABL (Schindler T. et al., 2000;Shah N.P. et
al., 2002; Nagar B. et al., 2002; Hantschel O. et al., 2003; Azam M. et al., 2003; Hughes
T. et al., 2006; Quintás-Cardama A. et al., 2007). Чаще других обнаруживают
мутации в Р-петле киназного домена, которая является сайтом связывания АТФ
28
(O’Hare T. et al., 2005; Carter TA. et al., 2005), и А-петле, которая играет роль
ключевого регулятора киназной активности BCR-ABL (рис. 3).
Рис. 3. Структурная модель белка BCR-ABL в комплексе с иматинибом.
Обозначены аминокислоты, замены которых приводят к резистентности к
иматинибу. 1, F317; 2, T315; 3, F359; 4, M244; 5, G250; 6, Q252; 7, Y253; 8, E255;
9, M351; 10, E355; 11, V379; 12, L387; 13, H396. Мутации 1-3 (красные) напрямую
влияют на связывание иматиниба, мутации 4-8 (зеленые) расположены в P-петле,
мутации 9-13 (голубые) в А-петле. .(Адаптировано из Shah N. et al., 2003)
Иматиниб способен связываться с BCR-ABL, только тогда, когда эта киназа
находится в инактивированной конформации. Возникновение мутаций в петле
активации (А-петле) не позволяет BCR-ABL принимать инактивированную
конформацию и соответственно предотвращает связывание с иматинибом
29
(Hochhaus A. et al., 2001; Barthe C. et al., 2001; Shah NP. et al., 2002). Описаны
также мутации в каталитическом домене. Несмотря на столь широкий спектр
мутаций, большинство из них встречается относительно редко и в 60%-70%
случаев мутации затрагивают всего шесть ключевых аминокислотных оснований
(Gly250, Tyr253, Glu255, Thr315, Met351, и Phe359).
Клоны лейкозных клеток, несущие мутантные формы BCR-ABL, становятся
доминантными под действием ИТК, которые играют роль фактора отбора
(Komarova N.L. et al., 2005; Ernst T. et al., 2008). В момент постановки диагноза до
начала терапии иматинибом лишь у немногих пациентов были обнаружены
мутации BCR-ABL, причем в очень небольшом числе клеток (Roche-Lestienne C.
et al., 2002; Willis S.G. et al., 2005; Soverini S. et al., 2011). При отмене терапии
ИТК клетки с нормальным BCR-ABL быстро вытесняют клетки с мутантными
формами BCR-ABL (Gruber F.X. et al., 2005; Hanfstein B. et al., 2011), так как
мутантные формы имеют более низкую тирозинкиназную активность (Griswold
I..J. et al., 2006).
Практика использования ИТК первого и второго поколений показала, что у
пациентов в фазе акселерации и бластного криза, а также с длительной историей
заболевания перед началом терапии вероятность появления мутаций в киназном
домене BCR-ABL заметно повышена. Было показано также, что у пациентов с
резистентностью к иматинибу, имеющих мутации BCR-ABL, с большей частотой
появляются мутации резистентности и при переходе на ИТК второго поколения
(Soverini S. et al., 2009; Hughes T. et al., 2009). Кроме того, последовательное
применение различных ИТК может приводить к накоплению множественных
мутаций, ассоциированных с резистентностью (Shah NP. et al., 2007; Breccia M. et
al., 2009).
Следует отметить, что обнаружение мутации у пациента с резистентностью
к терапии ИТК не обязательно означает, что мутация является причиной
резистентности. Поскольку активность BCR-ABL вызывает генетическую
нестабильность и накопление соматических мутаций в клетках, обнаруженная
30
мутация может быть случайной, не влияющей на патогенез заболевания
(Greenman C. et al., 2007).
В исследованиях in vitro было показано, что различные мутантные формы
BCR-ABL обладают различной чувствительностью к иматинибу и некоторые
мутации лишь незначительно снижают ее (Corbin AS. et al., 2003). В таких
случаях резистентность может быть преодолена с помощью увеличения дозы
иматиниба. Другим возможным способом преодоления резистентности может
быть переход на терапию ИТК второго и третьего поколений. При этом
отмеченные выше подходы для разработки ИТК второго и третьего поколений
оказались
успешными
в
преодолении
резистентности
к
иматинибу,
обусловленную мутациями BCR-ABL.
В исследованиях in vitro дазатиниб и нилотиниб продемонстрировали
активность против всех мутантных форм BCR-ABL, за исключением мутации
T315I (Shah N.P. et al., 2004; O’Hare T. et al., 2005). Кристаллографические
исследования и молекулярное моделирование подтвердили, что не смотря на
различную химическую структуру двух ингибиторов, образование водородной
связи между ними и треонином в 315 положении имеет решающее значение для
связывания ИТК с BCR-ABL (Lee TS. et al., 2008; Iacob RE. et al., 2009).
Однако опыт клинического применения двух ингибиторов второго
поколения показал, что помимо T315I, каждый из препаратов имеет свой
небольшой и уникальный спектр мутаций, приводящих к резистентости (Soverini
S. et al., 2006; Jabbour E. et al., 2009).
Спектр мутаций резистентности к нилотинибу включает некоторые из
мутаций, вызывающих резистентность к иматинибу – это мутации Y253H,
E255K/V и F359V/I/C.
Спектр мутаций резистентности к дазатинибу включает как мутации,
ассоциированные с резистентностью к иматинибу (F317L/I), так и несколько
специфичных для дазатиниба мутаций резистентости - V299L, T315A и F317V/C
(Burgess M.R. et al., 2005).
31
Наличие перечисленных мутаций, также как и мутации T315I, у пациентов с
резистентностью к иматинибу ассоциировано с низкой частотой ответов при
переключении терапии на соответствующий ИТК второго поколения. Эти же
мутации с высокой частотой обнаруживаются у пациентов с развившейся после
достижения первоначального ответа на терапию вторичной резистентности к
дазатинибу и нилотинибу (Soverini S. et al., 2011).
Относительно спектра мутаций, ассоциированных с резистенностью к
бозутинибу, в литературе имеется значительно меньше сведений, однако в него
входят как минимум две мутации – T315I и V299L.
Понатиниб, единственный ингибитор тирозинкиназ способный подавлять
киназную активность BCR-ABL с мутацией T315I, имеет слишком недолгую
историю применения в клинической практике, поэтому спектр мутаций
резистентности к нему остается пока не выясненным.
Гиперэкспрессия онкогена EVI1
У пациентов в бластном кризе ХМЛ с высокой частотой встречается
гиперэкспрессия онкогена EVI1 (Ogawa S. et al., 1996, 1997), хотя она может быть
обнаружена и в хронической фазе ХМЛ. У больных с миелоидным вариантом БК
нередки также транслокации с вовлечением этого гена, причём наличие таких
транслокаций ассоциируется
с развитием резистентности к ингибиторам
тирозинкиназ. Так, по данным одного из исследований, такие транслокации были
обнаружены у 39% пациентов с БК, резистентных к ИТК (Paquette R.L. et al.,
2011). Что касается пациентов с резистентной к иматинибу хронической фазе
ХМЛ, то гиперэкспрессия EVI1 является независимым неблагоприятным
прогностическим фактором в отношении общей и безрецидивной выживаемости
для последующей терапии ингибиторами тирозинкиназ второго поколения
(Daghistani M. et al., 2010).
Как известно, онкоген EVI1 представляет собой транскрипционный фактор,
играющий ключевую роль в поддержании стволовых гемопоэтических клеток и
контроле их пролиферации (Goyama S. et al., 2008). Этот ген EVI1 был впервые
32
обнаружен в ходе экспериментов по индукции миелойдных лейкозов с помощью
ретровирусной трансфекции у мышей. В итоге было показано, что встраивание
ретровирусов происходит в пределах региона, который был назван ecotropic viral
integration site-1 (Evi-1) (Morishita K. et al., 1988; Mucenski M.L. et al., 1988). У
человека EVI1 находится в локусе 3q26 и перестройки с участием локуса 3q26
часто вызывают гиперэкспрессию гена EVI1 при миелоидных заболеваниях крови
опухолевой природы, включая ОМЛ, ХМЛ и МДС. В то же время, в большом
количестве случаев гиперэкспрессия EVI1 не связана с перестройками в локусе
3q26. Так, около половины всех случаев ОМЛ с перестройками локуса 11q23 и
образованием химерных транскриптов с участием гена MLL характеризуется
повышенной экспрессией EVI1 (Groschel S. et al., 2010; Arai S. et al., 2010). Кроме
того, гиперэкспрессия гена
EVI1 очень характерна для гемобластов с
моносомией по 7-й хромосоме (Groschel S. et al., 2010; De Weer A. et al., 2010).
При
лечении
ОМЛ
гиперэкспрессия
EVI1
является
независимым
неблагоприятным фактором прогноза. В целом она была обнаружена у 10%
пациентов с ОМЛ, которые были расценены исследователями как отдельный
прогностически неблагоприятный подтип ОМЛ (Valk et al., 2004; Groschel et al.,
2010). Как показали исследования, профиль экспрессии генов в EVI1+ подтипе
ОМЛ был ближе всего к профилю экспрессии их в нормальных CD34+ клетках.
В экспериментах с трансплантацией стволовых клеток у мышей было
установлено, что гиперэкспрессия EVI1 вызывает заболевание, напоминающее
МДС (Jin G. et al., 2007). Однако, для развития лейкоза в этой модели было
необходимо наличие дополнительных генетических нарушений, в том числе
гиперэкспрессии HoxA9/Meis1 и мутации AML1/RUNX1 (Jin G. et al., 2007;
Watanabe-Okochi N. et al., 2008). Активность EVI1 необходима для пролиферации
гемопоэтических стволовых клеток, в том числе лейкозных, персистирование
которых в настоящее время считается одной из возможных причин развития
резистентности лейкозов к терапии, в том числе ХМЛ.
В настоящее время установлено, что белок EVI1 выполняет несколько
различных
функций,
связанных
с
лейкемической
трансформацией
33
гемопоэтических
стволовых
клеток.
Во-первых,
ген
EVI1
кодирует
транскрипционный фактор, имеющий несколько ДНК-связывающих доменов
типа «цинковые пальцы» и регулирующий активность ряда генов-мишеней.
Домены
«цинковые
пальцы»
белка
EVI1
распознают
консенсусные
последовательности с мотивами GA(C/T)AAGA(T/C)AAGATAA и GACAAGATA
(Yatsula B. et al., 2005; Yuasa H. et al., 2005). Важно, что среди мишеней
транскрипционного фактора EVI1 были обнаружены гены GATA2 (Yuasa H. et al.,
2005), PBX1 (Shimabe M. et al., 2009) и PML (Buonamici S. et al., 2005).
Во-вторых, ген EVI1 участвует в регуляции ряда сигнальных путей,
вовлеченных в лейкемогенез. Помимо связывания с ДНК, белок EVI1
взаимодействует с различными белками, такими как Smad3 и CtBP, что приводит
к образованию сложных белковых комплексов, регулирующих процессы
транскрипции. Взаимодействуя с белками Smad3 и JNK1, EVI1 подавляет
сигнальный путь TGF-β (Kurokawa M. et al., 1998; Kurokawa M. et al., 2000),
который принимает участие в контроле пролиферации и дифференцировки
большинства типов клеток и играет важную роль в процессах канцерогенеза.
Кроме того, EVI1 подавляет апоптоз, связываясь с белком JNK1 и ингибируя
фосфорилирование c-Jun (Kurokawa M. et al., 2000).
В-третьих, в последнее время в литературе появляется все больше новых
данных, свидетельствующих о роли гена EVI1 в эпигенетической регуляции
транскрипции генов. Так, в работе Lugthart et al. было показано, что у пациентов с
ОМЛ с гиперэкспрессией EVI1 наблюдается гиперметилирование геномной ДНК,
обусловленное взаимодействием EVI1 c ДНК-метилтрансферазами DNMT3A и
DNMT3B (Lugthart S. et al., 2011). EVI1 взаимодействует также со многими
эпигенетическими регуляторами, в том числе с гистоновыми деацетилазами
(HDAC) и гистоновыми метилтрансферазами (HMT) (Vinatzer U. et al., 2001;
Spensberger D. et al., 2008; Cattaneo F. et al., 2008).
Как известно, эпигенетические механизмы играют значительную роль в
процессе опухолевой трансформации клеток (Martin-Perez D. et al., 2010; Yoshimi
A. et al., 2011). При этом в онкогематологических заболеваниях с высокой
34
частотой
обнаруживаются
соматические
мутации
в
ключевых
генах,
контролирующих эпигенетические механизмы, таких как EZH2 (Ernst T. et al.,
2010; Nikoloski G. et al., 2010), DNMT3A (Ley T. et al., 2010; Walter M. et al., 2011),
TET2 (Delhommeau F. et al., 2009; Langemeijer S. et al., 2009) и ASXL1 (Gelsi-Boyer
V. et al., 2009).
Кроме того, белок EVI1 непосредственно взаимодействует с
комплексом белков группы polycomb (PcG) - EZH2, SUZ12, EED, BMI1, RING1,
RING2, и HPH2. Белки PcG катализируют метилирование гистонов (H3K27), что
приводит к эпигенетическому подавлению транскрипции генов-мишеней PcG.
Эти гены регулируют широкий спектр биологических процессов, в том числе
апоптоз, клеточный цикл и поддержание стволовых клеток и вовлечены в
процессы старения и канцерогенеза (Bracken A. et al., 2009; Sauvageau M. et al.,
2010; Surface L. et al., 2010; Beisel C. et al., 2011; Margueron R. et al., 2011).
Было показано, что одним из генов, экспрессия которых подавлена при
гиперэкспресии EVI1 под влиянием метилирования гистонов белками PcG
является хорошо изученый супрессор опухолей PTEN (Yoshimi A. et al., 2011). У
пациентов в бластной фазе ХМЛ была обнаружена обратная корреляция между
уровнями экспрессии генов EVI1 и PTEN. Поскольку белок PTEN действует как
негативный регулятор сигнального пути PI3K/AKT/mTOR, и подавление его
экспрессии под влиянием гиперэкспрессии EVI1 приводит к активации киназы
AKT и всего сигнального пути PI3K/AKT/mTOR (Yoshimi A. et al., 2011). Таким
образом, ключевой для лейкемогенеза сигнальный путь PI3K/AKT/mTOR может
быть активирован как в результате образования химерного гена BCR-ABL, так и
гиперэкспрессии гена EVI1. Гиперэкспрессия EVI1 является одним из возможных
механизмов BCR-ABL независимой прогрессии ХМЛ и резистентности к терапии
ингибиторами тирозинкиназ.
Резистентность
EVI1+
лейкозов
к
стандартной
химиотерапии
предопределяет необходимость поиска других, более эффективных в данной
группе пациентов, видов терапии (Мамаев Н.Н. и соавт., 2012).
В экспериментах in vitro было показано, что триоксид мышьяка (arsenic
trioxide, ATO) способен связываться с белком EVI1 и вызывать его деградацию
35
(Shackelford D. et al., 2006). Поэтому не удивительно, что комбинированная
терапия
с
использованием
АТО
и
талидомида
позволяет
получить
гематологичесий ответ у пациентов с МДС с гиперэкспрессией EVI1 (Raza A. et
al., 2004). Таким образом, АТО потенциально может быть одним из видов
таргетной терапии EVI1+ МДС.
Другим возможным направлением в терапии EVI+ лейкозов может быть
использование ингибиторов mTOR (рапамицин, сиролимус, эверолимус) и
ингибиторов ДНК-метилтрансфераз (дакоген и 5-азацитидин).
1.3. Аллогенная трансплантация гемопоэтических стволовых клеток
при хроническом миелолейкозе
Одним из наиболее эффективных методов лечения многих заболеваний
крови опухолевой природы является аллогенная трансплантация гемопоэтических
стволовых клеток (аллоТГСК) периферической крови или костного мозга
(Зубаровская Л.С. и соавт., 2001; Афанасьев Б.В. и соавт., 2002, 2007; Румянцев
А.Г. и соавт., 2003; Абдулкадыров K.M. и соавт., 2004; Савченко В.Г. и соавт.,
2010). Несмотря на огромные достижения в развитии таргетной терапии ХМЛ
ингибиторами тирозинкиназ, аллоТГСК до сих пор остается единственным
методом, который позволяет достичь полного излечения этого вида лейкоза
(Mamaev N.N., 2009). Что касается прогностических факторов, то наиболее
значимым для исхода аллоТГСК у больных ХМЛ считается фаза заболевания
(Менделеева Л.П. и соавт., 2003).
1.3.1. Эффективность и безопасность аллоТГСК
АллоТГСК успешно применяется в терапии ХМЛ уже более 30 лет.
С
помощью этого метода впервые удалось достичь элиминации клона Phпозитивных клеток после комбинированной интенсивной химио- и радиотерапии
с последующей трансплантацией клеток костного мозга от донора-близнеца (Fefer
A. et al., 1977). Этот успешный опыт был быстро распространен. Более того, была
показана эффективность аллогенной трансплантации и от доноров-сиблингов,
36
идентичных по HLA генотипу (Koeffler H.P. et al., 1981; Goldman J.M. et al., 1982;
Clift R.A. et al., 1982; Speck B. et al., 1984). С тех пор аллоТГСК стала
использоваться в качестве первой линии терапии у молодых пациентов с ХМЛ,
имеющих HLA-совместимого донора.
Анализ накопленных за прошедшие 30 лет данных в этой области позволил
оценить и долгосрочную выживаемость пациентов после аллоТГСК, и основные
факторы риска. В итоге, двадцатилетняя безрецидивная выживаемость в группе из
2600 пациентов с ХМЛ в хронической фазе, фазе акселерации и бластном кризе
составила 40%, 20% и 10%, соответственно (Gratwohl A. et al., 2006).
Исследования, проведенные после 2000 года, также продемонстрировали
высокую эффективность аллоТГСК у пациентов с ХМЛ. Так, по данным
европейского регистра EBMT, двухлетняя общая выживаемость пациентов в
первой хронической фазе составила 74% при родственных трансплантациях и
63% при трансплантациях от неродственного донора (Baccarani M. et al., 2009).
Поскольку большинство пациентов после аллоТГСК достигают полного
молекулярного ответа, аллоТГСК на сегодняшний день остается единственным
методом лечения ХМЛ, полностью элиминирующим опухолевые клетки
(Goldman J. et al., 2003). Высокая эффективность аллоТГСК при ХМЛ в
значительной степени связана с выраженным эффектом «трансплантат-противлейкоза», связанной с реакцией донорских Т-лимфоцитов и натуральных
киллеров на остаточные BCR-ABL-позитивные клетки. Если аллоТГСК сделана
своевременно, пост-рансплантационные рецидивы при ХМЛ относительно редки
и в большинстве случаев преодолимы посредством инфузий донорских
лимфоцитов, эффективность которых при ХМЛ максимальная.
Тем не менее, несмотря на высокую эффективность, аллоТГСК значительно
уступает терапии ИТК в отношении безопасности. Основным препятствием при
проведении аллоТГСК и основной причиной смертности остаются тяжелые посттрансплантационные осложнения. Среди них острая и хроническая реакция
трансплантат-против-хозяина (РТПХ), а также инфекционные осложнения,
37
являющиеся наиболее значимыми причинами смертности в раннем и позднем
пост-трансплантационном периодах.
1.3.2. Прогностические факторы, влияющие на исход трансплантации
Основными факторами, влияющими на выживаемость пациентов после
аллоТГСК по данным исследований European Group for Blood and Marrow
Transplantation (EBMT) были признаны следующие: 1) возраст пациента; 2) стадия
заболевания на момент трансплантации; 3) тип донора; 4) время от диагностики
заболевания до трансплантации; 5) сочетание по полу донора и реципиента
(таблица 1) (Gratwohl A. et al., 1998). Эта прогностическая шкала была
разработана А.Gratwohl в 1998 году на основе накопленных с 1970-х годов
данных и активно используется до сих пор. Как видно из данных таблицы 1,
шкала позволяет оценить вероятность благоприятного исхода трансплантации.
Выживаемость пациентов варьирует от 70% до 20% в группах с минимальным и
максимальным значениями индекса Gratwohl, соответственно. (Gratwohl A. et al.,
1998).
За прошедшие с момента первых трансплантаций 30 лет появилось много
новых методов, способствовавших значительному улучшению результатов
аллоТГСК.
Таблица 1.
Шкала факторов риска аллоТГСК у больных ХМЛ (Шкала Gratwohl)
Фактор риска
Балл
Возраст пациента
< 20 лет
0
20 – 40 лет
1
> 40 лет
2
Стадия заболевания
Хроническая фаза
0
Фаза акселерации
1
38
Бластный криз
2
Время от диагноза до трансплантации
< 12 месяцев
0
> 12 месяцев
1
Тип донора
HLA-совместимый сиблинг
0
Неродственный донор
1
Сочетание по полу донора и реципиента
Любое другое
0
Донор женщина – реципиент мужчина
1
Так, совершенствование методов HLA-типирования позволило сократить
риск развития реакции трансплантат против хозяина (РТПХ) при трансплантациях
от неродственных доноров. Появление и развитие международных регистров
доноров костного мозга обеспечило возможность проведения неродственой
аллоТГСК у пациентов, не имеющих HLA-совместимых сиблингов. Несмотря на
эти достижения, основные факторы риска при аллоТГСК сохранили свое
значение, а трансплантации у пациентов пожилого возраста в фазе акселерации и
бластного криза, с длительным временем после постановки диагноза и
проведением аллоТГСК от неродственного донора по-прежнему имеют наименее
благоприятный прогноз.
Наиболее значимым прогностическим фактором при любом виде терапии
ХМЛ, в том числе аллоТГСК является стадия заболевания., что может быть
связано с принципиальными различиями молекулярно-биологических свойств
лейкозных клеток в хронической фазе и на более поздних стадиях заболевания.
Согласно данным ряда исследований, 5-летняя выживаемость пациентов,
которым аллоТГСК была проведена в первой хронической фазе, составляла 85% –
90% (Radich J.P. et al., 2003; Saussele S. et al., 2010). Выживаемость пациентов,
трансплантированных
в фазе акселерации, была значительно ниже, чем
оперированных в хронической фазе, и не превышала 50%. При этом тенденции к
39
повышению выживаемости за последние годы не наблюдается (Martin P.J. et al.,
1988; Devergie A. et al., 1990; Clift R.A. et al., 1994). Результаты трансплантаций,
проведенных в фазе бластного криза, еще более скромные. В этой группе больных
3-летняя выживаемость составляет только 10% – 20 % (Thomas E.D. et al., 1986;
Goldman J.M. et al., 1988), причем причинами смерти становятся как рецидивы,
так и осложнения, связанные с аллоТГСК.
Возраст
пациента
был
признан
одним
из
наиболее
значимых
прогностических факторов уже в самых ранних исследованиях, посвященных
эффективности аллоТГСК при ХМЛ (Thomas E.D. et al., 1986). До сих пор
выживаемость среди пациентов более молодого возраста выше, чем среди
пожилых.
Выбор
донора
также
играет
важную
роль
в
отношении
исхода
трансплантации. Достижения в усовершенствовании методов HLA-типирования и
терапии РТПХ позволили значительно улучшить результаты трансплантаций от
HLA-совметимых неродственных доноров. Более того, в случае полной HLAсовместимости между донором и реципиентом, результаты аллоТГСК почти
идентичны тем, что могут быть получены с совместимым родственным донором
(Hansen J.A. et al., 1998). В целом, родственные трансплантации характеризуются
более низкой смертностью, связанной с РТПХ и ассоциированными с ней
осложнениями, в том числе инфекционными. В то же время, при родственных
трансплантациях с большей частотой развиваются пост-трансплантационные
рецидивы заболевания, что, по-видимому, связано с меньшей выраженностью
эффекта «трансплантат против лейкоза». Еще в 1970-х годах было установлено,
что при трансплантациях, в которых донор и реципиент являются генетически
идентичными
близнецами,
частота
рецидивов
значительно
выше,
что
свидетельствует о важной роли реакции «трансплантат против лейкоза» (Fefer A.
et al., 1979).
Влияние
времени,
прошедшего
между
установлением
диагноза
и
проведением аллоТГСК, на исход трансплантации было обнаружено в целом ряде
исследований (Enright H. et al., 1996; Goldman J.M. et al., 1998). Так, в отчете
40
регистра International Bone Marrow Transplant Registry (IBMTR) приводятся
данные, согласно которым 5-летняя выживаемость пациентов в хронической фазе
составляет 70% в случае, если трансплантация проведена в течение 1 года после
установления диагноза и 60%, если трансплантация была проведена на более
поздних сроках. Большинство исследователей объясняют эту зависимость
негативным влиянием предшествующей терапии. До появления иматиниба
основными терапевтическими агентами при ХМЛ были бусульфан и интерферон,
и анализ влияния терапии каждым из препаратов на исход аллоТГСК показал, что
и бусульфан, и интерферон негативно влияют на результаты трансплантации
(Goldman J.M. et al., 1998; Hehlmann R. et al., 1999). В то же время, крупные
многоцентровые
исследования
показали,
что
предшествующая
терапия
иматинибом не является неблагоприятным прогностическим фактором при
проведении аллоТГСК (Zaucha J.M. et al., 2005; Deininger M. et al., 2006; Oehler
V.G. et al., 2007). Более того, по данным IBMTR, при анализе результатов
трансплантаций у 409 пациентов в хронической фазе с предшествовавшей
терапией иматинибом и 900 пациентов, не получавших иматиниб, было
обнаружено, что терапия иматинибом улучшает результаты аллоТГСК (Lee S.J. et
al., 2008). В то же время, не было обнаружено ни позитивного, ни негативного
влияния предшествовавшей терапии иматинибом на исход аллоТГСК у пациентов
в фазе акселерации и бластного криза.
В двух больших рандомизированных клинических исследованиях было
показано, что источник гемопоэтических стволовых клеток также оказывает
влияние на эффективность аллоТГСК у пациентов с ХМЛ. В частности, была
выявлена
тенденция
периферической
к
крови,
увеличению
чем
выживаемости
костного
мозга,
в
при
использовании
качестве
источника
гемопоэтических клеток (Bensinger W.I. et al., 2001; Couban S. et al., 2002). В этой
группе пациентов частота рецидивов была ниже, однако хроническая РТПХ
развивалась с большей частотой по сравнению с группой пациентов, которым
была проведена аллоТГСК с использованием клеток костного мозга (Oehler V.G.
et al., 2005).
41
Молекулярно-биологические факторы прогноза при аллоТГСК
Наиболее
полно
исследованный
молекулярно-биологический
фактор
прогноза при аллоТГСК это совместимость донора и реципиента по локусам
гистосовместимости (HLA). В многочисленных исследованиях было показано,
что степень несовместимости клеток донора и реципиента является критически
важной в развитии реакции РТПХ и ассоциируется со значительным снижением
общей выживаемости после аллоТГСК.
Помимо локусов HLA, многие другие молекулярно-биологические факторы
оказывают влияние на развитие основных пост-транслантационных осложнений,
в том числе РТПХ и рецидивы заболевания. Однако, их, роль в настоящее время
изучена в значительно меньшей степени.
Так, развитие острой РТПХ связано с такими факторами, как несовпадение
донора и реципиента по минорным антигенам гистосовместимости (HA1, CD31 и
CD49b) (Heinemann F.M. et al., 2004), гаплотипом KIR (Bao X.J. et al., 2010), а
также полиморфизмами в ряде генов цитокинов и рецептора фактора некроза
опухоли TNFRSFIB (Dickinson A.M. et al., 2009). Было показано, что
гиперэкспрессия гена BMI1, относящегося к группе PcG, ассоциирована с
меньшим риском развития посттрансплантационных осложнений у пациентов с
ХМЛ (Gratwohl A. et al., 2006).
Роль молекулярно-биологических факторов, влияющих на развитие посттрансплантационных рецидивов, в настоящее время остается очень слабо
изученной. В то же время, изучение и внедрение в клиническую практику
прогностических
молекулярно-биологических
маркеров
необходимо
для
совершенствования подходов к оптимизации терапии в пост-трансплантационном
периоде, особенно в отношении профилактики рецидивов. Значительные успехи,
достигнутые в разработке и внедрении молекулярно-биологических методов
мониторинга минимальной остаточной болезни при ХМЛ позволяют надеяться,
что и прогностические маркеры могут быть с успехом использованы в
клинической практике.
42
1.3.3.
Роль
аллогенной
трансплантации
в
эпоху
ингибиторов
тирозинкиназ
К концу 1990-х годов, ХМЛ был наиболее распространенным показанием
для аллоТГСК, и количество проведенных трансплантаций быстро росло с
каждым годом. Однако появление первого таргетного ингибитора тирозинкиназ,
иматиниба, полностью изменило эту тенденцию и уже с 2000 года количество
аллоТГСК при ХМЛ начало резко снижаться. Причиной снижения количества
трансплантаций стала гораздо большая степень безопасности терапии ИТК в
сравнении с аллоТГСК при сопоставимой эффективности. С начала 2000-х годов
иматиниб рекомендован в качестве первой линии терапии у пациентов с ХМЛ в
хронической фазе.
Вместе с тем, терапия иматинибом и другими ИТК, имеющимися в
клинической практике, эффективна не у всех пациентов с ХМЛ. На данный
момент выделено три основные группы пациентов, у которых применение ИТК не
дает значимых преимуществ в выживаемости и аллоТГСК остается «терапией
выбора».
Во-первых, терапия ИТК неэффективна у пациентов в фазе акселерации и
бластного криза, где стойких длительных ремиссий с их помощью получить не
удается. В то же время количество лейкозных клеток может быть успешно
снижено в случае применения ИТК в предтрансплантационном периоде.
Во-вторых,
острой
проблемой
остается
первичная
и
вторичная
резистентность к ИТК. Так, у пациентов в хронической фазе ХМЛ в 20 – 30 %
случаев развивается резистентность к иматинибу. ИТК второго поколения
способны восстановить полный цитогенетический ответ у 40 – 50 % из них,
однако у 10% – 20 % пациентов после первоначального ответа развивается
резистентность и к ИТК второго поколения (Kantarjian H. et al., 2006, 2007; Cortes
J. et al., 2007). Количество пациентов, у которых после неудачи терапии одним
ИТК второго поколения удается получить ответ на терапию другим ИТК второго
поколения, еще меньше.
43
В-третьих, применение ИТК второго поколения
неэффективно в тех
случаях, когда развитие резистентности к иматинибу связано с появлением
мутации T315I. По данным разных авторов, частота встречаемости мутации T315I
у пациентов, резистентных к иматинибу, составляет 10-20% (Nicolini F.E. et al.,
2009).
Поэтому в настоящее время в соответствии с рекомендациями LeukemiaNet
(ELN) проведение аллоТГСК у больных ХМЛ показано только в следующих
группах пациентов: 1) пациенты в фазе акселерации и бластного криза, 2)
пациенты, имеющие мутацию T315I, и 3) пациенты с резистентностью к ИТК 2-го
поколения (Gratwohl A. et al., 2006).
Таким образом, с появлением ингибиторов тирозинкиназ роль аллоТГСК в
терапии ХМЛ значительно изменилась и в настоящее время аллоТГСК выступает
в качестве второй, третьей и четвертой линий терапии. Это привело к тому, что
среди реципиентов аллоТГСК значительно увеличилось количество пациентов с
неблагоприятными клиническими и биологическими характеристиками. При этом
почти вдвое (с 32% до 53%) возросло количество пациентов, которым
трансплантация проводится во второй и более хронической фазе, фазе
акселерации и бластного криза (Bacher U. et al., 2009). Естественно, что эта
тенденция не могла не привести к снижению общей эффективности аллоТГСК.
Так, в ряде работ было отмечено увелечение частоты пост-трансплантационных
рецидивов (Hansen J. et al., 1998; McGlave P. et al., 2000; Martin M. et al., 2009).
Кроме
того,
увеличению
риска
пост-трансплантационных
осложнений
способствует излишняя предлеченность больных.
Другая проблема – изменение биологических свойств лейкозных клеток у
реципиентов аллоТГСК при ХМЛ. Так, подавляющее большинство направляемых
на аллоТГСК пациентов характеризуется
прогрессией заболевания и/или
резистентностью его к ИТК. Молекулярно-биологические механизмы, ведущие к
развитию резистентности и прогрессии заболевания во многом схожи между
собой, а с биологической точки зрения, резистентность к ИТК является
предвестником быстрой прогрессии заболевания. Поэтому, даже те резистентные
44
к терапии ИТК пациенты, которые на момент трансплантации находятся в
хронической фазе заболевания,
оказываются прогностически тяжелее, чем
следует из шкалы Gratwohl.
Очевидно,
что
трансплантационных
в
эпоху
рисков
ингибиторов
может
быть
тирозинкиназ
пересмотрена
и
шкала
для
ее
совершенствования необходимо провести исследования влияния на результаты
аллоТГСК факторов, связанных с резистентностью к ИТК и ее механизмами.
Вместе с тем, роль молекулярно-биологических факторов, ассоциированных
с
резистентностью
к
ингибиторам
тирозинкиназ,
в
развитии
пост-
трансплантационных рецидивов и осложнений остается мало изученной. В
литературе имеются единичные противоречивые сообщения о влиянии мутаций в
киназном домене гена BCR-ABL на исход аллоТГСК, имеющие противоречивый
характер.
Так, согласно результатам анализа выживаемости 44 пациентов с
резистентностью к ИТК после аллоТГСК, проведенного E. Jabbour (Jabbour E. et
al., 2011), в группе пациентов, имевших мутации в гене BCR-ABL, 2-летние общая
и безрецидивная выживаемость была ниже, чем в группе пациентов без мутаций
(44% и 36% против 76% и 58%). Однако группы пациентов с мутациями и без
мутаций статистически значимо различались по числу пациентов в фазе
акселерации и бластного криза, что затрудняет интерпретацию результатов.
Результаты анализа данных регистра EBMT о 64 трансплантациях у
пациентов с ХМЛ и Ph+ОЛЛ, имеющих мутацию T315I, показали, что общая
двухлетняя выживаемость составляла 59%, 67%, 30% и 25% для пациентов в
хронической
фазе,
фазе
акселерации,
бластном
кризе
и
при
Ph+ОЛЛ
соответственно (Nicolini F.E. et al., 2011). Полученные результаты выживаемости
были выше, чем в группе пациентов с мутацией T315I, которым трансплантация
не была проведена, и авторы исследования сделали вывод о том, что аллоТГСК
является наилучшим вариантом терапии для пациентов с мутацией T315I. Тем не
менее, в этом исследовании не было проведено анализа выживаемости в
контрольной группе пациентов, не имевших мутаций в гене BCR-ABL и поэтому
45
вопрос о прогностическом значении мутации T315I в отношении исхода
аллоТГСК остался открытым.
Работ, посвященных анализу влияния других молекулярно-биологических
факторов, ассоциированных с резистентностью к ИТК, в том числе уровня
экспрессии гена EVI1, на результаты аллоТГСК в доступной нам литературе не
встретилось.
Заключение
Таким образом, имеющиеся на сегодняшний день литературные данные
свидетельствуют о том, что терапия ингибиторами тирозинкиназ является
высокоэффективным методом лечения ХМЛ в хронической фазе заболевания.
Серьезной
проблемой
является
развитие
резистентности
к
ингибиторам
тирозинкиназ, обусловленной широким спектром механизмов, в том числе
молекулярно-биологическими факторами. В случае развития резистентности или
непереносимости терапии ингибиторами тирозинкиназ, а также у пациентов в
фазе акселерации и бластного криза эффективным методом терапии является
аллоТГСК. Накопленный за более чем 30 лет опыт применения аллоТГСК в
практике лечения ХМЛ показал, что этот метод характеризуется высокой
эффективностью и является единственным способом, позволяющим достичь
полной
элиминации
лейкозных
клеток.
Тем
не
менее,
тяжелые
пост-
трансплантационные осложнения и рецидивы в значительной степени снижают
выживаемость пациентов после аллоТГСК. В литературе имеется достаточно
большое количество данных о прогностическом значении клинических факторов
в отношении исхода аллоТГСК при ХМЛ. Вместе с тем влияние на
эффективность аллоТГСК молекулярно-биологических факторов, в том числе
связанных с развитием резистентности к терапии ИТК, изучено недостаточно.
Изучение этого вопроса является целью настоящего исследования.
46
ГЛАВА 2. МЕТОДЫ ИССЛЕДОВАНИЯ И ХАРАКТЕРИСТИКА
ПАЦИЕНТОВ
2.1. Характеристика пациентов
В исследование включено 92 больных ХМЛ с резистентностью к терапии
ингибиторами тирозинкиназ, находившихся на лечении в Институте детской
онкологии, гематологии и трансплантологии имени Р.М.Горбачевой Первого
Санкт-Петербургского государственного медицинского университета им. акад.
И.П. Павлова и гематологических клиниках г. Санкт-Петербурга и СевероЗападного региона РФ. Возраст больных составлял от 4 до 80 лет (медиана 50
лет). В исследованной группе пациентов было 45 (49%) мужчин и 47 (51%)
женщин. В хронической фазе ХМЛ находилось 73 (79%) пациентов, в фазе
акселерации и бластного криза - 19 (21%) пациентов. В контрольную группу
включены 25 больных ХМЛ, достигших оптимального ответа на терапию
иматинибом.
АллоТГСК была проведена у 35 пациентов с резистентностью к
ингибиторам тирозинкиназ. Трансплантации были выполнены в НИИ детской
онкологии, гематологии и трансплантологии им. Р.М.Горбачевой Первого СанктПетербургского государственного медицинского университета им. акад. И.П.
Павлова в период с 2008 по 2012 гг. Возраст больных на момент проведения
трансплантации варьировал от 8 до 58 лет, медиана 36 лет (рис. 4). Группа
пациентов, которым была проведена трансплантация, состояла из 24 (71%)
мужчин и 11 (29%) женщин.
Особенностью
изучаемой
группы
пациентов
было
значительное
преобладание больных с высокими значениями индекса Gratwohl, только 4 (12%)
пациента имели значения индекса менее 3. Таким образом, подавляющее
большинство больных относилось к группе высокого риска при проведении
аллоТГСК. В первой хронической фазе ХМЛ на момент трансплантации
находилось 12 (34%) больных, во второй и третьей хронических фазах – 12 (34%)
больных, в фазе акселерации 7 (20%) больных и в фазе бластного криза 4 (12%)
47
больных (рис. 5). Диапазон времени от постановки диагноза до проведения
аллоТГСК составил от 6 до 100 месяцев (медиана 38 месяцев).
Рис. 4. Распределение больных в зависимости от возраста на момент
аллоТГСК.
Рис. 5. Распределение больных в зависимости от стадии заболевания на
момент аллоТГСК.
48
Все пациенты в качестве первой линии терапии получали иматиниб. После
развития резистентности к иматинибу или его непереносимости 21 больной
(59%) получил ИТК второго поколения, в том числе дазатиниб – 13 (37%),
нилотиниб – 7 (20%) и босутиниб - 1 (3%). 7 (20%) пациентов после развития
резистентности к первому ИТК второго поколения получали второй ИТК второго
поколения.
Трансплантации от донора-родственника были произведены у 16 (44%)
пациентов, от неродственного донора – у 19 (56%). В качестве подготовки к
трансплантации 11 (29%) пациентов получали
миелоаблативный режим
кондиционирования (бусульфан и циклофосфан), 24 (71%) пациента получали
режимы кондиционирования со сниженной интенсивностью (бусульфан и
флюдарабин, мелфалан и флюдарабин). Источником трансплантата являлись
костный мозг и периферические стволовые клетки крови. Профилактику острой
РТПХ проводили комбинациями иммуносупрессивных препаратов, у 20 (57%)
больных на основе циклоспорина и у 14 (40%) больных на основе такролимуса.
Критериями восстановления кроветворения служили положения о приживлении
трансплантата гемопоэтических стволовых клеток, принятые EBMT (European
Bone Marrow Transplantation Group) и СIBMTR (Center for International Blood and
Marrow Research).
Исследование молекулярно-генетических характеристик клеток пациентов
проводили на образцах тотальной РНК, выделенной из периферической крови и
костного мозга больных до проведения аллоТГСК.
2.2. Метод исследования уровня относительной экспрессии
транскриптов химерного гена BCR-ABL
Уровень относительной экспрессии транскриптов р210 и р190 гена BCRABL определяли по методу, описанному в работе Gabert и соавторов (Gabert J. et
al., 2003). Метод предусматривает последовательное проведение следующих
этапов: 1) выделение тотальной РНК из периферической крови больных ХМЛ; 2)
реакцию обратной транскрипции со случайными гексамерными праймерами; 3)
49
ПЦР в реальном времени с праймерами и зондами, специфичными к
последовательностям транскриптов р210, р190 и контрольного гена ABL.
Определение уровня относительной экспрессии в исследуемом образце основано
на определении соотношения количества транскриптов изучаемого гена BCR-ABL
и контрольного
гена ABL, используемого для нормализации. Нуклеотидные
последовательности праймеров и зондов, которые были использованы в работе,
представлены в таблице 2.
Таблица 2.
Нуклеотидные последовательности праймеров и зондов, используемых для
определения уровней экспрессии транскриптов р210 и р190 гена BCR-ABL
Название гена и Название
транскрипта
Нуклеотидная последовательность (5’ – 3’)
праймера
или зонда
P210 BCR-ABL
P190 BCR-ABL
ABL
ENR561
CACTCAGACCCTGAGGCTCAA
ENF501
TCCGCTGACCATCAAYAAGGA
ENP541
ENF402
Fam-CCCTTCAGCGGCCAGTAGCATCTGA
CTGGCCCAACGATGGCGA
ENR561
CACTCAGACCCTGAGGCTCAA
ENP541
Fam-CCCTTCAGCGGCCAGTAGCATCTGA
ENF1003
TGGAGATAACACTCTAAGCATAACTAAAGGT
ENR1063
GATGTAGTTGCTTGGGACCCA
ENPr1043
Fam-CCATTTTTGGTTTGGGCTTCACACCATTTamra
Тотальную РНК выделяли из 200 мкл периферической крови больных ХМЛ
с помощью гуанидин-тиоционат хлороформ-фенольного метода с использованием
набора для экстракции РНК Рибозоль Д (ИнтерЛабСервис, Россия) в соответствии
с инструкцией производителя.
50
Синтез кДНК из РНК осуществляли с использованием случайных
гексамерных праймеров и обратной транскриптазы (набор RevertAid, Fermentas.
Литва). Реакцию обратной транскрипции проводили в объеме 40 мкл по
протоколу производителя. Для отжига и проведения реакции использовался ПЦРамплификатор iQ5 (Bio-Rad, США)
Реакцию ПЦР в реальном времени по технологии Taqman проводили на
амплификаторе iQ5 (Bio-Rad, США) с использованием набора реагентов для
амплификации M-428 (Синтол, Россия). Электрофоретически чистые праймеры и
зонды, содержащие флуорофоры FAM и JOE, были
произведены компанией
“Синтол” (Россия). Реакционная смесь содержала 4 мM NaCl, 50 мM KCl, 12 мM
ТрисHCl (pH 8.0), 2.5 мM MgCl2, 200 мкМ dNTP, 0,4 мкМ каждого праймера,
0,25 мкМ зонда, 0.05 мкг кДНК, а также 1 ед. Taq ДНК полимеразы.
ПЦР
проводили в объеме 25 мкл в следующем режиме: начальная инкубация при 95°С
в течение 5 мин, затем 45 циклов с условиями 95°С - 15 сек, 60°С - 1 мин.
Флуоресцентный сигнал определяли при 60°С по каналам FAM и JOE.
В
качестве
разведения
положительных
плазмид
с
известным
контролей
числом
использовали
копий
с
стандартные
вставкой
участка
соответствующего гена (Invitrogen, США). Диапазон используемых концентраций
стандартов составлял 102-106 копий/мкл. Стандарты использовали для построения
калибровочной кривой и определения эффективности реакции.
2.3. Методы исследования мутационного статуса гена BCR-ABL
Мутационный статус гена BCR-ABL изучали с помощью двух методов –
прямого секвенирования по Сэнгеру и аллель-специфичной ПЦР (АС ПЦР).
Метод определения мутаций в киназном домене гена BCR-ABL с помощью
прямого секвенирования по Сэнгеру подробно изложен в работе Hochhaus A.
(Hochhaus A. et al., 2002). Последовательность кДНК киназного домена
амплифицировали в два этапа с использованием праймеров, представленных в
таблице 2.3. и затем секвенировали в обоих направлениях с использованием
реактивов Big Dye 3.1. (Applied Biosystems, США). Полученную нуклеотидную
51
последовательность сравнивали с референсной последовательностью транскрипта
c-abl 1 (NCBI Reference Sequence: NM_005157.4). Используемый метод позволял
определять точную последовательность фрагмента с 596 по 1270 нуклеотид
транскрипта с-abl1 (рис. 6).
Рис. 6. Референсная последовательность транскрипта с-abl1 (начало) и
участок прочтения методом прямого секвенирования
Аллель-специфичную ПЦР для детекции точечной мутации T315I и
количественной оценки содержания мутантных транскриптов проводили в два
этапа. На первом этапе амплифицировали фрагмент химерного транскрипта p210
гена BCR-ABL, на втором этапе использовали ПЦР в режиме реального времени c
52
аллель-специфичными праймерами. Для повышения специфичности реакции
использовались LNA-модифицированнные праймеры, которые отличаются от
классических олигонуклеотидов повышенной специфичностью и аффинностью
при гибридизации (Orum H. et al., 1999). Для дискриминации нормальной и
мутантной последовательностей подобраны два обратных аллель специфичных
праймера, один прямой праймер и проба, содержащая флуорофор и гаситель для
детекции сигнала в режиме реального времени (таблица 3).
Таблица 3.
Нуклеотидные последовательности праймеров и зондов, используемых для
определения мутационного статуса гена BCR-ABL методом прямого
секвенирования по Сэнгеру и аллель-специфичной ПЦР
Название
Последовательность (5’→ 3’)
праймера или
Метод, в котором
используется праймер
зонда
или зонд
B2B
ACAGCATTCCGCTGACCATCAATAAG Секвенирование
A7-
AGACGTCGGACTTGATGGAGAACT
Секвенирование
AN4+
TGGTTCATCATCATTCAACGGTGG
Секвенирование
T315I R MT
TCCCGTAGGTCATGAATTCAA
АС ПЦР
T315I R WT
TCCCGTAGGTCATGAATTCAG
АС ПЦР
T315I F
TGCAGTCATGAAAGAGATCAAA
АС ПЦР
T315I Pr
FAM-
АС ПЦР
ACCCTAACCTAGTGCAGCTCCTTRTQ1
ПЦР проводили в объеме реакционной смеси 25 мкл, каждая проба
содержала 1 мкл продукта первого этапа амплификации, 0,4 мкМ
каждого
праймера и 0,25 мкМ зонда, TaqMan® Universal PCR Master Mix (Applied
Biosystems, США). Амплификацию и детекцию сигнала осуществляли на
53
амплификаторе iQ5 (Bio-Rad, США) с использованием следующего режима:
начальная инкубация при 95°С в течение 10 мин, 40 циклов денатурации при 95°С
15 сек, отжига праймеров и элонгации при 60°С 1 мин.
Количественную оценку результатов ПЦР проводили по методу ∆Ct.
Одновременное проведение двух реакций, специфичных для мутантного
транскрипта и транскрипта дикого типа позволяло получить два значения Ct,
которые использовали для определения соотношения мутантного и нормального
транскриптов в пробе по ранее описанному методу (Germer S. et al., 2000).
Процент мутантных транскриптов рассчитывали по формуле % MUT =
1/(2∆Ct(mut-wt)+ 1) × 100.
2.4. Метод исследования уровня относительной экспрессии гена EVI1
Ген EVI1 расположен в пределах хромосомного локуса 3q26 и входит в
состав комплекса MDS1-EVI1 (рис. 7).
Рис. 7. Схематическое изображение расположения гена EVI1 на хромосоме
3 (А) и строение локуса MDS1-EVI1 (B). Стрелкой отмечен детектируемый регион
(место расположения праймеров и зонда).
54
В нормальных клетках различного происхождения за счет альтернативного
сплайсинга образуется 7 транскриптов гена EVI1, два из которых представляют
собой слитные транскрипты MDS1-EVI1 и пять образуются только с участием
гена EVI1 (рис. 7). В проведенном исследовании изучали суммарную экспрессию
всех семи транскриптов EVI1. Праймеры и зонд, использовавшиеся для детекции
уровня экспрессии, были расположены в последних двух экзонах гена EVI1,
входящих в состав всех семи транскриптов.
Для определения уровня относительной экспрессии гена EVI1 использовали
метод, предложенный Groshel и соавторами (Groschel S. et al., 2010), с
некоторыми модификациями. Метод основан на определении соотношения
количества транскриптов изучаемого и контрольного гена в исследуемом образце
с помощью ПЦР в реальном времени и в целом сходен с методом, используемым
для оценки уровня относительной экспрессии гена BCR-ABL.
В отличие от метода, предложенного Groshel, в качестве контрольного гена
использовали не PBGD, а ABL. Выбор контрольного гена был обусловлен тем, что
он используется для нормализации уровня экспрессии транскриптов гена BCRABL. Использование одного и того же контрольного гена для нормализации
оценки экспрессии двух различных исследуемых генов (EVI1 и BCR-ABL)
позволяет напрямую сравнивать результаты, полученные при исследовании
уровня относительной экспрессии каждого из генов.
Нуклеотидные последовательности праймеров и зонда, специфичные для
гена EVI1, приведены в таблице 4.
Таблица 4.
Нуклеотидные последовательности праймеров и зонда, используемых для
определения уровня экспрессии гена EVI1.
Название праймера
Нуклеотидная последовательность (5’ – 3’)
EVI1 ex14 fw
AGTGCCCTGGAGATGAGTTG
EVI1 ex15 rev
TTTGAGGCTATCTGTGAAGTGC
EVI1 ex14-15 probe
FAM-CCCCAGTGAGGTATAAAGAGGA-RTQ1
55
Для определения уровня экспрессии контрольного гена ABL использовали
те же праймеры и зонд, которые описаны в разделе, посвященном методу
исследования уровня относительной экспрессии гена BCR-ABL.
Выделение РНК из периферической крови и костного мозга, реакцию
обратной транскрипции, ПЦР в реальном времени
производили на том же
оборудовании и с теми же материалами, которые использовали для оценки уровня
относительной экспрессии BCR-ABL. Уровень относительной экспрессии гена
EVI1 определяли с помощью метода ∆∆Сt (Livak K.J. et al., 2001). Каждый образец
был протестирован три раза и среднее значение Сt было использовано для
вычислений.
2.5. Статистическая обработка данных
Статистическую обработку данных проводили в пакетах STATISTICA 10.0
и
R.
Для
сравнения
различий
в
непрерывных
данных
использовали
непараметрический U-тест Манна-Уитни. Категориальные данные оценивали с
помощью двухстороннего точного теста Фишера. Анализ общей и безрецидивной
выживаемости проводили по методу Каплан-Майер, используя лог-ранк-тест для
оценки достоверности различий. Многофакторный анализ выполняли с помощью
метода регрессии Кокса. Статистически достоверными считали различия при
значимостях p < 0,05 (Глянц С.П. и соавт., 1999).
56
ГЛАВА 3. РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ
Проведенное исследование состоит из двух взаимосвязанных частей. В
первой части были изучены молекулярно-биологические характеристики 92
больных ХМЛ с резистентностью к ингибиторам тирозинкиназ. У 35 пациентов
из этой группы была проведена аллоТГСК. Во второй части исследования мы
оценили влияние изученных молекулярно-биологических характеристик на
результаты аллоТГСК.
3.1. Молекулярно-генетические характеристики больных ХМЛ с
резистентностью к ингибиторам тирозинкиназ
В центре нашего внимания находились два гена, вовлеченных в патогенез
ХМЛ – BCR-ABL и EVI1. Роль BCR-ABL в патогенезе ХМЛ и развитии
резистентности к ингибиторам тирозинкиназ изучена достаточно подробно, о
роли гена EVI1 известно гораздо меньше. Влияние уровня экспрессии и
мутационного статуса этих двух генов на результаты аллоТГСК в настоящее
время остается весьма мало изученным.
В исследование были включены три характеристики, описывающие
состояние гена BCR-ABL у больных ХМЛ: 1) уровень относительной экспрессии
основного транскрипта, вовлеченного в патогенез ХМЛ (р210), 2) коэкспрессия
транскрипта р190, возникающего при ХМЛ за счет альтернативного сплайсинга и
3) наличие мутаций в киназном домене гена, ассоциированных с резистентностью
к ИТК. Что касается гена EVI1, то в исследовании был изучен только уровень
экспрессии гена, поскольку данные о вовлеченности мутаций в этом гене в
канцерогенез или развитие резистентности к терапии в литературе отсутствуют.
3.1.1. Уровень экспрессии транскрипта р210 BCR-ABL
Экспрессия типичного для ХМЛ транскрипта р210 гена BCR-ABL была
обнаружена у всех включенных в исследование пациентов с резистентностью к
ингибиторам
тирозинкиназ
(n=92).
Уровень
экспрессии
p210
BCR-ABL
57
относительно контрольного гена ABL значительно варьировал, медиана составила
98, диапазон от 1 до 474 копий BCR-ABL на 100 копий ABL. У пациентов в фазе
акселерации и бластного криза уровень экспрессии p210 BCR-ABL был лишь в
незначительной степени повышен по сравнению с группой пациентов в
хронической фазе ХМЛ (р = 0,65, рис. 8).
Рис. 8. Уровень относительной экспрессии транскрипта р210 гена BCR-ABL
у больных ХМЛ в зависимости от стадии заболевания
Уровень экспрессии транскрипта р210 гена BCR-ABL в группе больных,
получавших терапию ИТК второго поколения после развития резистентности к
иматинибу, был также незначительно повышен по сравнению с группой больных,
получавших только иматиниб (рис. 9).
Таким образом, уровень экспрессии гена BCR-ABL у больных ХМЛ,
резистентных к терапии ингибиторами тирозинкиназ, варьирует в широком
диапазоне. Не было получено данных, свидетельствующих об ассоциации
высокого уровня экспрессии BCR-ABL с фазой заболевания или предшествующей
терапией ИТК второго поколения.
58
Рис. 9. Уровень относительной экспрессии транскрипта р210 гена BCR-ABL
у больных ХМЛ в группах с резистентностью к иматинибу и ИТК второго
поколения
3.1.2. Коэкспрессия транскрипта р190 BCR-ABL
Интересной особенностью ХМЛ является довольно часто обнаруживаемая
коэкспрессия
второго
химерного
транскрипта,
р190,
гена
BCR-ABL.
В
исследованной группе пациентов коэкспрессия химерного транскрипта p190 была
отмечена у половины больных, причем уровень экспрессии p190 относительно
экспрессии гена ABL был низким (медиана 1,0, диапазон 0,02 - 12,7). Наличие
коэкспрессии р190 было ассоциировано с высоким уровнем экспрессии р210 (p =
0,0156, рис. 10).
Была обнаружена тенденция к более высокой частоте встречаемости
коэкспрессии р190 BCR-ABL в группе пациентов в фазе акселерации и бластного
криза по сравнению с группой в хронической фазе, однако наблюдаемая
тенденция не достигла уровня статистической значимости (р=0,1931).
59
Рис. 10. Уровень относительной экспрессии транскрипта р210 гена BCRABL у больных ХМЛ в зависимости от наличия или отсутствия экспрессии
транскрипта р190 BCR-ABL
Между группами пациентов, резистентных к иматинибу и ИТК второго
поколения статистически значимых различий в частоте коэкспрессии р190 BCRABL обнаружено не было (р=0,6404).
В исследуемой группе пациентов уровень экспрессии транскрипта р190
был в среднем в 100 раз ниже, чем уровень экспрессии транскрипта р210 BCRABL, что свидетельствует скорее о нарушениях в механизмах, контролирующих
альтернативный сплайсинг, чем о ведущей роли транскрипта р190 в патогенезе
заболевания и развитии резистентности.
3.1.3. Спектр и частота мутаций в киназном домене гена BCR-ABL
При исследовании мутационного статуса гена BCR-ABL методом прямого
секвенирования у 36 из 92 (38%) пациентов с резистентностью к ИТК были
выявлены различные мутации, представляющие собой замены единичных
нуклеотидов в последовательности ДНК.
60
Была отмечена тенденция к ассоциации мутаций в гене BCR-ABL c
повышенным уровнем экспрессии этого же гена (рис. 11), что подтверждает
выводы проведенных ранее исследований (Barnes D.J. et al., 2005).
Рис. 11. Уровень относительной экспрессии гена BCR-ABL в зависимости от
мутационного статуса
Всего было обнаружено 13 различных мутаций, частота встречаемости
которых значительно варьировала. Полный спектр и частота выявленных мутаций
представлены на рисунке 12. Мутации T315I, G250E, Y253H, F317L, E255K и
F359C
обнаруживались с наибольшей частотой, частота их встречаимости
составила 26% (n=10), 18% (n=7), 13% (n = 5), 11% (n=4), 8% (n=3) и 5% (n=2)
соответственно. Другие мутации (G250E, Q252Hc, E255V, V299L, F359V, H396P
и H396R) были выявлены только в одном случае каждая. У пяти (13%) пациентов
были обнаружены двойные мутации, у троих из них обе мутации присутствовали
в 100% клеток, у двоих же, по-видимому, сосуществовали два различных клона
лейкозных клеток, несущих две различные мутации, по одной мутации в каждом
клоне.
61
Рис. 12. Спектр и частота мутаций в киназном домене гена BCR-ABL у
больных ХМЛ с резистентностью к ИТК
Как показал анализ наблюдаемого спектра мутаций, изменениями были
затронуты только 9 аминокислотных остатков в последовательности белка BCRABL. Их частота, а также пространственное расположение в структуре киназы
BCR-ABL в комплексе с иматинибом представлены на рисунке 13.
62
Рис. 13. Локализация обнаруженных мутаций (желтый цвет) в структуре
киназного домена белка BCR-ABL (фиолетовый цвет) в комплексе с иматинибом
(красный цвет) и их частота у больных ХМЛ с резистентностью к ИТК
63
Как видно на рисунке, почти все мутации затронули участки молекулы
белка BCR-ABL, непосредственно взаимодействующие с ИТК.
Распределение мутаций по функциональным участкам киназного домена
BCR-ABL было следующим: 48% мутаций были локализованы в Р-петле (G250,
Q252, Y253, E255) и 6 % (Н396) в А-петле.
Нетипичные мутации в киназном домене BCR-ABL
Согласно литературным данным, подавляющее большинство мутаций в
киназном домене гена BCR-ABL, ассоциированных с резистентностью к терапии
ИТК, являются миссенс-мутациями, приводящими к замене одной аминокислоты
в белке BCR-ABL на другую. Остальные же типы мутаций встречаются крайне
редко. В нашей группе пациентов мы наблюдали такую же закономерность.
Однако у одного из пациентов структура киназного домена BCR-ABL была
довольно нетипичной. Помимо мутации T315I были обнаружены три делеции del P296-G303, del L341-I347 и del G383-T389 (рис. 14). Пространственное
расположение делеций в структуре белка BCR-ABL таково, что белок с этими
делециями полностью утрачивает тирозинкиназную активность (рис. 15).
Несмотря на это, у пациента наблюдалась резистентность как к иматинибу, так и
к ИТК второго поколения, что косвенно свидетельствует о том, что BCR-ABL
независимые механизмы патогенеза ХМЛ и резистентности к терапии ИТК могут
полностью компенсировать утраченную тирозинкиназную активность BCR-ABL.
Клональная эволюция и отбор резистентных клонов
Развитие
резистентности
к
ингибиторам
тирозинкиназ
посредством
появления мутаций в киназном домене гена BCR-ABL представляет собой
эволюционный процесс, в ходе которого те клоны лейкозных клеток, которые
приобретают мутации, получают преимущество в пролиферации в присутствии
соответствующего ИТК и постепенно вытесняют другие клоны. Мы исследовали
динамику этого процесса у пациента с первичной резистентностью к иматинибу с
помощью ретроспективного анализа методами прямого секвенирования и аллель-
64
Рис. 14. Последовательность нуклеотидов (наверху) и соответствующих им
аминокислот (внизу) в киназном домене гена BCR-ABL у пациента Б
65
Рис. 15. Пространственное расположение делеций и точечной мутации в
киназном домене белка BCR-ABL у пациента Б.
специфичной ПЦР серии образцов периферической крови, полученных в разное
время в течение одного года наблюдения (рис. 16).
Как видно на рисунке, на момент установления первичной резистентности к
иматинибу (отсутствие гематологического ответа через три месяца терапии)
мутация T315I не выявлялась (точка A).
Далее, несмотря на увеличение дозы препарата, уровень экспрессии BCRABL повысился на фоне отсутствия гематологического ответа и роста клона Ph+
66
клеток до 100%. В этот момент мутация T315I не выявляется методом прямого
секвенирования, однако по результатам аллель-специфичной ПЦР
Рис. 16. Динамика уровня экспрессии транскриптов T315I(+) у пациента с
резистентностью к ИТК
обнаруживается очень небольшой клон клеток с мутацией (0,14% транскриптов
p210 BCR-ABL, точка B).
После смены терапии на дазатиниб на 27 день был получен полный
гематологический ответ, но через три месяца гематологический ответ был утерян.
67
Уровень экспрессии BCR- ABL значительно снизился, в то время как по данным
аллель-специфичной ПЦР количество транскриптов с мутацией T315I возросло до
18,66% (точка С).
Данный уровень аллельной нагрузки является пороговым для метода
прямого секвенирования и мутация этим методом обнаружена не была. Еще через
три месяца уровень экспрессии BCR-ABL незначительно повысился и количество
транскриптов с мутацией T315I составляло уже 91,61% (точка D). В этом случае
мутация T315I была обнаружена как с помощью метода прямого секвенирования,
так и с помощью аллель-специфичной ПЦР.
Пациенту была проведена аллоТГСК от родственного донора. После
трансплантации, уровень экспрессии BCR-ABL был на детектируемом уровне в
течение пяти месяцев, на 160 день был достигнут полный молекулярный ответ.
Мутация T315I во время всего пост-трансплантационного периода не выявлялась
ни методом прямого секвенирования, ни методом аллель-специфичной ПЦР.
Отсюда можно сделать вывод, что первичная резистентность к иматинибу у
данного пациента была обусловлена BCR-ABL независимыми механизмами,
которые оказались неэффективными при терапии дазатинибом и в течение месяца
после смены терапии наблюдалось снижение количества лейкозных клеток.
Однако предсуществовавший минорный клон клеток с мутацией T315I на фоне
терапии дазатинибом обладал высокой пролиферативной активностью и через
полгода после начала терапии дазатинибом подавляющее большинство лейкозных
клеток имело эту мутацию и было резистентно к проводимой терапиии.
На данном примере видно, что аллель-специфичная ПЦР позволяет
выявлять клетки с мутацией T315I на 3-6 месяцев раньше, чем стандартный метод
прямого секвенирования, что дает возможность на более ранних сроках начать
поиск донора для аллоТГСК.
Таким образом, в результате проведенного исследования определены
спектр и частота мутаций в киназном домене гена BCR-ABL, обнаружены ранее не
описанные сложные нарушения структуры (комплексные делеции) BCR-ABL,
изучена динамика возникновения мутантного клона и предложен метод более
68
чувствительной детекции мутации T315I. Точечные мутации в киназном домене
гена BCR-ABL были обнаружены у 38% пациентов с резистентностью к ИТК. В
исследованной группе пациентов было обнаружено 13 различных мутаций,
затрагивающих 9 аминокислотных остатков в белке BCR-ABL. C наиболее
высокой частотой встречалисть мутации T315I (26%), G250E (18%), Y253H (13%),
F317L (11%), E255K (8%), F359C (5%). В единичных случаях были отмечены
более сложные структурные нарушения гена, такие как делеции нескольких
аминокислотных оснований.
3.1.4. Экспрессия гена EVI1
Уровень экспрессии EVI1 был определен у 92 больных ХМЛ с
резистентностью к ингибиторам тирозинкиназ и у 24 пациентов, достигших
полного молекулярного ответа. Между двумя анализируемыми группами
пациентов были обнаружены статистически значимые различия по уровню
относительной экспрессии гена EVI1 (рис. 17).
Рис. 17. Уровень экспрессии гена EVI1 в зависимости от ответа на терапию
ИТК
69
У пациентов с резистентностью к ИТК уровень экспрессии гена EVI1 был
выше, чем у пациентов, достигших ПМО (p=0,0179).
Далее в группе 92 больных с резистентностью к ИТК была исследована
взаимосвязь между уровнем экспрессии гена EVI1 и экспрессией различных
транскриптов гена BCR-ABL и его мутационным статусом.
Анализ коэкспрессии гена EVI1 и транскрипта р210 гена BCR-ABL показал
отсутствие статистически значимой корреляции в исследуемой группе пациентов
(p = 0,1125, рис. 18).
Рис. 18. Взаимосвязь уровней относительной экспрессии гена EVI1 и
транскрипта p210 гена BCR-ABL у больных ХМЛ с резистентностью к ИТК
В то же время, у трех пациентов были проанализированы серийные
образцы. полученные в
различных временных точках, и была обнаружена
высокая степень корреляции между изменением уровней экспрессии EVI1 и р210
BCR-ABL с течением времени. На рисунке 19 представлены данные мониторинга
уровней
экспрессии
этих
генов
у
пациента
В.
Полученные
данные
70
свидетельствуют о том, что соотношение экспрессии EVI1 и р210BCR-ABL
является индивидуальным для каждого пациента.
Рис. 19.
Взаимосвязь уровней относительной экспрессии гена EVI1 и
транскрипта p210 гена BCR-ABL у пациента В.
При сравнении групп пациентов с детектируемой экспрессией и без
экспрессии транскрипта р190 гена BCR-ABL было обнаружено, что наличие
коэкспрессии транскрипта р190 ассоциировано с более высоким уровнем
экспрессии гена EVI1 (p = 0,0452, рис. 20).
Далее была исследована взаимосвязь экспрессии гена EVI1 и мутационного
статуса гена BCR-ABL у больных ХМЛ с резистентностью к ИТК. Было показано,
что в группе пациентов с мутациями BCR-ABL (n=36) по сравнению с группой не
имевших мутаций (n=56) уровень экспрессии EVI1 значительно понижен
(р=0.0438, рис. 21). Кроме того, была отмечена тенденция, не достигшая уровня
статистической значимости, к более низкому уровню экспрессии гена EVI1 в
группе пациентов с мутацией T315I по сравнению с группой пациентов с другими
мутациями гена BCR-ABL (рис. 22).
71
Рис. 20. Взаимосвязь уровня относительной экспрессии гена EVI1 и
коэкспрессии транскрипта p190 гена BCR-ABL
Рис. 21. Уровень относительной экспрессии гена EVI1 в зависимости от
мутационного статуса гена BCR-ABL
72
Рис. 22. Уровень относительной экспрессии гена EVI1 в различных группах
больных ХМЛ
Таким образом, впервые показано, что гиперэкспрессия гена EVI1
характерна для резистентных к ИТК пациентов, не имеющих мутаций в киназном
домене
гена
BCR-ABL.
Это
наблюдение
говорит
о
возможной
роли
гиперэкспрессии гена EVI1 в развитии BCR-ABL-независимой резистентности к
ингибиторам тирозинкиназ. Исследование этих механизмов необходимо для
поиска путей преодоления резистентности и дальнейшее изучение роли EVI1 в
развитии резистентости представляется весьма актуальным.
3.2.
Анализ
эффективность
влияния
аллоТГСК
молекулярно-генетических
у
больных
ХМЛ
с
факторов
резистентностью
на
к
ингибиторам тирозинкиназ
АллоТГСК была проведена у 35 больных ХМЛ с резистентностью к
ингибиторам тирозинкиназ. Мы изучили влияние описанных выше четырех
молекулярно-биологических характеристик на эффективность аллоТГСК. В
73
качестве критериев эффективности терапии были использованы следующие
показатели: 1) общая выживаемость больных, 2) безрецидивная выживаемость, 3)
частота достижения полного молекулярного ответа, 4) частота развития
посттрансплантационных рецидивов, 5) смертность по причинам, связанным с
посттрансплантационными осложнениями, 6) смертность по причине прогрессии
основного заболевания.
Помимо
молекулярно-биологических
характеристик
были
изучены
клинические факторы, влияющие на эффективность аллоТГСК у больных ХМЛ и
для тех прогностических факторов, где были получены статистически значимые
различия в однофакторном анализе выживаемости, был проведен также
многофакторный анализ с целью определить степень независимости их влияния
на результаты аллоТГСК.
3.2.1. Результаты аллоТГСК
После проведения аллоТГСК 25 (73%) пациентов достигли полного
молекулярного ответа, у двух пациентов был получен только полный
цитогенетический ответ. У 5 пациентов ответа на терапию получено не было, у 3
из них было зарегистрировано неприживление или отторжение трансплантата.
Пост-трансплантационные рецидивы имели место у 12 (35%) пациентов, в том
числе у 2 только на молекулярном уровне, у 10 на цитогенетическом уровне. Всем
пациентам с пост-трансплантационными рецидивами была проведена инфузия
донорских лимфоцитов и в 8 случаях пациенты получили терапию ингибиторами
тирозинкиназ. В результате у 5 пациентов был достигнут полный молекулярный
ответ и 5 пациентов умерли в результате прогрессии заболевания. Другими
причинами смерти были различные посттрансплантационные осложнения, такие
как неприживление и отторжение трансплантата (n=3), инфекции (n=2), острая и
хроническая РТПХ (n=5). Четырем пациентам были проведены повторные
аллоТГСК.
74
3.2.2. Прогностическое значение уровня экспрессии транскрипта р210
BCR-ABL
Уровень относительной экспрессии транскрипта р210 гена BCR-ABL в
предтрансплантационном периоде (от 0 до 50 дней до аллоТГСК) был определен
у 26 пациентов. Медиана уровня относительной экспрессии p210 BCR-ABL
составила 98 копий транскрипта p210 BCR-ABL на 100 копий ABL. Для анализа
влияния уровня экспрессии p210 BCR-ABL на результаты аллоТГСК пациенты
были разделены на две группы – группа с высоким уровнем экспрессии (выше
медианы) и группа с низким уровнем экспрессии (ниже медианы).
Между группами пациентов с высоким и низким уровнем экспрессии р210
BCR-ABL не было статистически достоверных различий по клиническим
характеристикам (возрасту, полу, стадии заболевания, индексу Gratwohl и
предшествующей терапии ИТК) (таблица 5).
Таблица 5.
Характеристика пациентов в группах с высокой и низкой экспрессией
транскрипта р210 гена BCR-ABL
Характеристика пациента
Уровень экспрессии
р
р210 BCR-ABL
Низкий, n(%)
Высокий, n(%)
Возраст
1,0000
< 36 лет
4 (15,38)
5 (19,23)
> 36 лет
9 (34,62)
8 (30,77)
Пол
1,0000
Мужской
9 (34,62)
10 (38,46)
Женский
4 (15,38)
3 (11,54)
Стадия заболевания
0,6727
ХФ
10 (38,46)
8 (30,77)
ФА и БК
3 (11,54)
5 (19,23)
75
Предшествующая терапия
1,0000
Иматиниб
3 (11,54)
4 (15,38)
Иматиниб + ИТК
10 (38,46)
9 (34,62)
второго поколения
Индекс Gratwohl
1,0000
< 3
2 (7,69)
2 (7,69)
>=3
11 (42,31)
11 (42,31)
Донор
0,4337
Родственный
8 (32,00)
5 (20,00)
Неродственный
5 (20,00)
7 (28,00)
Анализ влияния уровня экспрессии транскрипта p210 BCR-ABL в
предтрансплантационном периоде на общую и безрецидивную выживаемость
пациентов с ХМЛ после аллоТГСК не выявил статистически значимого влияния
этого фактора в исследованной группе пациентов. Общая выживаемость после
аллоТГСК в группах пациентов с высоким и низким уровнем экспрессии BCRABL до трансплантации была почти идентичной, а однолетняя общая
выживаемость составила 47 и 48% соответственно (р = 0,95). Безрецидивная
выживаемость была несколько выше в группе пациентов с низким уровнем
экспрессии BCR-ABL (41% против 31%, р = 0,56). Кривые выживаемости
представлены на рисунке 23.
Далее был проведен анализ влияния уровня экспрессии р210 BCR-ABL в
предтрансплантационном периоде на различные показатели эффективности
аллоТГСК у больных ХМЛ - частоту достижения полного молекулярного ответа,
частоту цитогенетических рецидивов, смертность, связанную с осложнениями
аллоТГСК, а также смертность по причине прогрессии основного заболевания. Ни
по одному из проанализированных показателей различий между группами
пациентов с высоким и низким уровнем экспрессии р210 BCR-ABL обнаружено не
было (таблица 6).
76
Рис. 23. Общая и безрецидивная выживаемости больных ХМЛ после
аллоТГСК в зависимости от уровня экспрессии транскрипта р210 BCR-ABL
77
Таблица 6.
Эффективность аллоТГСК у пациентов с ХМЛ в зависимости от уровня
относительной экспрессии транскрипта р210 BCR-ABL до трансплантации
Показатель
Низкая
Высокая
эффективности
экспрессия
экспрессия
аллоТГСК
p210 BCR-
p210 BCR-
ABL
ABL
p
Полный молекулярный
ответ
1,0000
Нет, n (%)
3 (11,54)
4 (15,38)
Есть, n (%)
10 (38,46)
9 (34,62)
Цитогенетический
рецидив
0,6881
Нет, n (%)
7 (26,92)
9 (34,62)
Есть, n (%)
6 (23,08)
4 (15,38)
Нет, n (%)
9 (34,62)
9 (34,62)
Есть, n (%)
4 (15,38)
4 (15.38)
Нет, n (%)
11 (42,31)
12 (46,15)
Есть, n (%)
2 (7.69)
1 (3,85)
Смерть по причинам,
связанным с
трансплантацией
1,0000
Смерть в связи с
прогрессией ХМЛ
1,0000
Таким образом, нет оснований считать, что уровень экспрессии транскрипта
р210 гена BCR-ABL в предтрансплантационном периоде у больных ХМЛ с
резистентностью к ингибиторам тирозинкиназ оказывает влияние на основные
показатели эффективности аллоТГСК, в том числе на общую и безрецидивную
78
выживаемости, частоту развития посттрансплантационных рецидивов и частоту
достижения полного молекулярного ответа.
3.2.3. Прогностическое значение коэкспрессии транскрипта р190 BCRABL
Помимо уровня экспрессии транскрипта р210, у 23 пациентов был также
определен уровень относительной экспрессии транскрипта p190 гена BCR-ABL в
предтрансплантационном периоде. В отличие от транскрипта р210, который
играет ключевую роль в патогенезе ХМЛ и был обнаружен у всех больных ХМЛ с
резистентностью к ИТК в нашем исследовании, экспрессия транскрипта р190
наблюдалась только у половины пациентов (12 из 23), причем этот транскрипт
экспрессировался на очень низком уровне. Для анализа влияния экспрессии
транскрипта р190 BCR-ABL на результаты аллоТГСК пациенты были разделены
на две группы – группу с коэкспрессией p190 (наличием детектируемого с
помощью ПЦР в реальном времени транскрипта р190) и группу с отсутствием
коэкспрессии p190.
Коэкспрессия транскрипта р190 была более характерна для пациентов в
фазе акселерации и бластного криза (p = 0,19, рис. 24).
Рис. 24. Частота коэкспрессии транскрипта р190 гена BCR-ABL в
зависимости от стадии заболевания
79
Клинические
характеристики
пациентов
в
группах
с
наличием
и
отсутствием коэкспрессии р190 BCR-ABL, а также условия проведения аллоТГСК
обобщены в таблице 7.
Таблица 7.
Характеристика пациентов в группах с наличием и отсутствием
коэкспрессии транcкрипта р190 BCR-ABL до трансплантации
Характеристика пациента
Коэкспрессия р190
р
BCR-ABL
Нет
Есть
Возраст
0,4003
< 36 лет
5 (21,74)
3 (13,04)
> 36 лет
6 (26,09)
9 (39,13)
Пол
1,0000
Мужской
8 (34,78)
9 (39,13)
Женский
3 (13,04)
3 (13,04)
Стадия заболевания
0,1930
ХФ
9 (39,13)
6 (26,09)
ФА и БК
2 (8,70)
6 (26,09)
Предшествующая терапия
0,6404
Иматиниб
3 (13.04)
2 (8,70)
Иматиниб + ИТК
8 (34,78)
10 (43,48)
второго поколения
Индекс Gratwohl
1,0000
< 3
2 (8,70)
2 (8,70)
>=3
9 (39,13)
10 (44,17)
Донор
1,0000
Родственный
6 (27.27)
7 (31,82)
Неродственный
5 (22,73)
4 (18,18)
80
Следует отметить, что в группе с наличием коэкспрессии р190 наблюдалась
тенденция к преобладанию пациентов с высоким индексом Gratwohl (р = 0,18).
Таким образом, при анализе влияния экспрессии р190 BCR-ABL на результаты
аллоТГСК в исследуемой группе пациентов следует учитывать, что в данной
группе наличие коэкспрессии р190 ассоциировано с более неблагоприятными
клиническими характеристиками больных.
В группе пациентов с коэкспрессией транскрипта р190 BCR-ABL как общая,
так и безрецидивная выживаемости были ниже, чем в группе без коэкспрессии
транскрипта
р190,
статистической
однако
наблюдаемые
значимости.
Однолетняя
различия
общая
не
достигли
выживаемость
уровня
составила
соответственно 31 и 55% (р = 0,38), безрецидивная выживаемость – 14 и 46% (р =
0,08). Кривые выживаемости представлены на рисунке 25.
Помимо тенденции к более короткой безрецидивной выживаемости, в
группе пациентов с коэкспрессией р190 также наблюдалась тенденция к более
низкой частоте достижения полного молекулярного ответа (р = 0,07, рис. 26).
Статистически значимых различий между двумя изучаемыми группами
пациентов
по
частоте
цитогенетических
рецидивов,
смертности
от
посттрансплантационных осложнений и смертности по причине прогрессии
заболевания обнаружено не было (таблица 8).
Таким образом, в однофакторном анализе в исследованной группе больных
ХМЛ с резистентностью к ИТК была обнаружена тенденция к ассоциации
коэкспрессии транскрипта р190 гена BCR-ABL до аллоТГСК с более короткой
безрецидивной
выживаемостью
и
низкой
частотой
достижения
полного
молекулярного ответа после аллоТГСК. Однако при интерпретации результатов
следует учитывать выявленную тенденцию к ассоциации коэкспрессии р190 с
фазой акселерацией и бластным кризом и более высоким индексом Gratwohl.
81
Рис. 25. Общая и безрецидивная выживаемость больных ХМЛ после
аллоТГСК в зависимости от наличия коэкспрессии транскрипта р190 BCR-ABL
82
Рис. 26. Частота достижения полного молекулярного ответа после
аллоТГСК у больных ХМЛ в зависимости от наличия коэкспрессии транскрипта
р190 BCR-ABL
Таблица 8.
Эффективность аллоТГСК у пациентов с ХМЛ в зависимости от наличия
коэкспрессии транскрипта р190 BCR-ABL до трансплантации
Показатель
Отсутствие
Коэкспрессия p
эффективности
коэкспрессии р190 BCR-
аллоТГСК
р190 BCR-
ABL
ABL
Полный молекулярный
ответ
0,0686
Нет, n (%)
1 (4,35)
6 (26,09)
Есть, n (%)
10 (43,48)
6 (26,09)
83
Цитогенетический
рецидив
0,2137
Нет, n (%)
8 (34,78)
5 (21,74)
Есть, n (%)
3 (13,04)
7 (30,43)
Смерть по причинам,
связанным с
трансплантацией
0,6668
Нет, n (%)
7 (30.43)
9 (39,13)
Есть, n (%)
4 (17,39)
3 (13,04)
Смерть в связи с
прогрессией ХМЛ
1,0000
Нет, n (%)
10 (43,48)
10 (43,48)
Есть, n (%)
1 (4.35)
2 (8,70)
3.2.4. Прогностическое значение мутаций в киназном домене гена BCRABL
Мутационный статус гена BCR-ABL перед проведением аллоТГСК был
определен у 27 больных ХМЛ с резистентностью к ИТК методом прямого
секвенирования. У 11 (42%) пациентов мутаций в киназном домене BCR-ABL
обнаружено не было. У 16 (58%) пациентов были обнаружены различные
мутации. Частота и спектр обнаруженных мутаций представлены на рисунке 27.
У 10 (35%) пациентов была обнаружена мутация T315I. Столь высокая
частота встречаемости мутации T315I в исследованной группе пациентов связана
с тем, что обнаружение данной мутации является показанием к проведению
аллоТГСК.
Взаимосвязи между появлением мутаций в гене BCR-ABL и стадией
заболевания. а также предшествующей терапией ингибиторами тирозинкиназ в
данной группе пациентов выявлено не было (рисунки 28 и 29).
84
Рис. 27. Мутации в киназном домене гена BCR-ABL у больных ХМЛ,
которым была проведена аллоТГСК
Рис. 28. Частота мутаций в киназном домене гена BCR-ABL у больных ХМЛ
в зависимости от стадии заболевания
85
Рис. 29. Частота мутаций в киназном домене гена BCR-ABL у больных ХМЛ
в зависимости от предшествующей терапии
Клинические характеристики пациентов в группах с наличием мутаций
BCR-ABL и их отсутствием обобщены в таблице 9. Была выявлена тенденция к
преобладанию мужчин в группе с наличием мутаций BCR-ABL (14 из 16
пациентов, р = 0,08). Различий по возрасту, типу донора и индексу Gratwohl
между двумя сравниваемыми группами обнаружено не было.
Таблица 9.
Характеристика пациентов в группах с наличием и отсутствием
мутаций в гене BCR-ABL
Характеристика пациента
Мутации BCR-ABL
Нет, n(%)
р
Есть, n(%)
Возраст
0,6924
< 36 лет
3 (11,11)
6 (22,22)
> 36 лет
8 (29,63)
10 (37,04)
Пол
0,0840
Мужской
6 (22,22)
14 (51,85)
86
Женский
5 (18,52)
2 (7,41)
Стадия заболевания
0,4105
ХФ
6 (22,22)
12 (44,44)
ФА и БК
5 (18,52)
4 (14,81)
Предшествующая терапия
1,0000
Иматиниб
3 (11,11)
4 (14,81)
Иматиниб + ИТК
8 (29,63)
12 (44,44)
второго поколения
Индекс Gratwohl
0,4566
< 3
2 (7,41)
2 (7,41)
>=3
9 (33,33)
14 (52,26)
Донор
1,0000
Родственный
6 (23,08)
7 (26,92)
Неродственный
5 (19.23)
8 (30,77)
Анализ выживаемости пациентов с ХМЛ после аллоТГСК показал, что
наличие мутаций в гене BCR-ABL не оказывало влияния на общую и
безрецидивную выживаемости в исследуемой группе пациентов (рис. 30).
Однолетняя общая выживаемость в группе пациентов с мутациями BCR-ABL
составила 42%, в группе без мутаций – 40% (р = 0,51). Однолетняя безрецидивная
выживаемость составила, соответственно, 33 и 29% (р = 0,83).
Частота достижения ПМО после аллоТГСК и частота цитогенетических
рецидивов также не были ассоциированы с наличием или отсутствием мутаций в
гене BCR-ABL (таблица 10).
Таким образом, из представленных данных следует, что наличие мутаций в
киназном
домене
гена
BCR-ABL,
обуславливающих
резистентность
к
ингибиторам тирозинкиназ, в исследованной группе пациентов не оказывало
неблагоприятного влияния на результаты аллоТГСК у больных ХМЛ.
87
Рис. 30. Общая и безрецидивная выживаемости больных ХМЛ после
аллоТГСК в зависимости от наличия или отсутствия мутаций в гене BCR-ABL
88
Таблица 10.
Эффективность аллоТГСК у пациентов с ХМЛ в зависимости от наличия или
отсутствия мутаций в гене BCR-ABL
Показатель
Отсутствие
Мутации
эффективности
мутаций
BCR-ABL
аллоТГСК
BCR-ABL
p
Полный молекулярный
ответ
0,6753
Нет, n (%)
4 (14,81)
4 (14,81)
Есть, n (%)
7 (25,93)
12 (44,44)
Нет, n (%)
6 (22,22)
10 (37,04)
Есть, n (%)
5 (18,52)
6 (22,22)
Цитогенетический
рецидив
0,7104
Смерть по причинам,
связанным с
трансплантацией
0,2311
Нет, n (%)
9 (33,33)
9 (33,33)
Есть, n (%)
2 (7,41)
7 (25,93)
Смерть в связи с
прогрессией ХМЛ
0,2729
Нет, n (%)
8 (29,63)
15 (55,56)
Есть, n (%)
3 (11,11)
1 (3,70)
Прогностическое значение мутации T315I BCR-ABL.
Был проведен анализ влияния на результаты аллоТГСК отдельно мутации
T315I. Данная мутация BCR-ABL представляет наибольший интерес, поскольку
наличие этой мутации ассоциировано с резистентностью к ИТК как первого, так и
второго поколений и является показанием для проведения
аллоТГСК. В
89
исследованной группе пациентов с ХМЛ с резистентностью к ИТК, которым была
проведена аллоТГСК, было 10 больных с мутацией T315I. Контрольную группу
составили 17 пациентов, из них 11 не имели мутаций в гене BCR-ABL, а 6 имели
любые другие мутации, кроме T315I.
Различий по полу, возрасту, стадии заболевания, индексу Gratwohl,
предшествующей терапии ИТК, а также типу донора между группами с наличием
и отсутствием мутации T315I не наблюдалось (таблица 11), хотя отмечалась
тенденция
к
более
частому
использованию
миелоаблативных
режимов
кондиционирования у пациентов с мутацией T315I (р = 0,19).
Таблица 11.
Характеристика пациентов в группах с наличием и отсутствием мутации T315I в
гене BCR-ABL
Характеристика пациента
Мутация Т315I BCR-ABL
Нет, n(%)
р
Есть, n(%)
Возраст
0,6831
< 36 лет
5 (18,52)
4 (14,81)
> 36 лет
12 (44,44)
6 (22,22)
Пол
0,6783
Мужской
12 (44,44)
8 (29,63)
Женский
5 (18,52)
2 (7,41)
Стадия заболевания
0,4058
ХФ
10 (37,04)
8 (29,63)
ФА и БК
7 (25,93)
2 (7,41)
Предшествующая терапия
1,0000
Иматиниб
4 (14,81)
3 (11,11)
ИТК второго поколения
13 (48,15)
7 (25,93)
Индекс Gratwohl
0,5156
< 3
2 (7,41)
2 (7,41)
>=3
15 (55,56)
8 (30,04)
90
Донор
1,0000
Родственный
9 (34,62)
4 (15,38)
Неродственный
8 (30,77)
5 (19,23)
Негативного влияния мутации T315I на общую и безрецидивную
выживаемости пациентов с ХМЛ после аллоТГСК отмечено не было. Более того,
в
группе
пациентов,
имевших
эту
мутацию,
общая
и
безрецидивная
выживаемости были даже чуть выше, чем в группе без мутации, однако
наблюдаемые
различия
не
достигли
уровня
статистической
значимости.
Однолетняя общая выживаемость составила 48% в группе с мутацией T315I и
38% в группе без этой мутации (р = 0,91), однолетняя безрецидивная
выживаемость, соответственно 38% и 27% (р = 0,62). Кривые выживаемости
представлены на рисунке 31.
Была выявлена тенденция к большей частоте достижения полного
молекулярного ответа после аллоТГСК у пациентов с мутацией T315I – 9 из 10
больных достигли ПМО (рис. 32). Обнаруженная тенденция может отражать
большую эффективность реакции трансплантат против лейкоза в отношении
опухолевых клеток, несущих мутацию T315I.
Достоверных различий между группами пациентов с мутацией T315I и без
нее по частоте развития посттрансплантационных рецидивов, смертности от
осложнений, связанных с трансплантацией и в связи с прогрессией ХМЛ
обнаружено не было (таблица 12).
Ни один из 10 пациентов с мутацией T315I после аллоТГСК не умер в
результате прогрессии лейкоза.
91
Рис. 31. Общая и безрецидивная выживаемости больных ХМЛ после
аллоТГСК в зависимости от наличия мутации T315I в гене BCR-ABL
92
Рис. 32. Частота достижения полного молекулярного ответа в зависимости
от наличия или отсутствия мутации T315I в гене BCR-ABL
Таблица 12.
Эффективность аллоТГСК у пациентов с ХМЛ в зависимости от наличия
или отсутствия мутации T315I в гене BCR-ABL
Показатель
T315I (-).
T315I (+)
p
эффективности
аллоТГСК
Полный молекулярный
ответ
0,0985
Нет, n (%)
7 (25,93)
1 (3,70)
Есть, n (%)
10 (37,04)
9 (33,33)
Цитогенетический
рецидив
0,4475
93
Нет, n (%)
9 (33,33)
7 (25,93)
Есть, n (%)
8 (29,63)
3 (11,11)
Смерть по причинам,
связанным с
трансплантацией
0,6831
Нет, n (%)
12 (44,44)
6 (22,22)
Есть, n (%)
5 (18,52)
4 (14,81)
Смерть в связи с
прогрессией ХМЛ
0,2638
Нет, n (%)
13 (48,15)
10 (37,04)
Есть, n (%)
4 (14,81)
0 (0,00)
Таким образом, мы не получили данных, свидетельствующих о негативном
влиянии мутации T315I на результаты аллоТГСК у больных ХМЛ с
резистентностью к терапии ИТК.
3.2.5. Прогностическое значение уровня экспрессии гена EVI1
Уровень относительной экспрессии гена EVI1 был оценен у 27 больных
ХМЛ, резистентных к ингибиторам тирозинкиназ, которым была проведена
аллоТГСК.
Оценка
уровня
экспрессии
гена
EVI1
была
произведена
ретроспективно, с использованием образцов РНК, выделенной из периферической
крови больных в течение 0 – 50 дней до трансплантации.
Медиана уровня экспрессии гена EVI1 у больных ХМЛ с резистентностью к
ингибиторам тирозинкиназ составила 0,38 копий EVI1 на 100 копий ABL
(диапазон от 0,00 до 38,42). Была обнаружена тенденция к увеличению уровня
экспрессии EVI1 в группе больных в поздних стадиях заболевания по сравнению
с группой больных, находящихся в первой хронической фазе.
Однако, эта
тенденция не достигала уровня статистической значимости (медиана, 0,86
[диапазон, 0,00 – 38,42] против 0,15 [0,03 – 5,20], p = 0,068). Были обнаружены
различия в уровне экспрессии EVI1 между группами пациентов, получавшими
94
ИТК 2-го поколения в качестве второй линии терапии и группой пациентов,
получавших только иматиниб (рис. 33).
При этом значимой корреляции уровней экспрессии генов EVI1 и BCR-ABL
p210 обнаружено не было.
Для оценки прогностического значения уровня экспрессии EVI1 при
аллоТГСК пациенты были разделены на две группы – группа с высокой
экспрессией (выше медианы) и группа с низкой экспрессией (ниже медианы).
Клинические характеристики пациентов для каждой из исследуемой групп
представлены в таблице 13.
Рис. 33. Уровень относительной экспрессии гена EVI1 в зависимости от
предшествующей терапии ИТК
Значимых
различий
по
полу,
возрасту,
стадии
заболевания,
предшествующей терапии ИТК, индексу Gratwohl и типу донора между группами
пациентов с высокой и низкой экспрессией гена EVI1 обнаружено не было
(таблица 13).
95
Таблица 13.
Характеристика пациентов в группах с высоким и низким уровнем
экспрессии гена EVI1 до трансплантации.
Характеристика пациента
Уровень экспрессии
р
EVI1
Высокий,
Низкий,
n(%)
n(%)
Возраст
1,0000
< 36 лет
5 (18,52)
5 (18,52)
> 36 лет
9 (33,33)
8 (29,63)
Пол
0,2087
Мужской
12 (44,44)
8 (29,63)
Женский
2 (7,41)
5 (18,52)
Стадия заболевания
0,4197
ХФ
8 (29,63)
10 (37,04)
ФА и БК
6 (22,22)
3 (11,11)
Предшествующая терапия
0,0768
Иматиниб
1 (3,70)
5 (18,52)
Иматиниб + ИТК
13 (48,15)
8 (29,63)
второго поколения
Индекс Gratwohl
1,0000
< 3
2 (7,41)
2 (7,41)
>=3
12 (44,85)
11 (40,74)
Донор
0,6951
Родственный
8 (30,77)
6 (23,08)
Неродственный
5 (19,23)
7 (26,92)
96
При исследовании влияния уровня экспрессии гена EVI1 на результаты
аллоТГСК у пациентов с ХМЛ была обнаружена тенденция, не достигшая уровня
статистической
значимости,
к
большей
частоте
достижения
полного
молекулярного ответа в группе пациентов с низким уровнем экспрессии гена EVI1
по сравнению с группой с высоким уровнем его экспрессии (84% против 57%
соответственно, р = 0,13, рис. 34).
Рис. 34. Частота полного молекулярного ответа после аллоТГСК у
пациентов с ХМЛ в зависимости от уровня экспрессии гена EVI1 до
трансплантации
Группы пациентов с высоким и низким уровнями экспрессии EVI1
достоверно различались по частоте развития пострансплантационных рецидивов.
Цитогенетические рецидивы были зафиксированы у 9 (64%) пациентов с высоким
уровнем экспрессии EVI1 и только у 2 (15%) больных с низким уровнем
экспрессии EVI1 (р = 0,018, рис. 35).
97
Рис. 35. Частота пострансплантационных рецидивов у пациентов с ХМЛ в
зависимости от уровня экспрессии гена EVI1 до трансплантации
Повышенная частота рецидивов, ассоциированная с высоким уровнем
экспрессии
EVI1
в
предтрансплантационном
периоде,
отражается
на
безрецидивной выживаемости больных ХМЛ после аллоТГСК. Проведенный
анализ выживаемости показал. что безрецидивная выживаемость у больных с
высоким уровнем экспрессии EVI1 достоверно короче, чем у больных с низким
уровнем экспрессии EVI1 (р =
0,04, рис. 36). В то же время, статистически
значимых различий в общей выживаемости между двумя сравниваемыми
группами больных обнаружено не было.
98
Рис. 36. Общая и безрецидивная выживаемость больных ХМЛ после
аллоТГСК в зависимости от уровня экспрессии гена EVI1 (выше и ниже медианы)
99
Для оценки независимости прогностического значения уровня экспрессии
гена
EVI1
в
отношении
безрецидивной
выживаемости
был
проведен
однофакторный и многофакторный анализ, в который кроме уровня экспрессии
гена EVI1 были включены известные по литературным данным факторы,
влияющие на исход аллоТГСК у больных ХМЛ: значение индекса Gratwohl (1 и 2
против 3 и более), стадия заболевания (первая хроническая фаза против более
поздних), возраст (менее 35 лет и более 35 лет), интервал времени от
установления диагноза до проведения трансплантации (менее 36 месяцев и более
36 месяцев) и тип донора (родственный против неродственного). Результаты
однофакторного анализа показали, что в данной группе пациентов предикторами,
статистически
достоверно
влияющими
на
безрецидивную
выживаемость
больных, были высокое значение индекса Gratwohl (p=0,029), а также стадия
акселерации или бластного криза на момент трансплантации (p = 0,037).
Особенностью изучаемой группы пациентов было значительное преобладание
больных с высокими значениями индекса Gratwohl, только четверо пациентов
имели значения индекса менее 3, что не позволило включить этот показатель в
многофакторный анализ. Поэтому только уровень экспрессии гена EVI1 и стадия
заболевания были включены в многофакторный анализ на основе модели
пропорциональных
рисков
Кокса.
Результаты
проведенного
анализа,
представленные в таблице 14, свидетельствуют о том, что эти факторы имеют
независимое прогностическое значение.
Таблица 14.
Результаты многофакторного анализа безрецидивной выживаемости
Фактор
Hazard Ratio
95% ДИ
p
Хроническая фаза заболевания
0,37
0,15 – 0,94
0,037
Высокий уровень экспрессии EVI1
3,93
1,17 – 13,2
0,026
В то же время, между группами пациентов с высоким и низким уровнем
экспрессии EVI1 не было обнаружено значимых различий по продолжительности
100
общей
выживаемости,
а
также
по
частоте
смертности
по
причине
посттрансплантационных осложнений и прогрессии основного заболевания
(таблица 15).
Таблица 15.
Эффективность аллоТГСК у пациентов с ХМЛ в зависимости от уровня
экспрессии гена EVI1 до трансплантации
Показатель
Высокая
Низкая
эффективности
экспрессия
экспрессия
аллоТГСК
EVI1
EVI1
p
Полный молекулярный
ответ
0,1269
Нет, n (%)
6 (22,22)
2 (7,41)
Есть, n (%)
8 (29,63)
11 (40,74)
Цитогенетический
рецидив
0,0183
Нет, n (%)
5 (18,59)
11 (40,74)
Есть, n (%)
9 (33,33)
2 (7,41)
Смерть по причинам,
связанным с
трансплантацией
0,4197
Нет, n (%)
8 (29,63)
10 (37,04)
Есть, n (%)
6 (22,22)
3 (11,11)
Смерть в связи с
прогрессией ХМЛ
0,5955
Нет, n (%)
11 (40,74)
12 (44,44)
Есть, n (%)
3 (11.11)
1 (3,70)
101
Таким образом, можно сделать вывод о том, что высокий уровень
экспрессии гена EVI1 в предтрансплантационном периоде негативно влияет на
результаты
аллоТГСК
у
больных
ХМЛ,
увеличивая
частоту
посттрансплантационных рецидивов и сокращая безрецидивную выживаемость.
Уровень
экспрессии
EVI1
имеет
независимое
от
стадии
заболевания
прогностическое значение. В свою очередь, повышение экспрессии этого гена
связано с предшествующей терапией ИТК второго поколения.
102
ГЛАВА 4. ОБСУЖДЕНИЕ
Целью настоящего исследования было изучение молекулярно-генетических
характеристик больных хроническим миелолейкозом с резистентностью к
ингибиторам тирозинкиназ и их прогностического значения при аллогенной
трансплантации гемопоэтических стволовых клеток.
В центре нашего внимания находились два гена, вовлеченных в патогенез
ХМЛ – BCR-ABL и EVI1. Роль BCR-ABL в патогенезе ХМЛ и развитии
резистентности к ингибиторам тирозинкиназ изучена достаточно подробно. О
роли гена EVI1 известно гораздо меньше.
Известно, что активность белка BCR-ABL необходима и достаточна для
поддержания лейкозного фенотипа клеток (Daley et al., 1990; Kelliher et al., 1990;
Heisterkamp et al., 1990) и вызывает нарушения в трех основных сигнальных
путях:
RAS/MAPK
(усиление
пролиферации),
JAK/STAT
(увеличению
транскрипционной активности) и PI3K/AKT/mTOR (подавление апоптоза) (Melo
et al., 2004).
Типичное течение ХМЛ представляет собой не одноэтапный процесс. В
начале
заболевания
лейкозные
клетки
сохраняют
способность
к
дифференцировке, а также морфологическую и функциональную полноценность,
в то время как на этапе прогрессии заболевания зрелые клетки почти полностью
заменяются незрелыми бластными элементами. При этом распространено мнение,
что для прогрессии заболевания тирозинкиназной активности химерного гена
BCR-ABL недостаточно, и необходимы дополнительные генетические нарушения.
Одним из таких нарушений является гиперэкспрессия гена EVI1, которая
у
пациентов с бластным кризом ХМЛ встречается достаточно часто (Ogawa et al.,
1996).
В
этой
связи
в
экспериментальной
модели
с
использованием
ретровирусной трансформации и трансплантации костного мозга у мышей было
показано, что коэкспрессия одновременно BCR-ABL и AML1–EVI1 вызывает
быстрое развитие заболевания, сходного с фазой бластного криза ХМЛ (Cuenco et
al., 2001). Далее, у больных ХМЛ оба изучаемых гена могут быть вовлечены и в
103
развитие резистентности к ингибиторам тирозинкиназ. Наиболее хорошо
изученный механизм развития резистентности - возникновение точечных мутаций
в киназном домене гена BCR-ABL, препятствующих связыванию ингибитора с его
мишенью. В то же время, существуют и BCR-ABL независимые механизмы
развития резистентности, в основе которых лежат альтернативные генетические
нарушения, приводящие к активации вовлеченных в лейкемогенез сигнальных
путей. Одним из таких механизмов, вероятно, и является гиперэкспрессия гена
EVI1, которая, как известно, приводит к активации сигнального пути
PI3K/AKT/mTOR (Yoshimi et al., 2011). Отсюда следует, что ключевой для
лейкемогенеза сигнальный путь PI3K/AKT/mTOR может быть активирован как в
результате образования химерного гена BCR-ABL, так и гиперэкспрессии гена
EVI1 в случае подавления активности BCR-ABL ингибиторами тирозинкиназ.
В исследование были включены три характеристики, описывающие
состояние гена BCR-ABL у больных ХМЛ: 1) уровень относительной экспрессии
основного транскрипта, вовлеченного в патогенез ХМЛ (р210), 2) коэкспрессия
транскрипта р190, возникающего при ХМЛ за счет альтернативного сплайсинга и
3) наличие мутаций в киназном домене гена, ассоциированных с резистентностью
к ингибиторам тирозинкиназ. Что касается гена EVI1, то был изучен только
уровень экспрессии гена, поскольку данные о вовлеченности мутаций в этом гене
в канцерогенез или развитие резистентности к терапии в литературе отсутствуют.
Проведенное
исследование
молекулярно-генетических
характеристик
пациентов с ХМЛ с резистентностью к терапии ингибиторами тирозинкиназ
показало высокую степень гетерогенности этого вида лейкоза по изучаемым
характеристикам, обусловленную вовлечением различных механизмов развития
резистентности. По нашим данным уровень экспрессии BCR-ABL у пациентов с
резистентностью к ИТК колебался в очень широком диапазоне и у половины
пациентов
имела
место
коэкспрессия
минорного
транскрипта
р190.
В
исследуемой группе пациентов уровень экспрессии транскрипта р190 был в
среднем в 100 раз ниже, чем уровень экспрессии транскрипта р210 BCR-ABL, что
указывало не на ведущую роль транскрипта р190 в патогенезе заболевания и
104
развитии резистентности, а, скорее, на нарушения контрольных механизмов
альтернативного
сплайсинга.
При
этом
были
отмечены:
а)
ассоциация
коэкспрессии р190 и повышенного уровня экспрессии транскрипта p210 BCR-ABL
(р=0,01); и б) тенденция к более высокой частоте встречаемости коэкспрессии
р190 BCR-ABL в группе пациентов в фазе акселерации и бластного криза по
сравнению с таковыми в хронической фазе ХМЛ (р=0,19).
Полученные нами данные хорошо согласуются с результатами проведенных
ранее исследований. Так, в работе Lichty была проанализирована экспрессия
транскриптов p210 и р190 у 67 больных ХМЛ, при чем коэкспрессия р190 была
обнаружена у 35 из них (Lichty et al., 1998). Кроме того, ими была отмечена
взаимосвязь между коэкспрессией р190 и повышенным количеством бластов у
больных ХМЛ на момент установления диагноза. Van Rhee и соавторы
обнаружили, что коэкспрессия р190 была ассоциирована с более высоким
уровнем экспрессии р210 (van Rhee. et al., 1996), а основной причиной
коэкспрессии
р190
считали
альтернативный
сплайсинг.
Данных
о
прогностическом значении коэкспрессии р190 в литературе мы не встретили.
Вместе с тем, альтернативный сплайсинг является отражением общей геномной
нестабильности, характерной для прогрессии ХМЛ. В связи с этим, отмеченная
ранее ассоциация коэкспрессии р190 с большим числом бластов и более высоким
уровнем экспрессии BCR-ABL может быть следствием более агрессивного течения
заболевания.
По нашим данным, развитие резистентности к ингибиторам тирозинкиназ
было обусловлено возникновением мутаций в киназном домене гена BCR-ABL
лишь у 38% больных. Всего было обнаружено 13 различных мутаций, частота
встречаемости которых значительно варьировала. С наибольшей частотой
обнаруживались мутации T315I, G250E, Y253H, F317L, E255K и F359C, причём
48% мутаций были локализованы в Р-петле киназного домена белка BCR-ABL.
Кроме того, почти все мутации затрагивали участки молекулы белка BCR-ABL,
непосредственно взаимодействующие с ИТК. У 5 (13%) пациентов были
обнаружены двойные мутации, причём у 3 из них обе мутации присутствовали в
105
100% клеток, а у 2 больных две различные мутации, по-видимому, были связаны с
наличием двух различных клонов лейкозных клеток. Наконец, у одного из
больных были обнаружены сложные структурные нарушения в гене BCR-ABL,
которые. ранее не описывались.. По данным исследований частоты и спектра
мутаций в киназном домене гена BCR-ABL у больных с резистентностью к ИТК в
европейских популяциях, частота мутаций BCR-ABL, в зависимости от фазы
заболевания и использованных методов детекции мутаций варьирует от 30% до
90%, причём в 60-70% случаев мутации затрагивают всего шесть ключевых
аминокислотных оснований (G250, Y253, E255, T315, M351 и F359) (Hochhaus et
al., 2001; Barthe et al., 2001; Shah et al., 2002). В исследованной нами группе
больных мутации в этих основаниях, за исключением M351, также встречались с
наибольшей частотой. Отсутствие же мутации M315T в нашей группе больных
связано, вероятно, с небольшими размерами группы пациентов с мутациями
(всего 36 больных). Данные, полученные в результате нашего и других,
проведенных в России исследований (Куцев С.И. и соавт., 2008; Овсянникова Е.Г.
и соавт., 2012), свидетельствуют о том, что спектр мутаций BCR-ABL в
российской популяции больных ХМЛ не отличаются от такового
в других
европейских популяциях.
В ходе исследования мы обнаружили, что группа пациентов, не имевших
мутаций в гене BCR-ABL, имела достоверно более высокий уровень экспрессии
гена EVI1 (p=0,04). По литературным данным, высокий уровень экспрессии гена
EVI1 является маркером опухолевой прогрессии при солидных опухолях,
маркером резистентности к химиотерапии при остром миелоидном лейкозе и
маркером прогрессии ХМЛ. Гиперэкспрессия онкогена EVI1 с высокой частотой
встречается у пациентов с БК ХМЛ (Ogawa et al., 1996; 1997). Здесь следует
заметить, что гиперэкспрессия EVI1 была обнаружена также у части пациентов с
хронической фазой ХМЛ. Однако частота встречаемости гиперэкспрессии EVI1
была значительно ниже. Транслокации с вовлечением этого гена также часто
встречаются у пациентов с миелоидным вариантом БК ХМЛ, причем появление
транслокаций с участием EVI1 чётко ассоциируется с развитием резистентности к
106
ингибиторам тирозинкиназ. Так, по данным одного из исследований, такие
транслокации были обнаружены у 39% пациентов с резистентным к ИТК
бластным кризом (Paquette et al., 2011). С другой стороны, у резистентных к
иматинибу пациентов в хронической фазе ХМЛ гиперэкспрессия EVI1 является
независимым неблагоприятным прогностическим фактором в отношении общей и
безрецидивной
выживаемости
при
последующей
терапии
ингибиторами
тирозинкиназ второго поколения (Daghistani et al., 2010).
В проведенном нами исследовании была обнаружена взаимосвязь между
гиперэкспрессией гена EVI1 и предшествующей терапией ингибиторами
тирозинкиназ второго поколения, дазатинибом и нилотинибом. Выявленная
закономерность может быть объяснена тем, что лейкозы, резистентные и к
первой, и ко второй линии терапии ИТК, изначально представляли собой более
агрессивную форму заболевания, хотя не исключается, что повышение
экспрессии гена EVI1 может быть следствием самой терапии ИТК второго
поколения.
Результаты исследования продемонстрировали взаимосвязь между высоким
уровнем экспрессии EVI1 и наличием коэкспрессии транскрипта p190 BCR-ABL
(р=0,04). Эта закономерность свидетельствует о том, что нарушения в контроле
альтернативного сплайсинга являются отличительной чертой лейкозных клеток с
гиперэкспрессией EVI1. Отсюда допустимо предположение, что нарушения в
контроле альтернативного сплайсинга, возможно, являются одним из механизмов,
благодаря которым гиперэкспрессия EVI1 приводит к опухолевой прогрессии.
Однако, для
подтверждения верности этой гипотезы требуются дальнейшие
исследования.
В проведенном исследовании впервые показано, что гиперэкспрессия гена
EVI1 характерна для резистентных к ИТК пациентов, не имеющих мутаций в
киназном домене гена BCR-ABL (р=0,04). Это наблюдение говорит о возможной
роли
гиперэкспрессии
гена
EVI1
в
развитии
BCR-ABL-независимой
резистентности к ингибиторам тирозинкиназ. Поскольку одним из механизмов
такой резистентности может быть восстановление активации сигнального пути
107
PI3K/AKT/mTOR, правомочно допущение, что применение ингибиторов mTOR у
таких пациентов может быть полезно в плане преодоления резистентности. С
другой
стороны,
известно,
что
гиперэкс-прессия
EVI1
сопровождается
гиперметилированием геномной ДНК у больных ОМЛ (Lugthart. et al., 2011), что
даёт право предполагать возможность применения в терапии лейкозов с
гиперэкспрессией EVI1 гипометилирующих агентов. Поскольку используемые в
настоящее время для лечения EVI1+ лейкозов химиотерапия и аллоТГСК
недостаточно эффективны, вытекающие из теоретических предположений новые
подходы к терапии этой трудной группы больных представляются актуальными
и нуждаются в дальнейшей экспериментальной проверке.
В следующей части исследования было изучено прогностическое значение
молекулярно-биологических факторов в отношении результатов аллогенной
трансплантации
гемопоэтических
стволовых
клеток
у
больных
ХМЛ
с
резистентностью к ингибиторам тирозинкиназ.
В качестве критериев оценки эффективности терапии использовали: 1)
общую выживаемость больных; 2) безрецидивную выживаемость; 3) частоту
достижения
полного
молекулярного
ответа;
4)
частоту
развития
пост-
трансплантационных рецидивов; 5) частоту развития острой и хронической
РТПХ; 6) смертность по причинам, связанным с пост-трансплантационными
осложнениями; и 7) смертность по причине прогрессии основного заболевания.
В
ходе
выполнения
свидетельствующих
о
том,
работы
что
мы
уровень
не
получили
экспрессии
гена
результатов,
BCR-ABL
в
предтрансплантационном периоде у больных ХМЛ с резистентностью к
ингибиторам
тирозинкиназ
оказывает
какое-либо
влияние
на
основные
показатели эффективности аллоТГСК. В то же время была обнаружена тенденция
к ассоциации коэкспрессии транскрипта р190 гена BCR-ABL до аллоТГСК с более
короткой безрецидивной выживаемостью и низкой частотой достижения полного
молекулярного ответа после аллоТГСК.
Однако при интерпретации этих
результатов следует учитывать выявленную в исследованной группе больных
108
тенденцию к ассоциации коэкспрессии р190 с более поздней стадией заболевания
и более высоким индексом Gratwohl.
Наличие мутаций в киназном домене гена BCR-ABL, обуславливающих
резистентность к ингибиторам тирозинкиназ в исследованной группе пациентов,
не оказывало неблагоприятного влияния на результаты аллоТГСК. В группе из 10
пациентов с мутацией T315I общая и безрецидивная выживаемости были даже
несколько выше, чем в группе без мутации, хотя наблюдаемые различия не
достигли уровня статистической значимости. Далее, нами была выявлена
тенденция к большей частоте достижения полного молекулярного ответа после
аллоТГСК у пациентов с мутацией T315I, где 9 из 10 больных достигли ПМО.
По-видимому, обнаруженная тенденция может отражать большую эффективность
реакции трансплантат против лейкоза в отношении опухолевых клеток, несущих
мутацию T315I.
Литературные данные, посвященные вопросу влияния мутаций в гене BCRABL, и в частности мутации T315I, на исход аллоТГСК, немногочисленны и
достаточно противоречивы. Так, некоторые исследователи отмечали негативное
влияние мутаций в отношении общей и бессобытийной выживаемости больных
ХМЛ после аллоТГСК (Jabbour et al., 2011). По данным этого исследования, 2летние общая и безрецидивная выживаемости в группе пациентов с мутациями
были ниже, чем в группе пациентов без мутаций (44 и 36% против 76 и 58%).
Однако, поскольку группы пациентов с мутациями и без мутаций статистически
значимо различались по числу пациентов в фазе акселерации и бластного криза,
интерпретация этих результатов была затруднена. Вместе с тем другие
исследования, проведенные на большей выборке пациентов, этих выводов не
подтвердили. Результаты анализа данных регистра EBMT о 64 трансплантациях у
пациентов с ХМЛ и Ph+ ОЛЛ, имевших мутацию T315I, показали, что общая
двухлетняя выживаемость составляла 59, 67, 30 и 25% для пациентов в
хронической фазе, фазе акселерации, бластном кризе и при Ph+ ОЛЛ,
соответственно (Nicolini et al., 2011).
Полученные в нашем исследовании
109
результаты также не дают оснований сделать вывод о негативном влиянии
мутации T315I и других мутаций BCR-ABL на исход трансплантации.
Напротив, было показано, что уровень экспрессии гена EVI1 имеет
независимое от стадии заболевания негативное прогностическое значение как в
отношении частоты развития пост-трансплантационных рецидивов (p=0,02), так и
сокращения безрецидивной выживаемости (р=0,04). В то же время влияния
гиперэкспресии EVI1 на общую выживаемость больных отмечено не было.
Очевидно, что EVI1+ ХМЛ представляют собой обособленную по биологическим
свойствам подгруппу пациентов, нуждающихся в более эффективной терапии на
пост-трансплантационном этапе. В первую очередь, это относится к характеру
противорецидивной терапии, на роль которой, в свете полученных нами данных,
напрашиваются гипометилирующие соединения и ингибиторы mTOR .
Нельзя не отметить, что по данным проведенного исследования наиболее
важным прогностическим фактором в отношении общей и безрецидивной
выживаемости больных ХМЛ с резистентностью к терапии ИТК после аллоТГСК
является
стадия
заболевания,
а
влияние
молекулярно-биологических
характеристик пациентов на результаты аллоТГСК
выражено значительно
меньше. Из четырех исследованных характеристик, только одна, уровень
экспрессии гена EVI1, достоверно влияла на безрецидивную выживаемость. На
общую же выживаемость ни одна из изученных характеристик достоверного
влияния не оказывала.
Полученные
результаты
подтверждают
выводы
проведенных
ранее
исследований, как за рубежом, так и в России. Так, решающая роль фазы
заболевания в исходе аллоТГСК у больных ХМЛ установлена в исследованиях
Любимовой Л.С. с соавт и Кутьиной Р.М. с соавт. По данным этих исследований,
при медиане наблюдения 59 месяцев после аллоТГСК в молекулярной ремиссии
оставались 67% пациентов, у которых трансплантация была проведена в
хронической фазе и только 14% пациентов, перенесших трансплантацию в фазе
акселерации и бластного криза (Кутьина Р.М. и соавт., 2004). Общая
выживаемость больных в первой хронической фазе составила 71%, а в фазе
110
прогрессирования или бластного криза только 13% (Любимова Л.С. и соавт.,
2007).
В то же время в многочисленных зарубежных исследованиях было
обнаружено или подтверждено негативное влияние на исходы аллоТГСК: а)
поздней стадии заболевания; б) принадлежности пациента к старшей возрастной
группе; в) проведения трансплантации от неродственного донора; и г)
длительного периода от установления диагноза до трансплантации. Естественно,
что, все эти факторы при оценке рисков аллоТГСК.сейчас находятся в поле
зрения согласно шкале Gratwohl (Gratwohl et al., 1998; 2006).
Таким образом, мы установили, что высокий уровень экспрессии гена EVI1
имеет неблагоприятное прогностическое значение в отношении частоты развития
рецидивов и продолжительности безрецидивной выживаемости после аллоТГСК
у больных ХМЛ с резистентностью к ингибиторам тирозинкиназ. Высокий
уровень экспрессии гена EVI1 и поздняя стадия заболевания (фаза акселерации
или бластный криз) на момент трансплантации являются независимыми
предикторами менее продолжительной безрецидивной выживаемости. В то же
время, мутации в киназном домене гена BCR-ABL, в том числе панрезистентная
мутация T315I, а также высокий уровень экспрессии BCR-ABL, в исследованной
группе пациентов не имели негативного прогностического значения в отношении
общей и безрецидивной выживаемости после аллоТГСК у больных ХМЛ,
резистентных к ингибиторам тирозинкиназ.
Создаётся впечатление, что
представленные здесь результаты открывают неплохие перспективы для
дальнейших
исследований
по
влиянию
разнообразных
молекулярно-
биологических факторов на эффективность аллоТГСК у больных ХМЛ, а также
на
разработку
новых
подходов
профилактики
рецидивов EVI1+ позитивных лейкемий.
пост-трансплантационных
111
ВЫВОДЫ
1. Уровень экспрессии гена BCR-ABL у больных ХМЛ, резистентных к
терапии ингибиторами тирозинкиназ, варьирует в широком диапазоне.
Коэкспрессия транскрипта p190 гена BCR-ABL была обнаружена
у
половины больных ХМЛ с резистентностью к ИТК. Коэкспрессия
транскрипта р190 статистически достоверно ассоциирована с высоким
уровнем экспрессии основного транскрипта р210 BCR-ABL.
2. Мутации в киназном домене гена BCR-ABL были обнаружены у 38%
пациентов с резистентностью к ИТК. В исследованной группе пациентов
было
обнаружено
13
различных
мутаций,
затрагивающих
9
аминокислотных остатков в белке BCR-ABL. C наиболее высокой частотой
встречалисть мутации T315I (26%), G250E (18%), Y253H (13%), F317L
(11%), E255K (8%), F359C (5%). В единичных случаях были отмечены
более сложные структурные нарушения гена, такие как делеции нескольких
аминокислотных оснований.
3. Аллель-специфичная ПЦР позволяет выявлять клетки с мутацией T315I на
3-6 месяцев раньше, чем стандартный метод прямого секвенирования.
4. Уровень экспрессии гена EVI1 статистически достоверно повышен у
пациентов с резистентностью к ИТК по сравнению с пациентами с
оптимальным ответом на терапию.
5. Повышенный уровень экспрессии гена EVI1 у больных с резистентностью к
ИТК достоверно ассоциирован с отсутствием мутаций в киназном домене
гена BCR-ABL и наличием коэкспрессии химерного транскрипта р190 гена
BCR-ABL.
6. Прогностического значения мутаций в киназном домене гена BCR-ABL, в
том числе T315I, уровня его экспрессии, а также наличия коэкспрессии
транскрипта р190 в отношении общей и безрецидивной выживаемости, а
также частоты рецидивов и частоты достижения полного молекулярного
ответа у пациентов с ХМЛ после аллоТГСК выявлено не было.
112
7. Высокий уровень экспрессии гена EVI1 в предтрансплантационном периоде
обладает статистически достоверным неблагоприятным влиянием на
результаты
аллоТГСК
посттрансплантационных
у
больных
рецидивов
ХМЛ,
и
увеличивая
сокращая
частоту
безрецидивную
выживаемость. При этом уровень экспрессии EVI1 имеет независимое от
стадии заболевания прогностическое значение.
113
ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ
1. Перед проведением аллоТГСК у больных ХМЛ рекомендуется проводить
оценку уровня экспрессии гена EVI1 в периферической крови.
2. Больным
с
своевременное
повышенным
проведение
уровнем
экспрессии
противорецидивной
EVI1
терапии
необходимо
в
пост-
трансплантационном периоде.
3. Целесообразно включение исследования наличия мутации T315I методом
ПЦР в реальном времени в молекулярно-генетический мониторинг терапии
ХМЛ с целью более раннего выявления пациентов, нуждающихся в
проведении аллоТГСК.
114
СПИСОК СОКРАЩЕНИЙ
аллоТГСК – аллогенная трансплантация гемопоэтических стволовых клеток
БК - бластный криз
БМО - большой молекулярный ответ
БЦО - большой цитогенетический ответ
ДНК - дезоксирибонуклеиновая кислота
ИТК - ингибиторы тирозинкиназ
кДа - килодальтон
кДНК - комплементарная дезоксирибонуклеиновая кислота
мРНК - матричная рибонуклеиновая кислота
МОБ - минимальная остаточная болезнь
OJIJI - острый лимфобластный лейкоз
ПМО - полный молекулярный ответ
ПЦО - полный цитогенетический ответ
ПЦР — полимеразная цепная реакция
РНК - рибонуклеиновая кислота
РТПХ – реакция трансплантат-против-хозяина
ФА - фаза акселерации
ХМЛ - хронический миелолейкоз
ХФ - хроническая фаза
ЦО - цитогенетический ответ
ELN - European Leukemia Net
Ph – филадельфийская хромосома
115
СПИСОК ЛИТЕРАТУРЫ
1.
Абдулкадыров K.M., Беляков H.A., Селиванов В.А. и др. Реальность
и проблемы использования стволовых клеток в клинической практике // Вестн.
РАМН. 2004. – N. 9. - С.76-79.
2.
Аксенова Е.В., Крутов А.А., Солдатова И.Н. и др. Молекулярный
мониторинг у пациентов с хроническим миелолейкозом: корреляция с
цитогенетическим ответом, прогностическое значение, оценка ответа на терапию
// Клиническая онкогематология. 2010. - Т. 3, № 2. - С. 151-159.
3.
Афанасьев Б.В., Зубаровская Л.С. Трансплантация гемопоэтических
стволовых клеток крови // Детская онкология: Руководство. СПб, 2002. - С. 90108.
4.
Афанасьев Б.В., Зубаровская Л.С., Семенова Е.В. и др. Опыт
применения
неродственной
аллогенной
трансплантации
стволовых
гемопоэтических клеток в клинике трансплантации костного мозга СПбГМУ им.
акад. И. П. Павлова // Тер. архив. 2007. - Т. 79, № 7. - С. 36-43.
5.
Богданов К.В., Фролова О.И., Маринец О.В. и др. Клиническое
значение вариантов хромосомной транслокации t(9;22) у больных хроническими
миелолейкозами // Гематол. и трансфузиол. 2003. - Т. 2, №3. - С.З-9.
6.
Виноградова
О.
Ю.
Клиническая
эволюция
хронического
миелолейкоза в процессе лечения ингибиторами тирозинкиназ // Автореферат
диссертации доктора мед. наук. М., 2011.
7.
Виноградова О.Ю., Асеева Е.А., Воронцова А.В. и др. Влияние
различных хромосомных аномалий в ph-позитивных клетках костного мозга на
течение хронического миелолейкоза при терапии ингибиторами тирозинкиназ //
Онкогематология. 2012. - Т.2 - № 4.- С. 24-35.
8.
Виноградова О.Ю., Туркина А.Г., Воронцова А.В. и др. Применение
дазатиниба у больных в хронической стадии хронического миелолейкоза,
резистентных либо не переносящих терапию иматинибом // Тер. архив. 2009. - Т.
81. № 7. - С. 41-46.
116
9.
Владимирская Е.Б., Кисляк Н.С., Румянцев А.Г. Причины и пути
преодоления лекарственной резистентности при лейкозах и лимфомах у детей //
Гематол. и трансфузиол. 1998. - №6. - С.15-17.
10.
Волкова М.А. Гливек при хроническом миелолейкозе - достижения,
неудачи, проблемы // Гематол. и трансфузиол. 2004. - Т. 49. № 2. - С. 35-41.
11.
Волкова
М.А.
Гливек
революция
в
терапии
хронического
миелолейкоза // Фарматека. - 2003. - Т.77, №14. - С. 39-47.
12.
Волкова
М.А.
Новые
возможности
в
терапии
хронического
миелолейкоза: дазатиниб // Клиническая онкогематология. 2008. – Т. 1 №3.-С.
218-226.
13.
Волкова М.А. Хронический миелолейкоз: вчера, сегодня, завтра. К
165-летию первого описания // Клиническая онкогематология. 2010. - Т. 3. № 4. С. 317-326.
14.
Воробьев
А.И.
Лейкозы:
проблемы
и
достижения
//
Клин.
фармакология и терапия. 1995. - Т. 4 № 4. - С. 16-17.
15.
Глянц С. Медико-биологическая статистика //Пер. с англ. д.ф-м.н.
Данилова Ю.А. - М.: «Практика». 1999. - стр.424.
16.
Горюнова Е.Н., Ломаиа Е.Г., Алексеева Ю.А. и др. Течение
хронического миелолейкоза у пациента с панрезистентной мутацией Т315І в фазе
акселерации. Всегда ли необходима аллогенная трансплантация костного мозга
при мутации Т315І? // Клиническая онкогематология. 2009. - Т. 2. № 1. - С. 11-13.
17.
Давыдов М.И., Аксель Е.М. Заболеваемость злокачественными
новообразованиями населения России и стран СНГ в 2007 г. // Вестник РОНЦ им.
H.H. Блохина РАМН. 2009. - Т. 20 № 3. - С.52-90.
18.
Домрачева
Е.В.,
Захарова
А.В.,
Асеева
Е.А.
Цитогенетика
хронического миелолейкоза // Гематол. и трансфузиол. 2005. - Т. 50. № 2. - С. 4449.
19.
значение
Домрачева Е.В., Захарова А.Е., Асеева Е.А. Прогностическое
дополнительных
цитогенетических
аномалий
при
миелолейкозе // Гематол. и трансфузиол. 2005. - Т. 50 №4. - С. 37-41.
хроническом
117
20.
Зарицкий А.Ю., Ломаиа Е.Г. Перспективы фармакотерапии ХМЛ //
Эффективная фармакотерапия. 2006. - № 1. - С. 38-42.
21.
Зарицкий А.Ю., Ломаиа Е.Г., Виноградова О.Ю. и др. Результаты
многоцентрового
исследования
терапии
гливеком
больных
хроническим
миелолейкозом в хронической фазе // Гематол. и трансфузиол. 2007. - Т.52, № 2. С. 13-17.
22.
Зарицкий А.Ю., Ломаиа Е.Г., Виноградова О.Ю. и др. Факторы
прогноза при терапии иматиниба мезилатом у больных в хронической фазе Phпозитивного
хронического
миелолейкоза:
данные
многоцентрового
нерандомизированного исследования в россии // Тер. архив. 2007. - Т. 79. № 8. С. 17-22.
23.
Зубаровская Л.С., Фрегатова Л.М., Афанасьев Б.В. Трансплантация
гемопоэтических
стволовых
клеток
при
гемобластозах
//
Клиническая
онкогематология под ред. проф. М.А.Волковой. – М: 2001
24.
Копнин Б.П. Опухолевые супрессоры и мутаторные гены //
Канцерогенез. М: 2004. – С.125-156.
25.
Круглов С.С., Туркина А.Г., Хорошко Н.Д. и др. Резистентность при
терапии Гливеком у больных хроническим миелолейкозом в фазе акселерации //
Гематол. и трансфузиол. 2007. - №2. - С. 17-24
26.
Кутьина Р.М., Порешина Л.П., Любимова Л.С. и др. Трансплантация
аллогенного костного мозга при хроническом миелолейкозе // Тер. архив, 2004.-N
7.-С.18-24
27.
Куцев С.И., Вельченко М.В. Значение анализа мутаций гена BCR-ABL
в оптимизации таргетной терапии хронического миелолейкоза // Клиническая
онкогематология. 2008. - Т. 1, №3. - С. 190-199.
28.
Куцев
С.И.,
Вельченко
М.В.,
Зельцер
А.Н.
Молекулярно-
генетический мониторинг терапии хронического миелолейкоза ингибиторами
тирозинкиназ // Онкогематология. 2008. - № 3. - С. 86-86.
118
29.
Куцев С.И., Вельченко М.В., Морданов C.B. Роль мутаций гена BCR-
ABL в развитии рефрактерности к иматинибу у пациентов с хроническим
миелолейкозом // Клиническая онкогематология. 2008. - Т.1, №4. - С. 303-309.
30.
Куцев С.И., Морданов С.В. Амплификация гена BCR-ABL у
пациентов с хроническим миелоидным лейкозом, рефрактерных к иматинибу //
Онкогематология. 2009. - № 3. - С. 57-65
31.
Куцев С.И., Морданов С.В., Зельцер А.Н. Прогностическое значение
дополнительных хромосомных аномалий в Ph-позитивных клетках в терапии
иматинибом хронического миелолейкоза // Медицинская генетика. 2009. - Т. 8. №
10. - С. 23-28.
32.
Ломаиа Е.Г., Коноплева М.Ю., Романова Е.Г. и др. Хронический
миелолейкоз - до и после иматиниба (часть III) // Онкогематология. - 2010. № 1. С. 5-20.
33.
Ломаиа Е.Г., Лазорко Н.С., Саламатова Е.Н. и др. Хронический
миелолейкоз - до и после применения иматиниба (часть II) // Онкогематология.
2009. - № 3. - С. 40-56.
34.
Ломаиа Е.Г., Мартынкевич И.С. и др. Влияние b2a2 и b3a2
транскриптов гена bcr-abl на эффективность направленной терапии гливеком у
больных в хронической фазе хронического миелолейкоза // Вестник гематологии.
2006. - Т.2, №3. – C. 7-10.
35.
Ломаиа Е.Г., Моторин Д.В., Романова Е.Г.
и др.
Хронический
миелолейкоз - до и после применения иматиниба (часть I) // Онкогематология.
2009.- № 2.- С. 4-16.
36.
Ломаиа Э.Г., Зарицкий А.Ю. Нилотиниб новый этап успеха в терапии
хронического миелолейкоза // Онкогематология. - 2007. - № 4. - С. 6772.
37.
Ломана Е.Г., Огородникова Ю.С., Мартынкевич И.С. и др.
Прогностические
факторы
эффективности
терапии
Гливеком
больных
хроническим миелолейкозом // Вестник гематологии. 2005. - Т. 1., №1. - С. 14-21.
119
38.
Любимова Л.С. Трансплантация аллогенного костного мозга при
хроническом миелолейкозе // Вестник Московского онкологического общества.
2007.- № 2.- С. 6.
39.
Любимова Л.С., Кузьмина Л.А., Урнова Е.С. и др. HLA-идентичная
трансплантация костного мозга в первой хронической фазе хронического
миелолейкоза в ранние сроки заболевания или длительная терапия ингибиторами
тирозинкиназ? // Гематол. и трансфузиол. 2012. - N 3. - С.6-10.
40.
Любимова Л.С., Савченко В.Г., Демидова И.А. и др. Трансплантация
аллогенного костного мозга у больных хроническим миелолейкозом // Гематол. и
трансфузиол. 2007. - Т. 52. - № 6. - С. 27-31.
41.
Любимова
Л.С.,
Савченко
В.Г.,
Менделеева
Л.П.
и
др.
Трансплантация аллогенного костного мозга при хроническом миелолейкозе //
Тер. архив. 2004. - Т. 76. - № 7.- С. 18-24.
42.
Мамаев Н.Н., Горбунова А.В., Гиндина Т.Л. и др. Лейкозы и
миелодиспластические синдромы с экспрессией гена EVI1: теоретические и
клинические аспекты // Клиническая онкогематология. 2012. – Т. 5(4). - С.361364.
43.
Мамаев Н.Н., Морозова Е.В., Горбунова А.В. Теоретические и
клинические аспекты эпигенетических изменений при миелодиспластических
синдромах и острых нелимфобластных лейкозах. // Вестник гематол. 2011. - Т.7,
№3. – С. 12 - 21
44.
Мартынкевич
Дополнительные
И.С.,
хромосомные
Мартыненко
аберрации
Л.С.,
у
Иванова
больных
М.П.
и
др.
хроническим
миелолейкозом // Гематол. и трансфузиол. 2007. - Т. 52 №2. - С. 2835.
45.
Мартынкевич И.С.Абдулкадыров К.М. Значимость генетических
методов исследования при целенаправленной (таргетной) терапии хронического
миелолейкоза ингибиторами тирозинкиназ (Обзор литературы) // Вестник
гематол 2011. - Т.7, №3. – С. 5-11.
46.
при
Мартынкевич И.С, Значимость генетических методов исследования
современной
целенаправленной
(таргетной)
терапии
хронического
120
миелолейкоза ингибиторами тирозинкиназ // Вестник гематологии. 2012. – Т.8, №
3. – С. 19 – 23.
47.
Менделеева Л.П. Трансплантация аллогенного костного мозга при
острых лейкозах и хроническом миелолейкозе // Тер. архив. 2003. - Т. 75. № 7.- С.
89-94.
48.
Мисюрин A.B., Аксенова Е.В., Крутов A.A. и др. Молекулярная
диагностика хронического миелолейкоза // Гематол. и трансфузиол. 2007. – N.2. –
С.35-40.
49.
Овсянникова
Мутационный
статус
Е.Г.,
Капланов
резистентных
к
К.Д.,
Клиточенко
иматинибу
больных
Т.Ю.
и
др.
хроническим
миелолейкозом // Онкогематология. 2012. - № 4. - С. 16-24.
50.
Румянцев А.Г., Масчан А.А. Трансплантация гемопоэтических
стволовых клеток у детей: Руководство для врачей. - Москва: Медицинское
информационное агентство, 2003. - 912 с.
51.
Савченко В.Г. Трансплантация костного мозга в онкогематологии //
Клиническая онкогематология. 2010. - Т. 3. № 4. - С. 410-411.
52.
Ставровская А.А., Стромская Т.П. Транспортные белки семейства авс
и множественная лекарственная устойчивость опухолевых клеток // Биохимия.
2008. - Т. 73. № 5. - С. 735-750.
53.
Стромская Т.П., Рыбалкина Е.Ю., Круглов С.С. и др. Участие р-
гликопротеина в эволюции популяций клеток хронического миелолейкоза при
воздействии иматиниба // Биохимия. 2008. - Т. 73. № 1. - С. 36-46.
54.
Телегеев Г.Д. и соавт. Роль белка BCR-ABL в лейкозогенезе //
Экспериментальная онкология. 1999. – N. 21. – С.182-194.
55.
Inhibitor)
Туркина А.Г. Ингибитор сигнальных путей STI571 (Signal Transductor
новое
направление
в
лечении
хронического
миелолейкоза
//
Современная онкология. - 2001. – Т.3, N.2. - С.46- 48.
56.
Туркина А.Г. Патогенетическое лечение хронического миелолейкоза:
препарат гливек блокирует активность специфического BCR-ABL онкопротеина //
121
Вопросы гематологии, онкологии и иммунопатологии в педиатрии. 2002. - Т.1, №
2. - С. 60-65.
57.
Туркина А.Г., Хорошко Н.Д. Практические рекомендации по
лечению больных хроническим миелолейкозом. М:Из-во Триада, 2008. - 36 с.
58.
Туркина А.Г., Хорошко Н.Д., Дружкова Г.А. и др. Эффективность
терапии иматиниба мезилатом (Гливеком) в хронической фазе хронического
миелолейкоза // Тер. архив. 2003. - Т. 75, № 8. - С. 6267.
59.
Туркина А.Г., Челышева Е.Ю. Цитогенетический и молекулярный
ответ ранние маркеры эффективности терапии Гливеком больных Ph+
хроническим миелолейкозом // Фарматека. - 2004. - №18 (95). - С. 48-53.
60.
Хорошко
H.Д.,
Виноградова
О.Ю.,
Туркина
А.Г.
Терапия
дазатинибом больных хроническим миелолейкозом, резистентных к лечению
иматинибом // Гематол. и трансфузиол. 2008. - Т. 53, № 3. - С. 29-34.
61.
Хорошко Н.Д., Туркина А.К., Кузнецов С.В. и др. Хронический
миелолейкоз успехи современного лечения и перспективы
// Гематол. и
трансфузиол. 2001. - №4. - C.З-8.
62.
Челышева Е.Ю., Туркина А.Г., Мисюрин А.В. и др. Мониторинг
минимальной остаточной болезни у больных хроническим миелолейкозом:
клиническое значение полимеразной цепной реакции в режиме реального
времени // Тер. архив. 2007. - № 4. - С. 49-53
63.
киназного
Челышева Е.Ю., Шухов О.В., Лазарева О.В., Туркина А.Г. Мутации
домена
гена
BCR-ABL
при
хроническом
миелолейкозе
//
Клиниическая онкогематол. 2012. - Т.5, №1. – C. 13-21.
64.
Arai S., Yoshimi A., Shimabe M. et al. Evi-1 is a transcriptional target of
MLL oncoproteins in hematopoietic stem cells // Blood. 2010. - V.101, № 11. - P.46114614.
65.
Azam M., Latek R., Daley G. Mechanisms of autoinhibition and STI-
571/imatinib resistance revealed by mutagenesis of BCR-ABL // Cell. 2003. - V.112, №
6. - P.831-843.
122
66.
Baccarani M., Cortes J., Pane F. et al. Chronic myeloid leukemia: an
update of concepts and management recommendations of European LeukemiaNet. J
Clin Oncol 2009. - V. 27. - P. 6041–6051
67.
Bacher U, Klyuchnikov E, Zabelina T. et al. The changing scene of
allogeneic stem cell transplantation for chronic myeloid leukemia – a report from the
German Registry covering the period from 1998 to 2004. // Ann Hematol 2009. - V.88.
- P.1237–1247.
68.
Bao X., Hou L., Sun A. et al. The impact of KIR2DS4 alleles and the
expression of KIR in the development of acute GVHD after unrelated allogeneic
hematopoietic SCT // Bone Marrow Transplant. 2010 - V.45, № 9. - P.1435-1441.
69.
Barnes D., Palaiologou D., Panousopoulou E., et al. BCR-ABL expression
levels determine the rate of development of resistance to imatinib mesylate in chronic
myeloid leukemia // Cancer Res. 2005. - V.65, № 13. - P.8912-8919.
70.
Barthe C., Cony-Makhoul P., Melo J. et al. Roots of clinical resistance to
STI-571 cancer therapy // Science. 2009. - V 293, № 5538.- P. 2163 -2001
71.
Beachy P., Karhadkar S.S., Berman D.M. Mending and malignancy //
Nature. 2004. - V.431. - P.1435-1441.
72.
Beck Z., Kiss A., Toth F.D., et al. Alterations of p53 and RB genes and the
evolution of the accelerated phase of chronic myeloid leukemia // Leuk Lymphoma.
2000. - V.38. - P. 587-597
73.
Beisel C., Paro R. Silencing chromatin. - P. comparing modes and
mechanisms // Nat Rev Genet 2011. - V. 12. - P.123-135.
74.
Bensinger W.I., Martin P.J., Storer B. et al. Transplantation of bone
marrow as compared with peripheral-blood cells from HLA-identical relatives in
patients with hematologic cancers // N Engl J Med. 2001. - V.344, № 3. - P.175-181.
75.
Bracken A.P., Helin K. Polycomb group proteins: navigators of lineage
pathways led astray in cancer // Nat Rev Cancer 2009. - V. 9. - P.773-784.
76.
Breccia M., Frustaci A.M., Cannella L et al. Sequential development of
mutant clones in an imatinib resistant chronic myeloid leukaemia patient following
123
sequential treatment with multiple tyrosine kinase inhibitors: an emerging problem?
Cancer Chemother // Pharmacol. 2009. – V.64, № 1.- P. 195–197
77.
Buonamici S., Li D., Mikhail L. et al. EVI1 abrogates interferon-alpha
response by selectively blocking PML induction // J Biol Chem 2005. - V. 280. - P.428436.
78.
Burgess M.R., Skaggs B.J., Shah N.P. et al. Comparative analysis of two
clinically active BCR–ABL kinase inhibitors reveals the role of conformation-specific
binding in resistance // Proc. Natl Acad. Sci. USA. 2005. – V. 102, № 9. -P.3395–3400
79.
Calabretta B., Perrotti D. The biology of CML blast crisis // Blood. 2004. -
V.103. - P.4010-4022.
80.
Carayol N., Vakana E., Sassano A., et al. Critical roles for mTORC2 and
rapamycin-insensitive mTORC1-complexes in growth and survival of BCR-ABLexpressing leukemic cells // Proc Natl Acad Sci US A. 2010. - V.107. - P.12469–12474
81.
Carlesso N., Frank D.A., Griffin J.D. Tyrosyl phosphorylation and DNA
binding activity of signal transducers and activators of transcription (STAT) proteins in
hematopoietic cell lines transformed by Bcr/Abl // J Exp Med. 1996. - V.183. - P.811–
820.
82.
Carter T.A., Wodicka L.M., Shah N.P., et al. Inhibition of drug-resistant
mutants of ABL., KIT., and EGF receptor kinases // Proc Natl Acad Sci U S A. 2005. V.102, № 31. - P.11011-11016.
83.
Cattaneo F., Nucifora G. EVI1 recruits the histone methyltrans- ferase
SUV39H1 for transcription repression // J Cell Biochem. 2008. - V.105. - P.344–352.
84.
Clift R.A., Buckner C.D., Thomas E.D. et al. Marrow transplantation for
patients in accelerated phase of chronic myeloid leukemia // Blood. 1994 - V.84, № 12.
- P.4368-4373.
85.
Clift R.A., Buckner C.D., Thomas E.D. et al. Treatment of chronic
granulocytic leukaemia in chronic phase by allogeneic marrow transplantation // Lancet
1982. - V.2. - P.621–623.
124
86.
Collins S., Groudine M. Amplification of endogenous mycrelated DNA
sequences in a human myeloid leukaemia cell line // Nature. 1982. - V.298. - P.679681.
87.
Collins S.J., Groudine M.T. Chronic myelogenous leukemia: amplification
of a rearranged c-abl oncogene in both chronic phase and blast crisis // Blood. 1987. V.69. - P.893-898
88.
Corbin A.S., La Rosée P., Stoffregen E.P. et al. Several BCR-ABL kinase
domain mutants associated with imatinib mesylate resistance remain sensi- tive to
imatinib // Blood. 2003. - V.101, № 11. - P.4611-4614.
89.
Cortes J., Kantarjian H.M., O’Brien S. Result of interferon-alpha therapy
in patients with chronic myelogenous leukemia 60 years of age and older. // Am J Med
1996. - V.100. - P.452–455.
90.
Cortes J., Rousselot. P, Kim D.W. et al. Dasatinib induces complete
hematologic and cytogenetic responses in patients with imatinib-resistant or intolerant
chronic myeloid leukemia in blast crisis // Blood. 2007. - V 109. - P. 3207-3213
91.
Couban S., Simpson D.R., Barnett M.J. et al. - V. Canadian Bone Marrow
Transplant Group. A randomized multicenter comparison of bone marrow and
peripheral blood in recipients of matched sibling allogeneic transplants for myeloid
malignancies // Blood. 2002. - V.100, № 5. - P.1525-1531.
92.
Cuenco G.M., Ren R. Cooperation of BCR-ABL and AML1/MDS1/EVI1
in blocking myeloid differentiation and rapid induction of an acute myelogenous
leukemia. // Oncogene 2001. - V.20. – Р. 8236–8248
93.
Daghistani M., Marin D., Khorashad J.S. et al. EVI-1 oncogene expression
predicts survival in chronic-phase CML patients resistant to imatinib treated with
second-generation tyrosine kinase inhibitors // Blood. 2010. - V.116, № 26. - P.6014–
6017.
94.
Daley G.Q., Van Etten R.A., Baltimore D. Induction of chronic
myelogenous leukemia in mice by 210 BCR-ABL gene of the Philadelphia chromosome
// Science 1990. - V.87. - P.6649–6653.
125
95.
De Weer A., Poppe B., Vergult S. et al. Identification of two critically
deleted regions within chromosome segment 7q35-q36 in EVI1 deregulated myeloid
leukemia cell lines // PLoS One 2010. - V. 5. - P.8676-8680.
96.
Deininger M., Schleuning M., Greinix H. et al. - V. European Blood and
Marrow Transplantation Group. The effect of prior exposure to imatinib on transplantrelated mortality // Haematologica. 2006, - V.91, № 4. - P.452–459.
97.
Delhommeau F., Dupont S., Della Valle V. et al. Mutation in TET2 in
myeloid cancers // N Engl J Med 2009. - V. 360. - P.2289-2301.
98.
Dengler J., von Bubnoff N., Decker T. et al. Combination of imatinib with
rapamycin or RAD001 acts synergistically only in BCR-ABL-positive cells with
moderate resistance to imatinib // Leukemia. 2005. - V.19. - P.1835–1838.
99.
Devergie A., Reiffers J., Vernant J.P. et al. Long-term follow-up after bone
marrow transplantation for chronic myelogenous leukemia: factors associated with
relapse // Bone Marrow Transplant. 1990 - V.5, № 6. - P.379–386.
100. Dickinson A.M., Pearce K.F., Norden J., et al. Impact of genomic risk
factors on outcome after hematopoietic stem cell transplantation for patients with
chronic myeloid leukemia // Haematologica. 2010. - V.95, № 6. – P.922–927.
101. Donato N.J., Wu J.Y., Stapley J. et al. BCR–ABL independence and LYN
kinase overexpression in chronic myelogenous leukemia cells selected for resistance to
STI571 // Blood. 2003, - V.101, № 2. – P.690–698.
102. Druker B.J., Guilhot F., O’Brien S.G., et al. Five-year follow-up of
patients receiving imatinib for chronic myeloid leukemia // N Engl J Med. 2006. V.355, № 23. - P. 2408-2417.
103. Druker B.J., Sawyers C.L., Kantarjian H. et al. Activity of a specific
inhibitor of the BCR-ABL tyrosine kinase in the blast crisis of chronic myeloid
leukemia and acute lymphoblastic leukemia with the Philadelphia chromosome // N
Engl J Med. 2001. – V.344, № 14. - P.1038–1042.
104. Druker B.J., Talpaz M., Resta D.J. et al. Efficacy and safety of a specific
inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia // N Engl J Med.
2001. - V.344. - P.1031–1037.
126
105. Druker B.J., Tamura S., Buchdunger E., et al. Effects of a selective
inhibitor of the Abl tyrosine kinase on the growth of BCR-ABL positive cells // Nat
Med. 1996. - V.2. - P.561–566.
106. Enright H., Daniels K., Arthur DC. et al. Related donor marrow transplant
for chronic myeloid leukemia: patient characteristics predictive of outcome // Bone
Marrow Transplant. 1996. - V.17, № 4. – P.537–542.
107. Ernst T., Chase A. J., Score J. et al. Inactivating mutations of the histone
methyltransferase gene EZH2 in myeloid disorders // Nat Genet. 2010. - V. 42. - P.722726.
108. Ernst T., Erben P., Muller M.C et al. Dynamics of BCR–ABL mutated
clones prior to hematologic or cytogenetic resistance to imatinib // Haematologica.
2008. - V.93, № 2, - Р. 186–192.
109. Fefer A., Buckner C.D., Thomas E.D., et al. Cure of hematologic neoplasia
with transplantation of marrow from identical twins // N Engl J Med. 1977. - V.297. P.146–148.
110. Fefer A., Cheever M.A., Thomas E.D. et al. Disappearance of Ph1-positive
cells in four patients with chronic granulocytic leukemia after chemotherapy.,
irradiation and marrow transplantation from an identical twin // N Engl J Med. 1979. V.300, № 7. - P.333–337.
111. Fioretos T., Strombeck B., Sandberg T., et al. Isochromosome 17q in blast
crisis of chronic myeloid leukemia and in other hematologic malignancies is the result
of clustered breakpoints in 17p11 and is not associated with coding TP53 mutations //
Blood. 1999. - V.94. - P.225-232.
112. Franke T.F., Kaplan D.R., Cantley L.C. PI3K downstream AKTion blocks
apoptosis // Cell. 1997. - V.88. - P.435–7.
113. Gabert J, Beillard E, van der Velden V.H. et al. Standardization and
quality control studies of 'real-time' quantitative reverse transcriptase polymerase chain
reaction of fusion gene transcripts for residual disease detection in leukemia - a Europe
Against Cancer program. // Leukemia. 2003 – V.17, № 12. - P. 2318–2357.
127
114. Gaiger A., Henn T., Horth E., et al. Increase of bcr/abl chimeric mRNA
expression in tumor cells of patients with chronic myeloid leukemia precedes disease
progression // Blood. 1995. - V.86. - P.2371-2378.
115. Gambacorti-Passerini C.B., Gunby R.H., Piazza R., et al. Molecular
mechanisms of resistance to imatinib in Philadelphia-chromosome-positive leukaemias
// Lancet Oncol. 2003. - V.4, № 2. - P.75–85.
116. Gelsi-Boyer V., Trouplin V., Adelaide J. et al. Mutations of polycombassociated gene ASXL1 in myelodysplastic syndromes and chronic myelomonocytic
leukaemia // Br J Haematol 2009. - V. 145. - P.788–800.
117. Germer S., Holland M.J., Higuchi., R. et al. High-throughput SNP allelefrequency determination in pooled DNA samples by kinetic PCR. // Genome Res.2000.
- V. 10 , № 2. – P. 258–266.
118. Ghaffari S., Jagani Z., Kitidis C., et al. Cytokines and BCR-ABL mediate
suppression of TRAIL-induced apoptosis through inhibition of forkhead FOXO3a
transcription factor // Proc Natl Acad Sci USA. 2003. - V.100. - P.6523–6528.
119. Goldman J. Management of chronic myeloid leukemia // Semin Hematol.
2003. - V.40. - P.1–103
120. Goldman J.M., Baughan A.S., McCarthy D.M. et al. Marrow
transplantation for patients in the chronic phase of chronic granulocytic leukaemia //
Lancet 1982. - V.2. - P.623–625.
121. Goldman J.M., Gale R.P., Horowitz M.M. et al.
Bone marrow
transplantation for chronic myelogenous leukemia in chronic phase. Increased risk for
relapse associated with T-cell depletion. // Ann Intern Med. 1988 - V.108, № 6. P.806–814.
122. Goldman J.M., Szydlo R., Horowitz M.M. et al. Choice of pretransplant
treatment and timing of transplants for chronic myelogenous leukemia in chronic phase
// Blood.1993 – V..82 , № 7. - P.2235–2238.
123. Gorre M.E., Mohammed M., Ellwood K et al. Clinical resistance to STI571 cancer therapy caused by BCR–ABL gene mutation or amplification // Science.
2001. - V. 293, № 5531. - P. 876–880.
128
124. Goyama S., Yamamoto G., Shimabe M. et al. Evi-1 is a critical regulator
for hematopoietic stem cells and transformed leukemic cells // Cell Stem Cell. 2008. V. 3. - P.207-220.
125. Gratwohl A., Brand R., Apperley K., et al. Allogeneic hematopoietic stem
cell transplantation for chronic myeloid leukemia in Europe 2006: transplant activity.,
long-term data and current results. An analysis by the Chronic Leukemia Working
Party of the European Group for Blood and Marrow Transplantation (EBMT). //
Haematologica 2006. - V.91. - P.513–521.
126. Gratwohl A., Hermans J., Goldman J.M., et al. Risk assessment for
patients with chronic myeloid leukaemia before allogeneic blood or marrow
transplantation. Chronic Leukemia Working Party of the European Group for Blood
and Marrow Transplantation. // Lancet 1998. - V.352. - P.1087–1093.
127. Greenman C., Stephens P., Smith R et al. Patterns of somatic mutation in
human cancer genomes // Nature 2007. – V. 446, № 7132. - P. 153–158
128. Griswold I.J., MacPartlin M., Bumm T. et al. Kinase domain mutants of
BCR–ABL exhibit altered transformation potency., kinase activity, and substrate
utilization., irrespective of sensitivity to imatinib // Mol. Cell Biol. 2006. – V.26, № 16.
- P. 6082–6093
129. Groschel S., Lugthart S., Schlenk R. F. et al.
High EVI1 expression
predicts outcome in younger adult patients with acute myeloid leukemia and is
associated with distinct cytogenetic abnormalities // J Clin Oncol 2010. - V. 28. P.2101-2107.
130. Gruber F.X., Lamark T., Anonli A., et al. Selecting and deselecting
imatinib-resistant clones. - P. observations made by longitudinal., quantitative
monitoring of mutated BCR–ABL // Leukemia 2005. – V. 19, № 12. – P. 2159–2165
131. Guo J.Q., Wang J.Y., Arlinghaus R.B. Detection of BCR-ABL proteins in
blood cells of benign phase chronic myelogenous leukemia patients // Cancer Res.
1991. - V.51. - P.3048-3051.
129
132. Hanfstein B., Muller M.C., Kreil S et al. Dynamics of mutant BCR–ABLpositive clones after cessation of tyrosine kinase inhibitor therapy // Haematologica
2011. – V. 96, № 3, - P. 360–366
133. Hansen J.A., Gooley T.A., Martin P.J. et al. Bone marrow transplants
from unrelated donors for patients with chronic myeloid leukemia // N Engl J Med.
1998. - V.338, № 14. - P.962–968.
134. Hantschel O., Nagar B., Guettler S., et al. A myristoyl/phosphotyrosine
switch regulates c-Abl // Cell. 2003. - V.112, № 6. - P.845–857.
135. Hehlmann R., Hochhaus A., Kolb H.J. et al. Interferon-alpha before
allogeneic bone marrow transplantation in chronic myelogenous leukemia does not
affect outcome adversely., provided it is discontinued at least 90 days before the
procedure // Blood. 1999. - V.94, № 11. - P.3668–3677.
136. Heinemann F.M., Ferencik S., Ottinger H.D. et al. Impact of disparity of
minor histocompatibility antigens HA-1., CD31., and CD49b in hematopoietic stem
cell transplantation of patients with chronic myeloid leukemia with sibling and
unrelated donors // Transplantation. 2004. - V. 77, № 7. - P.1103–1106.
137. Heisterkamp N., Jenster G., ten Hoeve J. et al. Acute leukaemia in bcr/abl
transgenic mice // Nature. 1990. - V. 344. - P.251–253.
138. Hochhaus A., Kreil S., Corbin A et al. Roots of clinical resistance to STI571 cancer therapy // Science. 2001. – V. 293, № 5538. - P 2163-2172
139. Hochhaus A., Kreil S., Corbin A.S. et al. Molecular and chromosomal
mechanisms of resistance to imatinib (STI571) therapy // Leukemia. 2002. - V. 16. - P.
2190–2196.
140. Hochhaus A., La Rosée P. Imatinib therapy in chronic myelogenous
leukemia: strategies to avoid and overcome resistance // Leukemia. 2004. - V.18, № 8. P. 1321-1331.
141. Hoelbl A., Schuster C., Kovacic B., et al. Stat5 is indispensable for the
maintenance of bcr/abl-positive leukaemia // EMBO Mol Med. 2010. - V.2. - P.98–110.
130
142. Holtz M.S., Forman S.J., Bhatia R. Non-proliferating CML CD34+ progenitors are resistant to apoptosis induced by a wide range of proapoptotic stimuli //
Leukemia. 2005. - V.19, № 6. - P.1034–1041.
143. Horowitz M.M., Rowlings P.A., Passweg J.R. Allogeneic bone marrow
transplantation for CML. A report from the International Bone Marrow Transplant
Registry // Bone Marrow Transplant. 1996. - V.17. - P.S5-S6.
144. Hu Y., Liu Y., Pelletier S., et al. Requirement of Src kinases Lyn., Hck
and Fgr for BCR-ABL1-induced B-lymphoblastic leukemia but not chronic myeloid
leukemia // Nat Genet. 2004. - V.36, № 5. - P.453-461.
145. Hughes T., Branford S. Molecular monitoring of BCR-ABL as a guide to
clinical management in chronic myeloid leukaemia // Blood Rev. 2006. - V. 20, № 1. P.29-41.
146. Hughes T., Deininger M., Hochhaus A., et al. Monitoring CML patients
responding to treatment with tyrosine kinase inhibitors. Review and recommendations
for harmonizing current methodology for detecting BCR-ABL transcripts and kinase
domain mutations and for expressing results // Blood. 2006. - V.108, № 1. - P.28–37.
147. Hughes T., Saglio G., Branford S. et al. Impact of baseline BCR–ABL
mutations on response to nilotinib in patients with chronic myeloid leukemia in chronic
phase // J. Clin. Oncol. 2009. – V.27, № 25. – P. 4204–4210.
148. Iacob R.E., Pene-Dumitrescu T., Zhang J. et al.
Conformational
disturbance in Abl kinase upon mutation and deregulation // Proc. Natl Acad. Sci. USA
2009. – V.106, № 5. – P. 1386–1391.
149. Ilaria R.L., Van Etten R.A. P210 and P190BCR/ABL induce the tyrosine
phosphorylation and DNA binding activity of multiple specific STAT family members
// J Biol Chem. 1996. - V.271. - P.31704–31710.
150. Jabbour E., Cortes J., Santos F.P. et al. Results of allogeneic hematopoietic
stem cell transplantation for chronic myelogenous leukemia patients who failed
tyrosine kinase inhibitors after developing BCR-ABL1 kinase domain mutations //
Blood. 2011. - V.117, № 13. - P.3641–3647.
131
151. Jabbour E., Jones D., Kantarjian H.M., et al. Long-term outcome of
patients with chronic myeloid leukemia treated with second-generation tyrosine kinase
inhibitors after imatinib failure is predicted by the in vitro sensitivity of BCR-ABL
kinase domain mutations // Blood. 2009. - V.114. - P.2037–2043.
152. Jamieson C.H.M., Ailles L.E., Dylla S.J. et al. Granulocytemacrophage
progenitors as candidate leukemic stem cells in blast-crisis CML // N Engl J Med.
2004. - V.351. - P.657–667.
153. Janes M.R., Limon J.J., So L., et al. Effective and selective targeting of
leukemia cells using a TORC1/2 kinase inhibitor // Nat Med.2010. - V.16. - P.205–213.
154. Jin G., Yamazaki Y., Takuwa M. et al. Trib1 and EVI1 cooperate with
Hoxa and Meis1 in myeloid leukemogenesis // Blood. 2007. - V.109. - P.3998–4005.
155. Kantarjian H.., Giles F., Wunderle., L. et al. Nilotinib in imatinib-resistant
CML and Philadelphia chromosome-positive ALL. // N Engl J Med. 2006. – V.354. –
P.2542-2551.
156. Kantarjian., H.., Pasquini., R., Hamerschlak., N. et al. Dasatinib or highdose imatinib for chronic-phase chronic myeloid leukemia after failure of first-line
imatinib - a randomized phase 2 trial // Blood. 2007. – V.109. – P.5143-5150.
157. Kelliher M.A., McLaughlin J., Witte O.N. et al. Induction of a chronic
myelogenous leukemia-like syndrome in mice with v-abl and BCR/ABL // Proc Natl
Acad Sci U S A. 1990. - V.87. - P.6649–6653.
158. Kirstetter P., Thomas M., Dierich A. et al.. Ikaros is critical for B cell
differentiation and function // Eur J Immunol. 2002. - V.32. - P.720–730.
159. Koeffler H.P., Golde D.W. Chronic myelogenous leukemia – new
concepts (second of two parts) // N Engl J Med 1981. - V.304. - P.1269–1274.
160. Komarova N.L., Wodarz D. Drug resistance in cancer:
principles of
emergence and prevention. // Proc. Natl Acad. Sci. USA 2005. – V.102, № 27. –P.
9714–9719.
161. Kurokawa M., Mitani K., Irie K. et al. The oncoprotein Evi-1 represses
TGF-beta signalling by inhibiting Smad3 // Nature. 1998. - V.394. - P.92–96.
132
162. Kurokawa M., Mitani K., Yamagata T. et al.
The evi-1 oncoprotein
inhibits c-Jun N-terminal kinase and prevents stress-induced cell death. // EMBO J
2000. - V.19. - P.2958–2968.
163. Langemeijer S.M., Kuiper R.P., Berends M. et al. Acquired mutations in
TET2 are common in myelodysplastic syndromes. // Nat Genet. 2009. - V. 41. - P.838–
-842.
164. le Coutre P., Kreuzer K.A., Pursche S., et al. Pharmacokinetics and cellular uptake of imatinib and its main metabolite CGP74588 // Cancer Chemother
Pharmacol. 2004. - V.53, № 4. - P.313–323.
165. Lee S.J., Kukreja M., Wang T. et al. Impact of prior imatinibmesylate on
the outcome of hematopoietic cell transplantation for chronic myeloid leukemia //
Blood. 2008. - V.112, № 8. - P.3500–3507.
166. Lee T.S., Potts S.J., Kantarjian H. et al. Molecular basis explanation for
imatinib resistance of BCR–ABL due to T315I and P-loop mutations from molecular
dynamics simulations. // Cancer. 2008. - V.11, № 8. – P. 1744–1753
167. Ley T.J., Ding L., Walter M.J. et al.
DNMT3A mutations in acute
myeloid leukemia. // N Engl J Med. 2010. - V. 363. - P.2424–2433.
168. Lichty B.D., Keating A., Callum J. et al. Expression of p210 and p190
BCR-ABL due to alternativesplicing in chronic myelogenous leukaemia. // Br J
Haematol. 1998. - V.103, № 3. - P.711–-715.
169. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method // Methods.
2001. - V.25, № 4. - P.402–408.
170. Lowenberg B. Minimal residual disease in chronic myeloid leukemia // N
Engl J Med. 2003. - V.349, № 15. - P.1399–1401.
171. Lugthart S., Figueroa M.E., Bindels E. et al.
Aberrant DNA
hypermethylation signature in acute myeloid leukemia directed by EVI1 // Blood. 2011.
- V. 117. - P.234–241.
172. Ly C., Arechiga A.F., Melo J.V. et al. BCR-ABL kinase modulates the
translation regulators ribosomal protein S6 and 4E-BP1 in chronic myelogenous
133
leukemia cells via the mammalian target of rapamycin. // Cancer Res. 2003. - V.63. P.5716–5722.
173. Makishima H., Jankowska A.M., Tiu R.V. et al. Novel homo- and
hemizygous mutations in EZH2 in myeloid malignancies. // Leukemia. 2010. - V. 24. P.1799–1804.
174. Margueron R., Reinberg D. The Polycomb complex PRC2 and its mark in
life // Nature. 2011. - V. 469. - P.343–349.
175. Martin M.G, Uy G.L, Procknow E. et al. Allo-SCT conditioning for
myelodysplastic syndrome and acute myeloid leukemia with clofarabine, cytarabine
and ATG. // Bone Marrow Transplant. 2009. – V.44. – P. 13–17.
176. Martin P.J., Clift R.A., Fisher L.D. et al. HLA-identical marrow
transplantation during accelerated-phase chronic myelogenous leukemia. - P. analysis
of survival and remission duration. // Blood. 1988. - V.72, № 6. - P.1978–1984.
177. Martin-Perez D., Piris M.A., Sanchez-Beato M. Polycomb proteins in
hematologic malignancies // Blood. 2010. - V. 116. - P.5465–5475.
178. Mayerhofer M., Aichberger K.J., Florian S., et al. Identification of mTOR
as a novel bifunctional target in chronic myeloid leukemia. - P. dissection of growthinhibitory and VEGF-suppressive effects of rapamycin in leukemic cells // FASEB J.
2005. - V.19. - P.960–962.
179. McGlave P.B, Shu X.O, Wen W. et al. Unrelated donor marrow
transplantation for chronic myelogenous leukemia: 9 years’ experience of the national
marrow donor program. // Blood. 2000. – V.95. - P. 2219–2225.
180. Melo J.V., Barnes D.J. Chronic myeloid leukaemia as a model of disease
evolution in human cancer. // Nat Rev Cancer. 2007. - V.7. - P.441–453.
181. Melo J.V., Deininger M.W.N. Biology of chronic myelogenous
leukemia— signaling pathways of initiation and transformation // Hematol Oncol Clin
North Am. 2004. - V.18. - P.545–568.
182. Mitani K., Ogawa S., Tanaka T. et al. Generation of the AML1-EVI-1
fusion gene in the t(3;21)(q26;q22) causes blastic crisis in chronic myelocytic leukemia
// EMBO J. 1994. - V.13. - P.504–510.
134
183. Mohi M.G., Boulton C., Gu T.L., et al. Combination of rapamycin and
protein tyrosine kinase (PTK) inhibitors for the treatment of leukemias caused by
oncogenic PTKs. // Proc Natl Acad Sci U S A. 2004. - V.101. - P.3130–3135.
184. Morishita K., Parker D.S., Mucenski M.L. et al. Retroviral activation of a
novel gene encoding a zinc finger protein in IL-3-dependent myeloid leukemia cell
lines // Cell. 1988. - V.54. - P.831–840.
185. Mucenski M.L., Taylor B.A., Ihle J.N. et al. Identification of a common
ecotropic viral integration site., Evi-1., in the DNA of AKXD murine myeloid tumors.
// Mol Cell Biol. 1988. - V.8. - P.301–308.
186. Mullighan C.G., Miller C.B., Radtke I., et al. BCRABL1 lymphoblastic
leukaemia is characterized by the deletion of Ikaros // Nature. 2008. - V.453. - P.110114.
187. Nagao R., Ashihara E., Kimura S. et al. Growth inhibition of imatinibresistant CML cells with the T315I mutation and hypoxia-adaptation by AV65 - a novel
Wnt/beta-catenin signaling inhibitor. // Cancer Lett. 2011. – V.312. – P. 91-100.
188. Nagar B., Bornmann W.G., Pellicena P., et al. Crystal structures of the
kinase domain of c-Abl in complex with the small molecule inhibitors PD173955 and
imatinib (STI-571) // Cancer Res. 2002. - V.62, № 15. - P.4236-4243.
189. Nicolini F.E., Basak G.W., Soverini S. et al. Allogeneic stem cell
transplantation for patients harboring T315I BCR-ABL mutated leukemias. // Blood.
2011. - V.118, № 20. - P.5697–5700.
190. Nicolini F.E., Mauro M.J., Martinelli G. et al. Epidemiologic study on
survival of chronic myeloid leukemia and Ph(+) acute lymphoblastic leukemiapatients
with BCR-ABL T315I mutation. // Blood. 2009. - V.114, № 26. - P.5271–-5278.
191. Nikoloski G., Langemeijer S M., Kuiper R P. et al. Somatic mutations of
the histone methyltransferase gene EZH2 in myelodysplastic syndromes. // Nat Genet
2010. - V. 42. - P.665–667.
192. Nowell P.C., Hungerford D.A. A minute chromosome in human chronic
granulocitic leukemia // Science. 1960. - V.32. - P.1497–501.
135
193. O’Brien S.G., Guilhot F., Larson R.A., et al. Imatinib compared with
interferon and low-dose cytarabine for newly diagnosed chronic-phase chronic myeloid
leukemia // N Engl J Med. - 2003. - V.348. - P.994-1004.
194. O’Hare T., Walters D.K., Stoffregen E.P et al. In vitro activity of Bcr–Abl
inhibitors AMN107 and BMS-354825 against clinically relevant imatinib-resistant Abl
kinase domain mutants // Cancer Res 2005. – V. 65(11). – P. 4500–4505.
195. Oehler V.G., Gooley T., Snyder D.S. et al. The effects of imatinib
mesylate treatment before allogeneic transplantation for chronic myeloid leukemia. //
Blood. 2007. - V.109, № 4. - P.1782–1789.
196. Oehler V.G., Radich J.P., Storer B. et al. Randomized trial of allogeneic
related bone marrow transplantation versus peripheral blood stem cell transplantation
for chronic myeloid leukemia. // Biol Blood Marrow Transplant. 2005. - V.11, № 2. P.85–92.
197. Ogawa S, Kurokawa M, Tanaka T, et al . Increased Evi-1 expression is
frequently observed in blastic crisis of chronic myelocytic leukemia. // Leukemia. 1996.
- V. 10, № 5. – P. 788–794.
198. Ogawa S, Mitani K, Kurokawa M, et al . Abnormal expression of Evi-1
gene in human leukemias. // Hum Cell. 1996. – V. 9, № 4. – P. 323–332.
199. O'Hare T., Shakespeare W.C., Zhu X., et al. AP24534., a pan-BCR-ABL
inhibitor for chronic myeloid leukemia., potently inhibits the T315I mutant and
overcomes mutation-based resistance. // Cancer Cell. - 2009. - V.16. - P.401–412.
200. Orum H., Jakobsen M., Koch T. et al. Detection of the factor V Leiden
mutation by direct allele specific hybridization of PCR amplicons to photoimmobilized
locked nucleic acids. // Clinical Chemistry. - 1999. –V. 45. – P. 1898–1905.
201. Pabst T. Mutations of the myeloid transcription factor CEBPA are not
associated with the blast crisis of chronic myeloid leukaemia. // Br J Haematol. 2006. –
V. 33 . – P. 400–402.
202. Paquette R.L., Nicoll J., Chalukya M. et al. Frequent EVI1 translocations
in myeloid blast crisis CML that evolves through tyrosine kinase inhibitors. // Cancer
Genet. 2011. - V.204, № 7. - P.392–397.
136
203. Pellicano F., Simara P., Sinclair A., et al. The MEK inhibitor PD184352
enhances BMS-214662-induced apoptosis in CD34+ CML stem/progenitor cells. //
Leukemia. 2011. - V.25. - P.1159–1167.
204. Pendergast A.M., Muller A.J., Havlik M.H. et al. BCR sequences essential
for transformation by the BCR-ABL oncogene bind to the ABL SH2 regulatory domain
in a non-phosphotyrosine- dependent manner // Cell. 1991. - V.66. - P.161–171.
205. Pendergast A.M., Quilliam L.A., Cripe L.D. et al. BCR-ABL-induced
oncogenesis is mediated by direct inter- action with the SH2 domain of the GRB-2
adaptor protein. // Cell. 1993. - V.75. - P.175–185.
206. Peng B., Hayes M., Resta D., et al. Pharmacokinetics and pharmacodynamics of imatinib in a phase I trial with chronic myeloid leukemia patients. // J Clin
Oncol. 2004. - V. 22, № 5. - P.935–942.
207. Perrotti D. BCR-ABL suppresses C/EBPα xpression through inhibitory
action of hnRNP E2. // Nature Genet. 2002. – V. 7730. – P. 48–58.
208. Picard S., Titier K., Etienne G., et al. Trough imatinib plasma levels are
associated with both cytogenetic and molecular responses to standard-dose imatinib in
chronic myeloid leukemia/ // Blood. 2007 - V. 109, № 8. - P.3496–3499.
209. Puil L., Liu J., Gish G., et al. BCR-ABL oncoproteins bind directly to
activators of the Ras signalling pathway. // EMBO J 1994. - V.13. - P.764–773.
210. Quintás-Cardama A., Gibbons D.L., Kantarjian H., et al. Mutational
analysis of chronic myeloid leukemia (CML) clones reveals heightened BCR- ABL1
genetic instability and wild-type BCR-ABL1 exhaustion in patients failing sequential
imatinib and dasatinib therapy. // Blood. 2007. - V.110. Abstract 1938.
211. Radich J.P., Dai H., Mao M., et al. Gene expression changes associated
with progression and response in chronic myeloid leukemia. // Proc Natl Acad Sci U S
A. 2006. - V.103. - P.2794–2799.
212. Radich J.P., Gooley T., Bensinger W., et al. HLA-matched related
hematopoietic cell transplantation for chronic-phase CML using a targeted busulfan and
cyclophosphamide preparative regimen. // Blood. 2003. - V.102. - P.31–35.
137
213. Raza A., Buonamici S., Lisak L. et al. Arsenic trioxide and thalidomide
combination produces multi- lineage hematological responses in myelodysplastic
syndromes patients., particularly in those with high pre-therapy EVI1 expression //
Leuk Res. 2004. - V.28. - P.791–803.
214. Regl G., Kasper M., Schnidar H., et al. Activation of the BCL2 promoter
in response to Hedgehog/GLI signal transduction is predominantly mediated by GLI2.
// Cancer Res. 2004. - V.64. - P.7724–7731.
215. Roche-Lestienne C., Soenen-Cornu V., Grardel-Duflos N et al. Several
types of mutations of the Abl gene can be found in chronic myeloid leukemia patients
resistant to STI571., and they can pre-exist to the onset of treatment. // Blood 2002. –
V. 100, № 3. – P. 1014–1018.
216. Samanta A.K., Chakraborty S.N., Wang Y. et al. Jak2 inhibition
deactivates Lyn kinase through the SET-PP2A-SHP1 pathway., causing apoptosis in
drugresistant cells from chronic myelogenous leukemia patients. // Oncogene. 2009. –
V.28. - P. 1669–1681
217. Saussele S., Lauseker M., Gratwohl A. et al. - V. German CML Study
Group. Allogeneic hematopoietic stem cell transplantation (allo SCT) for chronic
myeloid leukemia in the imatinib era. Evaluation of its impact within a subgroup of the
randomized German CML Study IV // Blood. 2010 - V.115, № 10. - P.1880–1885.
218. Sauvageau M., Sauvageau G. Polycomb group proteins: multi-faceted
regulators of somatic stem cells and cancer // Cell Stem Cell. 2010. - V. 7. - P.299–313.
219. Savage D.G., Szydlo R.M.., Goldman J.M. Clinical features at diagnosis in
430 patients with chronic myeloid leukemia seen at a referral centre over a 16-year
period. // Br J Haematol. 1997. - V.96. - P.111–116.
220. Sawyers C.L., Callahan W., Witte O.N. Dominant negative MYC blocks
transformation by ABL oncogenes // Cell. 1992. - V.70. - P.901–910.
221. Schindler T., Bornmann W., Pellicena P., et al. Structural mechanism for
STI-571 inhibition of abelson tyrosine kinase. // Science. 2000. - V.289, № 5486. - P.
1938-1942.
138
222. Shackelford D., Kenific C., Blusztajn A. et al. Targeted degradation of the
AML1/MDS1/EVI1 oncoprotein by arsenic trioxide. // Cancer Res. 2006. - V.66. P.11360–11369.
223. Shah N.P., Nicoll J.M., Nagar B et al. Multiple BCR–ABL kinase domain
mutations confer polyclonal resistance to the tyrosine kinase inhibitor imatinib
(STI571) in chronic phase and blast crisis chronic myeloid leukemia. // Cancer Cell.
2002. – V.2, № 2. – P. 117–125.
224. Shah N.P., Skaggs B.J., Branford S et al. Sequential ABL kinase inhibitor
therapy selects for compound drug-resistant BCR–ABL mutations with altered
oncogenic potency. // J Clin Invest. 2007. – V. 117, № 9. – P. 2562–2569.
225. Shah N.P., Tran C., Lee F.Y. et al. Overriding imatinib resistance with a
novel ABL kinase inhibitor // Science. 2004. – V. 305, № 5682. – P. 399–401.
226. Shet A.S., Jahagirdar B.N., Verfaillie C.M. Chronic myelogenous
leukemia. - P. mechanisms underlying disease progression. // Leukemia. 2002. - V.16. P.1402–1411.
227. Shih A., Schairer A., Barrett C.L., et al. Cycling toward leukemia stem
cell elimination with a selective sonic hedgehog antagonist. // Blood. 2011. - V.118. P.3776a.
228. Shimabe M., Goyama S., Watanabe-Okochi N. et al. Pbx1 is a downstream
target of Evi-1 in hematopoietic stem/progenitors and leukemic cells. // Oncogene.
2009. - V. 28. - P.4364–4374.
229. Sill H., Goldman J.M., Cross N.C. Homozygous deletions of the p16
tumor-suppressor gene are associated with lymphoid transformation of chronic myeloid
leukemia. // Blood. 1995. - V.85. - P.2013–2016.
230. Skorski
T.,
Kanakaraj
P.,
Nieborowska-Skorska
M.
et
al.
Phosphatidylinositol-3 kinase activity is regulated by BCR/ABL and is required for the
growth of Philadelphia chromosome- positive cells. // Blood. 1995. - V.86. - P.726–
736.
139
231. Smith L.T., Hohaus S., Gonzalez D. A. et al. PU. 1 (Spi-1) and C/EBPα
regulate the granulocyte colony-stimulating factor receptor promoter in myeloid cells. //
Blood. 1996. – v.88. – P 1234–1247.
232. Soverini S., Gnani A., Colarossi S. et al. Philadelphia-positive patients
who already harbor imatinib-resistant Bcr–Abl kinase domain mutations have a higher
likelihood of developing additional mutations associated with resistance to second- or
third-line tyrosine kinase inhibitors. // Blood. 2009. – V.114, № 10. – P. 2168–2171.
233. Soverini S., Gnani A., De Benedittis C et al. Validation of the New
European LeukemiaNet (ELN) recommendations for Bcr–Abl kinase domain mutation
analysis in chronic myeloid leukemia: an analysis of the GIMEMA CML Working
Party Studies. // Blood. 2011. – V.118, № 21. – P. 112-120
234. Soverini S., Martinelli G., Colarossi S., et al. Presence or the emergence
of a F317L BCR–ABL mutation may be associated with resistance to dasatinib in
Philadelphia chromosome-positive leukemia. // J Clin Oncol. 2006. – V.24, № 33. E51–E52.
235. Soverini S., Vitale A., Poerio A., et al. Philadelphia-positive acute
lymphoblastic leukemia patients already harbor BCR–ABL kinase domain mutations at
low levels at the time of diagnosis. // Haematologica. 2011. – V.96, № 4. – P.552–557.
236. Speck B., Bortin M.M., Champlin R., et al. Allogeneic bone-marrow
transplantation for chronic myelogenous leukaemia. // Lancet. 1984. - V.8378. - P.665–
668.
237. Spensberger D., Delwel R. A novel interaction between the protooncogene EVI1 and histone methyltransferases., SUV39H1 and G9a. // FEBS Lett.
2008. - V.582. - P.2761–2767.
238. Surface L.E., Thornton S.R., Boyer L.A. Polycomb group proteins set the
stage for early lineage commitment // Cell Stem Cell. 2010. - V. 7. - P.288–298.
239. Thomas E.D., Clift R.A., Fefer A. et al. Marrow transplantation for the
treatment of chronic myelogenous leukemia. // Ann Intern Med. 1986. - V.104, № 2. P.155–163.
140
240. Valk P.J., Verhaak R.G., Beijen M.A. et al. Prognostically useful geneexpression profiles in acute myeloid leukemia. // N Engl J Med. 2004. - V.350. P.1617–1628.
241. van Rhee F., Hochhaus A., Lin F., Melo J.V. et al. p190 BCR-ABL mRNA
is expressed at low levels in p210-positive chronic myeloid and acute lymphoblastic
leukemias. // Blood. 1996. - V.87, № 12. - P.5213–5237.
242. Vinatzer U., Taplick J., Seiser C.. et al. The leukaemia-associated
transcription factors EVI-1 and MDS1/ EVI1 repress transcription and interact with
histone deacetylase. // Br J Haematol. 2001. - V.114. - P.566–573.
243. Walter M J., Ding L., Shen D. et al. Recurrent DNMT3A mutations in
patients with myelodysplastic syndromes. // Leukemia. 2011. - V.96, № 4. – P.552–
557.
244. Walz C., Ahmed W., Lazarides K., et al. Essential role for Stat5a/b in
myeloproliferative neoplasms induced by BCR-ABL1 and Jak2V617F in mice. // Blood.
2012. - V.119. - P.3550–3560.
245. Watanabe-Okochi N., Kitaura J., Ono R. et al. AML1 mutations induced
MDS and MDS/AML in a mouse BMT model // Blood. 2008. - V.111. - P.4297–4308.
246. Wendel HG., de Stanchina E., Cepero E., et al. Loss of p53 impedes the
antileukemic response to BCR-ABL inhibition. // Proc Natl Acad Sci U S A. 2006. V.103. - P.7444–7449.
247. Willis S.G., Lange T., Demehri S et al. High-sensitivity detection of BCR–
ABL kinase domain mutations in imatinib-naive patients: correlation with clonal
cytogenetic evolution but not response to therapy. // Blood. 2005. – V. 106, № 6. – P.
2128–2137.
248. Wu J., Meng F., Kong L.Y., et al. Association between imatinib-resistant
BCR–ABL mutation-negative leukemia and persistent activation of LYN kinase. // J
Natl Cancer Inst. 2008. – V. 100, № 13. – P. 926–939.
249. Wu J., Meng F., Lu H., et al. Lyn regulates BCR-ABL and Gab2 tyrosine
phosphorylation and c-Cbl protein stability in imatinib-resistant chronic myelogenous
leukemia cells. // Blood. 2008. - V.111, № 7. - P.3821–3829.
141
250. Yatsula B., Lin S., Read A J. et al. Identification of binding sites of EVI1
in mammalian cells. // J Biol Chem. 2005. - V. 280. - P.30712–30722.
251. Yoshimi A., Goyama S., Watanabe-Okochi N. et al. EVI1 represses PTEN
expression and activates PI3K/AKT/mTOR via interactions with polycomb proteins. //
Blood. 2011. - V. 117. - P.3617–3628.
252. Yoshimi A., Kurokawa M. Key roles of histone methyltransferase and
demethylase in leukemogenesis // J Cell Biochem. 2011. - V. 112. - P.415-424.
253. Yuasa H., Oike Y., Iwama A. et al. Oncogenic transcription factor EVI1
regulates hematopoietic stem cell proliferation through GATA-2 expression. // EMBO
J. 2005. - V. 24. - P.1976–1987.
254. Zaucha J.M., Prejzner W., Giebel S. et al. Imatinib therapy prior to
myeloablative allogeneic stem cell transplantation. // Bone Marrow Transplant. 2005. V.36, № 5. - P.417–424.
255. Zhang B., Irvine D., Ho Y.W., et al. Inhibition of chronic myeloid
leukemia stem cells by the combination of the Hedgehog pathway inhibitor LDE225
with nilotinib. // Blood. 2010. - V.116. - P.514a.
256. Zhang X., Ren R. BCR-ABL efficiently induces a myeloproliferative
disease and production of excess interleukin-3 and granulocyte-macrophage colonystimulating factor in mice: a novel model for chronic myelogenous leukemia. // Blood.
1998. - V. 92. - P.3829–3840.
257. Zhou T., Parillon L., Li F. et al. Crystal structure of the T315I mutant of
Abl kinase // Chem. Biol. Drug Des. 2007. – V. 70, № 3. – P.171–181.
1/--страниц
Пожаловаться на содержимое документа