close

Вход

Забыли?

вход по аккаунту

...маркеров с продолжительностью использования молочных коров

код для вставкиСкачать
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 1
Учредитель и издатель:
Всероссийский научноисследовательский институт
генетики и разведения
сельскохозяйственных животных
Подписной индекс: 43354
Тираж: 1000 экз.
Адрес издателя, учредителя, редакции:
196601, г. Санкт-Петербург, Пушкин,
Московское шоссе, д. 55а
Tel.: (812) 451 76 63
Fax: (812) 465 99 89
e-mail: [email protected]
сайт: http://www.vniigen.ru/
Главный редактор:
Племяшов Кирилл Владимирович —
доктор ветеринарных наук
Заместители главного редактора:
Прохоренко Петр Никифорович —
доктор сельскохозяйственных наук,
академик РАН
Яковлев Александр Федорович —
доктор биологических наук, членкорреспондент РАН
Редакционная коллегия:
Волгин Василий Ильич —
доктор сельскохозяйственных наук
Гальперн Ирина Леоновна —
доктор сельскохозяйственных наук
Кузьмина Татьяна Ивановна —
доктор биологических наук
Паронян Иван Амаякович —
доктор биологических наук
Сакса Екатерина Ивановна —
кандидат сельскохозяйственных наук
Сердюк Григорий Николаевич —
доктор биологических наук
Смарагдов Михаил Григорьевич —
кандидат биологических наук
Станишевская Ольга Игоревна —
доктор биологических наук
Тулинова Ольга Васильевна —
кандидат сельскохозяйственных наук
Турлова Юлия Григорьевна —
кандидат биологических наук
Шапиев Исмаил Шапиевич —
доктор сельскохозяйственных наук
Редактор:
Ширяев Геннадий Владимирович —
кандидат сельскохозяйственных наук
Дизайн и верстка:
Панкевич Аркадий Владиславович
Периодичность — ежеквартальная.
Подписано в печать — 16.12.2014 г.
Печать офсетная. Цена подписная.
Отпечатано в: ООО «Рекламное бюро”АЗ”»
Перепечатка материалов, опубликованных
в журнале «Генетика и разведение животных»
возможна только с письменного разрешения
редакции и со ссылкой на журнал.
Авторы статей несут всю полноту ответственности
за содержание статей. За содержание
рекламных материалов ответственность
несет рекламодатель.
Содержание
Рубрика: Генетика и разведение животных
Ä. î. üÍӂ΂, ç. Ç. ÑÂÏÂÌڸ‚‡, Ç. è. íÂΈÍËÈ.
ë‚flÁ¸ ÏÓÎÂÍÛÎflÌÓ-„ÂÌÂÚ˘ÂÒÍËı χÍÂÓ‚
Ò ÔÓ‰ÓÎÊËÚÂθÌÓÒÚ¸˛ ËÒÔÓθÁÓ‚‡ÌËfl
ÏÓÎÓ˜Ì˚ı ÍÓÓ‚ ....................................................3
é. û. ŇÍÓ‚‡, ë. à. ãÓÒÍÛÚÓ‚, å. É. ëχ‡„‰Ó‚.
ÇÎËflÌË ÒÛ·˙‰ËÌˈ˚ CAP-G ÍÓÏÔÎÂÍÒ‡ ÍÓ̉ÂÌÒË̇ I
̇ ÔËÁ̇ÍË flȈ‡ ‰Óχ¯ÌÂÈ ÍÛˈ˚ ........................8
í. à. äÛÁ¸ÏË̇, à. è. òÂÈÍÓ, Ä. à. ɇ̉ʇ,
ä. è. Å˛ÒÓ‚. ê‡Á‚ËÚË ‰ÓËÏÔ·ÌÚ‡ˆËÓÌÌ˚ı
˝Ï·ËÓÌÓ‚ Bos taurus Ë Sus scrofa domesticus,
ÔÓÎÛ˜ÂÌÌ˚ı ËÁ ‰Â‚ËÚËÙˈËÓ‚‡ÌÌ˚ı ÓÓˆËÚÓ‚ ........15
ã. å. ïÏÂθÌ˘ËÈ, Ç. Ç. ǘfi͇.
éˆÂÌ͇ ÍÓÓ‚ ÛÍ‡ËÌÒÍÓÈ Í‡ÒÌÓ-ÔÂÒÚÓÈ ÏÓÎÓ˜ÌÓÈ
ÔÓÓ‰˚ ‚ ÒÓÓÚÌÓÒËÚÂθÌÓÈ ËÁÏÂ̘˂ÓÒÚË ÔÓÏÂÓ‚
Ë Ë̉ÂÍÒÓ‚ ÚÂÎÓÒÎÓÊÂÌËfl ......................................20
é. Ç. åËÚÓÙ‡ÌÓ‚‡, ç. Ç. ÑÂÏÂÌڸ‚‡, Ç. à. í˚˘ÂÌÍÓ,
é. è. û˜ÂÌÍÓ, Ä. Å. LJı‡Ï‚.
ë‚flÁ¸ „ÂÌÓÚËÔÓ‚ ÔÓ Ó‰ÌÓÌÛÍÎÂÓÚˉÌ˚Ï Á‡ÏÂÌ‡Ï ‚ „ÂÌÂ
ÏËÓÒÚ‡ÚË̇ Ò ÔÓ͇Á‡ÚÂÎflÏË ÊË‚ÓÈ Ï‡ÒÒ˚ Û ÍÛ èÛ¯ÍËÌÒÍÓÈ ÔÓÓ‰˚....................................................25
é. Ç. íÛÎËÌÓ‚‡, Ö. Ç. Ü˂ӄ·ÁÓ‚‡. èÓ‰ÛÍÚË‚ÌÓÒÚ¸
ÔÂ‚ÓÚÂÎÓÍ ÄÈ¯ËÒÍÓÈ ÔÓÓ‰˚ ‡ÁÌÓ„Ó ÔÓËÒıÓʉÂÌËfl Ë ÏÂÚÓ‰Ó‚ ‚˚‚‰ÂÌËfl Ëı ÓÚˆÓ‚..........................29
é. Ö. ŇÒÛÍÓ‚‡, Ö. É. ãÓ„ÛÌÓ‚‡.
ìÎÛ˜¯ÂÌË ‚ÓÒÔÓËÁ‚Ó‰ËÚÂθÌ˚ı ͇˜ÂÒÚ‚ ÍÓÓ‚ ......34
å. Ä. ãÂÓÌÓ‚‡, ã. Ç. ÉÂÚχ̈‚‡, Ä. Ç. ìÒ‡ÚÓ‚.
êÓθ „Â̇ ÔÓ·ÍÚË̇ Ë Â„Ó ˆÂÔÚÓ‡
‚ ÙÓÏËÓ‚‡ÌËË ÔËÁ̇ÍÓ‚ ÔÓ‰ÛÍÚË‚ÌÓÒÚË
ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı ............................37
ã. Ç. êÓχÌÂÌÍÓ, Ç. à. ÇÓ΄ËÌ, á. ã. î‰ÓÓ‚‡.
ì„΂ӉÌÓ ÔËÚ‡ÌË ÍÓÓ‚ Ò Û‰ÓÂÏ 9000 Í„ ÏÓÎÓ͇
Á‡ ·ÍÚ‡ˆË˛ Ë ‚˚¯Â ..............................................40
Å. à. èÓÚ‡ÒÓ‚, Ç. à. ÇÓ΄ËÌ, ä. Ç. èÎÂÏfl¯Ó‚,
à. å. äÓÏËÒÒ‡Ó‚. é· Ó‰ÌÓÏ ËÁ ÔËfiÏÓ‚
ÒÓ‚Â¯ÂÌÒÚ‚Ó‚‡ÌËfl ˝ÙÙÂÍÚË‚ÌÓÒÚË
ÍÓÏÎÂÌËfl Ê‚‡˜Ì˚ı ..............................................46
à. ò. ò‡ÔË‚, Ñ. Ä. ÅÛı‡ÌˆÂ‚‡, ã. É. åÓÓÁ.
ÇÎËflÌË ҂ÂıχÎ˚ı ÍÓ̈ÂÌÚ‡ˆËÈ 2-·ÂÌÁËÏˉ‡ÁÓÎ-1ËÎ-1-ÛÍÒÛÒÌÓÈ ÍËÒÎÓÚ˚ ̇ ÛÒÚÓȘ˂ÓÒÚ¸ ÒÔÂχÚÓÁÓˉӂ
ÔË ÓÒÏÓÚ˘ÂÒÍÓÏ Ë ıÓÎÓ‰Ó‚ÓÏ ¯ÓÍ ......................51
Рубрика: Краткие сообщения
ã. Ç. ÅÓ̉‡˜ÛÍ.
䇘ÂÒÚ‚Ó ÒÔÂÏÓÔÓ‰Û͈ËË ·˚ÍÓ‚-ÔÓËÁ‚Ó‰ËÚÂÎÂÈ
·Û˚ı ÔÓÓ‰ CÛÏÒÍÓÈ Ó·Î‡ÒÚË................................54
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 2
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
4/2014
Content
Genetics & breeding
Yakovlev A. F., Dementeva N. V., Terletsky V. P.
Relationship molecular genetic markers with longevity of dairy cows ..........................................3
Barkova O. I., Loscutov S. I., Smaragdov M. G.
Affection of cap-g subunit complex condensin i with eggs traits of domestic chicken ......................8
Kuzmina T. I., Sheiko I. P., Gandja A. I., Brussow K. P.
Development of pre-implantation embryos Bos taurus and Sus scrofa domesticus,
derived from devitrified oocytes ..........................................................................................15
Khmel'nichiy L. M., VechÓrka V. V.
An estimation of cows of the ukrainian red-and-white dairy breed is in correlative changeability of
body measurements and indexes of data frame ........................................................................20
Mitrofanova O. V., Dementeva N. V., Tyschenko V. I., Yurchenko O. P., Vachrameev A. B.
Relationship between genotypes with single nucleotide changes
in myostatin and weight in Pushkin breed chickens ................................................................25
Tulinova é. V., Zhivoglazova E. V.
Productivity daughters of bulls of different origin ..................................................................29
Barsukova O. E., Logunova E. G.
Improving dairy cow fertility ..............................................................................................34
Leonova M. A., Getmantseva L. V., Usatov A. V.
Role of the gene of prolactin and its receptor in the formation of productivity traits farm animals ..........37
Romanenko L. V., Volgin V. I., Fedorova Z. L.
Carbohydrate nutrition of cows with milk production in 9000 kg and higher per lactation ............40
ProtasovB. I., VolginV. I., Plemyashov K. V., Komissarov I. M.
About one of method of animals improvement of feeding ..........................................................46
Shapiev I. Sh., Buhantseva D. A., Moroz L. G.
Influence of ultra low 2-benzimidazol-1-yl-1-acetic acid concentrations on spermatozoa
survival ability in osmotic and cold shock..............................................................................51
Brief communications
Bondarchuk L. V.
Quality semen sires brown breeds from sumy region ................................................................54
2
Л. В. Козикова
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 3
Генетика и разведение животных
Рубрика
УДК 636.08/088
А. Ф. Яковлев, Н. В. Дементьева, В. П. Терлецкий
Связь молекулярно-генетических маркеров
с продолжительностью использования молочных коров
Обзор
Аннотация. Имеется ряд достоверных данных о влиянии на продолжительность продуктивного использования молочных коров локусов количественных признаков с использованием анализа сцепления, а также
SNP гаплотипов. Наиболее достоверные данные по выбраковке коров получены на основании исследования полиморфизма гена лептина. Следует отметить, что лептин — пептидный гормон, регулирующий энергетический обмен и развитие репродуктивной системы. Несколько полиморфных типов лептина (LEP-2470,
LEP-1238, ЛЭП-963, Y7F и R25C), оказались связанными с энергетическими процессами лактогенеза, а SNP Y7F
связан с накоплением энергии. Обнаружены ассоциации между полиморфными типами лептина с признаками трудности отела, продолжительностью стельности и перинатальной смертности. Имеются данные
о связи между LEP-полиморфизмом и его белкового продукта с долголетием у мышей и людей. LEP-полиморфизмы можно рассматривать в качестве маркеров, которые могут использоваться в селекции на
долголетие. Громадную роль в формировании здоровья и продолжительности продуктивной жизни играют
гены, связанные с иммунологическими процессами в организме коров. Восприимчивость к маститу является сложным полилокусным признаком и неудивительно, локусы количественных признаков для мастита
были выявлены почти на всех хромосомах крупного рогатого скота. Недавние исследования, проведенные
на основе геномной оценки, позволили обнаружить регионы генома и гены, связанные с продолжительностью продуктивной жизни коров, в том числе гены SYT10, ADAMTS3, NTRK2 и SNTG1. Таким образом,
проблема продолжительности продуктивной жизни коров является крайне многогранной задачей как для
установления четких параметров распознавания причин, так и для разработки мероприятий при продлении сроков жизни.
Ключевые слова: молочные коровы, продолжительность жизни, геном, гены, лептин, мастит, иммунология, полигенный эффект, маркеры.
Сведения об авторах:
Яковлев Александр Федорович — д.б.н., проф., член-корреспондент РАН, зав. отделом генетики и биотехнологии ВНИИРГЖ, Санкт-Петербург, тел.: (812) 465-80-12, e-mail: [email protected];
Дементьева Наталия Викторовна — к.б.н., ведущий научный сотрудник лаборатории молекулярной цитогенетики, ВНИИГРЖ, Санкт-Петербург, тел.: (812) 465-80-12, e-mail: [email protected];
Терлецкий Валерий Павлович — д.б.н., профессор, ведущий научный сотрудник лаборатории молекулярной цитогенетики, ВНИИГРЖ, Санкт-Петербург, тел.: (812) 465-80-12, e-mail:[email protected]
èÓ‰ÓÎÊËÚÂθÌÓÒÚ¸ ËÒÔÓθÁÓ‚‡ÌËfl ÏÓÎÓ˜Ì˚ı
ÍÓÓ‚ fl‚ÎflÂÚÒfl ‚‡ÊÌÓÈ ÔÓ·ÎÂÏÓÈ ‚ ÊË‚ÓÚÌÓ‚Ó‰ÒÚ‚Â. àÒÔÓθÁÓ‚‡ÌË ÏÓÎÂÍÛÎflÌ˚ı χÍÂÓ‚ ‚ ÒÂÎÂ͈ËË ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı ÂÒÚÂÒÚ‚ÂÌÌÓ ÒÚ‡‚ËÚ ‚ÓÔÓÒ Ó ‚ÎËflÌËË ÓÔ‰ÂÎÂÌÌ˚ı „ÂÌÓ‚
Ë ˝ÎÂÏÂÌÚÓ‚ „ÂÌÓχ ̇ ÔÓ‰ÓÎÊËÚÂθÌÓÒÚ¸ ÔÓ‰ÛÍÚË‚ÌÓÈ ÊËÁÌË ÍÓÓ‚ Ë ‚ÓÁÏÓÊÌÓÒÚ¸ ÏÓ‰ÂÎËÓ‚‡ÌËfl ÒÂÎÂ͈ËÓÌÌ˚ı ÔÓ‰ıÓ‰Ó‚ Í ÔÓ‚˚¯ÂÌ˲ ˝ÚÓ„Ó
ÔÓ͇Á‡ÚÂÎfl. ë Ó‰ÌÓÈ ÒÚÓÓÌ˚ ÏÓÎÓ˜Ì˚È ÒÍÓÚ fl‚ÎflÂÚÒfl Û‰Ó·Ì˚Ï Ó·˙ÂÍÚÓÏ ‰Îfl ÔÓ‰Ó·ÌÓ„Ó ËÁÛ˜ÂÌËfl,
Ú‡Í Í‡Í ‚ ‡ÒÔÓflÊÂÌËË ËÒÒΉӂ‡ÚÂÎfl ËϲÚÒfl
Ó‰ÓÒÎÓ‚Ì˚ ‰‡ÌÌ˚Â. é‰Ì‡ÍÓ ‚˚ÊË‚‡ÂÏÓÒÚ¸ ÊË-
‚ÓÚÌÓ„Ó Á‡‚ËÒËÚ Ì ÚÓθÍÓ ÓÚ ÒÓÒÚÓflÌËfl Ô‰ÍÓ‚,
ÌÓ ‚Ó ÏÌÓ„ÓÏ ÓÚ ÛÒÎÓ‚ËÈ ÍÓÏÎÂÌËfl Ë ÒÓ‰ÂʇÌËfl
‰‡ÌÌÓÈ ÍÓÓ‚˚. èÓ˝ÚÓÏÛ ‚ ÏÓÎÓ˜ÌÓÏ ÒÍÓÚÓ‚Ó‰ÒÚ‚Â
ÏÓÊÌÓ ‡Á΢‡Ú¸ ËÒÚËÌÌÓ ‰Ó΄ÓÎÂÚËÂ, Ú.Â. ÍÓ„‰‡
Ù‡ÍÚ˘ÂÒ͇fl ‚ÂÓflÚÌÓÒÚ¸ ‚˚ÊË‚‡ÌËfl ÊË‚ÓÚÌÓ„Ó
Ò˜ËÚ‡ÂÚÒfl Ë ÙÛÌ͈ËÓ̇θÌÓÈ ‰Ó΄ӂ˜ÌÓÒÚ¸˛ Ë „‰Â
‰ÓÔÓÎÌËÚÂθÌ˚ ˝ÙÙÂÍÚ˚, ‚˚‡Ê‡˛˘Ë ËÒÍ ‚˚·‡ÍÓ‚ÍË ÍÓÓ‚˚, ÌÂÁ‡‚ËÒËÏÓ ÓÚ Â ÛÓ‚Ìfl ÔÓ‰ÛÍÚË‚ÌÓÒÚË Ë ÛÔ‡‚ÎÂÌËfl ÒÚÛÍÚÛÓÈ ÒÚ‡‰‡, ‚Íβ˜ÂÌ˚ ‚ ÏÓ‰ÂÎËÓ‚‡ÌË ‚ÂÓflÚÌÓÒÚË ‚˚ÊË‚‡ÌËfl [1].
îÛÌ͈ËÓ̇θ̇fl ‰Ó΄ӂ˜ÌÓÒÚ¸ ÒÚÂÏËÚÂθÌÓ ÔËÓ·ÂÚ‡ÂÚ ‚Ò ·Óθ¯Â Á̇˜ÂÌË ‚ ͇˜ÂÒÚ‚Â ÍËÚÂËfl
Связь молекулярно-генетических маркеров с продолжительностью использования молочных коров
3
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 4
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
ÓÚ·Ó‡ ‚ ÏÓÎÓ˜ÌÓÏ ÊË‚ÓÚÌÓ‚Ó‰ÒÚ‚Â. åÌÓ„Ë ËÒÒΉӂ‡ÚÂÎË Ò‰Â·ÎË ‡Ì‡ÎËÁ ‡Á΢Ì˚ı ͇Ú„ÓËÈ,
Ú‡ÍËı ͇Í: Í‡Í ÔËÁ̇ÍË ‚ÓÒÔÓËÁ‚Ó‰ÒÚ‚‡ [2], ÒÓÒÚÓflÌË ‚˚ÏÂÌË [3], ÛÓ‚Â̸ ËÌ·ˉËÌ„‡ [4] Ë ‰.
Ä̇ÎËÁ 124793 ·ÍÚ‡ˆËÈ (75137 ÍÓÓ‚ Ë 1586 ·˚ÍÓ‚)
ÔÓ͇Á‡Î [5], ˜ÚÓ Ó·˘‡fl ˜‡ÒÚÓÚ‡ χÒÚËÚÓ‚ Ë Á‡·Ó΂‡ÌËÈ ÍÓ̘ÌÓÒÚÂÈ (ıÓÏÓÚ‡) ÒÓÒÚ‡‚ËÎË ÒÓÓÚ‚ÂÚÒÚ‚ÂÌÌÓ 17% Ë 16% Ò ÍÓ˝ÙÙˈËÂÌÚÓÏ Ì‡ÒΉÛÂÏÓÒÚË ÒÓÓÚ‚ÂÚÒÚ‚ÂÌÌÓ 0,04 Ë 0,02. ÉÂÌÂÚ˘ÂÒÍËÂ
ÍÓÂÎflˆËË ÏÂÊ‰Û Ï‡ÒÚËÚÓÏ Ë Û‰ÓÂÏ Ë ÔËÁ̇ÍÓ‚
‚ÓÒÔÓËÁ‚Ó‰ÒÚ‚‡ ̇ıÓ‰ËÎËÒ¸ ‚ ‰Ë‡Ô‡ÁÓÌ ÓÚ 0,27
‰Ó 0,33. ÉÂÌÂÚ˘ÂÒÍË ÍÓÂÎflˆËË ÏÂÊ‰Û Ï‡ÒÚËÚÓÏ
Ë ıÓÏÓÚÓÈ Ò ÏÂÊÓÚÂθÌ˚Ï ËÌÚÂ‚‡ÎÓÏ ÒÓÒÚ‡‚ÎflÎË 0,38 Ë -0,59 ÒÓÓÚ‚ÂÚÒÚ‚ÂÌÌÓ. ïÓÏÓÚ‡ ÒÛ˘ÂÒÚ‚ÂÌÌÓ ÍÓÂÎËÓ‚‡Î‡ Ò Û‰ÓÂÏ (0,38), ‚‡ÎÓ‚˚Ï
·ÂÎÍÓÏ ‚ ÏÓÎÓÍ (0,28), ÏÂÊÓÚÂθÌ˚Ï ËÌÚÂ‚‡ÎÓÏ
(0,35), ˜ËÒÎÓÏ ÓÒÂÏÂÌÂÌËÈ (0,38) Ë ÔÓ‰ÓÎÊËÚÂθÌÓÒÚ¸˛ ÊËÁÌË (-0,53). éˆÂÌÍË Ì‡ÒΉÛÂÏÓÒÚË Ï‡ÒÚËÚ‡ Ë ıÓÏÓÚ˚ ·˚· ÌËÁÍÓÈ, ÔÓ˝ÚÓÏÛ „ÂÌÂÚ˘ÂÒÍËÈ
ÔÓ„ÂÒÒ ÔË ÓÚ·Ó ·Û‰ÂÚ Ú‡ÍÊ ÌËÁÍËÏ. ëÂÎÂ͈Ëfl ÔÓÚË‚ χÒÚËÚ‡ Ë ıÓÏÓÚ˚ ‚ ͇˜ÂÒÚ‚Â ‰ÓÔÓÎÌËÚÂθÌ˚ı ÔËÁ̇ÍÓ‚ ‰ÓÎÊ̇ ÒÌËÁËÚ¸ Á‡·Ó΂‡ÂÏÓÒÚ¸ Ë Ó‰ÌÓ‚ÂÏÂÌÌÓ ÛÎÛ˜¯ËÚ¸ ‚ÓÒÔÓËÁ‚Ó‰ÒÚ‚Ó
Ë ‰Ó΄ÓÎÂÚËÂ. íÂÏ Ì ÏÂÌÂÂ, Ó·‡ ÔËÁ͇̇ Á‰ÓÓ‚¸fl
ËÏÂ˛Ú ‡ÌÚ‡„ÓÌËÒÚ˘ÂÒÍË ÓÚÌÓ¯ÂÌËfl Ò ÔËÁ͇̇ÏË ÔÓ‰ÛÍÚË‚ÌÓÒÚË Ë ·Û‰ÛÚ ÒÌËʇڸ „ÂÌÂÚ˘ÂÒÍËÈ
ÔÓ„ÂÒÒ. ÉÂÌÂÚ˘ÂÒ͇fl ÒÓÒÚ‡‚Îfl˛˘‡fl, ‚Íβ˜‡fl
Ò‚flÁ¸ ÔËÁ͇̇ ‰Ó΄ÓÎÂÚËfl Ë ÔÓÎËÏÓÙËÁχ Ñçä
Ë „ÂÌÓ‚, ÔËÓ·ÂÚ‡ÂÚ ÔÂ‚ÓÒÚÂÔÂÌÌÓ Á̇˜ÂÌËÂ.
ç‡Ë·ÓΠ‡ÒÔÓÒÚ‡ÌÂÌÌ˚Ï ÔÓ‰ıÓ‰ÓÏ fl‚ÎflÂÚÒfl
ÏÓ‰ÂÎËÓ‚‡ÌË ̇ÍÓÔÎÂÌÌ˚ı ‰‡ÌÌ˚ı Ó ÔÓÎË„ÂÌÌÓÏ ˝ÙÙÂÍÚ [6]. è‰ÒÚ‡‚ÎflÂÚ ËÌÚÂÂÒ ËÒÒΉӂ‡ÌË ÍÓÌÍÂÚÌ˚ı „ÂÌÓ‚-͇̉ˉ‡ÚÓ‚ ‰Îfl ÓÚ‚ÂÚ‡
̇ ‚ÓÔÓÒ: ÏÓ„ÛÚ ÎË ÓÚ‰ÂθÌ˚ „ÂÌ˚ ‚ÌÓÒËÚ¸ Á‡ÏÂÚÌ˚È ‚Í·‰ ‚ ÙËÁËÓÎӄ˘ÂÒÍÓ ÙÓÏËÓ‚‡ÌËÂ
ÔÓËÁ‚Ó‰ÒÚ‚‡ ÏÓÎÓ͇ Ë ÔÓ‰ÓÎÊËÚÂθÌÓÒÚË ÊËÁÌË. ç‡Ë·ÓΠ‰ÓÒÚÓ‚ÂÌ˚ ‰‡ÌÌ˚ ÔÓ ‚˚·‡ÍÓ‚Í ÍÓÓ‚ ÔÓÎÛ˜ÂÌ˚ ̇ ÓÒÌÓ‚‡ÌËË ËÒÒΉӂ‡ÌËfl
ÔÓÎËÏÓÙËÁχ „Â̇ ÎÂÔÚË̇.
àÏÂÂÚÒfl fl‰ ÔÓ‰Ú‚ÂʉÂÌËÈ ‚ÎËflÌËfl ÔÓÎËÏÓÙÌ˚ı ‚‡ˇÌÚÓ‚ „Â̇ ÎÂÔÚË̇ ̇ ÙÛÌ͈ËÓ̇θÌÛ˛
ÔÓ‰ÓÎÊËÚÂθÌÓÒÚ¸ ÊËÁÌË ÍÓÓ‚ [7]. í‡Í ÔÓÎËÏÓÙÌ˚È ‚‡ˇÌÚ LEP-R25C ËÏÂÂÚ ÓÚÌÓÒËÚÂθÌ˚È
ËÒÍ ‚˚·‡ÍÓ‚ÍË ÍÓÓ‚ Ò „ÂÌÓÚËÔÓÏ CC ‚ 3,14
‡Á‡ ‚˚¯Â, ˜ÂÏ ‰Îfl „ÂÚÂÓÁË„ÓÚÌ˚ı ÊË‚ÓÚÌ˚ı.
èÓÏËÏÓ LEP-R25C, Ú‡ÍÊ FF „ÓÏÓÁË„ÓÚ˚ ‚ Á‡ÏÂÌ LTP-Y7F Ëϲ ËÒÍ ‚ 3,64 ‡Á‡ ·ÓΠ‚˚ÒÓÍËÈ,
˜ÂÏ YY „ÓÏÓÁË„ÓÚ˚, ‡ ÇÇ „ÓÏÓÁË„ÓÚ˚ LEP-A80V
‚ 1,83 ‡Á‡ ·ÓΠ‚˚ÒÓÍËÈ ËÒÍ ‚˚·‡ÍÓ‚ÍË, ˜ÂÏ
ÄÄ „ÓÏÓÁË„ÓÚ. ê‡Á΢Ëfl ‚ ËÒ͇ı ÏÂÊ‰Û „ÂÌÓÚËÔ‡ÏË ÔÓÎËÏÓÙËÁχ ‚ Ô‰Â·ı ‰Û„Ëı „ÂÌÓ‚ (butyrophilin ÔÓ‰ÒÂÏÂÈÒÚ‚‡ 1 „Â̇ A1, BTN1A1; ‡ˆËÎäÓÄ ‰Ë‡ˆË΄ÎˈÂËÌ ‡ˆËÎÚ‡ÌÒÙÂ‡Á‡ 1 „ÂÌ,
DGAT1; „Â̇ ˆÂÔÚÓ‡ ÎÂÔÚË̇, LTPR; ÄíîÒ‚flÁ˚‚‡˛˘Â„Ó Í‡ÒÒÂÚÌÓ„Ó ÔÓ‰ÒÂÏÂÈÒÚ‚Ó G ˝ÎÂÏÂÌÚ
2, ABCG2) ̇ÏÌÓ„Ó ÏÂ̸¯Â. í‡ÍËÏ Ó·‡ÁÓÏ, Ô‰-
4
4/2014
ÒÚ‡‚ÎÂÌÌ˚ ÂÁÛθڇÚ˚ ÔÓ͇Á˚‚‡˛Ú Ò‚flÁ¸ ÏÂʉÛ
LEP-ÔÓÎËÏÓÙËÁÏÓÏ Ë ‰Ó΄ÓÎÂÚËÂÏ ÍÓÓ‚, ۷‰ËÚÂθÌÓ ÔÓ‰Ú‚ÂʉÂÌÌ˚ ÂÁÛθڇڇÏË ‰Û„Ëı
ËÒÒΉӂ‡ÌËÈ. ì˜ËÚ˚‚‡fl ‡ÒÚÛ˘Â Á̇˜ÂÌË ÙÛÌ͈ËÓ̇θÌ˚ı ÔËÁ̇ÍÓ‚ ÏÓÎÓ˜ÌÓ„Ó ÒÍÓÚ‡, LEPÔÓÎËÏÓÙËÁÏ˚ ÒΉÛÂÚ ‡ÒÒχÚË‚‡Ú¸ ‚ ͇˜ÂÒÚ‚Â
χÍÂÓ‚ ÙÛÌ͈ËÓ̇θÌÓ„Ó ‰Ó΄ÓÎÂÚËfl. ëΉÛÂÚ
ÓÚÏÂÚËÚ¸, ˜ÚÓ ÎÂÔÚËÌ — ÔÂÔÚˉÌ˚È „ÓÏÓÌ, „ÛÎËÛ˛˘ËÈ ˝ÌÂ„ÂÚ˘ÂÒÍËÈ Ó·ÏÂÌ Ë ‡Á‚ËÚË ÂÔÓ‰ÛÍÚË‚ÌÓÈ ÒËÒÚÂÏ˚. çÂÒÍÓθÍÓ ÔÓÎËÏÓÙÌ˚ı
ÚËÔÓ‚ ÎÂÔÚË̇ (LEP-2470, LEP-1238, ãùè-963,
Y7F Ë R25C), Ó͇Á‡ÎËÒ¸ Ò‚flÁ‡ÌÌ˚ÏË Ò ˝ÌÂ„ÂÚ˘ÂÒÍËÏË ÔÓˆÂÒÒ‡ÏË Î‡ÍÚÓ„ÂÌÂÁ‡, ‡ SNP Y7F
Ò‚flÁ‡Ì Ò Ì‡ÍÓÔÎÂÌËÂÏ ˝ÌÂ„ËË. é·Ì‡ÛÊÂÌ˚ ‡ÒÒӈˇˆËË ÏÂÊ‰Û ÔÓÎËÏÓÙÌ˚ÏË ÚËÔ‡ÏË ÎÂÔÚË̇
Ò ÔËÁ͇̇ÏË ÚÛ‰ÌÓÒÚË ÓÚ·, ÔÓ‰ÓÎÊËÚÂθÌÓÒÚ¸˛ ÒÚÂθÌÓÒÚË Ë ÔÂË̇ڇθÌÓÈ ÒÏÂÚÌÓÒÚË [8].
Ç ‰Û„ÓÈ ‡·ÓÚ [9] ÔÓ͇Á‡ÌÓ, ˜ÚÓ SNP (A1457G
Ë A59V) ÎÂÔÚË̇ ·˚ÎË Ò‚flÁ‡Ì˚ Ò ÓÒÚÓÏ ÒÍÂÎÂÚ‡,
ÔÓ͇Á‡ÚÂÎflÏË ‚ÓÒÔÓËÁ‚Ó‰ÒÚ‚‡ (UASMS1, UASMS2,
A1457G, A59V) Ë ÏÓÎÓ˜ÌÓÈ ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸˛
(A59V). äÓ̈ÂÌÚ‡ˆËË ÎÂÔÚË̇ ‚ Ô‰Ó‰Ó‚ÓÏ
ÔÂËӉ ÍÓÓ‚˚ ÔÓ‰‚Â„‡˛ÚÒfl Á̇˜ËÚÂθÌ˚Ï ËÁÏÂÌÂÌËflÏ: ÓÌË ·˚ÎË ‚˚ÒÓÍËÏË Ì‡ ÔÓÁ‰ÌËı ÒÓ͇ı ·ÂÂÏÂÌÌÓÒÚË. ÉÂÌÂÚ˘ÂÒÍËÈ ‡Ì‡ÎËÁ ÔÓ͇Á‡Î,
˜ÚÓ ÒÓ˜ÂÚ‡ÌË ÚÂı ÔÓÎËÏÓÙËÁÏÓ‚, ‡ÒÔÓÎÓÊÂÌÌ˚ı ‚ ӷ·ÒÚË 135 Ô.Ì. ÔÓÏÓÚÓ‡ Ò‚flÁ‡Ì Ò ÍÓ̈ÂÌÚ‡ˆËÂÈ ÎÂÔÚË̇. èÓÎËÏÓÙËÁÏ Ñçä ËÌÚÓ̇
2 „Â̇ ÎÂÔÚË̇ Ó͇Á‡ÎÒfl Ò‚flÁ‡ÌÌ˚Ï Ò ‚‡ˇˆËÂÈ
̇‰Ófl. ç‡ ÔÓÏÓÚÓÌÓÈ Ó·Î‡ÒÚË „Â̇ ÎÂÔÚË̇ ӷ̇ÛÊÂÌ SNP, Ò‚flÁ‡ÌÌ˚È Ò ÔÂ‚ÓÈ ÔÓÒÎÂÓ‰Ó‚ÓÈ
βÚÂËÌÓ‚ÓÈ ‡ÍÚË‚ÌÓÒÚ¸˛. ÑÛ„ÓÈ SNP ÔÓÏÓÚÓ‡ ÎÂÔÚË̇ ·˚Î Ò‚flÁ‡Ì Ò ˝ÌÂ„ÂÚ˘ÂÒÍËÏ ·‡Î‡ÌÒÓÏ
Ë ÔÓÚ·ÎÂÌËfl ÒÛıÓ„Ó ‚¢ÂÒÚ‚‡ [10]. àϲÚÒfl ‰‡ÌÌ˚Â Ó Ò‚flÁË ÏÂÊ‰Û LEP-ÔÓÎËÏÓÙËÁÏÓÏ Ë Â„Ó
·ÂÎÍÓ‚Ó„Ó ÔÓ‰ÛÍÚ‡ Ò ‰Ó΄ÓÎÂÚËÂÏ Û Ï˚¯ÂÈ [11]
Ë Î˛‰ÂÈ [12]. ÇÒ ˝ÚÓ Ò‚Ë‰ÂÚÂθÒÚ‚ÛÂÚ Ó ÚÓÏ, ˜ÚÓ
LEP-ÔÓÎËÏÓÙËÁÏ˚ ÏÓÊÌÓ ‡ÒÒχÚË‚‡Ú¸ ‚ ͇˜ÂÒڂ χÍÂÓ‚, ÍÓÚÓ˚ ÏÓ„ÛÚ ËÒÔÓθÁÓ‚‡Ú¸Òfl
‚ ÒÂÎÂ͈ËË Ì‡ ‰Ó΄ÓÎÂÚËÂ.
片‚ÌË ËÒÒΉӂ‡ÌËfl, Ôӂ‰ÂÌÌ˚ ̇ ÓÒÌÓ‚Â „ÂÌÓÏÌÓÈ ÓˆÂÌÍË, ÔÓÁ‚ÓÎËÎË Ó·Ì‡ÛÊËÚ¸
„ËÓÌ˚ „ÂÌÓχ Ë „ÂÌ˚, Ò‚flÁ‡ÌÌ˚Â Ò ÔÓ‰ÓÎÊËÚÂθÌÓÒÚ¸˛ ÔÓ‰ÛÍÚË‚ÌÓÈ ÊËÁÌË ÍÓÓ‚ [13]. ç‡Ë·ÓΠÁ‡ÏÂÚÌ˚ „ÂÌ˚: SYT10 (synaptotagmin X,
‚ÎËflÂÚ Ì‡ Û˜‡ÒÚË ë‡2+ ‚ ˝ÍÁÓˆËÚÓÁ ÒÂÍÂÚÓÌ˚ı
‚ÂÁËÍÛÎ) ̇ıÓ‰ËÚÒfl ̇ ıÓÏÓÒÓÏ 5, ADAMTS3
(‰ÂÁËÌÚ„ËÌ ÒÓ Ò‚ÓÈÒÚ‚‡ÏË ÚÓÏ·ÓÒÔÓ̉Ë̇) —
̇ ıÓÏÓÒÓÏ 6, NTRK2 (ˆÂÔÚÓ ÌÂÈÓÚÓÙ˘ÂÒÍÓÈ ÚËÓÁËÌÍË̇Á˚) — ̇ ıÓÏÓÒÓÏ 8 Ë SNTG1
(Syntrophin — „‡Ïχ 1, ·ÂÎÓÍ ‡‰‡ÔÚÂ, Û˜‡ÒÚ‚Û˛˘ËÈ ‚ Ó„‡ÌËÁ‡ˆËË ÒÛ·ÍÎÂÚÓ˜ÌÓÈ ÎÓ͇ÎËÁ‡ˆËË
·ÂÎÍÓ‚) — ̇ ıÓÏÓÒÓÏ 14 „ÂÌÓχ ÍÛÔÌÓ„Ó Ó„‡ÚÓ„Ó ÒÍÓÚ‡. çÂÒÍÓθÍÓ Ò˄̇ÎÓ‚, ‚ ÚÓÏ ˜ËÒÎÂ
Ò‡ÏÓ„Ó ‚˚ÒÓÍÓ„Ó ÛÓ‚Ìfl, ̇ȉÂÌÌ˚ ̇ ıÓÏÓÒÓÏ 14, ·˚ÎË ‡ÒÔÓÎÓÊÂÌ˚ ‚ „ËÓ̇ı Ò ÌÂÍÓÚÓА. Ф. Яковлев и др. ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 5
Рубрика: Генетика и разведение животных
˚ÏË ‰Û„ËÏË „Â̇ÏË, ˜ÚÓ ÔÓÁ‚ÓÎflÂÚ Ô‰ÔÓ·„‡Ú¸ ̇΢ˠËÌ˚ı „ÂÌÓ‚, ‚ÎËfl˛˘Ëı ̇ ÔÓ‰ÓÎÊËÚÂθÌÓÒÚ¸ ÔÓ‰ÛÍÚË‚ÌÓÈ ÊËÁÌË ÒÍÓÚ‡.
ÉÓχ‰ÌÛ˛ Óθ ‚ ÙÓÏËÓ‚‡ÌËË Á‰ÓÓ‚¸fl
Ë ÔÓ‰ÓÎÊËÚÂθÌÓÒÚË ÔÓ‰ÛÍÚË‚ÌÓÈ ÊËÁÌË Ë„‡˛Ú
„ÂÌ˚, Ò‚flÁ‡ÌÌ˚Â Ò ËÏÏÛÌÓÎӄ˘ÂÒÍËÏË ÔÓˆÂÒÒ‡ÏË
‚ Ó„‡ÌËÁÏ ÍÓÓ‚. äÓ΢ÂÒÚ‚ÂÌ̇fl ÓˆÂÌ͇ ÔÓ͇Á‡Î‡ ‡ÒÒӈˇˆËË ÏÂÊ‰Û ‰‚ÛÏfl ÔÓÎËÏÓÙËÁχÏË
ÚÓÎÎ-ÔÓ‰Ó·Ì˚ı ˆÂÔÚÓÓ‚ 2 (TLR2) Ë ˆÂÔÚÓ‡
ıÂÏÓÍËÌÓ‚ 1 (CXCR1) Ò ÔËÁ͇̇ÏË Á‰ÓÓ‚¸fl ÏÓÎÓ˜Ì˚ı ÍÓÓ‚(21). TLR4-2021 Ò‚flÁ‡Ì (P <0,05)
Ò Ó·˘ËÏ ‚˚ıÓ‰ÓÏ ÏÓÎÓ˜ÌÓ„Ó ·ÂÎ͇ Ë ÔÓˆÂÌÚÓÏ
ÊË‡ ‚ ÍÓ̈ ·ÍÚ‡ˆËË (P <0,01). íÓÎÎ-ÔÓ‰Ó·Ì˚Â
ˆÂÔÚÓ˚ — ˝ÚÓ Í·ÒÒ ÍÎÂÚÓ˜Ì˚ı ˆÂÔÚÓÓ‚
Ò Ó‰ÌËÏ Ú‡ÌÒÏÂÏ·‡ÌÌ˚Ï Ù‡„ÏÂÌÚÓÏ, ÍÓÚÓ˚Â
‡ÒÔÓÁ̇˛Ú ÍÓÌÒÂ‚‡ÚË‚Ì˚ ÒÚÛÍÚÛ˚ ÏËÍÓÓ„‡ÌËÁÏÓ‚ Ë ‡ÍÚË‚ËÛ˛Ú ÍÎÂÚÓ˜Ì˚È ËÏÏÛÌÌ˚È ÓÚ‚ÂÚ Ë Ë„‡˛Ú Íβ˜Â‚Û˛ Óθ ‚Ó ‚ÓʉfiÌÌÓÏ ËÏÏÛÌËÚÂÚÂ. àÁ ¯ÂÒÚ̇‰ˆ‡ÚË ÔÓÎËÏÓÙËÁÏÓ‚ ÒÂϸ
ËÏÏÛÌÌ˚ı „ÂÌÓ‚ ‡ÒÒÓˆËËÛÂÚÒfl Ò ˜ËÒÎÓÏ ÒÓχÚ˘ÂÒÍËı ÍÎÂÚÓÍ ‚ ÏÓÎÓÍ [14].
ÇÓÒÔËËϘ˂ÓÒÚ¸ Í Ï‡ÒÚËÚÛ fl‚ÎflÂÚÒfl ÒÎÓÊÌ˚Ï ÔÓÎËÎÓÍÛÒÌ˚Ï ÔËÁ̇ÍÓÏ Ë ÌÂۉ˂ËÚÂθÌÓ,
˜ÚÓ ÎÓÍÛÒ˚ ÍÓ΢ÂÒÚ‚ÂÌÌ˚ı ÔËÁ̇ÍÓ‚ ‰Îfl ÏÓÎÓ˜ÌÓÈ ÔÓ‰ÛÍÚË‚ÌÓÒÚË Ë Ï‡ÒÚËÚ‡ ·˚ÎË ‚˚fl‚ÎÂÌ˚ ÔÓ˜ÚË Ì‡ ‚ÒÂı ıÓÏÓÒÓχı ÍÛÔÌÓ„Ó Ó„‡ÚÓ„Ó
ÒÍÓÚ‡. ëÓÓÍ ˜ÂÚ˚ „Â̇ ·˚ÎË Ô‰ÎÓÊÂÌ˚ ‚ ͇˜ÂÒڂ ̇˷ÓΠÔÂÒÔÂÍÚË‚Ì˚ı ͇̉ˉ‡ÚÓ‚ ‰Îfl
‰‡Î¸ÌÂÈ¯Â„Ó ËÒÒΉӂ‡ÌËfl ÛÓ‚ÌÂÈ ˝ÍÒÔÂÒÒËË,
„ÂÌÂÚ˘ÂÒÍÓÈ ËÁÏÂ̘˂ÓÒÚË Ë ·ËÓÎӄ˘ÂÒÍË ÙÛÌ͈ËË ‚ ÙÓÏËÓ‚‡ÌËË ıÓÁflÈÒÚ‚ÂÌÌ˚ı ÔËÁ̇ÍÓ‚
[15]. Ç ÔÓˆÂÒÒ „ÂÌÓÏÌÓÈ ÓˆÂÌÍË ‚‡ÊÌÓ ˝ÙÙÂÍÚË‚ÌÓ Ë‰ÂÌÚËÙˈËÓ‚‡Ú¸ ‚ ͇˜ÂÒڂ χÍÂÓ‚ ÌÂ
ÚÓθÍÓ „ÂÌ˚-͇̉ˉ‡Ú˚, ÌÓ Ë Ô˘ËÌÌÛ˛ ÏÛÚ‡ˆË˛. ì˜ËÚ˚‚‡fl, ˜ÚÓ Á‡·Ó΂‡ÌË χÒÚËÚÓÏ Ò‚flÁ‡ÌÓ ÒÓ ÏÌÓÊÂÒÚ‚ÓÏ ‡Á΢Ì˚ı „ÂÌÓ‚ Ë ÍÎÂÚÓ˜Ì˚ı
ÔÛÚÂÈ, „ÂÌ˚, ÍÓ‰ËÛ˛˘Ë ËÏÏÛÌÌ˚ هÍÚÓ˚,
ÍÓÚÓ˚ ӷ̇ÛÊË‚‡˛Ú Ë ÛÒÚ‡Ìfl˛Ú ·ÓÎÂÁÌÂÚ‚ÓÌ˚ ÏËÍÓÓ„‡ÌËÁÏ˚, fl‚Îfl˛ÚÒfl ‚‡ÊÌ˚ÏË ÔÓÚÂ̈ˇθÌ˚ÏË Ï‡ÍÂ‡ÏË. ä‡Í ÛÊ ÓÚϘ‡ÎÓÒ¸, TollÔÓ‰Ó·Ì˚È ˆÂÔÚÓ 4 (TLR4) fl‚ÎflÂÚÒfl ‚ÓʉÂÌÌ˚Ï
ËÏÏÛÌÌ˚Ï ·ÂÎÍÓÏ Ì‡ ÔÓ‚ÂıÌÓÒÚË ÍÎÂÚÓÍ, ÍÓÚÓ˚È ‡ÒÔÓÁ̇ÂÚ ÎËÔÓÔÓÎËÒ‡ı‡ˉ „‡ÏÓÚˈ‡ÚÂθÌ˚ı ·‡ÍÚÂËÈ (14). äÓÓ‰Ë̇ˆËfl ÔÂ‚˘Ì˚ı ÏÂı‡ÌËÁÏÓ‚ Á‡˘ËÚ˚ ÓÚ Ô‡ÚÓ„ÂÌÌ˚ı ÏËÍÓÓ„‡ÌËÁÏÓ‚
Á‡‚ËÒËÚ ÓÚ ÒÓÓÚ‚ÂÚÒÚ‚Û˛˘ÂÈ ˝ÍÒÔÂÒÒËË ˆÂÔÚÓÓ‚ Ë ‡ÒÔÓÁ̇‚‡ÌËfl Ô‡ÚÓ„Â̇, Á‡ÔÛÒ͇˛˘Â„Ó
‰ÓÒÓ˜ÌÓ ÓÒ‚Ó·ÓʉÂÌË ˝ÙÙÂÍÚÓÌ˚ı ÏÓÎÂÍÛÎ
ËÏÏÛÌÌÓÈ ÒËÒÚÂÏ˚. ÑÎfl ‡Ì‡ÎËÁ‡ ‚ÎËflÌËfl ˝ÚÓÈ
ÒËÒÚÂÏ˚ ̇ ÔÓÚË‚Ó‰ÂÈÒÚ‚Ë ËÌÙÂ͈ËË ÏÓÎÓ˜ÌÓÈ
ÊÂÎÂÁ˚ Óı‡‡ÍÚÂËÁÓ‚‡Ì „ÂÌ, ÍÓ‰ËÛ˛˘ËÈ Íβ˜Â‚ÓÈ PRR Toll-ÔÓ‰Ó·Ì˚È ˆÂÔÚÓ 9 (TLR9), ÍÓÚÓ˚È ÎÓ͇ÎËÁÓ‚‡Ì ̇ ıÓÏÓÒÓÏ 22. èÛÚÂÏ ËÒÔÓθÁÓ‚‡ÌËfl èñê ‚ ‡θÌÓÏ ‚ÂÏÂÌË ÍÓ΢ÂÒÚ‚ÂÌÌÓ
ËÁÏÂÂÌÓ ÍÓ΢ÂÒÚ‚Ó Ïêçä TLR9, TLR2 Ë TLR4
‚ Á‰ÓÓ‚˚ı Ë ËÌÙˈËÓ‚‡ÌÌ˚ı ÏÓÎÓ˜Ì˚ı ÊÂÎÂÁ‡ı.
èË Ï‡ÒÚËÚ ÒËθÌÓ Û‚Â΢ËÎÓÒ¸ (ÓÚ 4 ‰Ó 13 ‡Á)
ÒËÌÚÂÁ Ïêçä ‚ÒÂı ˝ÚËı „ÂÌÓ‚, ÍÓÏ TLR9. óËÒÎÓ ÍÓÔËÈ TLR2 ıÓÓ¯Ó ÍÓÂÎËÛÂÚ Ò ÂÁÛθڇڇÏË TLR4, Û͇Á˚‚‡˛˘ËÈ Ì‡ ÒÍÓÓ‰ËÌËÓ‚‡ÌÌÓÂ
„ÛÎËÓ‚‡ÌËfl ˝ÚËı ‰‚Ûı PRRS ‚Ó ‚ÂÏfl ËÌÙÂ͈ËË ‚˚ÏÂÌË. àı ÍÓÓ‰Ë̇ˆËfl Ó·˙flÒÌflÂÚ ÌÂÓÊˉ‡ÌÌÓ ̇·Î˛‰ÂÌËÂ Ó ÚÓÏ, ˜ÚÓ ËÌÙÂ͈ËË ÁÓÎÓÚËÒÚÓ„Ó ÒÚ‡ÙËÎÓÍÓÍ͇ ‚˚Á˚‚‡ÂÚ ÒËθÌÓ ۂÂ΢ÂÌËÂ
Ïêçä TLR4 [16]. ÇÒ ˝ÚÓ Ò‚Ë‰ÂÚÂθÒÚ‚ÛÂÚ Ó Á̇˜ËÚÂθÌÓÈ ÒÔÓÒÓ·ÌÓÒÚË ‚ÓʉÂÌÌÓÈ ËÏÏÛÌÌÓÈ ÒËÒÚÂÏ˚ ÔÓÚË‚Ó‰ÂÈÒÚ‚Ó‚‡Ú¸ χÒÚËÚÛ Ë ‚ÎËflÚ¸ ̇
ÔÓ‰ÛÍÚË‚ÌÛ˛ ÔÓ‰ÓÎÊËÚÂθÌÓÒÚ¸ ÊËÁÌË ÍÓÓ‚.
ë ‡ÎÎÂÎÂÏ «ë» ‡ÒÒÓˆËËÛÂÚÒfl ÒÌËÊÂÌË ˜ËÒ·
ÒÓχÚ˘ÂÒÍËı ÍÎÂÚÓÍ Ë ·ÓΠ‚˚ÒÓÍËÈ Û‰ÓÈ ÏÓÎÓ͇. Ç ÒÓ˜ÂÚ‡ÌËË Ò ˝ÚËÏ „ÂÌÓÏ ˆÂÔÚÓ „Â̇ TLR4
ÔÓfl‚ÎflÂÚ ‰ËÙÙÂÂ̈ˇθÌÛ˛ Ò‚flÁ¸ Ò Ï‡ÒÚËÚÓÏ,
˜ÚÓ ÔÓ·Û‰ËÎÓ Ô‰ÎÓÊËÚ¸ TLR4 ‚ ͇˜ÂÒڂ ͇̉ˉ‡Ú‡ ̇ ‚Íβ˜ÂÌË ‚ ÒÂÎÂ͈ËÓÌÌ˚ ÔÓ„‡ÏÏ˚ ‰Îfl
ÒÌËÊÂÌËfl Á‡·Ó΂‡ÂÏÓÒÚË Ï‡ÒÚËÚ‡ÏË [17]. Ç ÔÓˆÂÒÒ „ÂÌÓÏÌÓÈ ÓˆÂÌÍË Ò ˜‡ÒÚÓÚÓÈ Ì‡ÒÚÛÔÎÂÌËfl
ÒÚÂθÌÓÒÚË ·˚ÎÓ Ó·Ì‡ÛÊÂÌÓ SNP 40 „ÂÌÓ‚ ÔË
˝ÚÓÏ 36 SNP ·˚ÎË Ò‚flÁ‡Ì˚ Ò ÔÓ‰ÓÎÊËÚÂθÌÓÒÚ¸˛
ÔÓ‰ÛÍÚË‚ÌÓÈ ÊËÁÌË [18]. ùÚÓ ‰‡ÂÚ ‚ÓÁÏÓÊÌÓÒÚ¸
‚Íβ˜ËÚ¸ ˝ÚË SNP ‚ „ÂÌÓÏÌ˚ ÚÂÒÚ˚ ‚ÓÒÔÓËÁ‚Ó‰ÒÚ‚‡ Ë ÔÓ‰ÓÎÊËÚÂθÌÓÒÚË ÊËÁÌË ÍÓÓ‚.
ÉÂÌ CXCR1 ÍÓ‰ËÛÂÚ ˆÂÔÚÓ ıÂÏÓÍËÌÓ‚ ̇
ÔÓ‚ÂıÌÓÒÚË ÌÂÈÚÓÙËÎÓ‚, ÍÓÚÓ˚ ҂flÁ‡Ì˚ Ò ÔÓÚË‚Ó‚ÓÒÔ‡ÎËÚÂθÌ˚ÏË ‚ÓÁ‰ÂÈÒÚ‚ËflÏË ˆËÚÓÍË̇
ËÌÚÂÎÂÈÍË̇ 8 (IL8). á‡ÏÂ̇ ÌÛÍÎÂÓÚˉӂ SNP
CXCR1-777 (G/C) ÔË‚Ó‰ËÚ Í Á‡ÏÂÌ „ÎÛÚ‡ÏË̇
̇ „ËÒÚˉËÌ ‚ ÔÓÎÓÊÂÌËË ‡ÏËÌÓÍËÒÎÓÚ˚ ‚ ÔÓÎÓÊÂÌËË 245. äÓ„‰‡ CXCR1 ÒÚËÏÛÎËÛÂÚÒfl IL8,
˝Ú‡ ÔÂÚÎfl Û˜‡ÒÚ‚ÛÂÚ ‚ Ò‚flÁ˚‚‡ÌËË G-·ÂÎ͇ Ë Í‡Î¸ˆËfl. CC „ÂÌÓÚËÔ SNP CXCR1-777 ‡ÒÒÓˆËËÓ‚‡Ì˚
Ò Ì‡Û¯ÂÌËflÏË ÏË„‡ˆËË ÌÂÈÚÓÙËÎÓ‚, c ̇Û¯ÂÌËÂÏ ÔÓËÁ‚Ó‰ÒÚ‚‡ ‡ÍÚË‚Ì˚ı ÙÓÏ ÍËÒÎÓÓ‰‡,
˜ÚÓ ÔË‚Ó‰ËÚ Í Û‚Â΢ÂÌ˲ ÒÎÛ˜‡Â‚ ÒÛ·ÍÎËÌ˘ÂÒÍÓ„Ó Ï‡ÒÚËÚ‡ [19].
ÑÛ„Ë ÔÓÚÂ̈ˇθÌ˚ ËÏÏÛÌÌ˚ Ï˯ÂÌË —
χÍÂ˚ ‚Íβ˜‡˛Ú ÔÓÎËÏÓÙËÁÏ˚ ‚ Í·ÒÚÂ „Â̇ ‰ËÙÙÂÂ̈ËÓ‚ÍË 14 (CD14) ÔÓ ‰ÓÏÂÌÛ Í‡ÒÔ‡Á˚ 15 (CARD15 ) Ë IL8 „ÂÌÓ‚. CD14 ÍÓ‰ËÛÂÚ
ÏÂÏ·‡ÌÌ˚È ·ÂÎÓÍ, ‡ÒÒÓˆËËÓ‚‡ÌÌ˚È Ì‡ ÔÓ‚ÂıÌÓÒÚË ÍÎÂÚÓÍ, ÍÓÚÓ˚È Û˜‡ÒÚ‚ÛÂÚ ‚ ‡ÒÔÓÁ̇‚‡ÌËË ÎËÔÓÒ‡ı‡ˉӂ ‚ ÒÓ˜ÂÚ‡ÌËË Ò TLR4 [20]. àÁ
¯ÂÒÚ̇‰ˆ‡ÚË ÔÓÎËÏÓÙËÁÏÓ‚ ‚ ÒÂÏË ËÏÏÛÌÌ˚ı
Ó‰ÒÚ‚ÂÌÌ˚ı „ÂÌÓ‚, ÚÓθÍÓ CXCR1-777 (ˆÂÔÚÓ
1 ıÂÏÓÍËÌÓ‚Ó„Ó „Â̇ ËÎË ˆÂÔÚÓ‡ 8 ËÌÚÂÎÂÈÍË̇ ‡Î¸Ù‡), Í‡Í Ô‡‚ËÎÓ, ‡ÒÒÓˆËËÛÂÚÒfl Ò „ÂÌÂÚ˘ÂÒÍÓÈ ÛÒÚÓȘ˂ÓÒÚ¸˛ Í Á‡·Ó΂‡ÌËflÏ Ì‡ ÙÂχı.
éÚϘÂÌ˚ ‡ÒÒӈˇˆËË ÏÂÊ‰Û „ÂÌÓÏ „·‚ÌÓ„Ó
ÍÓÏÔÎÂÍÒ‡ „ËÒÚÓÒÓ‚ÏÂÒÚËÏÓÒÚË BoLA — DRB3
Ë fl‰ÓÏ ıÓÁflÈÒÚ‚ÂÌÌ˚ı ÔËÁ̇ÍÓ‚, ‚Íβ˜‡fl ˜ËÒÎÓ
ÒÓχÚ˘ÂÒÍËı ÍÎÂÚÓÍ ‚ ÏÓÎÓÍÂ Ë ˜‡ÒÚÓÚÓÈ Á‡·Ó΂‡ÂÏÓÒÚ¸˛ χÒÚËÚÓÏ [21].
Связь молекулярно-генетических маркеров с продолжительностью использования молочных коров
5
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 6
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
ÇÍ·‰ ‚ ‰Ó΄ÓÎÂÚË ÏÓÎÓ˜ÌÓ„Ó ÒÍÓÚ‡ Ì ÚÓθÍÓ „ÂÌÂÚ˘ÂÒÍËı, ÌÓ Ë ˝ÍÓÎӄ˘ÂÒÍËı, ‡ÌÚÓÔÓÎӄ˘ÂÒÍËı Ë ‰Û„Ëı Ù‡ÍÚÓÓ‚ ·ÂÒÒÔÓÌÓ ·Óθ¯ÓÈ.
éÔ‰ÂÎÂÌË ‰ÎËÚÂθÌÓÒÚË ÔÓ‰ÛÍÚË‚ÌÓÈ ÊËÁÌË Ò Ô˂ΘÂÌËÂÏ ÔÓ͇Á‡ÚÂÎÂÈ Ô˘ËÌ ‚˚·‡ÍÓ‚ÍË Û‚Â΢ËΠ̇ÒΉÛÂÏÓÒÚ¸ ÔËÁ͇̇. èË Ú‡ÍÓÈ
Ó·‡·ÓÚÍ ˝ÚÓÚ ÔÓ͇Á‡ÚÂθ ÏÓÊÂÚ ‰ÓÒÚË„‡Ú¸ ÓÍÓÎÓ
0,09. é·˚˜ÌÓ ÔÓ͇Á‡ÚÂÎË Ì‡ÒΉÛÂÏÓÒÚË „Ó‡Á‰Ó
ÌËÊÂ Ë ÒÓÒÚ‡‚Îfl˛Ú ‰Îfl ÌÂÚÂÎÂÈ ÓÍÓÎÓ 0,01 Ë ‰Îfl
ÍÓÓ‚ ‰Ó 0,06 [22]. êËÒÍ ‰Îfl ÍÓÓ‚ ·˚Ú¸ ÓÚ·‡ÍÓ‚‡ÌÌ˚ÏË ËÁ-Á‡ ̇Û¯ÂÌËfl ‚ÓÒÔÓËÁ‚Ó‰ÒÚ‚‡,
Á‡·Ó΂‡ÌËfl χÒÚËÚÓÏ, ÌÂÒÓÓÚ‚ÂÚÒÚ‚Ëfl Òڇ̉‡Ú‡Ï
˝ÍÒÚÂ¸Â‡ Ë ÌËÁÍÓÈ ÔÓ‰ÛÍÚË‚ÌÓÒÚË Á‡ÏÂÚÌÓ ‡Á΢‡˛ÚÒfl ÏÂÊ‰Û ÒÚ‡Ì‡ÏË. êÂÁÛθڇÚ˚ „ÂÌÓÏÌÓ„Ó ‡Ì‡ÎËÁ‡ ÔÓ͇Á˚‚‡˛Ú, ˜ÚÓ ÓÍÓÎÓ 40 SNPs Ò‚flÁ‡Ì˚ (P<0,05) Ò ˜‡ÒÚÓÚÓÈ Ì‡ÒÚÛÔÎÂÌËfl ÒÚÂθÌÓÒÚË.
ëÂ‰Ë ÌËı „ÂÌ˚, Û˜‡ÒÚ‚Û˛˘Ë ‚ ÙÛÌ͈ËÓÌËÓ‚‡ÌËË ˝Ì‰ÓÍËÌÌÓÈ ÒËÒÚÂÏ˚, ÍÎÂÚÓ˜ÌÓÈ Ò˄̇ÎËÁ‡ˆËË, ËÏÏÛÌÌÓ„Ó ÒÚ‡ÚÛÒ‡ Ë ËÌ„Ë·ËÓ‚‡ÌËfl ‡ÔÓÔÚÓÁ‡.
Ç Ó·˘ÂÈ ÒÎÓÊÌÓÒÚË Ó͇Á‡ÎÓÒ¸, ˜ÚÓ 10 „ÂÌÓ‚ „ÛÎËÛÂÚÒfl „ÂÌÓÏ ˝ÒÚ‡‰ËÓ·. äÓÏ ÚÓ„Ó, 22 SNP
·˚ÎË Ò‚flÁ‡Ì˚ Ò ÓÔÎÓ‰ÓÚ‚ÓflÂÏÓÒÚ¸˛ ÌÂÚÂÎÂÈ, 33 —
Ò ÓÔÎÓ‰ÓÚ‚ÓflÂÏÓÒÚ¸˛ ÍÓÓ‚˚, 36 — Ò ‰ÎËÚÂθÌÓÒÚ¸˛ ÔÓ‰ÛÍÚË‚ÌÓÈ ÊËÁÌË, 34 — Ò ÔÎÂÏÂÌÌÓÈ
4/2014
ˆÂÌÌÓÒÚ¸˛, 23 — Ò Û‰ÓÂÏ, 19 — Ò Ó·˘ËÏ ‚˚ıÓ‰ÓÏ
ÏÓÎÓ˜ÌÓ„Ó ÊË‡, 13 — Ò ÔÓˆÂÌÚÓÏ ÊË‡, 19 —
Ò Ó·˘ËÏ ‚˚ıÓ‰ÓÏ ÏÓÎÓ˜ÌÓ„Ó ·ÂÎ͇, 22 — Ò ÔÓˆÂÌÚÓÏ ·ÂÎ͇ Ë 13 — Ò ˜ËÒÎÓÏ ÒÓχÚ˘ÂÒÍËı ÍÎÂÚÓÍ [23].
èӂ‰ÂÌ ‡Ì‡ÎËÁ ÔÓ͇Á‡ÚÂÎÂÈ, ı‡‡ÍÚÂËÁÛ˛˘Ëı ÒÚÂÔÂ̸ ‰ÂÒÚ‡·ËÎËÁ‡ˆËË „ÂÌÓχ (˜‡ÒÚÓÚ‡ ˝ËÚÓˆËÚÓ‚ Ë ÎËÏÙÓˆËÚÓ‚ Ò ÏËÍÓfl‰‡ÏË, ˜ËÒÎÓ fl‰˚¯ÂÍ Ì‡ ÍÎÂÚÍÛ) ÏÓÎÓ˜Ì˚ı ÍÓÓ‚ [24]. ç‡ ÓÒÌÓ‚Â
ÔÓÎÛ˜ÂÌÌ˚ı ‰‡ÌÌ˚ı Ò‰ÂÎ‡Ì ‚˚‚Ó‰, ˜ÚÓ Í‡Í ÔÓ‰˙ÂÏ
ÔÓ‰ÛÍÚË‚ÌÓÒÚË ÍÓÓ‚, Ú‡Í Ë ÒÓÍË Ëı ËÒÔÓθÁÓ‚‡ÌËfl Û‚Â΢˂‡˛Ú ‰ÂÒÚ‡·ËÎËÁ‡ˆË˛ „ÂÌÓχ Ë, ‚ÓÁÏÓÊÌÓ, ÔÓ‚˚¯‡˛Ú ËÒÍ ‚ÓÁÌËÍÌÓ‚ÂÌËfl Ì„‡ÚË‚Ì˚ı ÏÛÚ‡ˆËÈ.
í‡ÍËÏ Ó·‡ÁÓÏ, ÔÓ·ÎÂχ ÔÓ‰ÓÎÊËÚÂθÌÓÒÚË
ÔÓ‰ÛÍÚË‚ÌÓÈ ÊËÁÌË ÍÓÓ‚ fl‚ÎflÂÚÒfl Í‡ÈÌ ÏÌÓ„Ó„‡ÌÌÓÈ Á‡‰‡˜ÂÈ Í‡Í ‰Îfl ÛÒÚ‡ÌÓ‚ÎÂÌËfl ˜ÂÚÍËı
Ô‡‡ÏÂÚÓ‚ ‡ÒÔÓÁ̇‚‡ÌËfl Ô˘ËÌ, Ú‡Í Ë ‰Îfl ‡Á‡·ÓÚÍË ÏÂÓÔËflÚËÈ ‰Îfl ÔÓ‰ÎÂÌËfl ÒÓÍÓ‚ ÊËÁÌË.
üÒÌÓ, ˜ÚÓ Ì‡fl‰Û Ò ËÒÔÓθÁÓ‚‡ÌËÂÏ „ÂÌÂÚËÍÓ-ÔÓÔÛÎflˆËÓÌÌ˚ı Ô‡‡ÏÂÚÓ‚ ıÓÁflÈÒÚ‚ÂÌÌ˚ı ÔËÁ̇ÍÓ‚ ÌÂÓ·ıÓ‰ËÏÓ ÒÓ‚Â¯ÂÌÒÚ‚Ó‚‡Ú¸ Ë ‚̉flÚ¸ ÏÓÎÂÍÛÎflÌ˚ χÍÂ˚ ‚ ÒÂÎÂ͈ËÓÌÌ˚ ÔÓ„‡ÏÏ˚.
Литература
1. Ducrocq V, Quaas R. L., Pollak E., Casella G. Length of productive life of dairy cows. //J Dairy Sci.1988 — ‹ 71 — P. 3061–3070.
2. Sewalem A., Miglior F., Kistemaker G. J., Sullivan P., VanDoormaal B. J. Relationship between reproduction traits and functional longevity in Canadian Dairy Cattle. // J Dairy, Sci. — 2008. — ‹ 9. — P. 1660–
1668.
3. Neerhof H. J., Madsen P., Ducrocq V. P., Vollema A. R., Jensen J., Korsgaard I. R. Relationship between mastitis and functional longevity in Danish Black and White dairy cattle estimated using survival
analysis. //J Dairy Sci. — 2000. — ‹ 83. — P. 1064–1071.
4. Sewalem A., Kistemaker G. J., Miglior F., VanDoormaal B. J. Analysis of inbreeding and its relationship
with functional longevity in Canadian Dairy Cattle //J Dairy Sci. ‹ 2006 — 89 — P. 2210–2216.
5. Pritchard T., Coffey M., Mrode R., Wall E. Genetic parameters for production, health, fertility and
longevity traits in dairy cows //Animal. 2013. — ‹ 7–1. — ê. 34–46.
6. Ducrocq V. Two years of experience with the French genetic evaluation of dairy bulls on production-adjusted longevity of their daughters. //Interbull Bulletin — 1999. — ‹21. — ê. 60–67.
7. Joanna Szyda, Małgorzata Morek-Kopeć, Jolanta Komisarek and Andrzej Żarnecki. Evaluating markers in
selected genes for association with functional longevity of dairy cattle//BMC Genetics — 2011. — ‹ 12. —
ê. 30–36.
8. Giblin L., Butler S. T., Kearney B. M., Waters S. M., Callanan M. J. Berry D. P. Association of bovine
leptin polymorphisms with energy output and energy storage traits in progeny tested Holstein-Friesian
dairy cattle sires //BMC Genet. — 2010. — ‹ 29–11. — P. 73–81.
9. Clempson A. M., Pollott G. E., Brickell J. S., Bourne N. E., Munce N., Wathes D. C. Evidence that
leptin genotype is associated with fertility, growth, and milk production in Holstein cows. // J Dairy
Sci. — 2011. — ‹ 94–7. — P. 3618–3628.
10. Liefers S. C., Veerkamp R. F., Te Pas M. F., Chilliard Y., Van der Lende T. Genetics and physiology
of leptin in periparturient dairy cows //Domest Anim Endocrinol. — 2005 — ‹ 29–1 — P. 227–238.
11. Boghossiana S., Uenoa N., Dubeb M. G., Kalrab P., Kalraa S. Leptin gene transfer in the hypothalamus
enhances longevity in adult monogenic mutant mice in the absence of circulating leptin // Neurobiol
Aging — 2007. — 28. — P. 1594–1604.
12. Khabour O. F., Mesmar F. S., Alatoum M. A., Gharaibeh M. Y., Alzoubi K. H. Associations of polymorphisms in adiponectin and leptin genes with men’s longevity//Aging Male — 2010 — ‹ 13 — ê. 188–193.
13. Gábor Mészáros, Sophie Eaglen, Patrik Waldmann, Johann Sölkner, A Genome Wide Association Study
for Longevity in Cattle //Open Journal of Genetics — 2014. — ‹ 4. — P. 46–55.
6
А. Ф. Яковлев и др. ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 7
Рубрика: Генетика и разведение животных
14. Akira S., Takeda K. Toll-like receptor signaling //Nat Rev.Immunol. — 2004 — ‹ 4 — ê. 499–511.
15. Ogorevc J., Kunej T., Razpet A., Dovc P. Database of cattle candidate genes and genetic markers for
milk production and mastitis //Anim Genet — 2009 — ‹40 — ê. 832–851.
16. White S. N., Taylor K. H., Abbey C. A., Gill C. A., Womack J. E. Haplotype variation in bovine Tolllike receptor 4 and computational prediction of a positively selected ligand-binding domain //Proc Natl
Acad Sci. USA — 2003 — ‹100 — ê. 10364–10369.
17. Goldammer T., Zerbe H., Molenaar A., Schuberth H. J., Brunner R. M., Kata S. R., Seyfert H. M.
Mastitis increases mammary mRNA abundance of beta-defensin 5, toll-like-receptor 2 (TLR2), and TLR4
but not TLR9 in cattle //Clin Diagn Lab Immunol. — 2004 — ‹ 11 — ê. 174–185.
18. Sarah D. Cochran1., John B. Cole, Daniel J. Null and Peter J. Hansen. Discovery of single nucleotide
polymorphisms in candidate genes associated with fertility and production traits in Holstein cattle. BMC
Genetics 2013, 14:49
19. Damaj B. B, McColl S. R., Neote K., Songqing N., Ogborn K. T., Hebert C. A., Naccache P. H.. Identification of G-protein binding sites of the human interleukin-8 receptors by functional mapping of the
intracellular loops.FASEB J 1996, 10:1426–1434.
20. Ibeagha-Awemu E. M., Lee J. W., Ibeagha A. E., Zhao X: Bovine CD14 gene characterization and relationship between polymorphisms and surface expression on monocytes and polymorphonuclear neutrophils. BMC Genet 2008, 9:50
21. Christine Beecher, Mairead Daly, Stuart Childs, Donagh P Berry, David A Magee, Tommie V McCarthy
and Linda Giblin, Polymorphisms in bovine immune genes and their associations with somatic cell count
and milk production in dairy cattle. BMC Genetics 2010, 11:99.
22. Roxstrom A., Ducrocq V., Strandberg E. Survival analysis of longevity in dairy cattle on a lactation
basis //Genet. Sel. Evol. //2003 — 35 — P. 305–318.
23. Pritchard T., Coffey M., Mrode R., Wall E. Genetic parameters for production, health, fertility and
longevity traits in dairy cows //Animal — 2013 — ‹7–1 — P. 34–46.
24. üÍӂ΂ Ä. î., äÓÒflÍÓ‚‡ É. è., èÓ„ÓÂθÒÍËÈ à. Ä. ÑÂÒÚ‡·ËÎËÁ‡ˆËfl „ÂÌÓχ ÍÓÓ‚ ‚ Ò‚flÁË Ò ÔÓ‰ÓÎÊËÚÂθÌÓÒÚ¸˛ ËÒÔÓθÁÓ‚‡ÌËfl //Å˛ÎÎÂÚÂ̸ Éçì ÇçààÉêÜ ‹ 150 — ë.24–27.
Yakovlev A. F., Dementeva N. V., Terletsky V. P.
Genetic nature of hereditary diseases cattle
and molecular genetic methods of diagnosis
Review
Abstract. There are a number of reliable data on the effect of the duration of the productive use of dairy
cows quantitative trait loci using linkage analysis and SNP haplotypes. The most reliable data on the culling of
cows and based on the study of leptin gene polymorphism. It should be noted that leptin — a peptide hormone
that regulates energy metabolism and the development of the reproductive system. Several polymorphic types
leptin (LEP-2470, LEP-1238, LEP-963, Y7F and R25C), were associated with the energy processes lactogenesis
and SNP Y7F associated with the accumulation of energy. Found an association between leptin polymorphic
types with signs of calving difficulty, duration of pregnancy and perinatal mortality. There is evidence of links
between LEP-polymorphism and its protein product with longevity in mice and humans. LEP-polymorphisms
can be regarded as a marker that can be used in selection longevity great role in the formation of the health
and life expectancy productive play genes associated with the immunological processes in organism cows. Susceptibility to mastitis is a complex multi-locus trait and it is not surprising quantitative trait loci for mastitis
were detected in almost all the chromosomes of cattle. Recent studies based on genomic evaluation have revealed regions of the genome and genes related to length of productive life of cows, including genes SYT10,
ADAMTS3, NTRK2 and SNTG1. Thus, the problem of the length of productive life of cows is extremely multi-faceted
challenge for establishing clear recognition parameters causes and to develop measures for extending life.
Keywords: dairy cows, longevity, gene, genes, leptin, mastitis, immunology, polygenic effect markers.
Authors:
Yakovlev A. F. — Ph.D., prof., Head. Department of Genetics and Biotechnology RRIFAGB, e-mail:
[email protected];
Dementieva N. V. — Ph.D, Laboratory of Molecular Cytogenetics, RRIFAGB, e-mail: [email protected];
Terletskii V. P. — Ph.D., prof., Laboratory of Molecular Cytogenetics, RRIFAGB, e-mail: [email protected],
tel.: (812) 465-80-12
Связь молекулярно-генетических маркеров с продолжительностью использования молочных коров
7
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 8
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
4/2014
УДК 639.3.05:575:57.08
О. Ю. Баркова, С. И. Лоскутов, М. Г. Смарагдов
Влияние субъединицы CAP-G комплекса конденсина I
на признаки яйца домашней курицы
Аннотация. Исследовали ассоциацию гена NCAPG c признаками качества яйца домашней курицы. Установлена достоверная связь аллелей rs14991030 в гене NCAPG с массой скорлупы, процентным соотношением масса скорлупы / масса яйца, а также с толщиной скорлупы домашней курицы. Замещение аллеля
G на A приводит к увеличению массы, толщины скорлупы и процентного соотношения масса скорлупы /
масса яйца. При этом достоверного отрицательного влияния на изученные признаки замены аллеля G на
A не выявлено.
Ключевые слова: конденсин I, ген NCAPG, генотип, домашняя курица, порода Род-Айленд, качество яйца.
Авторы:
Баркова Ольга Юрьевна — кандидат биологических наук, старший научный сотрудник лаборатории
молекулярной организации генома, ВНИИГРЖ, Санкт-Петербург-Пушкин, Московское шоссе, 55 а, е-mail:
[email protected];
Лоскутов Святослав Игоревич — кандидат сельскохозяйственных наук, старший научный сотрудник лаборатории молекулярной организации генома, ВНИИГРЖ, Санкт-Петербург-Пушкин, Московское шоссе, 55 а;
Смарагдов Михаил Григорьевич — кандидат биологических наук, заведующий лабораторией молекулярной
организации генома, ВНИИГРЖ, Санкт-Петербург-Пушкин, Московское шоссе, 55 а, е-mail: [email protected]
ǂ‰ÂÌËÂ. à‰ÂÌÚËÙË͇ˆËfl „ÂÌÓ‚, Ó͇Á˚‚‡˛˘Ëı
‚ÎËflÌË ̇ ÔÓfl‚ÎÂÌË ıÓÁflÈÒÚ‚ÂÌÌÓ ‚‡ÊÌ˚ı ÔËÁ̇ÍÓ‚, fl‚ÎflÂÚÒfl Ó‰ÌÓÈ ËÁ ‚‡ÊÌÂȯËı Á‡‰‡˜ „ÂÌÓÏËÍË ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı. ÅÓθ¯ËÌÒÚ‚Ó Ú‡ÍËı ÔËÁ̇ÍÓ‚ ı‡‡ÍÚÂËÁÛÂÚÒfl ¯ËÓÍÓÈ
‚‡ˇ·ÂθÌÓÒÚ¸˛ ˝ÍÒÔÂÒÒËË „ÂÌÓ‚, ̇ıÓ‰fl˘ËıÒfl
‚ ÓÔ‰ÂÎÂÌÌ˚ı ÎÓÍÛÒ‡ı, ̇Á˚‚‡ÂÏ˚ı QTL (quantitative trait loci — ÎÓÍÛÒ˚ ÍÓ΢ÂÒÚ‚ÂÌÌ˚ı ÔËÁ̇ÍÓ‚). ùÚË ÎÓÍÛÒ˚ ÔÓÎËÏÓÙÌ˚ Ë ‡ÒÒÓˆËËÓ‚‡Ì˚
Ò ‚‡ˇˆËflÏË ÙÂÌÓÚËÔ˘ÂÒÍËı ÔÓfl‚ÎÂÌËÈ ÔËÁ̇ÍÓ‚, Ú‡ÍËı, Í‡Í flȈÂÌÓÒÍÓÒÚ¸, ‚ÂÒ Ú· Ë Ú.Ô. [1].
Ç˚fl‚ÎÂÌÌ˚Â QTLs ÏÓ„ÛÚ ·˚Ú¸ ÔËÏÂÌÂÌ˚ ‚ MAS
(marker assisted selection — χÍÂ̇fl ÒÂÎÂ͈Ëfl)
‰Îfl Û‚Â΢ÂÌËfl ˝ÙÙÂÍÚË‚ÌÓÒÚË ÒÂÎÂ͈ËË [2].
Ç ËÒÒΉӂ‡ÌËË Ä. ÇÓÎÍ Ë ÒÓ‡‚Ú. [3] ·˚Î ‚˚fl‚ÎÂÌ Ï‡ÊÓÌ˚È QTL χÍËÓ‚‡ÌÌ˚È rs14491030
̇ ıÓÏÓÒÓÏ 4, Ó͇Á˚‚‡˛˘ËÈ ÒËθÌÓ ‚ÎËflÌË ̇
‚ÂÒ flȈ‡ ‰Óχ¯ÌÂÈ ÍÛˈ˚. éÌ ‡ÒÒÓˆËËÓ‚‡Î Ò „ÂÌÂÚ˘ÂÒÍÓÈ ËÁÏÂ̘˂ÓÒÚ¸˛ ‚ÂÒ‡ flȈ‡ ‰Ó 38,5%
(ê < 0,03). Ç ˝ÚÓÈ ‡·ÓÚ ·˚· ËÒÔÓθÁÓ‚‡Ì‡ χÚÂχÚ˘ÂÒ͇fl ÏÓ‰Âθ BayesB, ‰Îfl ˉÂÌÚËÙË͇ˆËË
‡ÈÓÌÓ‚ ıÓÏÓÒÓÏ, Ó·ÛÒ·‚ÎË‚‡˛˘Ëı ËÁÏÂ̘˂ÓÒÚ¸
ÔËÁ͇̇. ÉÂÌÓÚËÔËÓ‚‡ÌË ÓÒÛ˘ÂÒÚ‚ÎflÎÓÒ¸ Ò ÔÓÏÓ˘¸˛ SNP ˜ËÔ‡ 60ä. ÇÒÂ„Ó ‚˚fl‚ÎÂÌÓ 24.425 SNP
Û ÔÓ„ÓÎÓ‚¸fl 2900 ÍÛ. ë‚flÁ¸ ıÓÏÓÒÓÏ˚ 4 Ò Í‡˜ÂÒÚ‚ÓÏ flȈ‡ ·˚· ‡Ì ÛÔÓÏflÌÛÚ‡ Û fl‰‡ ‡‚ÚÓÓ‚
[4, 5, 6]. èӂ‰ÂÌÌ˚È Ì‡ÏË ‡Ì‡ÎËÁ in silico ÔÓ͇Á‡Î, ˜ÚÓ SNP rs14491030 ̇ıÓ‰ËÚÒfl ‚ „ÂÌ NCAPG
(Ì -SMC ÒÛ·˙‰ËÌˈ CAP-G ÍÓÏÔÎÂÍÒ‡ ÍÓ̉ÂÌÒË̇ I) ‚ ÔÓÁˈËË 78775527 Ô. Ì.
8
äÓ̉ÂÌÒËÌ˚ fl‚Îfl˛ÚÒfl ÒÛ·˙‰ËÌ˘Ì˚ÏË ·ÂÎÍÓ‚˚ÏË ÍÓÏÔÎÂÍÒ‡ÏË, Ë„‡˛˘ËÏË ÙÛ̉‡ÏÂÌڇθÌÛ˛ Óθ ‚ ÒÚÛÍÚÛÌÓÈ Ë ÙÛÌ͈ËÓ̇θÌÓÈ Ó„‡ÌËÁ‡ˆËË ıÓÏÓÒÓÏ. ÇÔÂ‚˚ ÍÓ̉ÂÌÒËÌ (ÚÂÔÂ¸
ËÁ‚ÂÒÚÌ˚È Í‡Í ÍÓ̉ÂÌÒËÌ I) ·˚Î ‚˚fl‚ÎÂÌ ËÁ ˝ÍÒÚ‡ÍÚ‡ flˈ ¯ÔÓˆÂ‚ÓÈ Îfl„Û¯ÍË Xenopus laevis,
Í‡Í ÓÒÌÓ‚ÌÓÈ ÍÓÏÔÓÌÂÌÚ ıÓÏÓÒÓÏ˚, Ë„‡˛˘ËÈ
‚‡ÊÌÛ˛ Óθ ‚ Ò·ÓÍ ıÓÏÓÒÓÏ. äÓ̉ÂÌÒËÌ I ÔËÒÛÚÒÚ‚ÛÂÚ Û ‚ÒÂı ‚ˉӂ ÓÚ ‰ÓÊÊÂÈ ‰Ó ˜ÂÎÓ‚Â͇
[7, 8]. èËϘ‡ÚÂθÌÓ, ˜ÚÓ ‰‡Ê ·‡ÍÚÂËË Ë ‡ıÂË
ËÏÂ˛Ú ÍÓ̉ÂÌÒËÌ — ÔÓ‰Ó·Ì˚ ÍÓÏÔÎÂÍÒ˚, ‡ ÏÌÓ„Ë ˝Û͇ËÓÚ˘ÂÒÍË ‚ˉ˚ ËÏÂ˛Ú ‰‚‡ ÚËÔ‡ ÍÓ̉ÂÌÒË̇ — ÍÓÏÔÎÂÍÒÓ‚, ËÁ‚ÂÒÚÌ˚ı Í‡Í ÍÓ̉ÂÌÒËÌ I
Ë II, ÍÓÚÓ˚ ‚˚ÔÓÎÌfl˛Ú ÌÂÒÓ‚Ô‡‰‡˛˘ËÂÒfl ÙÛÌ͈ËË Ë ÔÓ‰‚Â„‡˛ÚÒfl ‰ËÙÙÂÂ̈ˇθÌÓÏÛ „ÛÎËÓ‚‡Ì˲ ‚Ó ‚ÂÏfl ÏËÚÓÁ‡ Ë ÏÂÈÓÁ‡ [9, 10].
äÓ̉ÂÌÒËÌ˚ Ë„‡˛Ú ‚‡ÊÌÛ˛ Óθ ‚ ÒÚÛÍÚÛÌÓÈ
Ë ÙÛÌ͈ËÓ̇θÌÓÈ Ó„‡ÌËÁ‡ˆËË ˆÂÌÚÓÏÂ˚ Ë ÍËÌÂÚÓıÓ‡ ıÓÏÓÒÓÏ. Ç ÍÎÂÚ͇ı ÊË‚ÓÚÌ˚ı ÍÓ̉ÂÌÒËÌ I (ÌÓ Ì ÍÓ̉ÂÌÒËÌ II) „ÛÎËÛÂÚ ÔÎÓÚÌÓÒÚ¸
ˆÂÌÚÓÏÂÌÓ„Ó „ÂÚÂÓıÓχÚË̇ [11, 12, 13].
片‚ÌË ËÒÒΉӂ‡ÌËfl ÔÓ͇Á‡ÎË, ˜ÚÓ ˝ÚË ‰‚‡
ÍÓÏÔÎÂÍÒ‡ ÏÌÓ„ÓÙÛÌ͈ËÓ̇θÌ˚ Ë Û˜‡ÒÚ‚Û˛Ú ‚ „ÛÎflˆËË ˝ÍÒÔÂÒÒËË „ÂÌÓ‚, ÂÍÓÏ·Ë̇ˆËË Ë ÂÔ‡‡ˆËË [14, 15, 16].
äÓ̉ÂÌÒËÌ I Ë ÍÓ̉ÂÌÒËÌ II ÒÓ‰ÂÊ‡Ú Ó‰ÌÛ Ë ÚÛ
Ê ԇÛ SMC2 Ë SMC4 ÒÛ·˙‰ËÌˈ, ÔË̇‰ÎÂʇ˘Ëı Í ·ÂÎÍ‡Ï ÒÚÛÍÚÛÌÓ„Ó ÔÓ‰‰ÂʇÌËfl ıÓÏÓÒÓÏ (SMC) ·Óθ¯Ó„Ó ÒÂÏÂÈÒÚ‚‡ ıÓÏÓÒÓÏÌÓÈ
Äíî‡Á˚ [17]. í‡ÍÊ ͇ʉ˚È ÍÓÏÔÎÂÍÒ ËÏÂÂÚ ÛÌËО. Ю. Баркова и др. ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 9
Рубрика: Генетика и разведение животных
͇θÌ˚È Ì‡·Ó ËÁ ÚÂı ÌÂ-SMC ÒÛ·˙‰ËÌˈ (̇ÔËÏÂ, CAP-D2, CAP-G, Ë CAP-H ‰Îfl ÍÓ̉ÂÌÒË̇ I, Ë CAP-D3, CAP-G2, Ë CAP-H2 ‰Îfl ÍÓ̉ÂÌÒË̇ II). CAP-D2 Ë D3-CAP (Ë CAP-G Ë CAP-G2)
˜‡ÒÚ˘ÌÓ „ÓÏÓÎӄ˘Ì˚, Ú‡Í Í‡Í ËÏÂ˛Ú ‚˚ÓʉÂÌÌ˚È ÏÓÚË‚ ÔÓ‚ÚÓÓ‚, ̇Á˚‚‡ÂÏ˚È HEAT ÔÓ‚ÚÓ‡ÏË. ëÂ‰Ë ÚÂı ÌÂ-SMC ÒÛ·˙‰ËÌˈ, ‰‚ (CAP-D2
Ë CAP-G) ‚ӂΘÂÌ˚ ‚ ·ÂÎÓÍ-·ÂÎÍÓ‚˚ ‚Á‡ËÏÓ‰ÂÈÒÚ‚Ëfl [18].
å‡ÚÂË‡Î Ë ÏÂÚÓ‰˚ ËÒÒΉӂ‡ÌËÈ. ÑÎfl Ôӂ‰ÂÌËfl ˝ÍÒÔÂËÏÂÌÚÓ‚ ËÒÔÓθÁÓ‚‡Ì˚ ÍÛ˚ ‰‚Ûı
ÎËÌËÈ ÍÓ˘Ì‚Ó-ÒÍÓÎÛÔÌÓ„Ó ÍÓÒÒ‡ ìä äÛ·‡Ì¸ 7,
ÒÓÁ‰‡ÌÌ˚ı ̇ ÓÒÌÓ‚Â „ÂÌÓÙÓ̉‡ ÔÓÓ‰˚ êÓ‰-ÄÈÎẨ. éÚˆÓ‚Ò͇fl ÎËÌËfl ìä-72 ‚ χÚÂËÌÒÍÓÈ Ó‰ËÚÂθÒÍÓÈ ÙÓÏ ÚËÔ‡ ·ÂÎ˚È êÓ‰-ÄÈÎẨ Ë Ï‡ÚÂËÌÒ͇fl ÎËÌËfl ìä-73 ‚ χÚÂËÌÒÍÓÈ Ó‰ËÚÂθÒÍÓÈ
ÙÓÏ ÚËÔ‡ ·ÂÎ˚È êÓ‰-ÄÈÎẨ Ò „ÂÌÓÏ Ï‰ÎÂÌÌÓ„Ó ÓÔÂÂÌËfl, ÒˆÂÔÎÂÌÌ˚Ï Ò ÔÓÎÓÏ. Ç Ó·ÂËı ˝ÚËı
ÎËÌËflı ÓÚ·Ó ‚ÂÎÒfl, ‚ ÚÓÏ ˜ËÒÎÂ Ë Ì‡ ÔÓ‚˚¯ÂÌËÂ
χÒÒ˚ flȈ‡. í‡ÍÊ ‚ ˝ÍÒÔÂËÏÂÌÚ‡ı ·˚Î ËÒÔÓθÁÓ‚‡Ì ‰‚Ûı-ÎËÌÂÈÌ˚È „Ë·ˉ CD Ó‰ËÚÂθÒÍÓÈ
ÙÓÏ˚ ÍÓÒÒ‡ ãÓÏ‡Ì Å‡ÛÌ. è˘ÂÏ, ÓÚ·Ó ÍÛ
‚ ˝ÚËı ÎËÌËflı Ë ÍÓÒÒ ÓÒÛ˘ÂÒÚ‚ÎflÎÒfl, ‚ ÚÓÏ ˜ËÒΠ̇ ÔÓ˜ÌÓÒÚ¸ ÒÍÓÎÛÔ˚. Ç ‡·ÓÚ ËÒÔÓθÁÓ‚‡ÎË ÒÎÂ‰Û˛˘Ë ÔËÁ̇ÍË: 1. ÚÓ΢Ë̇ ÒÍÓÎÛÔ˚,
ÏÍÏ — Ò‰Ìflfl ÚÓ΢Ë̇ ÒÍÓÎÛÔ˚ flȈ‡ ‚ ÏÍÏ;
2. ÔÓˆÂÌÚ ÒÍÓÎÛÔ˚ — Ò‰Ìflfl ‰ÓÎfl χÒÒ˚ ÒÍÓÎÛÔ˚ ÓÚ Ï‡ÒÒ˚ ‚ÒÂ„Ó flȈ‡ ‚ ÔÓˆÂÌÚ‡ı; 3. ÒÍÓÎÛÔ‡, „‡ÏÏ — Ò‰Ìflfl χÒÒ‡ ÒÍÓÎÛÔ˚ ‚ „‡Ïχı; 4. ÔË„ÏÂÌÚ‡ˆËfl, 30, 60 ̉, ·‡Î. — Ò‰Ìflfl
ËÌÚÂÌÒË‚ÌÓÒÚ¸ ÔË„ÏÂÌÚ‡ˆËË ÒÍÓÎÛÔ˚ flˈ Û ÍÛ
ÒÓÓÚ‚ÂÚÒÚ‚Û˛˘Â„Ó ‚ÓÁ‡ÒÚ‡ ‚ ·‡Î·ı; 5. flȈÂÌÓÒÍÓÒÚ¸, 40, 60 ̉ÂθÌ˚ı ÍÛ — Ò‰Ìflfl flȈÂÌÓÒÍÓÒÚ¸ ÍÛ ‚ ÒÓÓÚ‚ÂÚÒÚ‚Û˛˘ÂÏ ‚ÓÁ‡ÒÚÂ; 6. ÔÓˆÂÌÚ
ÊÂÎÚ͇ — Ò‰Ìflfl χÒÒ‡ ÊÂÎÚ͇ ÔÓ ÓÚÌÓ¯ÂÌ˲
Í Ï‡ÒÒ flȈ‡; 7. ÊÂÎÚÓÍ, „‡ÏÏ. — Ò‰Ìflfl χÒÒ‡
ÊÂÎÚ͇ ‚ „‡Ïχı; 8. χÒÒ‡ flȈ‡, 30, 60 ̉. —
Ò‰Ìflfl χÒÒ‡ flȈ‡ Û ÍÛ ÒÓÓÚ‚ÂÚÒÚ‚Û˛˘Â„Ó ‚ÓÁ‡ÒÚ‡; 9. Ë̉ÂÍÒ ÙÓÏ˚ — Ò‰Ì ÓÚÌÓ¯ÂÌËÂ
‰ÎËÌ flȈ‡ ÔÓ ÍÓÓÚÍÓÈ Ë ‰ÎËÌÌÓÈ ÓÒË ‚ ‚˚‡ÊÂÌÌÓ ‚ ÔÓˆÂÌÚ‡ı; 10. ÛÔÛ„‡fl ‰ÂÙÓχˆËfl, 30,
40 ̉. — Ò‰Ìflfl ‰ÂÙÓχˆËfl ÒÍÓÎÛÔ˚ flȈ‡
·ÂÁ ̇Û¯ÂÌËfl  ˆÂÎÓÒÚÌÓÒÚË ‚ ÏËÍÓ̇ı ÔÓ‰
‚ÓÁ‰ÂÈÒÚ‚ËÂÏ „ÛÁ‡ ‚ÂÒÓÏ 500 „‡ÏÏ, ÒÌÂÒÂÌÌ˚ı
ÍÛ‡ÏË ÒÓÓÚ‚ÂÚÒÚ‚Û˛˘Â„Ó ‚ÓÁ‡ÒÚ‡. àÁ 149 Ó·‡ÁˆÓ‚ ÍÓ‚Ë ·˚· ‚˚‰ÂÎÂ̇ Ñçä Ò ÔÓÏÓ˘¸˛ ÙÂÌÓÎ-ıÎÓÓÙÓÏÌÓ„Ó ÏÂÚÓ‰‡. ëÂ‰Ë ÌËı 51 Ó·‡Áˆ ËÁ ÎËÌËË ìä-72, 73 ËÁ ÎËÌËË ìä-73 Ë 25 ËÁ
ÏÂÊÎËÌÂÈÌÓ„Ó „Ë·ˉ‡ CD.
ÑËÁ‡ÈÌ ‡ÎÎÂÎÂÒÔˆËÙ˘ÂÒÍËı Ô‡ÈÏÂÓ‚ ‰Îfl
„ÂÌÓÚËÔËÓ‚‡ÌËfl ÍÛ ÔÓ ‡ÎÎÂÎflÏ rs 14491030,
̇ıÓ‰fl˘ËÏÒfl „ÂÌ NCAPG, ÔÓ‚Ó‰ËÎË Ì‡ ÓÒÌÓ‚‡ÌËË ËÌÙÓχˆËË ·‡Á ‰‡ÌÌ˚ı ÒÂÚË ËÌÚÂÌÂÚ
(www.nlm.ncbi.nih.gov) ÔË ÔÓÏÓ˘Ë ÍÓÏÔ¸˛ÚÂÌÓÈ
ÔÓ„‡ÏÏ˚ PRIMER_3 (wwwgenome.wi.mit.edu).
ÇÂ΢Ë̇ ‡ÏÔÎËÙˈËÛÂÏÓ„Ó Ù‡„ÏÂÌÚ‡ ·˚·
Á‡‰‡Ì‡ ‚ Ô‰Â·ı 200–500 Ô.Ì. Ë ÚÂÏÔÂ‡ÚÛ‡ „Ë·ˉËÁ‡ˆËË ÔË 60°ë. èÓ‚Â͇ ÔÓÎÛ˜ÂÌÌ˚ı ÔÓÒΉӂ‡ÚÂθÌÓÒÚÂÈ Ô‡ÈÏÂÓ‚ ̇ ÒÔˆËÙ˘ÌÓÒÚ¸
Ë ÓÚÒÛÚÒÚ‚Ë ‚ÓÁÏÓÊÌÓÈ ‚ÌÛÚË„ÂÌÓÏÌÓÈ „ÓÏÓÎÓ„ËË ·˚· Ôӂ‰Â̇ ÔË ÔÓÏÓ˘Ë Ô‡ÍÂÚ‡ ÔÓ„‡ÏÏ BLAST.
ÑÎfl ÔÓÒΉӂ‡ÚÂθÌÓÒÚË rs 14491030 ËÒÔÓθÁÓ‚‡ÎË ‰‚‡ ‡Î¸ÚÂ̇ÚË‚Ì˚ı Ë ‰‚‡ ÛÌË‚Â҇θÌ˚ı
Ô‡ÈÏÂ‡.
ÄÎÎÂÎÂÒÔˆËÙ˘ÂÒÍË Ô‡ÈÏÂ˚ ‰Îfl „ÂÌÓÚËÔËÓ‚‡ÌËfl ÍÛ ÔÓ ‡ÎÎÂÎflÏ rs 14491030 (ÔÓÎËÏÓÙÌ˚ ҇ÈÚ˚ ‚˚‰ÂÎÂÌ˚ ÊËÌ˚ÏË ·ÛÍ‚‡ÏË):
rs 14491030 Up_A: ëTTCTTCCTCACAACTTTCAGTTCCAA
Dn: GTGGTGGTCTGCTATAACACTGTCTG
rs 14491030 Up_G: CTTCTTCCTCACAACTTTCAGTTCCAG
Dn TGTTTAAGCTTTGACTCATATCAGACC
ÄÏÔÎËÙË͇ˆË˛ Ñçä ÔË ÔÓÏÓ˘Ë èñê ÔÓ‚Ó‰ËÎË Ò ËÒÔÓθÁÓ‚‡ÌËÂÏ ‡ÏÔÎËÙË͇ÚÓ‡ IQ-5
(Bio-Rad, ëòÄ) ‚ ÒÎÂ‰Û˛˘ÂÏ ÂÊËÏÂ:
950ë — 5 ÏËÌÛÚ;
950ë — 1 ÏËÌÛÚ‡, 600ë — 1 ÏËÌÛÚ‡, 720ë —
1 ÏËÌÛÚ‡ (30 ˆËÍÎÓ‚);
720ë — 7 ÏËÌÛÚ
70ë — ı‡ÌÂÌËÂ.
ê‡Á‰ÂÎÂÌË Ù‡„ÏÂÌÚÓ‚ ÏÂÚÓ‰ÓÏ ˝ÎÂÍÚÓÙÓÂÁ‡ ‚ ‡„‡ÓÁÌÓÏ „ÂΠÔÓ‚Ó‰ËÎË ÒÎÂ‰Û˛˘ËÏ Ó·‡ÁÓÏ: ‰Îfl ÔË„ÓÚÓ‚ÎÂÌËfl 1,5% ‡„‡ÓÁÌ˚ı „ÂÎÂÈ
3,0 „ ‡„‡ÓÁ˚ ‡ÒÚ‚ÓflÎË ÔË Ì‡„‚‡ÌËË ‚ 200 ÏÎ
Ó‰ÌÓÍ‡ÚÌÓ„Ó ·ÛÙÂ‡ íÇÖ Ë ÔÓÒΠÓÒÚ˚‚‡ÌËfl ÔÓÎÛ˜ÂÌÌÓ„Ó ÁÓÎfl ‰Ó 55–60°ë ‰Ó·‡‚ÎflÎË 9 ÏÍÎ ‡ÒÚ‚Ó‡ ·ÓÏˉ‡ ˝ÚˉËfl (10 Ï„/ÏÎ). èË„ÓÚÓ‚ÎÂÌÌ˚È
ÁÓθ ‚˚ÎË‚‡ÎË ‚ ÙÓÏÛ-Ͳ‚ÂÚÛ, ÙÓÏËÓ‚‡ÎË Í‡χÌ˚ ÒÔˆˇθÌ˚ÏË „·ÂÌ͇ÏË, Ô‰‚‡ËÚÂθÌÓ
ÛÒÚ‡ÌÓ‚ÎÂÌÌ˚ÏË ‚ ÌÂÈ, Ë ÓÒÚ‡‚ÎflÎË ‰Îfl ÔÓÎËÏÂËÁ‡ˆËË Ì‡ 20-30 ÏËÌÛÚ ÔË ÍÓÏ̇ÚÌÓÈ ÚÂÏÔÂ‡ÚÛÂ. ùÎÂÍÚÓÙÓÂÁ ÔÓ‚Ó‰ËÎÒfl ‚ ÚËÒ-ùÑíÄ-·Ó‡ÚÌÓÏ ·ÛÙÂ (íÇÖ) (íêàë 0,089 å, ç3Çé3
0,089 å, ùÑíÄ 0,002 å, ç=8,2).
èӂ‰ÂÌË ˝ÎÂÍÚÓÙÓÂÁ‡: 10 ÏÍÎ ÔÓ‰ÛÍÚÓ‚
èñê Òϯ˂‡ÎË Ò 2 ÏÍÎ ·ÛÙÂ‡ ‰Îfl ̇ÌÂÒÂÌËfl
(75% „ÎˈÂËÌ, 0,05% ·ÓÏÙÂÌÓÎÓ‚Ó„Ó ÒËÌ„Ó,
0,05% ÍÒËÎÂÌ ˆË‡ÌÓ·). á‡ÚÂÏ ‚ÌÓÒËÎË ÔÓ·˚ Ò ·ÛÙÂÓÏ ‚ ͇χÌ˚ ‡„‡ÓÁÌÓ„Ó „ÂÎfl. ùÎÂÍÚÓÙÓÂÁ
ÔÓ‚Ó‰ËÎË ‚ Ú˜ÂÌË 45 ÏËÌÛÚ ÔË Ì‡ÔflÊÂÌËË
110 ‚ÓθÚ. î‡„ÏÂÌÚ˚ Ñçä ‚ËÁÛ‡ÎËÁËÓ‚‡ÎË ‚ ÔÓıÓ‰fl˘Ëı ìî ÎÛ˜‡ı. ê‡ÁÏÂ˚ Ù‡„ÏÂÌÚÓ‚ Ñçä
ÓÔ‰ÂÎflÎË ÔÛÚÂÏ Ò‡‚ÌÂÌËfl Ò ‡ÁÏÂ‡ÏË Ù‡„ÏÂÌÚÓ‚ χÍÂ‡ ÏÓÎÂÍÛÎflÌÓ„Ó ‚ÂÒ‡ Ñçä (ÙÓÚÓ 1.)
Влияние субъединицы CAP-G комплекса конденсина I на признаки яйца домашней курицы
9
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 10
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
4/2014
ëÚ‡ÚËÒÚ˘ÂÒÍÛ˛ Ó·‡·ÓÚÍÛ ÂÁÛθڇÚÓ‚ ÓÒÛ˘ÂÒÚ‚ÎflÎË Ò ÔÓÏÓ˘¸˛ Ó‰ÌÓÙ‡ÍÚÓÌÓ„Ó ‰ËÒÔÂÒËÓÌÌÓ„Ó ‡Ì‡ÎËÁ‡.
Ç Í‡˜ÂÒÚ‚Â ÍËÚÂËfl ‰ÓÒÚÓ‚ÂÌÓÒÚË
ËÒÔÓθÁÓ‚‡ÎË ÍËÚÂËÈ î˯Â‡ F.
Ç˚˜ËÒÎÂÌËfl ÓÒÛ˘ÂÒÚ‚ÎflÎË ÔË ÔÓÏÓ˘Ë Ô‡ÍÂÚ‡ ÍÓÏÔ¸˛ÚÂÌÓÈ ÔÓ„‡ÏÏ˚ Statistica 6.
Ä̇ÎËÁ Ë Ó·ÒÛʉÂÌË ÂÁÛθڇÚÓ‚. èӂ‰ÂÌÓ „ÂÌÓÚËÔËÓ‚‡ÌË 149
ÍÛˈ ÔÓÓ‰˚ êÓ‰-ÄÈÎẨ (ÎËÌËË
ìä-72, ìä-73 Ë ÏÂÊ„Ë·ˉÌ˚È ÍÓÒÒ
CD).
Фото 1. Электрофореграмма результатов ПЦР
с аллелеспецифическими праймерами rs 14491030
퇷Îˈ‡ 1. ÄÒÒӈˇˆËfl „ÂÌÓÚËÔÓ‚ rs 14491030 Ò ÔËÁ͇̇ÏË,
ı‡‡ÍÚÂËÁÛ˛˘ËÏË flÈˆÓ ÍÛ ÎËÌËË ìä-72
èËÁ̇Í
ëÍÓÎÛÔ‡, „‡ÏÏ
èÓˆÂÌÚ ÒÍÓÎÛÔ˚
èË„ÏÂÌÚ‡ˆËfl, 30 ̉
üȈÂÌÓÒÍÓÒÚ¸, 60 ̉.
üȈÂÌÓÒÍÓÒÚ¸, 40 ̉.
èÓˆÂÌÚ ÊÂÎÚ͇
ÜÂÎÚÓÍ, „‡ÏÏ
å‡ÒÒ‡ flȈ‡, „‡ÏÏ,
30 ̉.
å‡ÒÒ‡ flȈ‡, „‡ÏÏ,
60 ̉.
ìÔÛ„‡fl ‰ÂÙÓχˆËfl,
30 ̉.
ìÔÛ„‡fl ‰ÂÙÓχˆËfl,
60 ̉.
à̉ÂÍÒ ÙÓÏ˚, 30 ̉.
íÓ΢Ë̇ ÒÍÓÎÛÔ˚,
ÏÍÏ.
10
ÉÂÌÓÚËÔ
N
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
43
7
1
43
7
1
43
7
1
43
1
7
43
7
1
43
7
1
43
7
1
43
7
1
43
7
1
43
7
1
41
6
1
43
7
1
43
7
1
ë‰Ì Á̇˜ÂÌË ±
ӯ˷͇ Ò‰Ì„Ó
5,73±0,06
6,1±0,0
5,12±0,23
8,97±0,09
10,0±0,0
8,28±0,35
1,34±0,06
1,47±0,17
1±0
267,45±2,6
263,5±1,9
264±0
127,97±0,93
125±1,9
128±0,0
27,73±2,8
28,2±0,78
28±0,0
17,69±0,19
17,1±0,48
17,42±0,0
61,6±0,3
60,9±0.41
58,6±0,0
63,8±0,47
61,8±0,44
61±0,0
18,54±0,8
22±2
12±0,0
24,5±0,7
28±3,3
24±0,0
78,64±0,29
80±0,89
77,±0,0
361,95±4,1
346±17,27
403±0,0
ëڇ̉‡ÚÌÓÂ
ÓÚÍÎÓÌÂÌËÂ
0,4
0
0,6
0,61
0
0,93
0,41
0,17
0
17
5,1
0
6,1
5
0
1,85
2
0
1,26
1,29
0
1,92
1,09
0
3,8
1,1
0
5,2
5,4
0
4,42
8
0
1,93
2,36
0
ê
0,0032
0,014
0,54
0,82
0,48
0,81
0,79
0,19
0,17
0,12
0,29
0,17
0
О. Ю. Баркова и др. ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 11
Рубрика: Генетика и разведение животных
èË Ôӂ‰ÂÌËË ‰ËÒÔÂÒËÓÌÌÓ„Ó ‡Ì‡ÎËÁ‡ ‰‡ÌÌ˚ı „ÂÌÓÚËÔËÓ‚‡ÌËfl Û „ÂÌÓÚËÔÓ‚ AG, AA Ë GG
SNP rs 14491030 (ÎËÌËfl ìä-72) ·˚ÎÓ ‚˚fl‚ÎÂÌÓ
‰ÓÒÚÓ‚ÂÌÓ ‡Á΢ˠ‰Îfl ÒÎÂ‰Û˛˘Ëı ÔËÁ̇ÍÓ‚:
χÒÒ‡ ÒÍÓÎÛÔ˚ ‚ „‡Ïχı Ë ÔÓˆÂÌÚ ÒÍÓÎÛÔ˚
(Ò‰Ìflfl ‰ÓÎfl χÒÒ˚ ÒÍÓÎÛÔ˚ ÓÚ Ï‡ÒÒ˚ ‚ÒÂ„Ó flȈ‡) ÔË ê = 0,0032 Ë 0,014 ÒÓÓÚ‚ÂÚÒÚ‚ÂÌÌÓ (Ú‡·Îˈ‡ 1).
ì ÎËÌËË ìä-73, ÔÓÓ‰‡ êÓ‰-ÄÈÎẨ ‰ÓÒÚÓ‚ÂÌ˚ı ‡Á΢ËÈ ‰‡ÌÌ˚ı ‰Îfl ‚ÒÂı ÔËÁ̇ÍÓ‚ ÏÂʉÛ
ÚÂÏfl „ÂÌÓÚËÔ‡ÏË Ì ·˚ÎÓ ÔÓÎÛ˜ÂÌÓ (Ú‡·Îˈ‡ 2).
Ç Ú‡·Îˈ 3 Ô‰ÒÚ‡‚ÎÂÌ˚ ÒÚ‡ÚËÒÚ˘ÂÒÍË ‰‡ÌÌ˚ ‰Îfl ÍÓÒÒ‡ ëD. ì ÍÓÒÒ‡ CD ‰ÓÒÚÓ‚ÂÌÓ ‡Á΢ˠËÁ ‚ÒÂı ÔËÁ̇ÍÓ‚ ËÏÂÎ ÔËÁÌ‡Í ÚÓ΢Ë̇
ÒÍÓÎÛÔ˚ flȈ‡ ‚ ÏÍÏ (ê = 0,0064), Ë ·ÎËÁÍËÈ Í ‰ÓÒÚÓ‚ÂÌÓÏÛ Ì‡ ÛÓ‚Ì Á̇˜ËÏÓÒÚË 0,09 ÔËÁ̇Í
ÔÓˆÂÌÚ ÒÍÓÎÛÔ˚ (Ò‰Ìflfl ‰ÓÎfl χÒÒ˚ ÒÍÓÎÛÔ˚ ÓÚ Ï‡ÒÒ˚ ‚ÒÂ„Ó flȈ‡).
Ç í‡·Îˈ 4 Ô˂‰ÂÌ ‰ÓÒÚÓ‚ÂÌ˚È ˝ÙÙÂÍÚ Á‡Ï¢ÂÌËfl ‡ÎÎÂÎÂÈ rs 14491030 ‰Îfl ÔËÁ̇ÍÓ‚ Ëϲ˘Ëı ‰ÓÒÚÓ‚ÂÌÓÂ Ë ·ÎËÁÍÓÂ Í ‰ÓÒÚÓ‚ÂÌÓÏÛ ‡Á΢Ëfl ÏÂÊ‰Û ÚÂÏfl „ÂÌÓÚËÔ‡ÏË ÍÛ ÎËÌËË ìä-72.
퇷Îˈ‡ 2. ÄÒÒӈˇˆËfl „ÂÌÓÚËÔÓ‚ rs 14491030 Ò ÔËÁ͇̇ÏË,
ı‡‡ÍÚÂËÁÛ˛˘ËÏË flÈˆÓ ÍÛ ÎËÌËË ìä-73
èËÁ̇Í
ëÍÓÎÛÔ‡, „‡ÏÏ
èÓˆÂÌÚ ÒÍÓÎÛÔ˚
èË„ÏÂÌÚ‡ˆËfl,
30 ̉.
üȈÂÌÓÒÍÓÒÚ¸,
60 ̉.
üȈÂÌÓÒÍÓÒÚ¸,
40 ̉.
èÓˆÂÌÚ ÊÂÎÚ͇
ÜÂÎÚÓÍ, „‡ÏÏ
å‡ÒÒ‡ flȈ‡, „‡ÏÏ,
30 ̉.
å‡ÒÒ‡ flȈ‡, „‡ÏÏ,
60 ̉.
ìÔÛ„‡fl
‰ÂÙÓχˆËfl, 30 ̉.
ìÔÛ„‡fl
‰ÂÙÓχˆËfl, 60 ̉.
à̉ÂÍÒ ÙÓÏ˚,
30 ̉.
íÓ΢Ë̇ ÒÍÓÎÛÔ˚,
ÏÍÏ.
ÉÂÌÓÚËÔ
N
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
67
3
3
67
3
3
67
3
3
67
3
3
67
3
3
67
3
3
67
3
3
67
3
3
67
3
3
67
3
3
65
3
3
11
1
1
67
3
3
ë‰Ì Á̇˜ÂÌË ±
Ò‰Ìflfl ӯ˷͇
5,62±0,06
5,5±0,1
5,6±0,25
8,64±0,09
8,8±0,1
8,7±0,38
1,47±0,05
1±0,0
1,43±0,29
268±0,9
270±4,6
270±2,7
127±0,6
125±1,5
126±1,7
26,6±2,2
25,4±0,9
27±2,1
17,3±0,17
15,8±0,7
17,26±1,4
62,8±0,2
63±0.75
62±1,3
65,6±0,7
62,3±0,9
63,9±3,3
20,1±0,9
17±2
16±4
28±0,8
30±1,5
25±0,58
79±0,8
80±0,0
78±0,0
341±3,9
340,6±4
351,6±20,2
ëڇ̉‡ÚÌÓÂ
ÓÚÍÎÓÌÂÌËÂ
0,4
0,17
0,43
0,8
0
0,66
0,48
0
0,51
7,5
8
4,7
5
2,4
3
1,87
1,5
3,8
1,4
1,28
2,4
1,7
1,3
2,2
5,4
1,6
5,7
7,1
3,4
6,9
4,42
2,6
1
1,93
0
0
32
7
35
Влияние субъединицы CAP-G комплекса конденсина I на признаки яйца домашней курицы
ê
0,91
0,93
0,25
0,8
0,75
0,54
0,26
0,71
0,54
0,48
0,61
0,87
0,85
11
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 12
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
ùÙÙÂÍÚ Á‡Ï¢ÂÌËfl ‡ÎÎÂÎÂÈ Ì‡·Î˛‰‡ÂÚÒfl ÔË Á‡ÏÂÌ ‡ÎÎÂÎfl G ̇ A Û ÔËÁ̇ÍÓ‚ χÒÒ‡ ÒÍÓÎÛÔ˚
‚ „‡Ïχı (P = 0,001) Ë ÔÓˆÂÌÚ ÒÍÓÎÛÔ˚ (P =
0,013). ì ÍÓÒÒ‡ CD ˝ÙÙÂÍÚ Á‡Ï¢ÂÌËfl ‡ÎÎÂÎÂÈ
̇·Î˛‰‡ÂÚÒfl ÔË Á‡ÏÂÌ ‡ÎÎÂÎfl G ̇ A Û ÔËÁ͇̇ ÚÓ΢Ë̇ ÒÍÓÎÛÔ˚ ‚ ÏÍÏ (P = 0,01). èË
„ÓÏÓÁË„ÓÚËÁ‡ˆËË ‡ÎÎÂÎfl G Á̇˜ÂÌËfl ÚÓ΢ËÌ˚ ÒÍÓÎÛÔ˚ ÒÚ‡ÌÓ‚flÚÒfl ·Óθ¯Â, ˜ÚÓ Ò‚Ë‰ÂÚÂθÒÚ‚ÛÂÚ Ó·
‡‰‰ËÚË‚ÌÓÒÚË ˝ÙÙÂÍÚ‡ Á‡ÏÂÌ˚ ‡ÎÎÂÎÂÈ. èÓÔÛÒÍË ‚ Ú‡·Îˈ 4 ÓÁ̇˜‡˛Ú, ˜ÚÓ ‚˚·Ó͇ ÍÛ ̉ÓÒÚ‡ÚӘ̇ ‰Îfl ÒÚ‡ÚËÒÚ˘ÂÒÍÓ„Ó ‡Ì‡ÎËÁ‡. á‡Ï¢Â-
4/2014
ÌË ‡ÎÎÂÎË G ̇ A ÔË‚Ó‰ËÚ Í Û‚Â΢ÂÌ˲ χÒÒ˚, ÚÓ΢ËÌ˚ ÒÍÓÎÛÔ˚ Ë ÔÓˆÂÌÚ‡ χÒÒ˚ ÒÍÓÎÛÔ˚ ÔÓ ÓÚÌÓ¯ÂÌ˲ Í Ï‡ÒÒ flȈ‡. èË ˝ÚÓÏ, ‰ÓÒÚÓ‚ÂÌÓ„Ó ÓÚˈ‡ÚÂθÌÓ„Ó ‚ÎËflÌËfl ̇ ËÁÛ˜ÂÌÌ˚Â
ÔËÁ̇ÍË Á‡ÏÂ̇ ‡ÎÎÂÎfl G ̇ A Ì ‚˚fl‚ÎÂÌÓ.
í‡ÍËÏ Ó·‡ÁÓÏ, ‰ÓÒÚÓ‚ÂÌ˚ ‡Á΢Ëfl ÔË Á‡ÏÂÌ ‡ÎÎÂÎÂÈ SNP rs 14491030 ÔÓÎÛ˜ÂÌ˚ ‰Îfl ÎËÌËË ìä-72 Ë Û ÍÓÒÒ‡ CD.
Ç˚‚Ó‰˚. 1. Ä̇ÎËÁ in silico ÔÓ͇Á‡Î, ˜ÚÓ SNP
rs 14491030 ̇ıÓ‰ËÚÒfl ‚ „ÂÌ NCAPG (Ì -SMC
퇷Îˈ‡ 3. ÄÒÒӈˇˆËfl „ÂÌÓÚËÔÓ‚ rs 14491030 Ò ÔËÁ͇̇ÏË,
ı‡‡ÍÚÂËÁÛ˛˘ËÏË flÈˆÓ ÍÛ ÍÓÒÒ‡ CD
èËÁ̇Í
ëÍÓÎÛÔ‡, „‡ÏÏ
èÓˆÂÌÚ ÒÍÓÎÛÔ˚
èË„ÏÂÌÚ‡ˆËfl,
30 ̉.
üȈÂÌÓÒÍÓÒÚ¸,
60 ̉.
üȈÂÌÓÒÍÓÒÚ¸,
40 ̉.
èÓˆÂÌÚ ÊÂÎÚ͇
ÜÂÎÚÓÍ, „‡ÏÏ
å‡ÒÒ‡ flȈ‡, „‡ÏÏ,
30 ̉.
å‡ÒÒ‡ flȈ‡, „‡ÏÏ
60 ̉.
ìÔÛ„‡fl
‰ÂÙÓχˆËfl, 30 ̉.
ìÔÛ„‡fl
‰ÂÙÓχˆËfl, 60 ̉.
à̉ÂÍÒ ÙÓÏ˚,
30 ̉.
íÓ΢Ë̇ ÒÍÓÎÛÔ˚,
ÏÍÏ.
12
ÉÂÌÓÚËÔ
N
ë‰Ì Á̇˜ÂÌË ±
Ò‰Ìflfl ӯ˷͇
ëڇ̉‡ÚÌÓÂ
ÓÚÍÎÓÌÂÌËÂ
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
AG
AA
GG
20
3
1
20
3
1
20
3
1
67
3
3
15
2
0
18
3
1
18
3
1
20
3
1
20
3
1
15
2
2
19
3
1
15
2
0
20
3
1
6,4±0,1
6,4±0,2
6,1±0,0
9,7±0,1
10±0,1
8,8±0,0
1,25±0,1
1,±0,0
2±0,0
268±1
270±5
270±3
171,9±1,5
170±6
0
26,6±0,7
26±1,4
25,4±0,0
17±0,7
16±1
17,5±0,0
64,6±0,9
63,6±2
69±0,0
65,8±1
63±2
69±0,0
16,33±1,9
12±0,0
12±0,0
21,3±0,7
20±0,7
26±0,0
77,5±0,4
76,5±0,5
0
381±3
405,6±4
350±0,0
0,4
0,34
0
0,5
0,1
0
0,6
0
0
7,5
8
4,7
5,8
8,5
0
3
2,5
0
3
1,6
0
4
3
0
3,8
3,5
0
7,6
0
0
3
8
0
1,56
0,7
0
15
7,5
0
ê
0,77
0,09
0,8
0,8
0,67
0,86
0,91
0,47
0,34
0,12
0,29
0,40
0,0064
О. Ю. Баркова и др. ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 13
Рубрика: Генетика и разведение животных
퇷Îˈ‡ 4. ùÙÙÂÍÚ Á‡Ï¢ÂÌËfl ‡ÎÎÂÎÂÈ rs 14491030 Û ÍÛ ÎËÌËË ìä-72 Ë ÍÓÒÒ‡ CD
ãËÌËfl
èËÁ̇Í
ëÍÓÎÛÔ‡,
„‡ÏÏ
ìä-72
èÓˆÂÌÚ
ÒÍÓÎÛÔ˚
èÓˆÂÌÚ
ÒÍÓÎÛÔ˚
CD
íÓ΢Ë̇
ÒÍÓÎÛÔ˚,
ÏÍÏ.
ÉÂÌÓÚËÔ
N
ë‰Ì Á̇˜ÂÌË ±
Ò‰Ìflfl ӯ˷͇
ëڇ̉‡ÚÌÓÂ
ÓÚÍÎÓÌÂÌËÂ
ùÙÙÂÍÚ Á‡Ï¢ÂÌËfl
‡ÎÎÂÎÂÈ
‰Îfl „ÂÌÓÚËÔÓ‚
P
AG
43
5,73±0,06
0,4
AG-AA 0,37
0,001
AA
7
6,1±0,0
0
AG-GG 0,4
0,4
GG
1
5,12±0,23
0,6
AA-GG 0,98
—
AG
43
8,97±0,09
0,6
AG-AA 1,03
0,013
AA
7
10,0±0,0
0
AG-GG 0,69
0,1
GG
1
8,28±0,35
0,9
AA-GG 1,72
—
AG
20
9,7±0,1
0,5
AG-AA 0,3
0,1
AA
3
10±0,08
0,1
AG-GG 0,9
0,2
GG
1
8,8±0,0
0
AA-GG 1,2
—
AG
20
381±3,3
15
AG-AA 24,6
0,01
AA
3
405,6±4,3
7,5
AG-GG 31
0,06
GG
1
350±0,0
0
AA-GG 55
—
ÒÛ·˙‰ËÌˈ CAP-G ÍÓÏÔÎÂÍÒ‡ ÍÓ̉ÂÌÒË̇ I) ‚ ÔÓÁˈËË 78775527 Ô. Ì. á‡ÏÂ̇ ‡ÎÎÂÎfl G ̇ A ÔË‚Ó‰ËÚ Í Á‡ÏÂÌ ‚‡ÎË̇ ̇ ‡Î‡ÌËÌ.
2. èË Ò‡‚ÌÂÌËË ÚÂı „ÂÌÓÚËÔÓ‚ rs 14491030
‰ÓÒÚÓ‚Â̇fl ‡ÒÒӈˇˆËfl ÔÓÎÛ˜Â̇ ‰Îfl χÒÒ˚ ÒÍÓÎÛÔ˚ (ê = 0,0032) Ë ÒÓÓÚÌÓ¯ÂÌËfl χÒÒ ÒÍÓÎÛÔ˚
Ë flȈ‡ ‚ ÔÓˆÂÌÚ‡ı (ê = 0,014) Û ÍÛ ÎËÌËË ìä-72,
‡ Ú‡ÍÊ ÚÓ΢ËÌ˚ ÒÍÓÎÛÔ˚ flˈ (ê = 0,0064) Û ÍÛ
ÍÓÒÒ‡ CD.
3. ùÙÙÂÍÚ Á‡Ï¢ÂÌËfl ‡ÎÎÂÎfl G ̇ A (rs
14491030) ÔË‚Ó‰ËÚ Í ‰ÓÒÚÓ‚ÂÌÓÈ ‡ÒÒӈˇˆËË Ï‡ÒÒ˚ ÒÍÓÎÛÔ˚ (ê = 0.001), ÓÚÌÓ¯ÂÌËfl χÒÒ˚ ÒÍÓÎÛÔ˚ Í Ï‡ÒÒ flȈ‡ (ê = 0.013) ‰Îfl ÍÛ ÎËÌËË ìä-72
Ë ÚÓ΢ËÌ˚ ÒÍÓÎÛÔ˚ (ê = 0.01) ‰Îfl ÍÛ ÍÓÒÒ‡ CD.
4. á‡Ï¢ÂÌË ‡ÎÎÂÎfl G ̇ A ÔË‚Ó‰ËÚ Í Û‚Â΢ÂÌ˲ χÒÒ˚, ÚÓ΢ËÌ˚ ÒÍÓÎÛÔ˚ Ë ÔÓˆÂÌÚ‡
χÒÒ˚ ÒÍÓÎÛÔ˚ ÔÓ ÓÚÌÓ¯ÂÌ˲ Í Ï‡ÒÒ flȈ‡. èË
˝ÚÓÏ ‰ÓÒÚÓ‚ÂÌÓ„Ó ÓÚˈ‡ÚÂθÌÓ„Ó ‚ÎËflÌËfl ̇
ËÁÛ˜ÂÌÌ˚ ÔËÁ̇ÍË Á‡ÏÂÌ˚ ‡ÎÎÂÎfl A ̇ G ÌÂ
‚˚fl‚ÎÂÌÓ. í‡ÍËÏ Ó·‡ÁÓÏ, ÔÓ Ô‰‚‡ËÚÂθÌ˚Ï
‰‡ÌÌ˚Ï rs 14491030 ÏÓÊÂÚ ·˚Ú¸ ÂÍÓÏẨӂ‡Ì
‰Îfl ËÒÔÓθÁÓ‚‡ÌËfl ‚ ÒÂÎÂ͈ËË ÍÛ ÌÂÒÛ¯ÂÍ. Ç˚fl‚ÎÂÌÌ˚ χÊÓÌ˚ QTL (ÎÓÍÛÒ˚ ÍÓ΢ÂÒÚ‚ÂÌÌ˚ı ÔËÁ̇ÍÓ‚) ÏÓ„ÛÚ ·˚Ú¸ ËÒÔÓθÁÓ‚‡Ì˚ ‰Îfl ÓÔÚËÏËÁ‡ˆËË ÒËÒÚÂÏ˚ ÏÓÎÂÍÛÎflÌ˚ı χÍÂÓ‚, ‰Îfl
χÍÂÌÓÈ ÒÂÎÂ͈ËË ‰Óχ¯ÌÂÈ ÍÛˈ˚ Ë „ÂÌÓÏÌÓÈ ÒÂÎÂ͈ËË ÔÓ ıÓÁflÈÒÚ‚ÂÌÌÓ-ÔÓÎÂÁÌ˚Ï ÔËÁÌ‡Í‡Ï Í‡˜ÂÒÚ‚‡ flȈ‡. ÑÎfl ÒÂÎÂ͈ËË ÔÓ ÔËÁ͇̇Ï
͇˜ÂÒÚ‚‡ flȈ‡ ‚ êÓÒÒËË „ÂÌÓÏ̇fl ÒÂÎÂ͈Ëfl ÔÓÁ‚ÓÎËÚ ‰Ó·ËÚ¸Òfl ÒÛ˘ÂÒÚ‚ÂÌÌÓ„Ó ÔÓ„ÂÒÒ‡ ‚ ·ËÓÚÂıÌÓÎÓ„ËË ÔÚˈ‚ӉÒÚ‚‡ Ë ËÁ·Âʇڸ ÌÂÓ·ıÓ‰ËÏÓÒÚË ÔËÓ·ÂÚÂÌËfl ÍÓÒÒÓ‚ ËÁ Á‡Û·ÂÊÌ˚ı ÒÚ‡Ì.
Литература
1. Cheng H. H. Development of a genetic map of the chicken with markers of high utility. / H. H. Cheng,
I. Levin, R. L. Vallejo, H. Khatib, J. B. Dodgson, L. B. Crittenden, J. Hillel //Poultry Science. — 1997
— V. 74. ‹ 11. — P. 1855–1874.
2. Grisart B. Positional candidate cloning of a QTL in dairy cattle: identification of a missence mutations in
the bovine DGAT1 gene with major effect on milk yield and composition / B. Grisart, W. Coopetees,
F. Farnir, L. Karim , K. Ford, P. Berzi, N. Cambisario, M. Mni, S. Reid, P. Simon, R. Spelman, M. Georges,
R. J. R. Snell //Genome Research. — 2002. — V. 12. — P. 222–231.
3. Wolc, A. Genome-wide association analysis and genetic architecture of egg weight and egg uniformity in
layer chickens. /A. Wolc, J Arango, P. Settar, JE. Fulton, NP. O'Sullivan, R. Preisinger, D. Habier,
R. Fernando, DJ. Garrick, WG. Hill, JC. Dekkers //Anim Genet. — 2012 — V. 43 — P. 87–96.
4. ŇÍÓ‚‡ é. û. ëÓÁ‰‡ÌË ÒËÒÚÂÏ˚ „ÂÌÓÚËÔËÓ‚‡ÌËfl Gallus Gallus ÔÓ ‡ÎÎÂÎflÏ RSNP („ÛÎflÚÓÌ˚ı ÏÓÌÓÌÛÍÎÂÓÚˉÌ˚ı ÔÓÎËÏÓÙÌ˚ı Ò‡ÈÚÓ‚), Ó͇Á˚‚‡˛˘ËÏ ‚ÎËflÌË ̇ ÚÓ΢ËÌÛ ÒÍÓÎÛÔ˚ flȈ‡ /é. û. ŇÍÓ‚‡, Ä. ã. ë‡Á‡ÌÓ‚‡, à. û. Å·„ӂ¢ÂÌÒÍËÈ, ä. Ä. îÓÏ˘‚, í. å‡Î‚ÒÍË, Ä. Ä. ë‡Á‡ÌÓ‚//ÉÂÌÂÚË͇. —
2011. í. 47. — ‹ 2. — ë. 243–248.
5. ŇÍÓ‚‡ é. û. Ä̇ÎËÁ ‡ÒÒӈˇˆËË Ó‰ÌÓÌÛÍÎÂÓÚˉÌÓÈ Á‡ÏÂÌ˚ ‚ ÏÂÊ„ÂÌÌÓÏ ‡ÈÓÌ ıÓÏÓÒÓÏ˚ 4 Ò ÔËÁ͇̇ÏË, ÓÔ‰ÂÎfl˛˘ËÏË Í‡˜ÂÒÚ‚‡ flȈ‡ ‰Óχ¯ÌÂÈ ÍÛˈ˚ / é. û. ŇÍÓ‚‡, å. É. ëχ‡„‰Ó‚ //ÉÂÌÂÚË͇. — 2013. — í. 49. — ‹ 7. — ë. 243–248.
Влияние субъединицы CAP-G комплекса конденсина I на признаки яйца домашней курицы
13
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 14
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
4/2014
6. Tuiskula-Haavisto, M. Genome-wide significant QTL for egg quality and production in egg-layers. / M.
Tuiskula-Haavisto, M. Honkatukia, J. Vikki, D. De Konig, N. Schulman, A. Maki-Tanila //Proceeding
of the 2th poultry Genetics Symposium, Godollo. — 2001 — P. 128.
7. Hirano, T. Condensins, chromosome condensation protein complexes containing XCAP-C, XCAP-E and
a Xenopus homolog of the Drosophila Barren protein./T. Hirano, R. Kobayashi, M. Hirano //Cell-1997- V.
89 — P. 511–521.
8. Sutani, T. Fission yeast condensin complex: Essential roles of non-SMC subunits for condensation and
cdc2 phosphorylation of Cut3/SMC4./T. Sutani, T. Yuasa, T. Tomonaga, N. Dohmae, K. Takio, M. Yanagida. //Genes Dev — 1999 — P. 13 — V. 2271–2283.
9. Gerlich, D. Condensin I stabilizes chromosomes mechanically through a dynamic interaction in living cells./
D. Gerlich, T. Hirota, B. Koch, J-M. Peters, Ellenberg //J Curr Biol — 2006 — V. 16 — P. 333–344.
10. Yeong F. M. Identification of a subunit of a novel kleisin-β/SMC complex as a potential substrate of
protein phosphatase 2A./F. M. Yeong, H. Hombauer, K. S. Wendt, T. Hirota, I. Mudrak, K. Mechtler,
T. Loregger, A. Marchler-Bauer, K. Tanaka, J-M. Peters //Curr Biol — 2003 — V.13 — P. 2058–2064.
11. Ono, T. Spatial and temporal regulation of condensins I and II in mitotic chromosome assembly in human
cells./Ono T., Fang Y., Spector D., Hirano T. //Mol Biol Cell — 2004 — V. 15 — P. 3296–3308.
12. Ribeiro, S. Condensin regulates the stiffness of vertebrate centromeres./ S. Ribeiro, J. Gatlin, Y. Dong,
A. Joglekar, L. Cameron, D. Hudson, C. Farr, B. McEwen, E .Salmon, W. Earnshaw //Mol Biol Cell —
2009 — V. 20 — P 2371–2380.
13. Oliveira R. A. The condensin I subunit Barren/CAP-H is essential for the structural integrity of centromeric
heterochromatin during mitosis./RA. Oliveira, P. A. Coelho, C. E. Sunkel //Mol Cell Biol. — 2005 —
V. 25 — P. 8971–8984.
14. Hirano, T. Condensins: Organizing and segregating the genome./T. Hirano //Curr Biol-2005 — V. 15 —
P. 265–275.
15. Hudson D. F. Molecular and genetic analysis of condensin function in vertebrate cells./D. F. Hudson,
S. Ohta, T. Freisinger, F. Macisaac, L. Sennels, F. Alves, F. Lai, A. Kerr, J. Rappsilber, W. Earnshaw //
Mol Biol Cell — 2008 — V. 19 — P. 3070–3079.
16. Wood A. J. Condensin and cohesin complexity: The expanding repertoire of functions./A. J. Wood, A. F. Severson, B. J. Meyer //Nat Rev Genet — 2010 — V. 11 — P. 391–404
17. Hirano T. At the heart of the chromosome: SMC proteins in action./T. Hirano //Nat Rev Mol Cell Biol —
2006 — V. 7 — P. 311–322.
18. Neuwald A. F. and Hirano T. HEAT repeats associated with condensins, cohesins and other chromosome-related complexes./A. F. Neuwald, T. Hirano //Genome. — 2000 — V. 10 — P. 1445–1452.
Barkova O. I., Loscutov S. I., Smaragdov M. G.
Affection of CAP-G subunit complex condensin I with eggs traits
of domestic chicken
Abstract. The association of gene NCAPG that affects on the eggs trait of domestic chicken has been examined. A significant association of rs 14491030 alleles of NCAPG gene was revealed with such traits as mass of
eggshell, percentage of eggshell weight / egg weight, as well as the thickness of the eggshell of Gallus gallus.
Substitution of G to A allele results in an increase in egg weight, shell thickness and percentage of eggshell
weight / egg weight. At the same time, significant negative effect on the studied traits of substitution allele G
on A was not revealed.
Keywords: condensin I, NCAPG gene, genotype, Rhode-Island breed, domestic chicken, eggs traits.
Authors:
Barkova Olga Iurevna — candidate of Biological Science, Senior Researcher, Laboratory of Molecular Organization of a Genome, Russian Research Institute of Farm Animal Genetics & Breeding; e-mail: [email protected];
Loscutov Svyatoslav Igorevich — candidate of Agricultural Science, Senior Researcher, Laboratory of Molecular Organization of a Genome, Russian Research Institute of Farm Animal Genetics & Breeding;
Smaragdov Michael Grigorievich — candidate of Biological Science, Head of the Laboratory of Molecular Organization of a Genome, Russian Research Institute of Farm Animal Genetics & Breeding, e-mail: [email protected]
14
О. Ю. Баркова и др. ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 15
Рубрика: Генетика и разведение животных
УДК 636.2:612.621
Т. И. Кузьмина, И. П. Шейко, А. И. Ганджа, К. П. Брюсов
Развитие доимплантационных эмбрионов bos taurus и sus scrofa
domesticus, полученных из девитрифицированных ооцитов
Аннотация. Проанализированы цитоморфологические показатели качества эмбрионов коров и свиней,
полученных из девитрифицированных ооцитов после оплодотворения in vitro. Предложены системы дозревания женских гамет, модернизированные преинкубацией ооцитов в жидкости фолликулов малого
диаметра до витрификации, позволившие получить до 10% эмбрионов коров и 7% эмбрионов свиней на
стадиях поздней морулы и бластоцисты.
Ключевые слова: ооцит, витрификация, эмбрион, корова, свинья.
Авторы:
Кузьмина Татьяна Ивановна — доктор биологических наук, профессор, зав. лабораторией биологии
развития, ВНИИГРЖ, Санкт-Петербург-Пушкин, Московское шоссе, 55а, e-mail: [email protected];
Шейко Иван Павлович — доктор сельскохозяйственных наук, профессор, член-корреспондент Национальной академии наук Беларуси Первый заместитель генерального директора, Республиканское унитарное предприятие «Научно-практический центр Национальной академии наук Беларуси по животноводству», Беларусь, Минская обл., г.Жодино, ул. Фрунзе, 11, e-mail: [email protected];
Ганджа Алла Ивановна — кандидат сельскохозяйственных наук, заведующая лабораторией, Республиканское унитарное предприятие «Научно-практический центр Национальной академии наук Беларуси
по животноводству», Беларусь, Минская обл., г. Жодино, ул. Фрунзе, 11, e-mail: [email protected];
Брюсов Клаус-Питер — доктор биологических наук, профессор, Лейбницкий Институт биологии сельскохозяйственных животных, заместитель главы отдела репродуктивной биологии, Wilhelm-Stahl-Allee 2,
18196, Думмерсторф, Германия, телефон. +49 (0) 38208-68770, электронная почта: [email protected]
ǂ‰ÂÌËÂ. Ç ÔÓÒΉÌË „Ó‰˚ ÔÓ‰Ó‚ÓθÒÚ‚ÂÌ̇fl
ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌ̇fl Ó„‡ÌËÁ‡ˆËfl ééç (FAO)
‡ÍÚË‚ÌÓ ‚‰ÂÚ ‡·ÓÚ˚ ÔÓ ÒÓÁ‰‡Ì˲ „ÎÓ·‡Î¸ÌÓÈ ÔÓ„‡ÏÏ˚ ‰Îfl ÏÓÌËÚÓËÌ„‡ Ë ÛÔ‡‚ÎÂÌËfl „ÂÌÂÚ˘ÂÒÍËÏË ÂÒÛÒ‡ÏË ÊË‚ÓÚÌ˚ı, ‚ ÍÓÚÓÓÈ ‚‡ÊÌÓÂ
Á̇˜ÂÌË ËÏÂÂÚ ÍËÓÍÓÌÒÂ‚‡ˆËfl „‡ÏÂÚ Ë ˝Ï·ËÓÌÓ‚. äÎÂÚÓ˜Ì˚ ÂÔÓ‰ÛÍÚË‚Ì˚ ÚÂıÌÓÎÓ„ËË Ë„‡˛Ú Ó„ÓÏÌÛ˛ Óθ Ì ÚÓθÍÓ ‚ ¯ÂÌËË Á‡‰‡˜
ÔÓÎÛ˜ÂÌËfl ‚˚ÒÓÍÓÔÓ‰ÛÍÚË‚Ì˚ı ÊË‚ÓÚÌ˚ı ‰Îfl
ıÓÁflÈÒÚ‚ÂÌÌ˚ı Ë ·ËÓωˈËÌÒÍËı ˆÂÎÂÈ, ÌÓ Ë ‚ ÒÓı‡ÌÂÌËË „ÂÌÂÚ˘ÂÒÍËı ÂÒÛÒÓ‚ (ÒÓÁ‰‡ÌË ÍËÓ·‡ÌÍÓ‚ „‡ÏÂÚ, ˝Ï·ËÓÌÓ‚) Ó‰Óχ¯ÌÂÌÌ˚ı Ë ËÒ˜ÂÁ‡˛˘Ëı ‚ˉӂ ÊË‚ÓÚÌ˚ı. ê‡Á‡·ÓÚ͇ ˝ÙÙÂÍÚË‚Ì˚ı
ÚÂıÌÓÎÓ„ËÈ ÍËÓÍÓÌÒÂ‚‡ˆËË ‰ÓÌÓÒÍËı ÓÓˆËÚÓ‚
ÊË‚ÓÚÌ˚ı ÔÓÁ‚ÓÎËÚ ËÌÚÂÌÒËÙˈËÓ‚‡Ú¸ ÚÂıÌÓÎÓ„ËË
ÍÎÓÌËÓ‚‡ÌËfl, Ú‡ÌÒ„ÂÌÂÁ‡, Ú.Í. Ó·ÂÒÔ˜ËÚ ‚ ‰ÓÒÚ‡ÚÓ˜ÌÓÈ ÏÂ ˜ËÒÎÓ ‰ÓÌÓÒÍËı ÓÓˆËÚÓ‚, ‡, Á̇˜ËÚ,
Ë ÍÓ΢ÂÒÚ‚Ó ˆËÚÓÔ·ÒÚÓ‚ Ë ÁË„ÓÚ, ÌÂÓ·ıÓ‰ËÏ˚ı
‚ ͇˜ÂÒÚ‚Â ˆËÔËÂÌÚÓ‚ ‰Îfl ÔÂÂÌÓÒ‡ ‚ ÌËı fl‰Â
ËÎË „ÂÌÓ‚.
Ç Ì‡ÒÚÓfl˘Â ‚ÂÏfl ËÒÒΉӂ‡ÚÂÎË ‡Á‡·‡Ú˚‚‡˛Ú ÌÂÒÍÓθÍÓ ÔÓ‰ıÓ‰Ó‚ Í ÍËÓÍÓÌÒÂ‚‡ˆËË
ÓÓˆËÚÓ‚ ÏÎÂÍÓÔËÚ‡˛˘Ëı: ωÎÂÌÌÓ Á‡ÏÓ‡ÊË‚‡ÌË ËÎË ‚ËÚËÙË͇ˆËfl ˆÂÎÓ„Ó fl˘ÌË͇, Ú͇ÌË
fl˘ÌË͇ (ÒÂ͈ËË, ÍÓÚÂÍÒ‡) Ë ÊÂÌÒÍÓÈ „‡ÏÂÚ˚ [1,
2, 3. 4]. ÑÎfl ÓÓˆËÚÓ‚, Í‡Í ÔÓ͇Á˚‚‡ÂÚ ‡Ì‡ÎËÁ ‰‡ÌÌ˚ı ÎËÚÂ‡ÚÛ˚, ‚ËÚËÙË͇ˆËfl Ô‰ÒÚ‡‚ÎflÂÚÒfl,
Í‡Í Ì‡Ë·ÓΠ˝ÙÙÂÍÚË‚Ì˚È ÏÂÚÓ‰ ÍËÓÍÓÌÒÂ‚‡ˆËË ÔÓ Ò‡‚ÌÂÌ˲ Ò Ï‰ÎÂÌÌ˚Ï Á‡ÏÓ‡ÊË‚‡ÌËÂÏ
[5]. éÓˆËÚ-ÍÛÏÛβÒÌ˚ ÍÓÏÔÎÂÍÒ˚ ‰Îfl Ôӈ‰Û˚
‚ËÚËÙË͇ˆËË ËÁ‚ÎÂ͇˛ÚÒfl ËÁ fl˘ÌËÍÓ‚ ÊË‚ÓÚÌ˚ı
post mortem ËÎË ËÁ ‡ÌÚ‡Î¸Ì˚ı ÙÓÎÎËÍÛÎÓ‚ ÊË‚˚ı ÓÒÓ·ÂÈ Ú‡ÌÒ‚‡„Ë̇θÌÓÈ ‡ÒÔË‡ˆËÂÈ (Ovum
pick up technology). çÂÒÏÓÚfl ̇ ÚÓ, ˜ÚÓ ËÒÒΉӂ‡ÌËfl ÔÓ ‚ËÚËÙË͇ˆËË ÓÓˆËÚÓ‚ ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı ‡ÍÚË‚ËÁËÓ‚‡ÎËÒ¸ ‚ ÔÓÒΉÌË 10 ÎÂÚ, ‚˚ıÓ‰ ÊËÁÌÂÒÔÓÒÓ·Ì˚ı ˝Ï·ËÓÌÓ‚ ̇
ÒÚ‡‰ËË ·Î‡ÒÚÓˆËÒÚ˚, ÔË„Ó‰Ì˚ı ‰Îfl Ú‡ÌÒÔ·ÌÚ‡ˆËË Ì‚˚ÒÓÍ, ÔÓ Ò‡‚ÌÂÌ˲ Ò ˝Ï·ËÓ̇ÏË, ÔÓÎÛ˜ÂÌÌ˚ÏË ËÁ ̇ÚË‚Ì˚ı ÓÓˆËÚÓ‚, ÒÓÁ‚¯Ëı in vivo
ËÎË in vitro. ñÂθ ̇ÒÚÓfl˘Â„Ó ËÒÒΉӂ‡ÌËfl —
ÓÔÚËÏËÁËÓ‚‡Ú¸ ˝Ú‡Ô˚ ÚÂıÌÓÎÓ„ËË ‚ËÚËÙË͇ˆËË
ÓÓˆËÚÓ‚ ÍÓÓ‚ Ë Ò‚ËÌÂÈ Ì‡ ÒÚ‡‰ËË ‰ËÔÎÓÚÂÌ˚ ‰Îfl
ÔÓÎÛ˜ÂÌËfl ËÁ ÌËı ‰ÓËÏÔ·ÌÚ‡ˆËÓÌÌ˚ı ˝Ï·ËÓÌÓ‚
in vitro.
ìÒÎÓ‚Ëfl, χÚÂˇÎ˚ Ë ÏÂÚÓ‰˚ ËÒÒΉӂ‡ÌËÈ.
å‡ÚÂˇÎÓÏ ‰Îfl ËÒÒΉӂ‡ÌËÈ ÒÎÛÊËÎË ÓÓˆËÚÍÛÏÛβÒÌ˚ ÍÓÏÔÎÂÍÒ˚, ‚˚‰ÂÎÂÌÌ˚ ËÁ ‡ÌÚ‡Î¸Ì˚ı ÙÓÎÎËÍÛÎÓ‚ Ò‚ËÌÂÈ (ÔÓÓ‰˚ ·̉‡Ò) Ë ÍÓÓ‚
post mortem. ÇËÚËÙË͇ˆË˛ ÓÓˆËÚÓ‚ ÔÓ‚Ó‰ËÎË
ÔÓÒΠËÁ‚ΘÂÌËfl ËÁ ÙÓÎÎËÍÛÎÓ‚ (̇ ÒÚ‡‰ËË ‰ËÔÎÓÚÂÌ˚). Ç ˝ÍÒÔÂËÏÂÌÚ‡ı ËÒÔÓθÁÓ‚‡ÎË ÓÓˆËÚ˚,
ÓÍÛÊÂÌÌ˚ Ì ÏÂÌ ˜ÂÏ 5–6 ÒÎÓ‚ ÍÛÏÛβÒÌ˚ı
ÍÎÂÚÓÍ, Ò ‡‚ÌÓÏÂÌÓÈ ÔÓ ¯ËËÌ ÁÓÌÓÈ ÔÂÎβˆË‰‡,
Развитие доимплантационных эмбрионов bos taurus и sus scrofa domesticus,
полученных из девитрифицированных ооцитов
15
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 16
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
„ÓÏÓ„ÂÌÌÓÈ ÓÓÔ·ÁÏÓÈ. éÓˆËÚ˚, Ô‰̇Á̇˜ÂÌÌ˚Â
‰Îfl ‚ËÚËÙË͇ˆËË, Ó·‡·‡Ú˚‚‡ÎËÒ¸ ÚÂÏfl ‡ÒÚ‚Ó‡ÏË ÍËÓÔÓÚÂÍÚÓÓ‚ (ëêÄ), ÔË„ÓÚÓ‚ÎÂÌÌ˚ÏË Ì‡ Ò‰ íë-199 Ò 10% ÙÂڇθÌÓÈ ·˚˜¸ÂÈ Ò˚‚ÓÓÚÍË (îÅë, HyClone, Logan, UT). CPA-1:
0.7 M ‰ËÏÂÚËÎÒÛθÙÓÍÒˉ (Ñåëé) + 0.9 M ˝ÚËÎÂÌ„ÎËÍÓÎfl (ùÉ); CPA-2: 1.4 M Ñåëé + 1.8 M
ùÉ; CPA-3: 2.8 M Ñåëé + 3.6 M ùÉ + 0.65 M
Ú„‡ÎÓÁ‡. éÓˆËÚ-ÍÛÏÛβÒÌ˚ ÍÓÏÔÎÂÍÒ˚ ÔÓ˝Ú‡ÔÌÓ ˝ÍÒÔÓÌËÓ‚‡ÎË ‚ Ú˜ÂÌË 30 ÒÂÍ ‚ ëêÄ-1, Á‡ÚÂÏ
‚ ëêÄ-2 Ë 20 ÒÂÍÛ̉ ‚ ëêÄ-3. è‡ÈÂÚ˚ Ò ÓÓˆËÚ‡ÏË
ÔÓÏ¢‡ÎË ‚ ÊˉÍËÈ ‡ÁÓÚ. éÓˆËÚ-ÍÛÏÛβÒÌ˚ ÍÓÏÔÎÂÍÒ˚ ËÁ‚ÎÂ͇ÎË ËÁ Ô‡ÈÂÚ Ì ‡Ì¸¯Â, ˜ÂÏ ˜ÂÂÁ
60 ÏËÌÛÚ, Ë ÔÓÏ¢‡ÎË ‚ 0,25 å Ú„‡ÎÓÁÛ ‚ íë199 Ò 10% îÅë ÔË 370ë, ÓÚÏ˚‚‡ÎË ‚ 0,19 å,
Á‡ÚÂÏ ‚ 0,125 å Ú„‡ÎÓÁÂ, ÓÍÓ̘‡ÚÂθÌÓ ‚ íë-199.
éÚ·Ó ÓÓˆËÚ-ÍÛÏÛβÒÌ˚ı ÍÓÏÔÎÂÍÒÓ‚, ÓˆÂÌÍÛ Í‡˜ÂÒÚ‚‡ ÙÓÎÎËÍÛÎÓ‚, ÔÓÎÛ˜ÂÌË ÙÓÎÎËÍÛÎflÌÓÈ
ÊˉÍÓÒÚË, ÔÓ‚Ó‰ËÎË ÏÂÚÓ‰‡ÏË, ÓÔËÒ‡ÌÌ˚ÏË Ì‡ÏË
‡Ì [6]. êÂÊËÏ˚ ÍÛθÚË‚ËÓ‚‡ÌËfl Ë ÓÔÎÓ‰ÓÚ‚ÓÂÌËfl ÓÓˆËÚÓ‚ Ò‚ËÌÂÈ Ë ÍÓÓ‚ in vitro, ‡ Ú‡ÍÊÂ
ÍÛθÚË‚ËÓ‚‡ÌËfl ‰ÓËÏÔ·ÌÚ‡ˆËÓÌÌ˚ı ˝Ï·ËÓÌÓ‚
Ô‰ÒÚ‡‚ÎÂÌ˚ ‚ ÏÂÚӉ˘ÂÒÍËı ÂÍÓÏẨ‡ˆËflı, ‡Á‡·ÓÚ‡ÌÌ˚ı ‚ ··Ó‡ÚÓËË ·ËÓÎÓ„ËË ‡Á‚ËÚËfl
îÉÅçì ÇçààÉêÜ Ë Òڇڸ [7, 8, 9]. ëÚ‡ÚÛÒ ıÓχÚË̇ ÓÓˆËÚÓ‚ Ë ˝Ï·ËÓÌÓ‚ ÓˆÂÌË‚‡ÎË ÔÓ ÏÂÚÓ‰Û A. Tarkowski [10].
ÑÎfl Ò‡‚ÌÂÌËfl ÂÁÛθڇÚÓ‚, ÔÓÎÛ˜ÂÌÌ˚ı ‚ ÓÔ˚ÚÌ˚ı Ë ÍÓÌÚÓθÌ˚ı „ÛÔÔ‡ı, ËÒÔÓθÁÓ‚‡ÎË ÍËÚÂËÈ χ2, ‰‡ÌÌ˚ ӷ‡·ÓÚ‡Ì˚ Ò ÔÓÏÓ˘¸˛ ÒÚ‡ÚËÒÚ˘ÂÒÍÓÈ ÔÓ„‡ÏÏ˚ Sigma Stat. ÑÓÒÚÓ‚ÂÌÓÒÚ¸
‡Á΢Ëfl Ò‡‚ÌË‚‡ÂÏ˚ı Ò‰ÌËı Á̇˜ÂÌËÈ ÓˆÂÌË‚‡ÎË ÔË ÚÂı ÛÓ‚Ìflı Á̇˜ËÏÓÒÚË: P<0,05;
P<0,01; P<0,001, ‰Îfl 3 ÌÂÁ‡‚ËÒËÏ˚ı ˝ÍÒÔÂËÏÂÌÚÓ‚.
Ä̇ÎËÁ Ë Ó·ÒÛʉÂÌË ÂÁÛθڇÚÓ‚. ê‡Á‡·ÓÚ‡Ì̇fl ̇ÏË ‡Ì ÏÓ‰Âθ Ò‰˚ ÒÓÁ‚‡ÌËfl ÓÓˆËÚÓ‚ ÍÓÓ‚ ̇ ÓÒÌÓ‚Â íë-199, Ò ‰Ó·‡‚ÎÂÌËÂÏ 10%
Ò˚‚ÓÓÚÍË ˝Ï·ËÓÌÓ‚ ÍÛÔÌÓ„Ó Ó„‡ÚÓ„Ó ÒÍÓÚ‡,
50 Ì„/ÏÎ ·˚˜¸Â„Ó ÔÓ·ÍÚË̇ Ë ÍÓÍÛθÚË‚ËÓ‚‡ÌËÂÏ ÓÓˆËÚ-ÍÛÏÛβÒÌ˚ı ÍÓÏÔÎÂÍÒÓ‚ ÒÓ‚ÏÂÒÚÌÓ
Ò ÍÎÂÚ͇ÏË „‡ÌÛÎÂÁ˚ (106 ÍÎÂÚÓÍ „‡ÌÛÎÂÁ˚ ̇
ÏÎ Ò‰˚) ÔÓÁ‚ÓÎflÂÚ ÔÓÎÛ˜‡Ú¸ ‰Ó 40% ˝Ï·ËÓÌÓ‚
̇ ÒÚ‡‰ËË ·Î‡ÒÚÓˆËÒÚ˚ Ò ‚˚ÒÓÍËÏË Í‡˜ÂÒÚ‚ÂÌÌ˚ÏË ı‡‡ÍÚÂËÒÚË͇ÏË [11]. ìÒÔ¯ÌÓÈ ‰Îfl ÔÓÎÛ˜ÂÌËfl Ò‚ËÌ˚ı ˝Ï·ËÓÌÓ‚ Ó͇Á‡Î‡Ò¸ ÏÓ‰Âθ Ò‰˚
ÒÎÂ‰Û˛˘Â„Ó ÒÓÒÚ‡‚‡: NCSU 23 — ÒËÌÚÂÚ˘ÂÒ͇fl
ÔËÚ‡ÚÂθ̇fl Ò‰‡, ‰ÓÔÓÎÌÂÌ̇fl 10 å.Ö. ıÓËÓÌ˘ÂÒÍÓ„Ó „Ó̇‰ÓÚÓÔË̇ ˜ÂÎÓ‚Â͇, å.Ö. ıÓËÓÌ˘ÂÒÍÓ„Ó „Ó̇‰ÓÚÓÔË̇ ÎÓ¯‡‰Ë, 10% ÙÓÎÎËÍÛÎflÌÓÈ ÊˉÍÓÒÚ¸ (‰Ë‡ÏÂÚ ÙÓÎÎËÍÛÎÓ‚ 3–5 ÏÏ).
äÛθÚË‚ËÓ‚‡ÌË ÓÓˆËÚ-ÍÛÏÛβÒÌ˚ı ÍÓÏÔÎÂÍÒÓ‚
ÔÓ‚Ó‰ËÎË Ì‡ ÒÚÂÌ͇ı ÙÓÎÎËÍÛÎÓ‚, ÔÓÏ¢ÂÌÌ˚ı
̇ ‰ÌÓ ˜‡¯ÍË èÂÚË, ‚ Ú˜ÂÌË 44 ˜‡ÒÓ‚ êÂÁÛθڇÚË‚ÌÓÒÚ¸ ËÒÔÓθÁÓ‚‡ÌËfl Ú‡ÍÓÈ ÒËÒÚÂÏ˚ ‚˚‡-
16
4/2014
ʇ·Ҹ ‚ ‚˚ıӉ ˝Ï·ËÓÌÓ‚ ̇ ÒÚ‡‰ËË ÔÓÁ‰ÌÂÈ
ÏÓÛÎ˚ — ·Î‡ÒÚÓˆËÒÚ˚ ‰Ó 45% [9]. éÒÌÓ‚˚‚‡flÒ¸
̇ ‚˚¯ÂËÁÎÓÊÂÌÌÓÏ, ‚ ̇¯Ëı ˝ÍÒÔÂËÏÂÌÚ‡ı Ï˚
ËÒÔÓθÁÓ‚‡ÎË ËÏÂÌÌÓ ˝ÚË ÏÓ‰ÂÎË ‰Îfl ÒÓÁ‚‡ÌËfl
‰Â‚ËÚËÙˈËÓ‚‡ÌÌ˚ı ÓÓˆËÚÓ‚ ËÒÒΉÛÂÏ˚ı ‚ˉӂ ÊË‚ÓÚÌ˚ı. ïÓχÚËÌ ÓÓˆËÚÓ‚, ‚˚‰ÂÎÂÌÌ˚ı
ËÁ fl˘ÌËÍÓ‚ ÊË‚ÓÚÌ˚ı post mortem, ̇ıÓ‰ËÚÒfl ̇
ÒÚ‡‰ËË ‰ËÔÎÓÚÂÌ˚. à‰ÂÌÚËÙˈËÓ‚‡Ì˚ ÚË ÚËÔ‡
‰ËÔÎÓÚÂÌ: ‰ËÙÙÛÁ̇fl, ÙË·ËÎÎfl̇fl Ë ‚ˉËÏ˚ı
·Ë‚‡ÎÂÌÚÓ‚, ÒÚÛÍÚÛ‡ ÔÂ‚˚ı ‰‚Ûı Ô‰ÒÚ‡‚ÎÂ̇
ÚÓÌÍËÏË ÌËÚflÏË ıÓÏÓÒÓÏ. éÒÓ·ÂÌÌÓÒÚ¸ ÒÚÛÍÚÛ˚ ıÓÏÓÒÓÏ Ì‡ ˝ÚÓÈ ÒÚ‡‰ËË ÏÂÈÓÁ‡ Ó·˙flÒÌflÂÚ
ÛflÁ‚ËÏÓÒÚ¸ ÓÓˆËÚ‡, ‚ ‰‡ÌÌÓÏ ÒÎÛ˜‡Â ·Óθ¯Û˛ ‚ÂÓflÚÌÓÒÚ¸ ÍËÓÔÓ‚ÂʉÂÌËÈ ‚ ÓÓˆËÚÂ. Ç Ò‚ÓËı ËÒÒΉӂ‡ÌËflı Ï˚ ËÒıÓ‰ËÎË ËÁ ÒÎÂ‰Û˛˘Ëı Á‡Íβ˜ÂÌËÈ: ÔÂËÌÍÛ·‡ˆËfl ÊÂÌÒÍÓÈ „‡ÏÂÚ˚ ‚ ÊˉÍÓÒÚË
ÙÓÎÎËÍÛÎÓ‚ χÎÓ„Ó ‰Ë‡ÏÂÚ‡, ‚Ó-ÔÂ‚˚ı, Á‡Ï‰ÎËÚ ÔÓˆÂÒÒ ÂËÌˈˇˆËË ÏÂÈÓÁ‡, ÍÓÚÓ˚È ËÏÂÂÚ
ÏÂÒÚÓ ÔÓÒΠËÁ‚ΘÂÌËfl ÓÓˆËÚ‡ ËÁ ÏËÍÓÓÍÛÊÂÌËfl ÙÓÎÎËÍÛ·, Ú.Í. ‡Ì ̇ÏË ·˚ÎÓ ÔÓ͇Á‡ÌÓ,
˜ÚÓ ÌËÁÍÓÏÓÎÂÍÛÎflÌ˚Â ·ÂÎÍË ÙÓÎÎËÍÛÎflÌÓÈ
ÊˉÍÓÒÚË ËÌ„Ë·ËÛ˛Ú ÂËÌˈˇˆË˛ ÏÂÈÓÁ‡, Ë, ÚÂÏ
Ò‡Ï˚Ï, ÛÏÂ̸¯‡ÂÚÒfl ‚ÂÓflÚÌÓÒÚ¸ ÔÓ‚ÂʉÂÌËfl
ÚÓÌÍÓÈ ÒÚÛÍÚÛ˚ ıÓχÚË̇, ‡, ‚Ó-‚ÚÓ˚ı, ‚ÒΉÒÚ‚Ë ‚˚ÒÓÍÓÈ ‚flÁÍÓÒÚË ÊˉÍÓÒÚË ÙÓÎÎËÍÛÎÓ‚
Á‡ÚÛ‰ÌflÂÚÒfl Ó·‡ÁÓ‚‡ÌË ÍËÒÚ‡ÎÎÓ‚ [12, 13].
ÑÎfl ÔÂËÌÍÛ·‡ˆËË ÓÓˆËÚÓ‚ Í‡Ê‰Ó„Ó ‚ˉ‡ ÊË‚ÓÚÌÓ„Ó ËÒÔÓθÁÓ‚‡ÎË „ÓÏÓÎӄ˘ÌÛ˛ Ë̇ÍÚË‚ËÓ‚‡ÌÌÛ˛ ÙÓÎÎËÍÛÎflÌÛ˛ ÊˉÍÓÒÚ¸ ËÁ ÙÓÎÎËÍÛÎÓ‚
‰Ë‡ÏÂÚÓÏ Ì ·ÓΠ3 ÏÏ. ä‡Í ÔÓ͇Á‡ÎË Ô‰˚‰Û˘Ë ËÒÒΉӂ‡ÌËfl, ÒÓÁ‚¯Ë ̇ÚË‚Ì˚Â Ë ‰Â‚ËÚËÙˈËÓ‚‡ÌÌ˚ ÓÓˆËÚ˚, Ô‰‚‡ËÚÂθÌÓ ÔÂËÍÛ·ËÓ‚‡ÌÌ˚ ‚ ÙÓÎÎËÍÛÎflÌÓÈ ÊˉÍÓÒÚË, ÔÓÒÎÂ
ÍÛθÚË‚ËÓ‚‡ÌËfl ·˚ÎË ÓÍÛÊÂÌ˚ ÍÛÏÛβÒÓÏ Ò ‚˚ÒÓÍÓÈ ÒÚÂÔÂ̸˛ ˝ÍÒÔ‡ÌÒËË (‰Ó 80%) [14]. éÓˆËÚ˚, Ì Ôӯ‰¯Ë ÔÂËÌÍÛ·‡ˆË˛ ‚ ÙÓÎÎËÍÛÎflÌÓÈ
ÊˉÍÓÒÚË, ËÏÂÎË ÌËÁÍË ÔÓ͇Á‡ÚÂÎË ˝ÍÒÔ‡ÌÒËË
ÍÛÏÛβÒÌ˚ı ÍÎÂÚÓÍ (45%). èÓÒΉÌËÈ Ù‡ÍÚ Ò‚Ë‰ÂÚÂθÒÚ‚ÛÂÚ ‚ ÔÓθÁÛ ÔÓÁËÚË‚ÌÓ„Ó ‚ÎËflÌËË ÙÓÎÎËÍÛÎflÌÓÈ ÊˉÍÓÒÚË Ì‡ ‚ËÚËÙË͇ˆË˛ ÍÛÏÛβÒÌ˚ı ÍÎÂÚÓÍ, ‡, ‡ÔËÓË, Ë ÓÓˆËÚÓ‚, Ú.Í. Ó‰ÌËÏ ËÁ
χÍÂÓ‚ ÛÒÔ¯ÌÓ„Ó ÒÓÁ‚‡ÌËfl ÓÓˆËÚÓ‚ in vitro
fl‚ÎflÂÚÒfl ÛÓ‚Â̸ ˝ÍÒÔ‡ÌÒËË ÍÎÂÚÓÍ ÍÛÏÛÎ˛Ò‡.
àÒÒΉӂ‡Ì˲ ÔÓ‰‚Â„ÎËÒ¸ ÒÎÂ‰Û˛˘Ë ˝ÍÒÔÂËÏÂÌڇθÌ˚ „ÛÔÔ˚: ÓÓˆËÚ-ÍÛÏÛβÒÌ˚ ÍÓÏÔÎÂÍÒ˚, ‚˚‰ÂÎÂÌÌ˚ ËÁ ÙÓÎÎËÍÛÎÓ‚ Ë ÔÓÍÛθÚË‚ËÓ‚‡ÌÌ˚ ‚ Ú˜ÂÌË 24 ˜‡ÒÓ‚ ‰Îfl ÓÓˆËÚÓ‚
ÍÓÓ‚ Ë 44 ‰Îfl ÓÓˆËÚÓ‚ Ò‚ËÌÂÈ [̇ÚË‚Ì˚ ÓÓˆËÚ˚
(-)]; ÓÓˆËÚ-ÍÛÏÛβÒÌ˚ ÍÓÏÔÎÂÍÒ˚, ‚˚‰ÂÎÂÌÌ˚Â
ËÁ ÙÓÎÎËÍÛÎÓ‚ Ë ËÌÍÛ·ËÓ‚‡ÌÌ˚ ‚ Ú˜ÂÌË 30 ÏËÌÛÚ ‚ ÊˉÍÓÒÚË ÙÓÎÎËÍÛÎÓ‚ ‰Ë‡ÏÂÚÓÏ ‰Ó 3 ÏÏ,
Á‡ÚÂÏ ÔÓÍÛθÚË‚ËÓ‚‡ÌÌ˚ ‚ Ú˜ÂÌË 24 ˜‡ÒÓ‚
‰Îfl ÓÓˆËÚÓ‚ ÍÓÓ‚ Ë 44 ‰Îfl ÓÓˆËÚÓ‚ Ò‚ËÌÂÈ [̇ÚË‚Ì˚ ÓÓˆËÚ˚ (+)]; ÓÓˆËÚ-ÍÛÏÛβÒÌ˚ ÍÓÏÔÎÂÍÒ˚, ‚˚‰ÂÎÂÌÌ˚ ËÁ ÙÓÎÎËÍÛÎÓ‚, ÔÓ‰‚Â„‡ÎËÒ¸ ÔÓТ. И. Кузьмина и др. ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 17
Рубрика: Генетика и разведение животных
ˆÂ‰Û‡Ï ‚ËÚËÙË͇ˆËË-‰Â‚ËÚËÙË͇ˆËË Ë Á‡ÚÂÏ
ÍÛθÚË‚ËÓ‚‡ÎË ‚ Ú˜ÂÌË 24 ˜‡ÒÓ‚ ‰Îfl ÓÓˆËÚÓ‚
ÍÓÓ‚ Ë 44 ‰Îfl ÓÓˆËÚÓ‚ Ò‚ËÌÂÈ [‰Â‚ËÚËÙˈËÓ‚‡ÌÌ˚ ÓÓˆËÚ˚ (-)]; ÓÓˆËÚ-ÍÛÏÛβÒÌ˚ ÍÓÏÔÎÂÍÒ˚, ‚˚‰ÂÎÂÌÌ˚ ËÁ ÙÓÎÎËÍÛÎÓ‚ Ë ËÌÍÛ·ËÓ‚‡ÌÌ˚ ‚ Ú˜ÂÌË 30 ÏËÌÛÚ ‚ ÊˉÍÓÒÚË ÙÓÎÎËÍÛÎÓ‚
‰Ë‡ÏÂÚÓÏ ‰Ó 3 ÏÏ, ÔÓÒΠ‚ËÚËÙË͇ˆËË-‰Â‚ËÚËÙË͇ˆËË ÍÛθÚË‚ËÓ‚‡ÎË ‚ Ú˜ÂÌË 24 ˜‡ÒÓ‚
‰Îfl ÓÓˆËÚÓ‚ ÍÓÓ‚ Ë 44 ‰Îfl ÓÓˆËÚÓ‚ Ò‚ËÌÂÈ [‰Â‚ËÚËÙˈËÓ‚‡ÌÌ˚ ÓÓˆËÚ˚ (+)];
êÂÁÛθڇÚ˚ ˝ÍÒÔÂËÏÂÌÚÓ‚ ÔÓ ÔÓÎÛ˜ÂÌ˲ ˝Ï·ËÓÌÓ‚ ÍÓÓ‚ Ë Ò‚ËÌÂÈ ËÁ ̇ÚË‚Ì˚ı Ë ‰Â‚ËÚËÙˈËÓ‚‡ÌÌ˚ı ÓÓˆËÚÓ‚, Ô‰ÒÚ‡‚ÎÂÌ˚ ‚ Ú‡·Îˈ‡ı
1 Ë 2. Ç˚ıÓ‰ ˝Ï·ËÓÌÓ‚ ÍÓÓ‚ ̇ ÒÚ‡‰Ëflı ÔÓÁ‰ÌÂÈ
ÏÓÛÎ˚, ·Î‡ÒÚÓˆËÒÚ˚, ‡Á‚Ë‚¯ËıÒfl ËÁ ‰Â‚ËÚËÙˈËÓ‚‡ÌÌ˚ı ÓÓˆËÚÓ‚, ‰ÓÒÚË„‡Î 10%, ‡ Û Ò‚ËÌÂÈ
˝ÚÓÚ ÔÓ͇Á‡ÚÂθ ÒÓÒÚ‡‚ËÎ 7%, ˜ÚÓ ÒÓÓÚ‚ÂÚÒÚ‚ÛÂÚ
ÎÛ˜¯ËÏ ‰ÓÒÚËÊÂÌËflÏ ËÒÒΉӂ‡ÚÂÎÂÈ, Á‡ÌËχ˛˘ËıÒfl ÔÓ·ÎÂχÏË ‚ËÚËÙË͇ˆËË ÓÓˆËÚÓ‚ Ò‚ËÌÂÈ
Ë ÍÓÓ‚ [15, 16]. èÓ͇Á‡ÌÓ, ˜ÚÓ ÔÂËÌÍÛ·‡ˆËfl
ÓÓˆËÚÓ‚ ‰Ó ‚ËÚËÙË͇ˆËË ‚ ÊˉÍÓÒÚË ÙÓÎÎËÍÛÎÓ‚ ‰Ó 3 ÏÏ ÔÓ‚˚¯‡ÂÚ ˜ËÒÎÓ ‰ÓËÏÔ·ÌÚ‡ˆËÓÌÌ˚ı ˝Ï·ËÓÌÓ‚ ÍÓÓ‚ Ë Ò‚ËÌÂÈ (52% ÔÓÚË‚ 33%,
P˂0,05 Ë 31% ÔÓÚË‚ 14%, P˂0,05, ÒÓÓÚ‚ÂÚÒÚ‚ÂÌÌÓ) (Ú‡·Î. 1 Ë 2).
èË ‡ÌÌÂÏ ‡Á‚ËÚËË ˝Ï·ËÓÌÓ‚ ÍÓÓ‚ Ë Ò‚ËÌÂÈ ˜‡ÒÚÓ Ì‡·Î˛‰‡ÂÚÒfl Ëı ‰Â„ÂÌÂ‡ˆËfl, ÓÒÓ·ÂÌÌÓ
‚˚ÒÓÍÓ ˜ËÒÎÓ ‰Â„ÂÌÂËÓ‚‡ÌÌ˚ı Á‡Ó‰˚¯ÂÈ ÔË
ÔÓÎÛ˜ÂÌËË Ëı ËÁ ‰Â‚ËÚËÙˈËÓ‚‡ÌÌ˚ı ÓÓˆËÚÓ‚.
Ç ËÁÎÓÊÂÌÌ˚ı ‰‡Î ÂÁÛθڇڇı ˝ÍÒÔÂËÏÂÌÚÓ‚
ÓˆÂÌË‚‡ÎË ˝Ï·ËÓÌ˚ Ò Û˜ÂÚÓÏ ÒÎÂ‰Û˛˘Ëı ÏÓÙÓÎӄ˘ÂÒÍËı ÍËÚÂË‚: ÍÓÏÔ‡ÍÚÌÓÒÚ¸ ÍÎÂÚÓÍ; Ô‡‚ËθÌÓÒÚ¸ ÙÓÏ˚ ˝Ï·ËÓ̇; ÓÚÍÎÓÌÂÌËfl ‚ ‡ÁÏÂ ÍÎÂÚÓÍ; ˆ‚ÂÚ Ë ÒÚÛÍÚÛ‡; ̇΢ˠ·Óθ¯Ëı
‚ÂÁËÍÛÎ; ÔËÒÛÚÒÚ‚Ë ˝ÍÒÚÛ‰ËÓ‚‡ÌÌ˚ı ˝ÎÂÏÂÌÚÓ‚ ÍÎÂÚÓÍ; ˆÂÎÓÒÚÌÓÒÚ¸ ÁÓÌ˚ ÔÂÎβˆË‰‡; ̇΢ËÂ
Ù‡„ÏÂÌÚÓ‚ ÍÎÂÚÓÍ. èË ˆËÚӇ̇ÎËÁ ۘËÚ˚‚‡ÎË
ÔÎÓˉÌÓÒÚ¸, ÒÓÓÚ‚ÂÚÒÚ‚Ë ˜ËÒ· fl‰Â ÍÓ΢ÂÒÚ‚Û
·Î‡ÒÚÓÏÂÓ‚, ÛÓ‚Â̸ ÔËÍÌÓÁÓ‚. ëΉÛÂÚ ÓÚÏÂÚËÚ¸,
˜ÚÓ ÔË ÏÓÙÓÎӄ˘ÂÒÍÓÈ ÓˆÂÌÍ ˝Ï·ËÓÌÓ‚ ‚Ó
‚ÒÂı „ÛÔÔ‡ı ˝ÍÒÔÂËÏÂÌÚ‡ Ì ӷ̇ÛÊÂÌÓ ‰ÓÒÚÓ‚ÂÌ˚ı ‡Á΢ËÈ ÔÓ ÛÓ‚Ì˛ ˝Ï·ËÓÌÓ‚ Ò ÏÓÙÓÎӄ˘ÂÒÍËÏË ÔËÁ͇̇ÏË ‰Â„ÂÌÂ‡ˆËË (Ú‡·Î. 3).
Ç˚‚Ó‰˚. Ç˚fl‚ÎÂÌ ÔÓÎÓÊËÚÂθÌ˚È ˝ÙÙÂÍÚ ÔÂËÌÍÛ·‡ˆËË ‰ÓÌÓÒÍËı ÓÓˆËÚÓ‚ ÍÓÓ‚ Ë Ò‚ËÌÂÈ
‚ „ÓÏÓÎӄ˘ÌÓÈ ÊˉÍÓÒÚË ÙÓÎÎËÍÛÎÓ‚ ‰Ë‡ÏÂÚÓÏ
‰Ó 3 ÏÏ ÔÂ‰ Ôӈ‰ÛÓÈ ‚ËÚËÙË͇ˆËË, ÍÓÚÓ˚È ‚˚‡Ê‡ÎÒfl ‚ ÔÓ‚˚¯ÂÌËË ‚˚ıÓ‰‡ ‰Ó·fl˘ËıÒfl
ÍÎÂÚÓÍ. è‰ÎÓÊÂ̇ Ò‰‡ ‰Îfl ÍÛθÚË‚ËÓ‚‡ÌËfl
‰Â‚ËÚËÙˈËÓ‚‡ÌÌ˚ı ÓÓˆËÚÓ‚ ÍÓÓ‚ (íë-199 +
10% ÙÂڇθÌÓÈ ·˚˜¸ÂÈ Ò˚‚ÓÓÚÍË + 106 ÍÎÂÚÓÍ/ÏÎ
„‡ÌÛÎÂÁ˚ + 50 Ì„/ÏÎ ·˚˜¸Â„Ó ÔÓ·ÍÚË̇), Ó·ÂÒÔ˜˂‡˛˘‡fl ÔË ÔÓÒÎÂ‰Û˛˘ÂÏ ÓÔÎÓ‰ÓÚ‚ÓÂÌËË
in vitro ‚˚ıÓ‰ ˝Ï·ËÓÌÓ‚ ̇ ÒÚ‡‰Ëflı ÔÓÁ‰ÌÂÈ ÏÓÛÎ˚ Ë ·Î‡ÒÚÓˆËÒÚ˚ ‰Ó 10%. ĉ‡ÔÚËÓ‚‡Ì‡ ÏÓ‰Âθ
˝ÍÒÚ‡ÍÓÔÓ‡Î¸ÌÓ„Ó ‰ÓÁ‚‡ÌËfl ‰Â‚ËÚËÙˈËÓ‚‡ÌÌ˚ı ÓÓˆËÚÓ‚ Ò‚ËÌÂÈ, ÍÓÏÔÓÌÂÌÚ‡ÏË ÍÓÚÓÓÈ
퇷Îˈ‡ 1. ê‡Á‚ËÚË ‰ÓËÏÔ·ÌÚ‡ˆËÓÌÌ˚ı ˝Ï·ËÓÌÓ‚ ËÁ ̇ÚË‚Ì˚ı
Ë ‰Â‚ËÚËÙˈËÓ‚‡ÌÌ˚ı ÓÓˆËÚÓ‚ ÍÓÓ‚ (˜ËÒÎÓ ÓÓˆËÚÓ‚ — 656)
ÉÛÔÔ˚
˝ÍÒÔÂËÏÂÌÚ‡
ç‡ÚË‚Ì˚ ÓÓˆËÚ˚
Ñ‚ËÚËÙˈËÓ‚‡ÌÌ˚ ÓÓˆËÚ˚
èÂËÌÍÛ·‡ˆËfl ‚ ÙÓÎÎËÍÛÎflÌÓÈ ÊˉÍÓÒÚË
n ÓÓˆËÚÓ‚
n (%) ‰Ó·ÎÂÌËfl
n (%) ÏÓÛη·ÒÚÓˆËÒÚ
-
136
97(71)a
50(37)e
+
151
100(66)b
42(28)f
-
191
63(33)
8 (4)j
+
178
93(52)d
18(10)k
c
(ÍËÚÂËÈ χ-Í‚‡‰‡Ú) a:c; a:d; b:c; Ò:d; b:d;e:j;e:k P<0.05
ë‰‡ ÍÛθÚË‚ËÓ‚‡ÌËfl: íë199 + 10% ÙÂڇθÌÓÈ ·˚˜¸ÂÈ Ò˚‚ÓÓÚÍË + 106 ÍÎÂÚÓÍ/ÏÎ „‡ÌÛÎÂÁ˚ + 50 Ì„/ÏÎ
·˚˜¸Â„Ó ÔÓ·ÍÚË̇
퇷Îˈ‡ 2. ê‡Á‚ËÚË ‰ÓËÏÔ·ÌÚ‡ˆËÓÌÌ˚ı ˝Ï·ËÓÌÓ‚ ËÁ ̇ÚË‚Ì˚ı
Ë ‰Â‚ËÚËÙˈËÓ‚‡ÌÌ˚ı ÓÓˆËÚÓ‚ Ò‚ËÌÂÈ (˜ËÒÎÓ ÓÓˆËÚÓ‚ — 781)
ÉÛÔÔ˚
˝ÍÒÔÂËÏÂÌÚ‡
ç‡ÚË‚Ì˚ ÓÓˆËÚ˚
Ñ‚ËÚËÙˈËÓ‚‡ÌÌ˚ ÓÓˆËÚ˚
èÂËÌÍÛ·‡ˆËfl ‚ ÙÓÎÎËÍÛÎflÌÓÈ ÊˉÍÓÒÚË
n ÓÓˆËÚÓ‚
n (%) ‰Ó·ÎÂÌËfl
n (%) ÏÓÛη·ÒÚÓˆËÒÚ
-
189
91(48)a
62(33)e
+
176
83(47)
40(23)f
-
211
30(14)c
6(3)j
+
205
64(31)
14(7)k
b
d
a:c;b:c;a:d;Ò:d;b:d;e:j;e:k;f:jP<0.05(ÍËÚÂËÈ χ-Í‚‡‰‡Ú) ë‰‡ ÍÛθÚË‚ËÓ‚‡ÌËfl: NCSU 23 — ÒËÌÚÂÚ˘ÂÒ͇fl ÔËÚ‡ÚÂθ̇fl Ò‰‡ + 10 å.Ö. ıÓËÓÌ˘ÂÒÍÓ„Ó „Ó̇‰ÓÚÓÔË̇ ˜ÂÎÓ‚Â͇ + 10 å.Ö. ıÓËÓÌ˘ÂÒÍÓ„Ó „Ó̇‰ÓÚÓÔË̇
ÎÓ¯‡‰Ë +10% ÙÓÎÎËÍÛÎflÌÓÈ ÊˉÍÓÒÚË (‰Ë‡ÏÂÚ ÙÓÎÎËÍÛÎÓ‚ 3–5 ÏÏ) + ÒÚÂÌÍË ÙÓÎÎËÍÛÎÓ‚ (‰Ë‡ÏÂÚ ÙÓÎÎËÍÛÎÓ‚ 3–5 ÏÏ).
Развитие доимплантационных эмбрионов bos taurus и sus scrofa domesticus,
полученных из девитрифицированных ооцитов
17
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 18
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
4/2014
fl‚Îfl˛ÚÒfl ÒÚÂÌÍË ÙÓÎÎËÍÛ· Ë Â„Ó ÊˉÍÓÒÚ¸, ÔÓÁ‚ÓÎfl˛˘‡fl ÔÓÎÛ˜‡Ú¸ ‰Ó 7% ˝Ï·ËÓÌÓ‚ Ò‚ËÌÂÈ Ì‡
ÒÚ‡‰Ëflı ÔÓÁ‰ÌÂÈ ÏÓÛÎ˚ Ë ·Î‡ÒÚÓˆËÒÚ˚.
ꇷÓÚ‡ ‚˚ÔÓÎÌÂ̇ ÔË ÙË̇ÌÒÓ‚ÓÈ ÔÓ‰‰ÂÊÍÂ
êÓÒÒËÈÒÍÓ„Ó ÙÓ̉‡ ÙÛ̉‡ÏÂÌڇθÌ˚ı ËÒÒΉӂ‡ÌËÈ (ÔÓÂÍÚ 14-04-90038 ÅÂÎ_‡).
퇷Îˈ‡ 3. ñËÚÓÏÓÙÓÎӄ˘ÂÒ͇fl ÓˆÂÌ͇ ‰ÓËÏÔ·ÌÚ‡ˆËÓÌÌ˚ı ˝Ï·ËÓÌÓ‚ ÍÓÓ‚ Ë Ò‚ËÌÂÈ,
ÔÓÎÛ˜ÂÌÌ˚ı ËÁ ‰Â‚ËÚËÙˈËÓ‚‡ÌÌ˚ı ÓÓˆËÚÓ‚ (˜ËÒÎÓ ˝Ï·ËÓÌÓ‚ — 567)
Çˉ ÊË‚ÓÚÌ˚ı
ÉÛÔÔ˚ ˝ÍÒÔÂËÏÂÌÚ‡
̇ÚË‚Ì˚ ÓÓˆËÚ˚
ÍÓÓ‚‡
‰Â‚ËÚËÙˈËÓ‚‡ÌÌ˚Â
ÓÓˆËÚ˚
̇ÚË‚Ì˚ ÓÓˆËÚ˚
Ò‚Ë̸fl
‰Â‚ËÚËÙˈË-Ó‚‡ÌÌ˚ ÓÓˆËÚ˚
èÂËÌÍÛ·‡ˆËfl
ÓÓˆËÚÓ‚ ‚ ÙÓÎÎËÍÛÎflÌÓÈ ÊˉÍÓÒÚË
n ˝Ï·ËÓÌÓ‚
n(%) ‰Â„ÂÌÂËÓ‚‡ÌÌ˚ı ˝Ï·ËÓÌÓ‚
-
97
17(18)
+
100
16(16)
-
60
14(23)
+
72
15(21)
-
91
17(19)
+
83
12(14)
-
24
6(25)
+
40
9(23)
Литература
1. Baudot A. Towards whole sheep ovary cryopreservation./A. Baudot, B. Courbiere, V. Odagescu, B. Salle,
C. Mazoyer, J. Massardier & J. Lornage //Cryobiology˛. 2007. Vol. 55. P. 236–248.
2. Bordes A. Normal gestations and live births after orthotopic autograft of vitrified-warmed hemi-ovaries
into ewes/Bordes, A., J. Lornage, B. Demirci, M. Franck, B. Courbiere, J. F. Guerin&B. Salle. //Hum
Reprod. 2005. Vol. 20. 2745-2748.
3. Borges, E. N. Cryopreservation of swine ovarian tissue: effect of different cryoprotectants on the structural preservation of preantral follicle oocytes./E. N. Borges, R. C. Silva, D. O. Futino, C. M. RochaJunior, C. A. Amorim, S. N. Bao & C. M. Lucci. //Cryobiology. 2009. Vol. 59, P.195–200. 1090–2392.
4. Celestino J. J. Preservation of bovine preantral follicle viability and ultra-structure after cooling and
freezing of ovarian tissue./J. J. Celestino, R. R. Dos Santos, C. A. Lopes, F. S. Martins, M. H. Matos,
M. A. Melo, S. N.Bao, A. P. Rodrigues, J. R. Silva&J. R. De Figueiredo. //Anim Reprod Sci, 2008.
Vol. 108. P. 309–318, 1873–2232.
5. Zhou X. L. Bovine oocyte vitrification using the Cryotop method: effect of cumulus cells and vitrification
protocol on survival and subsequent development./X. L. Zhou, Al. A. Naib, D. W. Sun, P. Lonergan //
Cryobiology. 2010. Vol. 61. P. 66–72, 2010.
6. äÛÁ¸ÏË̇ í. à. åÂÚÓ‰˚ ÓˆÂÌÍË ÙÛÌ͈ËÓ̇θÌÓ„Ó ÒÓÒÚÓflÌËfl ‰ÓÌÓÒÍËı ÓÓˆËÚÓ‚, ÒÓχÚ˘ÂÒÍËı ÍÎÂÚÓÍ ÙÓÎÎËÍÛÎÓ‚ Ë ˝Ï·ËÓÌÓ‚ ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı/í. à. äÛÁ¸ÏË̇, Ç. û. ÑÂÌËÒÂÌÍÓ, à. û. ã·‰‚‡, é. Ç. òÓÍËÌ //åÂÚÓ‰ ÂÍÓÏẨ‡ˆËË/åÓÒÍ‚‡. 2005. ë. 32.
7. äÛÁ¸ÏË̇ í. à. ÅËÓÚÂıÌÓÎÓ„Ëfl ÔÓÎÛ˜ÂÌËfl ˝Ï·ËÓÌÓ‚ ÍÛÔÌÓ„Ó Ó„‡ÚÓ„Ó ÒÍÓÚ‡ in vitro./í. à. äÛÁ¸ÏË̇, Ç. Ä. Ň„ËÓ‚, Ä. Ç. քˇÁ‡flÌ, ï. ÄθÏ, ï. íÓÌÂ //ë‡ÌÍÚ-èÂÚÂ·Û„-èÛ¯ÍËÌ. 2009. ë. 44.
8. äÛÁ¸ÏË̇ í. à. åÂÚÓ‰˚ ÔÓÎÛ˜ÂÌËfl ˝Ï·ËÓÌÓ‚ Ò‚ËÌÂÈ in vitro. / í. à. äÛÁ¸ÏË̇, ï. ÄθÏ, ï. íÓÌÂ //
ëè·—èÛ¯ÍËÌ. 2008. C.37.
9. äÛÁ¸ÏË̇ í. à. åÓ‰ÂÎËÓ‚‡ÌË ÒËÒÚÂÏ ÒÓÁ‚‡ÌËfl ÓÓˆËÚÓ‚ Ò‚ËÌÂÈ in vitro/í. à. äÛÁ¸ÏË̇, Ñ. Ä. çӂ˘ÍÓ‚‡, ç. Ä. ÇÓÎÍÓ‚‡ //ëÂθÒÍÓıÓÁflÈÒÚ‚ÂÌ̇fl ·ËÓÎÓ„Ëfl. 2013. ‹ 2. ë.52–57.
10. Tarkowski A. K. An air drying method for chromosomal preparation from mouse eggs/A. K. Tarkowski //
Cytogenetic. 1966. V. 1. P. 394–400.
11. Kuzmina T. I. Innovative embryotechnology in the reproduction of animals from basic researches to practice./T. I. Kuzmina, X. Torner, H. Alm // J. Advances in science and technology agro industrial
complex.2010. V. 4. P. 66–68.
12. Kuzmina T. I. Evaluation of the functional status of bovine oocytes culture in vitro after vitrification/
T. I. Kuzmina, B. I. Protasov //Cell and tissue biology. 2004. V. 46. ‹ 9. P. 781.
18
Т. И. Кузьмина и др. ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 19
Рубрика: Генетика и разведение животных
13. Kuzmina T. I Effect of pre-treating bovine oocytes with the follicular fluid prior to vitrification on their
nuclear-cytoplasmic maturation/T.I. Kuzmina, V. Yu. Denisenko, A. Yu. Malishev //Reproductive BioMed-cine. 2010. V. 20. suppl. 3. P.538–539.
14. äÛÁ¸ÏË̇ í. à. éÓˆËÚ-ÍÛÏÛβÒÌ˚ ‚Á‡ËÏÓ‰ÂÈÒÚ‚Ëfl Ë fl‰ÂÌÓ ÒÓÁ‚‡ÌË ̇ÚË‚Ì˚ı Ë ‰Â‚ËÚËÙˈËÓ‚‡ÌÌ˚ı ÓÓˆËÚÓ‚ ÍÓÓ‚ in vitro/äÛÁ¸ÏË̇ í. à., òÂÈÍÓ à. è., èÓÁ‰ÌflÍÓ‚‡ í. ù., ɇ̉ʇ Ä. à. //
àÁ‚ÂÒÚËfl ë. ÔÂÚÂ·Û„ÒÍÓ„Ó Ä„‡ÌÓ„Ó ìÌË‚ÂÒËÚÂÚ‡. 2012. ‹ 26. C.102-106.
15. Zhang W. Advances on in vitro production and cryopreservation of porcine embryos./W. Zhang, K. Yi,
H. Yan, X. Zhou //Anim Reprod Sci. 2012. V. 132. P. 115–122.
16. Prentice-Biensch J. R. Vitrification of immature bovine cumulus-oocyte complexes: effects of cryoprotectants, the vitrification procedure and warming time on cleavage and embryo development/J. R. Prentice-Biensch, J. Singh, R. J. Mapletoft, M. Anzar //Reproductive Biology and Endocrinology. 2012, V. 10.
P. 1186–1477.
Kuzmina T. I., Sheiko I. P., Gandja A. I., Brussow K.-P.
Development of pre-implantation embryos bos taurus and
sus scrofa domesticus, derived from devitrified oocytes
Abstract. Cytomorphological indicators of quality of embryos in cows and pigs derived from devitrified
oocytes after fertilization in vitro have analized. The systems of maturation of female gametes, upgraded by
pre-incubation of oocytes before vitrification in liquid from follicles of small diameter, were proposed, which
allowed to receive 10% cow’s and 7% of porcine embryos at the stage of late morula and blastocyst .
Keywords: oocyte, vitrification, embryo, cow, pig.
Authors:
Kuzmina Tatiana Ivanovna — Dr. of Biological Sciences, Professor, Head of Laboratory of Developmental Biology, Russian Research Institute for Farm Animal Genetics & Breeding, Tel. 7(921)3921947, e-mail:[email protected];
Sheiko Ivan Pavlovich — Dr. of agricultural Sciences, Professor, Corresponding member of National academy
of sciences of Belarus, First Deputy General Director, The republican unitary enterprise «the Scientificallypractical centre of National academy of sciences of Belarus on animal industries, tel. +375 1775 3 27 86, e-mail:
[email protected];
Gandja Alla Ivanovna — The candidate of agricultural sciences, The leading scientific employee, The republican unitary enterprise «the Scientifically-practical centre of National academy of sciences of Belarus on animal
industries», tel.:+375177523746; e-mail [email protected];
Brussow Klaus-Piter — Dr. of Biological Sciences, Professor, Leibniz Institute for Farm Animal Biology (FBN),
Institute of Reproductive Biology, Deputy. of head of Experimental Reproductive Biology department, WilhelmStahl-Allee 2, 18196 Dummerstorf, Germany, Phone. +49(0)38208-68770, e-mail: [email protected]
Развитие доимплантационных эмбрионов bos taurus и sus scrofa domesticus,
полученных из девитрифицированных ооцитов
19
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 20
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
4/2014
УДК 636.22/28.081.14
Л. М. Хмельничий, В. В. Вечёрка
Оценка коров украинской красно-пестрой молочной породы
в соотносительной изменчивости промеров
и индексов телосложения
Аннотация. В процессе исследований по определению средних величин и изменчивости индексов телосложения; определения степени и направления корреляций между промерами, каждого из использованных индексов между собой; с определением их совокупного и одиночного влияния на уровень молочной продуктивности коров-первотелок украинской красно-пестрой молочной породы установлено, что
средние показатели индексов телосложения исследуемых животных являются характерными для молочного типа. Высокая корреляционная изменчивость между промерами, которые образуют индексы телосложения, свидетельствует об объективной мотивации их использования при оценке животных по экстерьерному типу. Полученные достоверные корреляции между промерами, которые формируют индексы
телосложения, и удоем коров за лактацию не имеют аналогичного совокупного влияния на уровень удоя,
когда они представлены в форме индексов. Тем не менее, полученные степень и направление коэффициентов корреляций между основными индексами и удоем за лактацию свидетельствуют о возможности
их использования в селекционной работе с молочным скотом.
Ключевые слова: промеры, индексы, экстерьер, удой, украинская красно-пестрая молочная порода.
Авторы:
Л. М. Хмельничий — доктор с.-х. наук, профессор, заведующий кафедрой разведения и селекции животных и водных биоресурсов Сумского национального аграрного университета;
В. В. Вечёрка — кандидат с.-х. наук, доцент кафедры разведения и селекции животных и водных биоресурсов Сумского национального аграрного университета.
ǂ‰ÂÌËÂ. éˆÂÌ͇ ÍÛÔÌÓ„Ó Ó„‡ÚÓ„Ó ÒÍÓÚ‡ ÔÓ
ÔÓÏÂ‡Ï ÒÚ‡ÚÂÈ ˝ÍÒÚÂ¸Â‡ ËÏÂÂÚ ‰ÓÒÚ‡ÚÓ˜ÌÛ˛
ÔÓÚflÊÂÌÌÓÒÚ¸ ‚Ó ‚ÂÏÂÌË ‚ ËÒÚÓ˘ÂÒÍÓÏ ‡ÒÔÂÍÚÂ,
Ó̇ ÒÛ˘ÂÒÚ‚ÂÌÌÓ ‰ÓÔÓÎÌflÂÚ „·ÁÓÏÂÌÛ˛ (·‡ÎθÌÛ˛) ÓˆÂÌÍÛ, ‰Â·ÂÚ Â ·ÓΠӷ˙ÂÍÚË‚ÌÓÈ Ë ·ÓÎÂÂ
ÚÓ˜ÌÓÈ, ‡ ˆËÙÓ‚Ó ‚˚‡ÊÂÌË ‡Á‚ËÚËfl ÓˆÂÌË‚‡ÂÏ˚ı ÔËÁ̇ÍÓ‚ ÔÓÁ‚ÓÎflÂÚ ÔÛÚÂÏ Ëı Ò‡‚ÌÂÌËfl
ӷ̇ÛÊËÚ¸ Ë̉˂ˉۇθÌ˚Â Ë „ÛÔÔÓ‚˚ ÓÒÓ·ÂÌÌÓÒÚË ÊË‚ÓÚÌ˚ı. é‰Ì‡ÍÓ ÓÚ‰ÂθÌÓ ‚ÁflÚ˚ ‡·ÒÓβÚÌ˚ ÔÓ͇Á‡ÚÂÎË ÔÓÏÂÓ‚ ÚÂÎÓÒÎÓÊÂÌËfl ÌÂ
‚Ò„‰‡ ÏÓ„ÛÚ Óı‡‡ÍÚÂËÁÓ‚‡Ú¸ ÊË‚ÓÚÌÓ ‚ ÔÓÎÌÓÈ ÏÂÂ, Í‡Í Ëı ÒÓÓÚÌÓÒËÚÂθÌÓ ÒÓ˜ÂÚ‡ÌËÂ, ‚˚‡ÊÂÌÌÓ ‚ ÓÚÌÓÒËÚÂθÌ˚ı ‰ËÌˈ‡ı Ë̉ÂÍÒÓ‚ [2,
6, 10]. éÔ‰ÂÎÂÌË Ë̉ÂÍÒÓ‚ ‚ ÁÓÓÚÂıÌ˘ÂÒÍÓÈ
Ô‡ÍÚËÍ ·‡ÁËÛÂÚÒfl ̇ ËÒÔÓθÁÓ‚‡ÌËË Ú‡ÍËı
ÔÓÏÂÓ‚, ÍÓÚÓ˚ ‡Ì‡ÚÓÏ˘ÂÒÍË Ò‚flÁ‡Ì˚ ÏÂʉÛ
ÒÓ·ÓÈ Ë Ì‡Ë·ÓΠӷÒÚÓflÚÂθÌÓ ÓÚÓ·‡Ê‡˛Ú ÔÓÔÓˆËÓ̇θÌÓÒÚ¸ Ë „‡ÏÓÌ˘ÌÓÒÚ¸ ‡Á‚ËÚËfl Ó„‡ÌËÁχ ‚ Ó·˘ÂÈ ı‡‡ÍÚÂËÒÚËÍ ˝ÍÒÚÂ¸ÂÌÓ„Ó ÚËÔ‡ ÊË‚ÓÚÌ˚ı.
àÌÚÂÂÒ Í ÛÒÓ‚Â¯ÂÌÒÚ‚Ó‚‡Ì˲ ‚̯ÌËı ÙÓÏ
Ô‰ÓÔ‰ÂÎÂÌ ‚ ÔÂ‚Û˛ Ó˜Â‰¸ ÒÛ˘ÂÒÚ‚Ó‚‡ÌËÂÏ
ÍÓÂÎflˆËÓÌÌÓÈ ËÁÏÂ̘˂ÓÒÚË ‡Á‚ËÚËfl ÓÚ‰ÂθÌ˚ı ÒÚ‡ÚÂÈ Ë ÔÓÔÓˆËÈ ÚÂÎÓÒÎÓÊÂÌËfl Ò „·‚Ì˚ÏË
ÒÂÎÂ͈ËÓÌËÛÂÏ˚ÏË ÔËÁ͇̇ÏË ÏÓÎÓ˜ÌÓÈ ÔÓ‰ÛÍÚË‚ÌÓÒÚË ÍÓÓ‚, ‰ÎËÚÂθÌÓÒÚ¸˛ Ë ˝ÙÙÂÍÚË‚ÌÓÒÚ¸˛
20
Ëı ÔÓÊËÁÌÂÌÌÓ„Ó ËÒÔÓθÁÓ‚‡ÌËfl, ‚ÓÒÔÓËÁ‚Ó‰ËÚÂθÌ˚ÏË Í‡˜ÂÒÚ‚‡ÏË Ë Á‰ÓÓ‚¸flÏ [3]. ÖÒÎË Ó Ì‡Î˘ËË ÔÓÎÓÊËÚÂθÌÓÈ ‰ÓÒÚÓ‚ÂÌÓÈ Ò‚flÁË ÏÂʉÛ
ÔÓÏÂ‡ÏË Ë ÏÓÎÓ˜ÌÓÈ ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸˛ ÍÓÓ‚
ÒÓÓ·˘‡ÂÚÒfl ÏÌÓ„ËÏË Ì‡Û˜Ì˚ÏË ËÒÒΉӂ‡ÌËflÏË
[1, 4, 5, 8, 9], ÚÓ Ó ÍÓÂÎflˆËÓÌÌÓÈ ËÁÏÂ̘˂ÓÒÚË
ÔÓ‰ÛÍÚË‚ÌÓÒÚË Ò Ë̉ÂÍÒ‡ÏË ÚÂÎÓÒÎÓÊÂÌËfl ËÌÙÓχˆËfl Ô‡ÍÚ˘ÂÒÍË ÓÚÒÛÚÒÚ‚ÛÂÚ, ˜ÚÓ ÔÓ·Ûʉ‡ÂÚ Í Ôӂ‰ÂÌ˲ Û„ÎÛ·ÎÂÌÌÓ„Ó ËÒÒΉӂ‡ÌËfl
‚ ˝ÚÓÏ Ì‡Ô‡‚ÎÂÌËË.
ñÂθ˛ ËÒÒΉӂ‡ÌËÈ ÒÚ‡ÎÓ ÓÔ‰ÂÎÂÌË Ò‰ÌËı ‚Â΢ËÌ Ë ËÁÏÂ̘˂ÓÒÚË Ò‡Ï˚ı ‡ÒÔÓÒÚ‡ÌÂÌÌ˚ı ‚ ÏÓÎÓ˜ÌÓÏ ÒÍÓÚÓ‚Ó‰ÒÚ‚Â Ë̉ÂÍÒÓ‚ ÚÂÎÓÒÎÓÊÂÌËfl, ÓÔ‰ÂÎÂÌËfl ÒÚÂÔÂÌË ÍÓÂÎflˆËÓÌÌÓÈ
ËÁÏÂ̘˂ÓÒÚË ÔÓÏÂÓ‚ ÒÚ‡ÚÂÈ, Í‡Ê‰Ó„Ó ËÁ ËÒÔÓθÁÓ‚‡ÌÌ˚ı Ë̉ÂÍÒÓ‚ ÏÂÊ‰Û ÒÓ·ÓÈ Ò ÓÔ‰ÂÎÂÌËÂÏ Ëı Ó·˘Â„Ó Ë Ó‰ËÌÓ˜ÌÓ„Ó ‚ÎËflÌËfl ̇ ÛÓ‚Â̸ ÏÓÎÓ˜ÌÓÈ ÔÓ‰ÛÍÚË‚ÌÓÒÚË ÍÓÓ‚-ÔÂ‚ÓÚÂÎÓÍ
ÛÍ‡ËÌÒÍÓÈ Í‡ÒÌÓ-ÔÂÒÚÓÈ ÏÓÎÓ˜ÌÓÈ ÔÓÓ‰˚.
å‡ÚÂË‡Î Ë ÏÂÚÓ‰˚ ËÒÒΉӂ‡ÌËÈ. àÒÒΉӂ‡ÌËfl ÔÓ‚Ó‰ËÎËÒ¸ ̇ ÔÓ„ÓÎÓ‚¸Â ÍÓÓ‚-ÔÂ‚ÓÚÂÎÓÍ ÛÍ‡ËÌÒÍÓÈ Í‡ÒÌÓ-ÔÂÒÚÓÈ ÏÓÎÓ˜ÌÓÈ ÔÓÓ‰˚
‚ ÒÚ‡‰Â ÔÎÂÏÂÌÌÓ„Ó Á‡‚Ó‰‡ ëééé «Äî «å‡flÍ» áÓÎÓÚÓÌÓ¯ÒÍÓ„Ó ‡ÈÓ̇ óÂ͇ÒÒÍÓÈ Ó·Î‡ÒÚË. èÓÏÂ˚ ÒÚ‡ÚÂÈ ˝ÍÒÚÂ¸Â‡ ·‡ÎË ‚ ÔÂËÓ‰ 2–5 ÏÂÒflˆ‡
ÔÂ‚ÓÈ Î‡ÍÚ‡ˆËË Ò ÔÓÏÓ˘¸˛ ÏÂÌ˚ı ËÌÒÚÛÏÂÌЛ. М. Хмельничий, В. В. Вечёрка ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 21
Рубрика: Генетика и разведение животных
ÚÓ‚. Ç˚˜ËÒÎflÎË Ë̉ÂÍÒ˚ ÚÂÎÓÒÎÓÊÂÌËfl, ÍÓÚÓ˚Â
ÂÍÓÏÂÌ‰Û˛Ú Ö. ü. ÅÓËÒÂÌÍÓ [2] Ë Ä. Ö. üˆÂÌÍÓ
[10]. ëÚ‡ÚËÒÚ˘ÂÒ͇fl Ó·‡·ÓÚ͇ ˝ÍÒÔÂËÏÂÌڇθÌ˚ı
‰‡ÌÌ˚ı ÔӂӉ˷Ҹ ÔÓ ÏÂÚÓ‰ËÍ Ö. ä. åÂÍÛ¸Â‚ÓÈ [7] ̇ èä Ò ËÒÔÓθÁÓ‚‡ÌËÂÏ ÔÓ„‡ÏÏÌÓ„Ó
Ó·ÂÒÔ˜ÂÌËfl.
êÂÁÛθڇÚ˚ ËÒÒΉӂ‡ÌËÈ. à̉ÂÍÒ˚ ÚÂÎÓÒÎÓÊÂÌËfl ‰ÓÒÚ‡ÚÓ˜ÌÓ ˆÂÌÌ˚È Ï‡ÚÂˇΠ‰Îfl Ó·˙ÂÍÚË‚ÌÓÈ ÓˆÂÌÍË ÊË‚ÓÚÌ˚ı ÔÓ ˝ÍÒÚÂ¸ÂÌÓÏÛ ÚËÔÛ, ÔÓÒÍÓθÍÛ Ëı ËÒÔÓθÁÓ‚‡ÌË ÔÓÁ‚ÓÎflÂÚ ÒÂÎÂ͈ËÓÌÂ‡Ï
ÓÔ‰ÂÎËÚ¸ ÚËÔ ÍÓÌÒÚËÚÛˆËË, Ë̉˂ˉۇθÌ˚ ÓÒÓ·ÂÌÌÓÒÚË, ÒÚÂÔÂ̸ Ë ÔÓÔÓˆËÓ̇θÌÓÒÚ¸ ‡Á‚ËÚËfl Ó„‡ÌËÁχ, ‚ÓÁ‡ÒÚÌÛ˛ ËÁÏÂ̘˂ÓÒÚ¸, ÍÓ̉ˈËË Ë ÒÔÓÒÓ·ÌÓÒÚ¸ Í ÚÓÈ ËÎË ËÌÓÈ ÔÓ‰ÛÍÚË‚ÌÓÒÚË.
Ç Ú‡·Îˈ Ô‰ÒÚ‡‚ÎÂÌ˚ Ò‰ÌË ÔÓ͇Á‡ÚÂÎË Ë̉ÂÍÒÓ‚ ÚÂÎÓÒÎÓÊÂÌËfl, ÍÓÚÓ˚ ˜‡˘Â ‚ÒÂ„Ó ËÒÔÓθÁÛ˛ÚÒfl ‚ ÁÓÓÚÂıÌ˘ÂÒÍÓÈ Ô‡ÍÚËÍÂ; ‚Â΢ËÌ˚
ÍÓ˝ÙÙˈËÂÌÚÓ‚ ÍÓÂÎflˆËÈ ÏÂÊ‰Û ÔÓÏÂ‡ÏË,
ÍÓÚÓ˚ ҂ÓËÏ ÒÓÓÚÌÓ¯ÂÌËÂÏ Ó·‡ÁÛ˛Ú ËÒÒΉÛÂÏ˚ Ë̉ÂÍÒ˚; ÍÓÂÎflˆËÓÌ̇fl ËÁÏÂ̘˂ÓÒÚ¸ Ë̉ÂÍÒÓ‚ Ë ‚Â΢ËÌ˚ Û‰Ófl Á‡ ÔÂ‚Û˛ ·ÍÚ‡ˆË˛ Ë ÓÚ‰ÂθÌÓ ÏÂÊ‰Û ÔÓÏÂ‡ÏË, Ó·‡ÁÛ˛˘Ë Ë̉ÂÍÒ˚
Ë Û‰ÓÂÏ ÍÓÓ‚-ÔÂ‚ÓÚÂÎÓÍ.
èÓÏÂ˚ Ú·, ÒÓÓÚÌÓ¯ÂÌË ÍÓÚÓ˚ı Ó·‡ÁÛÂÚ Ú‡ÁÓ„Û‰ÌÓÈ Ë̉ÂÍÒ, ¯ËË̇ „Û‰Ë Ë ¯ËË̇
‚ χÍÎÓ͇ı, ̇ıÓ‰flÚÒfl ‚ ÌÂÁ̇˜ËÚÂθÌÓÈ ‚Á‡ËÏÓÒ‚flÁË (r=0,206). ê‡ÒÒ˜ËÚ‡ÌÌ˚ ÓÚ‰ÂθÌÓ ÔÓ ˝ÚËÏ
ÔÓÏÂ‡Ï ÍÓ˝ÙÙˈËÂÌÚ˚ ÍÓÂÎflˆËÈ Ò Û‰ÓÂÏ ÒÛ˘ÂÒÚ‚ÂÌÌÓ ÓÚ΢‡˛ÚÒfl. ìÓ‚Â̸ ÍÓÂÎflˆËË ÏÂÊ‰Û Û‰ÓÂÏ ÍÓÓ‚ Ë ¯ËËÌÓÈ ‚ χÍÎÓ͇ı ‚ ‰‚‡ ‡Á‡
‚˚¯Â, ÔÓ Ò‡‚ÌÂÌ˲ Ò ¯ËËÌÓÈ „Û‰Ë. èÓÒÍÓθÍÛ ÊË‚ÓÚÌ˚Ï ÏÓÎÓ˜ÌÓ„Ó ÚËÔ‡ ÔËÒÛ˘‡ ·ÓΠÛÁ͇fl „Û‰¸, ÔÓÏÂ ÍÓÚÓÓÈ ÒÛ˘ÂÒÚ‚ÂÌÌ˚Ï Ó·‡ÁÓÏ
‚ÎËflÂÚ Ì‡ ‚Â΢ËÌÛ Ú‡ÁÓ„Û‰ÌÓ„Ó Ë̉ÂÍÒ‡, ÔÓÎÛ˜ÂÌÌ˚È ÓÚˈ‡ÚÂθÌ˚È ÍÓ˝ÙÙˈËÂÌÚ ÍÓÂÎflˆËË
ÏÂÊ‰Û ˝ÚËÏ Ë̉ÂÍÒÓÏ Ë Û‰ÓÂÏ Ò‚Ë‰ÂÚÂθÒÚ‚ÛÂÚ
Ó ‚ÓÁÏÓÊÌÓÒÚË ˝ÙÙÂÍÚË‚ÌÓ„Ó ÓÚ·Ó‡ ÍÓÓ‚, Û ÍÓÚÓ˚ı Ú‡ÁÓ„Û‰ÌÓÈ Ë̉ÂÍÒ ËÏÂÂÚ ·ÓΠÌËÁÍËÈ
ÔÓ͇Á‡ÚÂθ.
ÉÛ‰ÌÓÈ Ë̉ÂÍÒ ‰ÓÔÓÎÌflÂÚ ÓÔ‰ÂÎÂÌÌ˚Ï Ó·‡ÁÓÏ Ú‡ÁÓ„Û‰ÌÓÈ, ı‡‡ÍÚÂËÁÛfl ‡Á‚ËÚË „Û‰ÌÓÈ ÍÎÂÚÍË. å. Ä. ä‡‚˜ÂÌÍÓ [4] ̇Á˚‚‡ÂÚ Â„Ó Ë̉ÂÍÒÓÏ ¯ËÓÍÓ„Û‰ÓÒÚË. Ç Ì‡¯Ëı ËÒÒΉӂ‡ÌËflı
Ò‰Ìflfl ‚Â΢Ë̇ „Û‰ÌÓ„Ó Ë̉ÂÍÒ‡ ÒÓÒÚ‡‚ÎflÂÚ
59,1 Ò ‰ÓÒÚ‡ÚÓ˜ÌÓ ·Óθ¯ÓÈ ËÁÏÂ̘˂ÓÒÚ¸˛ (7,88%)
‚ Ò‡‚ÌÂÌËË Ò ‰Û„ËÏË Ë̉ÂÍÒ‡ÏË. ìÓ‚Â̸ ÍÓ˝ÙÙˈËÂÌÚÓ‚ ÍÓÂÎflˆËÈ ÏÂÊ‰Û ÔÓÏÂ‡ÏË, ÔÓ ÍÓÚÓ˚Ï ‡ÒÒ˜ËÚ‡Ì ˝ÚÓÚ Ë̉ÂÍÒ, ÌÂÁ̇˜ËÚÂθÌ˚È, ıÓÚfl ‚˚ÒÓÍÓ‰ÓÒÚÓ‚ÂÌ˚È. åÂÊ‰Û ÓÚ‰ÂθÌÓ ‚ÁflÚ˚ÏË
ÔÓÏÂ‡ÏË Ë Û‰ÓÂÏ ÔÓ ÔÂ‚ÓÈ Î‡ÍÚ‡ˆËË ‚˚Ò¯‡fl
퇷Îˈ‡ 1. èÓ͇Á‡ÚÂÎË Ë̉ÂÍÒÓ‚ ÚÂÎÓÒÎÓÊÂÌËfl ÍÓÓ‚-ÔÂ‚ÓÚÂÎÓÍ
‚ Ëı ÒÓÓÚÌÓÒËÚÂθÌÓÈ ËÁÏÂ̘˂ÓÒÚË Ò ‚Â΢ËÌÓÈ Û‰Ófl Á‡ ·ÍÚ‡ˆË˛ (n=138)
ç‡Á‚‡ÌËÂ
Ë̉ÂÍÒ‡
äÓÂÎflˆËfl ÏÂÊ‰Û ÔÓÏÂ‡ÏË
ï‡‡ÍÚÂËÒÚË͇
Ë̉ÂÍÒ‡, %
äÓÂäÓÂÎflˆËfl ÔÓÏÂ/Û‰ÓÈ
ÎflˆËfl
(Ë̉ÂÍÒ – ÔÓÔÓr
r
Û‰ÓÈ), r
ÏÂ
ÏÂ
̇Á‚‡ÌË ÔÓÏÂÓ‚
r
å±m
Cv
í‡ÁÓ„Û‰ÌÓÈ
¯ËË̇ „Û‰Ë (òÉ) –
¯ËË̇ ‚ χÍÎÓ͇ı (òå)
0,2061
82,4±0,65
8,53
ÉÛ‰ÌÓÈ
¯ËË̇ „Û‰Ë (òÉ) –
„ÎÛ·Ë̇ „Û‰Ë (ÉÉ)
0,2833
59,1±0,43
7,88
-0,042
òÉ
ë·ËÚÓÒÚË
Ó·ı‚‡Ú „Û‰Ë (éÉ) – ÍÓÒ‡fl
‰ÎË̇ ÚÛÎӂˢ‡ (äÑí)
0,568
117,5±0,49
4,53
-0,074
éÉ
òËÎÓÁ‡‰ÓÒÚË
¯ËË̇ ‚ χÍÎÓ͇ı (òå) –
0,6493 152,7±0,71
¯ËË̇ ‚ Ò‰‡ÎˢÌ˚ı
·Û„‡ı (òëÅ)
5,03
0,2101
òå
0,8193 106,9±0,18
1,81
0,033
Çä
0,3703
Çï
ÍÓÒ‡fl ‰ÎË̇ ÚÛÎӂˢ‡
0,5883 120,0±0,47
(äÑí) – ‚˚ÒÓÚ‡ ‚ ıÓÎÍ (Çï)
4,23
0,2211
äÑí
0,4163
Çï
èÂÂÓÒÎÓÒÚË
ê‡ÒÚflÌÛÚÓÒÚË
‚˚ÒÓÚ‡ ‚ ÍÂÒڈ (Çä) –
‚˚ÒÓÚ‡ ‚ ıÓÎÍÂ (Çï)
-0,137
òÉ
0,199
òå
0,4473
ÉÉ
0,3553
äÑí
0,4163
2
0,4113
0,4473 òëÅ 0,2412
äÓÒÚËÒÚÓÒÚË
Ó·ı‚‡Ú ÔflÒÚË (éè) –
‚˚ÒÓÚ‡ ‚ ıÓÎÍÂ (Çï)
0,3953
13,8±0,07
5,62
-0,078
éè
0,142
Çï
ÉÎÛ·ÓÍÓ„Û‰ÓÒÚË
„ÎÛ·Ë̇ „Û‰Ë (ÉÉ) –
‚˚ÒÓÚ‡ ‚ ıÓÎÍÂ (Çï)
0,6313
54,1±0,18
3,57
0,113
ÉÉ
0,3553
Çï
å‡ÒÒË‚ÌÓÒÚË
Ó·ı‚‡Ú „Û‰Ë (éÉ) –
‚˚ÒÓÚ‡ ‚ ıÓÎÍÂ (Çï)
0,6983 141,4±0,46
3,47
0,165
éÉ
0,4113
Çï
òËÓÍÓ„Û‰ÓÒÚË
¯ËË̇ „Û‰Ë (òÉ) –
‚˚ÒÓÚ‡ ‚ ıÓÎÍÂ (Çï)
0,2141
31,9±0,23
7,76
0,011
òÉ
0,1992
Çï
îÓχڇ
Ú‡Á‡
¯ËË̇ ‚ Ú‡Áӷ‰ÂÌÌ˚ı
ÒÛÒÚ‡‚‡ı (òíë) – ¯ËË̇
‚ χÍÎÓ͇ı (òå)
0,8243
96,0±0,28
3,13
-0,062
0,3993
Оценка коров украинской красно-пестрой молочной породы
в соотносительной изменчивости промеров и индексов телосложения
òíë 0,5163
òå
0,4473
21
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 22
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
Ò‚flÁ¸ ÛÒÚ‡ÌÓ‚ÎÂ̇ ÏÂÊ‰Û ÔÓÏÂÓÏ „ÎÛ·ËÌ˚ „Û‰Ë. é·Ì‡ÛÊÂÌ̇fl ÓÚˈ‡ÚÂθ̇fl Ò‚flÁ¸ ÏÂʉÛ
„Û‰Ì˚Ï Ë̉ÂÍÒÓÏ Ë Û‰ÓÂÏ Á‡ ·ÍÚ‡ˆË˛ ҂ˉÂÚÂθÒÚ‚ÛÂÚ Ó ÚÓÏ, ˜ÚÓ ÍÓÓ‚˚ Ò ·ÓΠÛÁÍÓÈ Ë ·ÓΠ„ÎÛ·ÓÍÓÈ „Û‰¸˛ ·ÓΠÔÓ‰ÛÍÚË‚Ì˚ ÔÓ ÍÓ΢ÂÒÚ‚Û
̇‰ÓÂÌÌÓ„Ó ÏÓÎÓ͇.
à̉ÂÍÒ Ò·ËÚÓÒÚË (ÍÓÏÔ‡ÍÚÌÓÒÚË) fl‚ÎflÂÚÒfl ıÓÓ¯ËÏ ÔÓ͇Á‡ÚÂÎÂÏ ‡Á‚ËÚËfl χÒÒ˚ Ú· ÊË‚ÓÚÌ˚ı.
èÓÏÂ˚ ÒÚ‡ÚÂÈ ˝ÍÒÚÂ¸Â‡, ÒÓÓÚÌÓ¯ÂÌË ÍÓÚÓ˚ı Ó·‡ÁÛÂÚ Ë̉ÂÍÒ, ̇ıÓ‰ËÚÒfl ‚ ÚÂÒÌÓÈ ÍÓÂÎflˆËÓÌÌÓÈ Ò‚flÁË (r=0,568; ê<0,001) Ò ‡Ì‡Îӄ˘ÌÓÈ ‚˚ÒÓÍÓÈ Ò‚flÁ¸˛ ÏÂÊ‰Û Û‰ÓÂÏ Ë ÔÓÏÂ‡ÏË
Ó·ı‚‡Ú‡ „Û‰Ë (r=0,411; ê<0,001) Ë ÍÓÒÓÈ ‰ÎËÌ˚
ÚÛÎӂˢ‡ (r=0,416; ê<0,001). èË ‚˚ÒÓÍËı ÔÓÎÓÊËÚÂθÌ˚ı ÍÓ˝ÙÙˈËÂÌÚ‡ı ÍÓÂÎflˆËÈ ÏÂʉÛ
Ò‡Ï˚ÏË ÔÓÏÂ‡ÏË Ë ÏÂÊ‰Û ÌËÏË Ë Û‰ÓÂÏ, Ë̉ÂÍÒ
Ò·ËÚÓÒÚË Ì‡Ó·ÓÓÚ ı‡‡ÍÚÂËÁÛÂÚÒfl ÓÚˈ‡ÚÂθÌÓÈ ÍÓÂÎflˆËÓÌÌÓÈ Ì‡Ô‡‚ÎÂÌÌÓÒÚ¸˛ Ò Û‰ÓÂÏ
Á‡ ·ÍÚ‡ˆË˛ (r = -0,074) ·ÂÁ ÔÓ‰Ú‚ÂʉÂÌËfl ‰ÓÒÚÓ‚ÂÌÓÒÚË.
à̉ÂÍÒ ¯ËÎÓÁ‡‰ÓÒÚË ÓÔ‰ÂÎflÂÚÒfl ÒÓÓÚÌÓ¯ÂÌËÂÏ ¯ËËÌ˚ ‚ χÍÎÓ͇ı Í ¯ËËÌ ‚ Ò‰‡ÎˢÌ˚ı
·Û„‡ı. ìÒÚ‡ÌÓ‚ÎÂÌ̇fl ‚˚ÒÓ͇fl ÔÓÎÓÊËÚÂθ̇fl
Ò‚flÁ¸ ÏÂÊ‰Û ÔÓÏÂ‡ÏË, Ó·‡ÁÛ˛˘ËÏË Ë̉ÂÍÒ
(r=0,649; ê<0,001), ‚˚ÒÓÍÓ‰ÓÒÚÓ‚Â̇fl ÏÂʉÛ
ÔÓÏÂ‡ÏË ‚ χÍÎÓ͇ı (r=0,447; ê<0,001) Ë ÌÂÒÍÓθÍÓ ÌËÊ — ÏÂÊ‰Û ÔÓÏÂ‡ÏË ‚ Ò‰‡ÎˢÌ˚ı ·Û„‡ı Ë ‚Â΢ËÌÓÈ Û‰Ófl (r=0,241; ê<0,01)
ÔÓÎÓÊËÚÂθÌÓ Òӄ·ÒÓ‚˚‚‡ÂÚÒfl Ò ÍÓÂÎflˆËÂÈ ÏÂÊ‰Û Ë̉ÂÍÒÓÏ ¯ËÎÓÁ‡‰ÓÒÚË Ë Û‰ÓÂÏ ÍÓÓ‚ Ë Ò‚Ë‰ÂÚÂθÒÚ‚ÛÂÚ Ó ‚ÓÁÏÓÊÌÓÒÚË ˝ÙÙÂÍÚË‚ÌÓ„Ó ÓÚ·Ó‡
ÏÓÎÓ˜ÌÓ„Ó ÒÍÓÚ‡ ÔÓ ‰‡ÌÌÓÏÛ Ë̉ÂÍÒÛ.
ïÓÓ¯ËÏ ÔÓ͇Á‡ÚÂÎÂÏ ÓÒÚ‡ Ë ‡Á‚ËÚËfl Ó„‡ÌËÁχ ‚ ÔÓÒÚ˝Ï·ËÓ̇θÌ˚È ÔÂËÓ‰ fl‚ÎflÂÚÒfl Ë̉ÂÍÒ ÔÂÂÓÒÎÓÒÚË — ÒÓÓÚÌÓ¯ÂÌË ‚˚ÒÓÚ˚ ‚ ÍÂÒÚˆÂ Í ‚˚ÒÓÚ ‚ ıÓÎÍÂ. èÓ ‚Â΢ËÌ ‰‡ÌÌÓ„Ó Ë̉ÂÍÒ‡
ÏÓÊÌÓ ÒÛ‰ËÚ¸ Ó ‚˚ÒÓÚ ÍÂÒÚˆ‡ ÓÚÌÓÒËÚÂθÌÓ ıÓÎÍË. óÂÏ ·Óθ¯Â ‡ÁÌˈ‡ ÏÂÊ‰Û ‚˚ÒÓÚÓÈ ‚ ıÓÎÍÂ
Ë ÍÂÒÚˆÂ, ÚÂÏ ‚˚¯Â Ë̉ÂÍÒ Ë Ì‡Ó·ÓÓÚ. ë ‚ÓÁ‡ÒÚÓÏ Ë̉ÂÍÒ ÒÌËʇÂÚÒfl. ê‡ÁÌËˆÛ ÏÂÊ‰Û ÔÓ͇Á‡ÚÂÎflÏË ‚˚ÒÓÚ˚ ‚ ÍÂÒÚˆÂ Ë ıÓÎÍÂ, ÍÓÚÓ‡fl ÒÓÒÚ‡‚ÎflÂÚ Û ÔÓ‰ÍÓÌÚÓθÌ˚ı ÍÓÓ‚-ÔÂ‚ÓÚÂÎÓÍ 9,6 ÒÏ,
‚˚‡Ê‡ÂÚ Ò‰Ìflfl ‚Â΢Ë̇ Ë̉ÂÍÒ‡ ÔÂÂÓÒÎÓÒÚË — 106,9%. åÂÊ‰Û ‚˚ÒÓÚÓÈ ‚ ıÓÎÍÂ Ë ÍÂÒÚˆÂ
Ë ‚Â΢ËÌÓÈ Û‰Ófl Á‡ ·ÍÚ‡ˆË˛ ӷ̇ÛÊÂ̇ ‚˚ÒÓÍÓ‰ÓÒÚÓ‚Â̇fl Ò‚flÁ¸ Ò ÍÓ˝ÙÙˈËÂÌÚ‡ÏË ÍÓÂÎflˆËË ÒÓÓÚ‚ÂÚÒÚ‚ÂÌÌÓ 0,370 Ë 0,399. åÂÊ‰Û ˝ÚËÏË ‰‚ÛÏfl ‚˚ÒÓÚÌ˚ÏË ÔÓÏÂ‡ÏË ÒÛ˘ÂÒÚ‚ÛÂÚ
̇˷ÓΠÚÂÒ̇fl ÍÓÂÎflˆËfl (0,819). à̉ÂÍÒ ÔÂÂÓÒÎÓÒÚË ı‡‡ÍÚÂËÁÛÂÚÒfl ̇ËÏÂ̸¯ÂÈ ËÁÏÂ̘˂ÓÒÚ¸˛ ÒÂ‰Ë ‚ÒÂı Û˜ÚÂÌÌ˚ı Ë̉ÂÍÒÓ‚ ÚÂÎÓÒÎÓÊÂÌËfl. éÚÒÛÚÒÚ‚Ë ÍÓÂÎflˆËË ÏÂÊ‰Û Ë̉ÂÍÒÓÏ
ÔÂÂÓÒÎÓÒÚË Ë ‚Â΢ËÌÓÈ Û‰Ófl Á‡ ·ÍÚ‡ˆË˛ ÌÂ
ÔÓÁ‚ÓÎflÂÚ ‚ÂÒÚË ÓÚ·Ó ÍÓÓ‚ ÔÓ ˝ÚÓÏÛ Ë̉ÂÍÒÛ.
22
4/2014
èÓÎÛ˜ÂÌ̇fl ̇ÏË Ò‰Ìflfl ‚Â΢Ë̇ Ë̉ÂÍÒ‡
‡ÒÚflÌÛÚÓÒÚË, ËÎË ÙÓχڇ (120,0%) ‚ ÒÓÓÚÌÓÒËÚÂθÌÓÏ ‡Á‚ËÚËË ‚˚ÒÓÚ˚ Ë ‰ÎËÌ˚ ÚÛÎӂˢ‡ ı‡‡ÍÚÂËÁÛÂÚ ‡Á‚ËÚË ÍÓÓ‚-ÔÂ‚ÓÚÂÎÓÍ ÛÍ‡ËÌÒÍÓÈ
Í‡ÒÌÓ-ÔÂÒÚÓÈ ÏÓÎÓ˜ÌÓÈ ÔÓÓ‰˚ ‚ ̇Ô‡‚ÎÂÌËË
ÏÓÎÓ˜ÌÓ„Ó ÚËÔ‡. äÓÂÎflˆËÓÌ̇fl ËÁÏÂ̘˂ÓÒÚ¸
ÏÂÊ‰Û ÔÓÏÂ‡ÏË, ÍÓÚÓ˚ ӷ‡ÁÛ˛Ú Ë̉ÂÍÒ
ÙÓχڇ, ‰ÓÒÚ‡ÚÓ˜ÌÓ ‚˚ÒÓ͇fl (r=0,588), ‡‚ÌÓ
Í‡Í Ë ÍÓÂÎflˆËË ÏÂÊ‰Û ÌËÏË Ë ‚Â΢ËÌÓÈ Û‰Ófl
(r=0,416 Ë 0,399). ë˜ËÚ‡ÂÚÒfl, ˜ÚÓ ÏÂ̸¯ËÈ Ë̉ÂÍÒ ‡ÒÚflÌÛÚÓÒÚË Ò‚ÓÈÒÚ‚ÂÌ ÒÍÓÚÛ ÏÓÎÓ˜ÌÓ„Ó ÚËÔ‡, Ӊ̇ÍÓ Â„Ó ‚Â΢ËÌÛ ÙÓÏËÛÂÚ ÔÓÏÂ ÍÓÒÓÈ
‰ÎËÌ˚ ÚÛÎӂˢ‡, ÔÓÒÍÓθÍÛ ÊË‚ÓÚÌ˚Â Ò ‚ÓÁ‡ÒÚÓÏ ËÏÂ˛Ú ·ÓΠËÌÚÂÌÒË‚Ì˚È ÓÒÚ ‚ ‰ÎËÌÛ, ˜ÂÏ
‚ ‚˚ÒÓÚÛ. ìÒÚ‡ÌÓ‚ÎÂÌÌ˚È ÔÓÎÓÊËÚÂθÌ˚È ÍÓ˝ÙÙˈËÂÌÚ ÍÓÂÎflˆËË ÏÂÊ‰Û Ë̉ÂÍÒÓÏ ‡ÒÚflÌÛÚÓÒÚË Ë Û‰ÓÂÏ (r=0,221; ê<0,05) ҂ˉÂÚÂθÒÚ‚ÛÂÚ
Ó ‚ÓÁÏÓÊÌÓÒÚË ˝ÙÙÂÍÚË‚ÌÓ„Ó ÓÚ·Ó‡ ÍÓÓ‚ Ò ‚˚Ò¯ËÏ Ë̉ÂÍÒÓÏ.
à̉ÂÍÒ ÍÓÒÚËÒÚÓÒÚË ‰‡ÂÚ Ô‰ÒÚ‡‚ÎÂÌË ӷ ÓÚÌÓÒËÚÂθÌÓÏ ‡Á‚ËÚËË ÒÍÂÎÂÚ‡. óÂÏ ÚÓ̸¯Â ÒÍÂÎÂÚ ÓˆÂÌË‚‡ÂÏÓ„Ó ÊË‚ÓÚÌÓ„Ó, ÚÂÏ ÌËÊ ÔÓ͇Á‡ÚÂθ
Ë̉ÂÍÒ‡ Ë Ì‡Ó·ÓÓÚ. ë‰ÌËÈ Ë̉ÂÍÒ ÍÓÒÚËÒÚÓÒÚË
(13,8%) ‚ ‰‡ÌÌÓÏ ÒÎÛ˜‡Â ÔÓ͇Á˚‚‡ÂÚ, ˜ÚÓ ÒÚ‡‰Ó
ÛÍ‡ËÌÒÍÓÈ Í‡ÒÌÓ-ÔÂÒÚÓÈ ÏÓÎÓ˜ÌÓÈ ÔÓÓ‰˚ ‡Á‚Ë‚‡ÂÚÒfl ‚ ̇Ô‡‚ÎÂÌËË ÏÓÎÓ˜ÌÓ„Ó ÚËÔ‡ ÚÂÎÓÒÎÓÊÂÌËfl. éÚˈ‡ÚÂθÌ˚È ÍÓ˝ÙÙˈËÂÌÚ ÍÓÂÎflˆËË
ÏÂÊ‰Û Ë̉ÂÍÒÓÏ ÍÓÒÚËÒÚÓÒÚË Ë Û‰ÓÂÏ, ıÓÚfl Ì‚˚ÒÓÍËÈ Ë Ì‰ÓÒÚÓ‚ÂÌ˚È, ÓÌ ‚Ò Ê ҂ˉÂÚÂθÒÚ‚ÛÂÚ Ó· ˝ÙÙÂÍÚË‚ÌÓÒÚË ÓÚ·Ó‡ ÍÓÓ‚ Ò ÏÂ̸¯ËÏ
Ë̉ÂÍÒÓÏ ÍÓÒÚËÒÚÓÒÚË, ÍÓÚÓ˚È ·Û‰ÂÚ ÒÔÓÒÓ·ÒÚ‚Ó‚‡Ú¸ ˝ÙÙÂÍÚË‚ÌÓÏÛ Ì‡‡˘Ë‚‡Ì˲ ÏÓÎÓ˜ÌÓÈ ÔÓ‰ÛÍÚË‚ÌÓÒÚË ÊË‚ÓÚÌ˚ı ‚ ÒÚ‡‰Â.
ëÓÓÚÌÓ¯ÂÌË „ÎÛ·ËÌ˚ „Û‰Ë Í ‚˚ÒÓÚ ‚ ıÓÎÍÂ
ı‡‡ÍÚÂËÁÛÂÚ ‡Á‚ËÚË „Û‰ÌÓÈ ÍÎÂÚÍË ‚ „ÎÛ·ËÌÛ, Ë ˜ÂÏ ·Óθ¯Â „ÎÛ·Ë̇ „Û‰Ë Á‡ ÎÓÔ‡Ú͇ÏË, ÚÂÏ
‚˚¯Â Ë̉ÂÍÒ. à̉ÂÍÒ „ÎÛ·ÓÍÓ„Û‰ÓÒÚË ı‡‡ÍÚÂËÁÛÂÚÒfl Ò‡‚ÌËÚÂθÌÓ Ò‰ÌËÏ ÛÓ‚ÌÂÏ ËÁÏÂ̘˂ÓÒÚË Ë ÚÂÒÌÓÈ ‚Á‡ËÏÓÒ‚flÁ¸˛ ÏÂÊ‰Û ÔÓÏÂ‡ÏË
Ú·, ÍÓÚÓ˚Â Â„Ó Ó·‡ÁÛ˛Ú (r=0,631). èÓÎÛ˜ÂÌÌ˚Â
‚˚ÒÓÍÓ‰ÓÒÚÓ‚ÂÌ˚ ÔÓÎÓÊËÚÂθÌ˚ ÍÓ˝ÙÙˈËÂÌÚ˚ ÍÓÂÎflˆËÈ ÏÂÊ‰Û Û‰ÓÂÏ Ë „ÎÛ·ËÌÓÈ „Û‰Ë
Ò ‚˚ÒÓÚÓÈ ‚ ıÓÎÍÂ Ë ÏÂÊ‰Û Ë̉ÂÍÒÓÏ „ÎÛ·ÓÍÓ„Û‰ÓÒÚË Ë Û‰ÓÂÏ Á‡ ·ÍÚ‡ˆË˛ ҂ˉÂÚÂθÒÚ‚Û˛Ú Ó·
˝ÙÙÂÍÚË‚ÌÓÒÚË ÓÚ·Ó‡ ÔÓ ‚ÒÂÏ ˝ÚËÏ Ù‡ÍÚÓ‡Ï, ÍÓÚÓ˚ ı‡‡ÍÚÂËÁÛ˛Ú ˝ÍÒÚÂ¸Â ÏÓÎÓ˜Ì˚ı ÍÓÓ‚.
éÚÌÓÒËÚÂθÌÓ ‡Á‚ËÚË ÚÛÎӂˢ‡ ‚ ÔÓÎÌÓÈ
ÏÂ ı‡‡ÍÚÂËÁÛÂÚÒfl ÒÓÓÚÌÓ¯ÂÌËÂÏ Ó·ı‚‡Ú‡ „Û‰Ë Ë ‚˚ÒÓÚ˚ ‚ ıÓÎÍÂ, ÍÓÚÓÓ ˜‡˘Â ‚ÒÂ„Ó ËÒÔÓθÁÛ˛Ú Ì‡ Ô‡ÍÚËÍÂ, ÚÓ ÂÒÚ¸ Ë̉ÂÍÒÓÏ Ï‡ÒÒË‚ÌÓÒÚË.
èÓ ÂÁÛÎ¸Ú‡Ú‡Ï ËÒÒΉӂ‡ÌËÈ Ò‰ÌÂÈ ÊË‚ÓÈ Ï‡ÒÒ ÍÓÓ‚-ÔÂ‚ÓÚÂÎÓÍ 522 Í„ ÒÓÓÚ‚ÂÚÒÚ‚ÛÂÚ Ë̉ÂÍÒ
χÒÒË‚ÌÓÒÚË Ì‡ ÛÓ‚Ì 141,4%. äÓ˝ÙÙˈËÂÌÚ ÍÓÂÎflˆËË ÏÂÊ‰Û Ë̉ÂÍÒÓÏ Ï‡ÒÒË‚ÌÓÒÚË Ë ÊË‚ÓÈ
χÒÒÓÈ ÔÓ‰ÍÓÌÚÓθÌÓ„Ó ÔÓ„ÓÎÓ‚¸fl ÔÓÎÓÊËÚÂθЛ. М. Хмельничий, В. В. Вечёрка ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 23
Рубрика: Генетика и разведение животных
Ì˚È Ë ÒÓÒÚ‡‚ÎflÂÚ 0,165. éÌ ÒÓ‚Ô‡‰‡ÂÚ Ò ÔÓÎÓÊËÚÂθÌ˚ÏË ÍÓÂÎflˆËflÏË Í‡Í ÏÂÊ‰Û ÔÓÏÂ‡ÏË Ë̉ÂÍÒ‡ (r=0,698), Ú‡Í Ë ÏÂÊ‰Û ÌËÏË Ë Û‰ÓÂÏ Á‡ ·ÍÚ‡ˆË˛ (r=0,411 Ë 0,399).
à̉ÂÍÒ ¯ËÓÍÓ„Û‰ÓÒÚË, ‚˚‡ÊÂÌÌ˚È ÓÚÌÓ¯ÂÌËÂÏ ¯ËËÌ˚ „Û‰Ë Í ‚˚ÒÓÚ ‚ ıÓÎÍ ڇÍÊ ı‡‡ÍÚÂËÁÛÂÚ ‡Á‚ËÚË „Û‰ÌÓÈ ÍÎÂÚÍË, ÌÓ ‚ ¯ËËÌÛ, ÚÓ ÂÒÚ¸ ˜ÂÏ ¯Ë „Û‰¸ ÊË‚ÓÚÌÓ„Ó, ÚÂÏ ‚˚¯Â
Ë̉ÂÍÒ. èÓ Ú‡ÍÓÏÛ ÒÓÓÚÌÓ¯ÂÌ˲ ÔÓÏÂÓ‚ Ë̉ÂÍÒ
¯ËÓÍÓ„Û‰ÓÒÚË ‚˚˜ËÒÎflÎ ÚÓθÍÓ Ä. Ö. üˆÂÌÍÓ
[3]. åÂÊ‰Û ÒÓÓÚÌÓÒËÚÂθÌ˚ÏË ÔÓÏÂ‡ÏË Ë̉ÂÍÒ‡ ‚Á‡ËÏÓÒ‚flÁ¸ Ì·Óθ¯‡fl Ë ÌËÁÍÓ‰ÓÒÚÓ‚Â̇fl
(r=0,214; ê<0,05), Ӊ̇ÍÓ ‰ÓÒÚ‡ÚÓ˜ÌÓ ËÁÏÂ̘˂‡fl.
èÓÏÂ ¯ËËÌ˚ „Û‰Ë ÙÓÏËÛÂÚ Ë̉ÂÍÒ ¯ËÓÍÓ„Û‰ÓÒÚË. èÓÒÍÓθÍÛ ÛÁÍÓ„Û‰ÓÒÚ¸ ÔËÒÛ˘‡ ÏÓÎÓ˜ÌÓÏÛ ÒÍÓÚÛ, ÏÂÊ‰Û Ë̉ÂÍÒÓÏ ¯ËÓÍÓ„Û‰ÓÒÚË
Ë Û‰ÓÂÏ ÓÚÒÛÚÒÚ‚ÛÂÚ ÍÓÂÎflˆËfl.
à̉ÂÍÒ ÙÓχڇ Ú‡Á‡ ÓÔ‰ÂÎÂÌÌ˚Ï Ó·‡ÁÓÏ
‰ÓÔÓÎÌflÂÚ ÛÊ Ô˂‰ÂÌÌ˚È Ë̉ÂÍÒ ¯ËÎÓÁ‡‰ÓÒÚË,
ı‡‡ÍÚÂËÁÛfl Â„Ó ‡Á‚ËÚË ‚ ¯ËËÌÛ, ÌÓ ÛÊ ˜ÂÂÁ ÒÓÓÚÌÓ¯ÂÌË ¯ËËÌ˚ ‚ Ú‡Áӷ‰ÂÌÌ˚ı ÒÛÒÚ‡‚‡ı Í ¯ËËÌ ‚ χÍÎÓ͇ı. à̉ÂÍÒ ÙÓχڇ Ú‡Á‡
ı‡‡ÍÚÂËÁÛÂÚÒfl Ò‰ÌËÏ ÛÓ‚ÌÂÏ ËÁÏÂ̘˂ÓÒÚË.
àÁ ‚ÒÂı ¯ËÓÚÌ˚ı ÔÓÏÂÓ‚ Á‡‰‡ ̇˂˚Ò¯‡fl ‚Á‡ËÏÓÒ‚flÁ¸ ӷ̇ÛÊÂ̇ ÏÂÊ‰Û ¯ËËÌÓÈ ‚ Ú‡Áӷ‰ÂÌÌ˚ı ÒÛÒÚ‡‚‡ı Ë Ï‡ÍÎÓ͇ı (r=0,824). ç „Îfl‰fl
Ú‡ÍÊ ̇ ‚˚ÒÓÍË ÔÓ͇Á‡ÚÂÎË ÍÓÂÎflˆËÈ ÏÂʉÛ
ÔÓÏÂ‡ÏË ¯ËËÌ˚ ‚ ÍÛθ¯‡ı Ë Ï‡ÍÎÓ͇ı Ò Û‰ÓÂÏ
(r=0,516 Ë 0,447) ÍÓÂÎflˆËfl ÏÂÊ‰Û Ë̉ÂÍÒÓÏ
ÙÓχڇ Ú‡Á‡ Ë Û‰ÓÂÏ Ó͇Á‡Î‡Ò¸ ÓÚˈ‡ÚÂθÌÓÈ
̇Ô‡‚ÎÂÌÌÓÒÚË.
Ç˚‚Ó‰˚. èÓ ÂÁÛÎ¸Ú‡Ú‡Ï ËÒÒΉӂ‡ÌËÈ ÏÓÊÌÓ
҉·ڸ ÒÎÂ‰Û˛˘Ë ӷӷ˘‡˛˘Ë ‚˚‚Ó‰˚: Ò‰-
ÌË ÔÓ͇Á‡ÚÂÎË Ë̉ÂÍÒÓ‚ ÚÂÎÓÒÎÓÊÂÌËfl ÍÓÓ‚ÔÂ‚ÓÚÂÎÓÍ ÛÍ‡ËÌÒÍÓÈ Í‡ÒÌÓ-ÔÂÒÚÓÈ ÏÓÎÓ˜ÌÓÈ
ÔÓÓ‰˚ ‚ ˆÂÎÓÏ fl‚Îfl˛ÚÒfl ı‡‡ÍÚÂÌ˚ÏË ‰Îfl ÊË‚ÓÚÌ˚ı ÏÓÎÓ˜ÌÓ„Ó ÚËÔ‡; Á̇˜ËÚÂθÌ˚È ÛÓ‚Â̸
ËÁÏÂ̘˂ÓÒÚË Ë̉ÂÍÒÓ‚ — Ú‡ÁÓ„Û‰ÌÓ„Ó, „Û‰ÌÓ„Ó Ë ¯ËÓÍÓ„Û‰ÓÒÚË, ҂ˉÂÚÂθÒÚ‚ÛÂÚ Ó· ÓÔ‰ÂÎÂÌÌÓÈ ÌÂÓ‰ÌÓÓ‰ÌÓÒÚË ÊË‚ÓÚÌ˚ı ÔÓ‰ÍÓÌÚÓθÌÓ„Ó ÒÚ‡‰‡ ÔÓ ÔÓÏÂ‡Ï ¯ËËÌ˚ „Û‰Ë; ‚˚ÒÓ͇fl
ÍÓÂÎflˆËÓÌ̇fl ËÁÏÂ̘˂ÓÒÚ¸ ÏÂÊ‰Û ÔÓÏÂ‡ÏË, ÍÓÚÓ˚ ӷ‡ÁÛ˛Ú ‚Â‰Û˘Ë Ë̉ÂÍÒ˚ ÚÂÎÓÒÎÓÊÂÌËfl, Á‡ ËÒÍβ˜ÂÌËÂÏ Ë̉ÂÍÒÓ‚ Ú‡ÁÓ„Û‰ÌÓ„Ó,
„Û‰ÌÓ„Ó Ë ¯ËÓÍÓ„Û‰ÓÒÚË, ҂ˉÂÚÂθÒÚ‚ÛÂÚ Ó·
Ó·˙ÂÍÚË‚ÌÓÈ ÏÓÚË‚‡ˆËË Ëı ËÒÔÓθÁÓ‚‡ÌËfl ÔË
ÓˆÂÌÍ ˝ÍÒÚÂ¸ÂÌÓ„Ó ÚËÔ‡ ÊË‚ÓÚÌ˚ı; ÔÓÎÛ˜ÂÌÌ˚Â
‚˚ÒÓÍÓ‰ÓÒÚÓ‚ÂÌ˚ ÍÓÂÎflˆËË ÏÂÊ‰Û ÔÓÏÂ‡ÏË, ÍÓÚÓ˚ ÙÓÏËÛ˛Ú Ë̉ÂÍÒ˚ ÚÂÎÓÒÎÓÊÂÌËfl,
Ë Û‰ÓÂÏ ÍÓÓ‚ Á‡ ·ÍÚ‡ˆË˛ Ì ËÏÂ˛Ú ‡Ì‡Îӄ˘ÌÓ„Ó (ÒÓ‚ÓÍÛÔÌÓ„Ó) ‚ÎËflÌËfl ̇ ÛÓ‚Â̸ Û‰Ófl, ÍÓ„‰‡ ÓÌË Ô‰ÒÚ‡‚ÎÂÌ˚ ÛÊ ‚ ÙÓÏ Ë̉ÂÍÒÓ‚; ÔÓÎÛ˜ÂÌÌ˚ ÒÚÂÔÂ̸ Ë Ì‡Ô‡‚ÎÂÌË ÍÓ˝ÙÙˈËÂÌÚÓ‚
ÍÓÂÎflˆËÈ ÏÂÊ‰Û Ë̉ÂÍÒ‡ÏË ‡ÒÚflÌÛÚÓÒÚË, Ú‡ÁÓ„Û‰Ì˚Ï, ¯ËÎÓÁ‡‰ÓÒÚË, ÍÓÒÚËÒÚÓÒÚË, ¯ËÓÍÓ„Û‰ÓÒÚË Ë Û‰ÓÂÏ Á‡ ·ÍÚ‡ˆË˛ ÔÓ‰Ú‚Âʉ‡˛Ú ‚ÓÁÏÓÊÌÓÒÚ¸ Ëı ËÒÔÓθÁÓ‚‡ÌËfl ‚ ÒÂÎÂ͈ËÓÌÌÓÈ ‡·ÓÚÂ
Ò ÏÓÎÓ˜Ì˚Ï ÒÍÓÚÓÏ.
èÂÒÔÂÍÚË‚‡ ÔÓÒÎÂ‰Û˛˘Ëı ËÒÒΉӂ‡ÌËÈ ÔÓ
ËÒÔÓθÁÓ‚‡Ì˲ Ë̉ÂÍÒÓ‚ ÚÂÎÓÒÎÓÊÂÌËfl ‰Îfl ÓˆÂÌÍË ‰Ë̇ÏËÍË ÓÌÚÓ„ÂÌÂÚ˘ÂÒÍÓ„Ó ‡Á‚ËÚËfl ÛÍ‡ËÌÒÍÓÈ Í‡ÒÌÓ-ÔÂÒÚÓÈ ÏÓÎÓ˜ÌÓÈ ÔÓÓ‰˚ ÔÓÁ‚ÓÎËÚ
ÛÒÚ‡ÌÓ‚ËÚ¸ ·ËÓÎӄ˘ÂÒÍË Á‡ÍÓÌÓÏÂÌÓÒÚË ‡Á‚ËÚËfl Ò ‰ËÙÙÂÂ̈ˇˆËÂÈ Ëı ÔÓ Ì‡Ô‡‚ÎÂÌ˲ ÔÓ‰ÛÍÚË‚ÌÓÒÚË ‚ ÔÓˆÂÒÒ ÍÓÌÒÓÎˉ‡ˆËË ÒÚ‡‰‡ ÔÓ
˝ÍÒÚÂ¸ÂÌÓÏÛ ÚËÔÛ.
Литература
1. Ň‡ÌÓ‚ Ä. íËÔËÓ‚‡ÌË ÍÓÒÚÓÏÒÍÓ„Ó ÒÍÓÚ‡ ÔÓ ÍÓÏÔÎÂÍÒÛ ÔËÁ̇ÍÓ‚/Ä. Ň‡ÌÓ‚, å. ëËÓÚË̇, ã. åÛ‡‰Ó‚‡ //åÓÎÓ˜ÌÓÂ Ë ÏflÒÌÓ ÒÍÓÚÓ‚Ó‰ÒÚ‚Ó. — 2008. — ‹ 4. — ë. 12–13.
2. ÅÓËÒÂÌÍÓ Ö. ü. ê‡Á‚‰ÂÌË ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı. å.: äÓÎÓÒ, 1967. — ë. 97–162.
3. ÅÛÍ‡Ú Ç. è. ãËÌÂÈ̇fl ÓˆÂÌ͇ ÍÓÓ‚ ÔÓ ÚËÔÛ/Ç. è. ÅÛ͇Ú, û. è. èÓÎÛÔ‡Ì, à. é. âÓ‚ÂÌÍÓ. — ä.: Ä„‡̇fl ̇Û͇, 2004. — 88 Ò.
4. ÉˈÂÌÍÓ ë. Ä. ÇÁ‡ËÏÓÒ‚flÁ¸ ÔÓ‰ÛÍÚË‚ÌÓÒÚË ˜ÂÌÓ-ÔÂÒÚÓ„Ó ÒÍÓÚ‡ ÁÓÌ˚ ûÊÌÓ„Ó ì‡Î‡ Ò ˝ÍÒÚÂ¸ÂÌ˚ÏË ÓÒÓ·ÂÌÌÓÒÚflÏË / ë. Ä. ÉˈÂÌÍÓ, Ä. Ä. á‡È‰ÛÎÎË̇, Ä. É. ò‡ÈıËÒ·ÏÓ‚, ç. Ç. çÓÓ‚ //áÓÓÚÂıÌËfl. — 2006. — ‹ 12. — ë. 10–11.
5. чÌËÎÍË‚ é. ç. äË‚ÓÎËÌÂÈÌÓÒÚ¸ Ò‚flÁË ÛÓ‚Ìfl Û‰Ófl ÍÓÓ‚ Ò ÔÓ͇Á‡ÚÂÎflÏË ˝ÍÒÚÂ¸Â‡/é. ç. чÌËÎÍË‚, à. à. ëË‡ˆÍËÈ //áÓÓÚÂıÌËfl. — 2001. — ‹ 9. — ë. 2–3.
6. ä‡‚˜ÂÌÍÓ ç. Ä. ê‡Á‚‰ÂÌË ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı. å.: ëÂθıÓÁËÁ‰‡Ú. — 1963. — 311 Ò.
7. åÂÍÛ¸Â‚‡ Ö. ä. ÅËÓÏÂÚËfl ‚ ÒÂÎÂ͈ËË Ë „ÂÌÂÚËÍ ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı/Ö. ä. åÂÍÛ¸Â‚‡ — å. : äÓÎÓÒ, 1970. — 423 Ò.
8. ëÂθˆÓ‚ Ç. à. éÔÚËχθÌ˚ ԇ‡ÏÂÚ˚ ˝ÍÒÚÂ¸Â‡ ÒËÏÏÂÌڇθÒÍËı ÍÓÓ‚/Ç. à. ëÂθˆÓ‚ //áÓÓÚÂıÌËfl. — 2000. — ‹2. — ë. 10–12.
9. ëˉÓÓ‚‡ Ç. û. ùÍÒÚÂ¸ÂÌ˚ ÔËÁ̇ÍË ÏÓÎÓ˜ÌÓ„Ó ÒÍÓÚ‡ êÓÒÒËÈÒÍÓÈ î‰Â‡ˆËË Ë Ëı ‚Á‡ËÏÓÒ‚flÁ¸
Ò ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸˛/Ç. û. ëˉÓÓ‚‡ //áÓÓÚÂıÌËfl. — 2006. — ‹ 5. — ë. 4–6.
10. üˆÂÌÍÓ Ä. Ö. ã·‰ËÌÒ͇fl ÔÓÓ‰‡ ÍÛÔÌÓ„Ó Ó„‡ÚÓ„Ó ÒÍÓÚ‡. — ä.: «Ååí», 1997. — 300 Ò.
Оценка коров украинской красно-пестрой молочной породы
в соотносительной изменчивости промеров и индексов телосложения
23
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 24
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
4/2014
Khmel'nichiy L. M., Vechоrka V. V.
An estimation of cows of the ukrainian red-and-white dairy breed
is in correlative changeability of body measurements
and indexes of data frame
Abstract. In the process of researches on determination of averages and changeability of indexes of data
frame, establishments of degree and direction of correlations between indexes of data frame, each of the utilized
indexes between itself, with determination their general and influences singly on the level of the dairy productivity of first-calf cows of the Ukrainian red-and-white dairy breed are set that middle indexes of data frame
cows of the probed breed are characteristic for animals of dairy type. High cross-correlation changeability between body measurements which form the indexes of data frame testifies to objective motivation of their using
for the estimation of animals on an exterior type. High-reliable correlations are got between body measurements which form the indexes data frame, and the yield of milk of cows for a lactation is not have an analogical
combined influence on the level of yield of milk, when they are presented in form indexes. Nevertheless, the
got degree and direction of coefficients of correlations between basic indexes and yield of milk for a lactation
certify possibility of their use in plant-breeding work with a dairy cattle.
Key words: body measurements, indexes, exterior, yield of milk, Ukrainian red- and-white dairy breed.
Authors:
Khmel'nichiy L. M. — Dr. of agricultural sciences, Professor, Head of Department of Animal Breeding and
Selection of living aquatic resources, Sumy National Agrarian University;
Vechorka V. V. — candidate of agricultural sciences, associate Professor of breeding and breeding animals
and aquatic biological resources Sumy National Agrarian University.
24
Л. М. Хмельничий, В. В. Вечёрка ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 25
Рубрика: Генетика и разведение животных
УДК 575.162
О. В. Митрофанова, Н. В. Дементьева, В. И. Тыщенко, О. П. Юрченко, А. Б. Вахрамеев
Связь генотипов по однонуклеотидным заменам в гене миостатина
с показателями живой массы у кур Пушкинской породы
Аннотация. С помощью метода ПЦР-ПДРФ были проанализированы частоты двух SNP в гене GDF-8
у кур Пушкинской породы экспериментального хозяйства ФГУП «Генофонд». Определена взаимосвязь изученных замен с показателями живой массы курочек и петушков в 7, 49 и 110 дней.
Ключевые слова: полиморфизм, SNP, GDF-8, PCR-RFLP.
Авторы:
Митрофанова Ольга Викторовна — кандидат биологических наук, старший научный сотрудник лаборатории молекулярной цитогенетики, ВНИИГРЖ, Санкт-Петербург, пос. Тярлево, Московское шоссе, 55а,
+7 (921) 796-41-63, [email protected];
Дементьева Наталия Викторовна — кандидат биологических наук, ведущий научный сотрудник лаборатории молекулярной цитогенетики, ВНИИГРЖ, Санкт-Петербург, пос. Тярлево, Московское шоссе, 55а,
+7 (921) 743-07-43, [email protected];
Тыщенко Валентина Ивановна — кандидат биологических наук, старший научный сотрудник лаборатории молекулярной цитогенетики, ВНИИГРЖ, Санкт-Петербург, пос. Тярлево, Московское шоссе, 55а;
Юрченко Олег Павлович — кандидат биологических наук, старший научный сотрудник лаборатории
сохранения генофонда, ВНИИГРЖ, Санкт-Петербург, пос. Тярлево, Московское шоссе, 55а;
Вахрамеев Анатолий Борисович — старший научный сотрудник лаборатории сохранения генофонда,
ВНИИГРЖ, Санкт-Петербург, пос. Тярлево, Московское шоссе, 55а.
ǂ‰ÂÌËÂ. ÉÂÌ (GDF-8), ËÎË ÏËÓÒÚ‡ÚËÌ, fl‚ÎflÂÚÒfl Ô‰ÒÚ‡‚ËÚÂÎÂÏ „ÛÔÔ˚ Ú‡ÌÒÙÓÏËÛ˛˘Ëı
β-Ù‡ÍÚÓÓ‚ ÓÒÚ‡ (TGF-β). Ö„Ó ÓÒÌӂ̇fl Á‡‰‡˜‡
Á‡Íβ˜‡ÂÚÒfl ‚ „ÛÎËÓ‚‡ÌËË Ï‡ÒÒ˚ ÒÍÂÎÂÚÌ˚ı
Ï˚¯ˆ ÔÛÚÂÏ Ì„‡ÚË‚ÌÓ„Ó ‚ÓÁ‰ÂÈÒÚ‚Ëfl [1, 2]. ÇÔÂ‚˚ ˝ÚÓÚ „ÂÌ ·˚Πӷ̇ÛÊÂÌ Û Ï˚¯ÂÈ [3]. ì ÍÛÔÌÓ„Ó Ó„‡ÚÓ„Ó ÒÍÓÚ‡ ÓÌ ·˚ΠˉÂÌÚËÙˈËÓ‚‡Ì ͇Í
„ÂÌ, ‚˚Á˚‚‡˛˘ËÈ „ËÔÂÚÓÙËÓ‚‡ÌÌÓ ‡Á‚ËÚËÂ
ÏÛÒÍÛ·ÚÛ˚ (Ú‡Í Ì‡Á˚‚‡Âχfl «Double muscling»
Û ÍÓÓ‚ ÅÂθ„ËÈÒÍÓÈ „ÓÎÛ·ÓÈ ÔÓÓ‰˚) [4, 5, 6].
èÓÒΉӂ‡ÚÂθÌÓÒÚ¸ „Â̇ MSTN ÓÔ‰ÂÎÂ̇ Û ˆÂÎÓ„Ó fl‰‡ ÊË‚ÓÚÌ˚ı Ë ˜ÂÎÓ‚Â͇. ì ÍÛ „ÂÌ MSTN
ÒÓÒÚÓËÚ ËÁ ÚÂı ˝ÍÁÓÌÓ‚, ‰ÎËÌÓÈ 373 Ô.Ì., 374 Ô.Ì.
Ë 1567 Ô.Ì. ÒÓÓÚ‚ÂÚÒÚ‚ÂÌÌÓ [7], Ë ‰‚Ûı ËÌÚÓÌÓ‚.
ꇷÓÚ˚ ÔÓÒΉÌËı ÎÂÚ Ì‡Ô‡‚ÎÂÌ˚ ̇ ÔÓËÒÍ Ó‰ÌÓÌÛÍÎÂÓÚˉÌ˚ı Á‡ÏÂÌ (SNP) ‚ ÍÓ‰ËÛ˛˘ÂÈ ˜‡ÒÚË
ÏËÓÒÚ‡ÚËÌÓ‚Ó„Ó „Â̇. êfl‰ ËÒÒΉӂ‡ÚÂÎÂÈ Ó·Ì‡ÛÊËÎË Ò‚flÁ¸ ÓÚ‰ÂθÌ˚ı Á‡ÏÂÌ Ò ıÓÁflÈÒÚ‚ÂÌÌÓÔÓÎÂÁÌ˚ÏË ÔËÁ͇̇ÏË Û ÍÛ [8,9,10].
ÎÂÓÚˉÌ˚Ï Á‡ÏÂÌ‡Ï ‚ „ÂÌ ÏËÓÒÚ‡ÚË̇, ‡ Ú‡Í ÊÂ
ÓÔ‰ÂÎËÚ¸ Ò‚flÁ¸ SNP c ÊË‚ÓÈ Ï‡ÒÒÓÈ ÔÚˈ˚ ‚ ‡Á΢Ì˚ ÔÂËÓ‰˚  ÊËÁÌË.
ìÒÎÓ‚Ëfl, χÚÂˇÎ˚ Ë ÏÂÚÓ‰˚ ËÒÒΉӂ‡ÌËfl.
å‡ÚÂˇÎÓÏ ‰Îfl ̇¯Ëı ËÒÒΉӂ‡ÌËÈ ÔÓÒÎÛÊË·
Ñçä, ‚˚‰ÂÎÂÌ̇fl ËÁ ÍÓ‚Ë ÍÛ èÛ¯ÍËÌÒÍÓÈ ÔÓÓ‰˚ ˝ÍÒÔÂËÏÂÌڇθÌÓ„Ó ıÓÁflÈÒÚ‚‡ îÉìè «ÉÂÌÓÙÓ̉».
Ñçä ‚˚‰ÂÎflÎË ÔÓ Òڇ̉‡ÚÌÓÈ ÏÂÚÓ‰ËÍÂ, Ò ËÒÔÓθÁÓ‚‡ÌËÂÏ ÔÓÚÂË̇Á˚ ä (ëË·˝ÌÁËÏ, çÓ‚ÓÒË·ËÒÍ) Ë ÙÂÌÓ·.
éÒÓ·ÂÌÌÓÒÚ¸ ÒÂÎÂ͈ËÓÌÌÓÈ ‡·ÓÚ˚ ‚ ÔÚˈ‚ӉÒÚ‚Â Á‡Íβ˜‡ÂÚÒfl ‚ ÚÓÏ, ˜ÚÓ Ë‰ÂÚ ËÌÚÂÌÒË‚Ì˚È ÓÚ·Ó Ò‡ÁÛ ÔÓ ÌÂÒÍÓθÍËÏ ÔËÁ͇̇Ï. ùÚÓ ÔÓÁ‚ÓÎflÂÚ ‡ÒÒχÚË‚‡Ú¸ ÏÓÎÂÍÛÎflÌ˚ χÍÂ˚ ͇Í
ıÓӯˠ‰ÓÔÓÎÌËÚÂθÌ˚ ÔÓÏÓ˘ÌËÍË ‰Îfl ÛÒÔ¯ÌÓ„Ó ÓÚ·Ó‡ ÔÚˈ˚ [11, 12].
ÑÎfl ÚËÔËÓ‚‡ÌËfl ·˚ÎË ‚˚·‡Ì˚ ‰‚ ԇ˚
Ô‡ÈÏÂÓ‚: MSTpr (ÔflÏÓÈ 5’-AAC-CAA-TCGTCG-GTT-TTG-AC-3’, Ó·‡ÚÌ˚È 5’-CGT-TCTCTG-TGG-GCT-GAC-TA-3’) Ë MSTex1 (ÔflÏÓÈ
5’-TAG-TCA-GCC-CAC-AGA-GAA-CG-3’, Ó·‡ÚÌ˚È 5’-CGA-AAG-CAG-CAG-GGT-TGT-TA-3’).
ë Ëı ÔÓÏÓ˘¸˛ ÔÓÎÛ˜‡ÎË ‰‚‡ Û˜‡ÒÚ͇ ˝ÍÁÓ̇ 1 ÏËÓÒÚ‡ÚËÌÓ‚Ó„Ó „Â̇ (AF346599). èÓ‰ÛÍÚ˚ ‡ÏÔÎËÙË͇ˆËË Ó·‡·‡Ú˚‚‡ÎË Ò ÔÓÏÓ˘¸˛ ÂÒÚËÍÚ‡Á
HpaII Ë HinPII (Thermo). Ç ÂÁÛθڇÚÂ, ·˚ÎË Ì‡È‰ÂÌ˚ ‰‚ ӉÌÓÌÛÍÎÂÓÚˉÌ˚ Á‡ÏÂÌ˚ (SNP). ùÚÓ
Á‡ÏÂ̇ G/A ‚ ÔÓÎÓÊÂÌËË 2109 Ë Á‡ÏÂ̇ G/C ‚ ÔÓÎÓÊÂÌËË 2244 ÏËÓÒÚ‡ÚËÌÓ‚Ó„Ó „Â̇.
ñÂθ˛ ̇¯ÂÈ ‡·ÓÚ˚ ·˚ÎÓ ÔӇ̇ÎËÁËÓ‚‡Ú¸
ÔÓÔÛÎflˆË˛ ÍÛ èÛ¯ÍËÌÒÍÓÈ ÔÓÓ‰˚ îÉìè «ÉÂÌÓÙÓ̉» ̇ ̇΢ˠÔÓÎËÏÓÙËÁχ ÔÓ Ó‰ÌÓÌÛÍ-
ÑÎfl ÓÒÛ˘ÂÒÚ‚ÎÂÌËfl ÔÓÎËÏÂ‡ÁÌÓÈ ˆÂÔÌÓÈ ‡͈ËË „ÓÚÓ‚ËÎË ÒÏÂÒ¸ ËÁ ÒÎÂ‰Û˛˘Ëı ÍÓÏÔÓÌÂÌÚÓ‚: 67 må ÚËÒ -HCl pH 8,6, 2,5 mM MgCl2,
Связь генотипов по однонуклеотидным заменам в гене миостатина
с показателями живой массы у кур Пушкинской породы
25
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 26
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
16,6 mM NHOH, 0,125 Ïå Í‡Ê‰Ó„Ó ËÁ ‰ÂÁÓÍÒËË·ÓÌÛÍÎÂÓÚˉÚËÙÓÒÙ‡ÚÓ‚ (dATP, dGTP, dCTP,
dTTP), 0,5 ÏÍå Ô‡ÈÏÂ‡, 50–100 Ì„ „ÂÌÓÏÌÓÈ
Ñçä Ë 2,5 ‰ Taq-ÔÓÎËÏÂ‡Á˚ («ëË·˝ÌÁËÏ», çÓ‚ÓÒË·ËÒÍ). é·˘ËÈ Ó·˙ÂÏ ‡͈ËÓÌÌÓÈ ÒÏÂÒË ÒÓÒÚ‡‚ÎflÎ 10 ÏÍÎ.
êÂ‡ÍˆË˛ ÔÓ‚Ó‰ËÎË Ì‡ ‡ÏÔÎËÙË͇ÚÓ «Biorad» (ëòÄ). àÒÔÓθÁÓ‚‡ÎË ÂÊËÏ, ÒÓÒÚÓfl˘ËÈ ËÁ
35 ˆËÍÎÓ‚: 30 ÒÂÍ — 940ë, 30 ÒÂÍ — 600ë, 30 ÒÂÍ —
720ë. ÑÎfl ÂÒÚË͈ËË ‚ ÔÓ·ËÍÛ ‰Ó·‡‚ÎflÎË 0,5 ÏÍÎ
ÌÂÓ·ıÓ‰ËÏÓÈ ÂÒÚËÍÚ‡Á˚ HpaII, HinPII (Thermo), ÔÂÂϯ˂‡ÎË Ë ÒÚ‡‚ËÎË Ì‡ ËÌÍÛ·‡ˆË˛ ̇
3 ˜‡Ò‡ ÔË 370C.
ÑÎfl ˝ÎÂÍÚÓÙÓÂÁ‡ ËÒÔÓθÁÓ‚‡ÎË 1,5% ‡„‡ÓÁÌ˚ „ÂÎË, ÒÓ‰Âʇ˘Ë ÙÎÛÓÂÒˆÂÌÚÌ˚È Í‡ÒËÚÂθ
·ÓÏËÒÚ˚È ˝ÚˉËÈ, Ë íÇÖ-·ÛÙÂ (45 Ïå ÚËÒ·Ó‡Ú. 1 Ïå ùÑíÄ). ëÏÂÒ¸ ÔÓÒΠÂÒÚË͈ËË ‚ÌÓÒËÎË ‚ ͇χ¯ÍË „ÂÎfl. ùÎÂÍÚÓÙÓÂÁ ÔÓ‚Ó‰ËÎË
‚ Ú˜ÂÌË 1 ˜‡Ò‡ ÔË ‡·Ó˜ÂÏ Ì‡ÔflÊÂÌËË 150 Ç.
Ç Í‡˜ÂÒڂ χÍÂ‡, ÔÓÁ‚ÓÎfl˛˘Â„Ó ÓˆÂÌËÚ¸ ‰ÎËÌÛ Ù‡„ÏÂÌÚÓ‚ Ñçä ̇ „ÂÎÂ, ËÒÔÓθÁÓ‚‡ÎË pUC/
MspI (Fermentas). ë˄̇ΠÙÎÛÓÂÒˆÂ̈ËË ÙÓÚÓ„‡ÙËÓ‚‡ÎË ‚ ÒËÒÚÂÏ „Âθ-‰ÓÍÛÏÂÌÚ‡ˆËË ÙËÏ˚ äÓ‰‡Í.
Ä̇ÎËÁ Ë Ó·ÒÛʉÂÌË ÂÁÛθڇÚÓ‚. ó‡ÒÚÓÚ˚
‡ÎÎÂÎÂÈ Ë „ÂÌÓÚËÔÓ‚ ÔÓ ‰‚ÛÏ ËÁÛ˜ÂÌÌ˚Ï Á‡ÏÂ̇Ï
Û ÍÛ èÛ¯ÍËÌÒÍÓÈ ÔÓÓ‰˚ Ô‰ÒÚ‡‚ÎÂÌ˚ ‚ Ú‡·Îˈ 1.
4/2014
ÇˉÌÓ, ˜ÚÓ ÔÓ Á‡ÏÂÌ MST2109 ̇·Î˛‰‡ÂÚÒfl
ÒÛ˘ÂÒÚ‚ÂÌÌÓ ÔÂӷ·‰‡ÌË GG „ÂÌÓÚËÔ‡ Ò ˜‡ÒÚÓÚÓÈ ‚ÒÚ˜‡ÂÏÓÒÚË 0,81. ëΉӂ‡ÚÂθÌÓ, ÔË ‡Ì‡ÎËÁ ˜‡ÒÚÓÚ ‚ÒÚ˜‡ÂÏÓÒÚË ‡ÎÎÂÎÂÈ, Ï˚ ̇·Î˛‰‡ÎË
ÔÂËÏÛ˘ÂÒÚ‚Ó ‡ÎÎÂÎfl G (˜‡ÒÚÓÚ‡ ‚ÒÚ˜‡ÂÏÓÒÚË
0,89). ÄÎÎÂθ Ä Û Ô‰ÒÚ‡‚ËÚÂÎÂÈ ˝ÚÓÈ ÔÓÓ‰˚
‚ÒÚ˜‡ÎÒfl ‰ÍÓ.
èË ‡Ì‡ÎËÁ ˜‡ÒÚÓÚ ‚ÒÚ˜‡ÂÏÓÒÚË ‡Á΢Ì˚ı
„ÂÌÓÚËÔÓ‚ Û èÛ¯ÍËÌÒÍËı ÍÛ ÔÓ Á‡ÏÂÌ MST2244
ÓÚϘ‡ÎÓÒ¸ Á̇˜ËÚÂθÌÓ ÔÂӷ·‰‡ÌË „ÓÏÓÁË„ÓÚ ëë, ˜ÚÓ ÔË‚ÂÎÓ Í ÒÛ˘ÂÒÚ‚ÂÌÌÓÏÛ ÒÏ¢ÂÌ˲
˜‡ÒÚÓÚ ‡ÎÎÂÎÂÈ. ó‡ÒÚÓÚ‡ ‡ÎÎÂÎfl ë ÒÓÒÚ‡‚Ë· 0,87.
èÓÒÍÓθÍÛ, ÔӇ̇ÎËÁËÓ‚‡ÌÓ ÔÓ ‰‡ÌÌÓÈ Á‡ÏÂÌ ·˚ÎÓ ‰ÓÒÚ‡ÚÓ˜ÌÓ ·Óθ¯Ó ÔÓ„ÓÎÓ‚¸Â ÍÛ,
ÏÓÊÌÓ „Ó‚ÓËÚ¸ Ó Ì‡Ô‡‚ÎÂÌÌÓÏ ÓÚ·ÓÂ, ÍÓÚÓÓÏÛ
ÔÓ‰‚Â„‡Î‡Ò¸ ˝Ú‡ ÔÓÓ‰‡ ‚ ıӉ ÒÂÎÂ͈ËË.
èË ‡Ì‡ÎËÁ ÔÓ͇Á‡ÚÂÎÂÈ ÊË‚ÓÈ Ï‡ÒÒ˚ ‚ ÔÓÔÛÎflˆËË èÛ¯ÍËÌÒÍÓÈ ÔÚˈ˚ Ï˚ ̇·Î˛‰‡ÎË, ˜ÚÓ
‚ 110 ‰ÌÂÈ Ë Û ÍÛÓ˜ÂÍ, Ë Û ÔÂÚÛ¯ÍÓ‚ Ò „ÂÌÓÚËÔÓÏ
ÄÄ ÔÓ Á‡ÏÂÌ MST2109 ˝ÚÓÚ ÔÓ͇Á‡ÚÂθ ·˚Î ‚˚¯Â, ˜ÂÏ Û ÔÚˈ˚ Ò ‰Û„ËÏ „ÂÌÓÚËÔÓÏ (Ú‡·Îˈ‡ 2).
í‡Í, ÍÛÓ˜ÍË ‚ ˝ÚÓÏ ‚ÓÁ‡ÒÚ ‚ÂÒËÎË 1714±87 „,
‡ ÔÂÚÛ¯ÍË — 2460±190 „. ä ÒÓʇÎÂÌ˲, χÎÓÂ
˜ËÒÎÓ ÔӇ̇ÎËÁËÓ‚‡ÌÌ˚ı ÊË‚ÓÚÌ˚ı Ì ÔÓÁ‚ÓÎËÎÓ Ò˜ËÚ‡Ú¸ ˝ÚË ‡Á΢Ëfl ‰ÓÒÚÓ‚ÂÌ˚ÏË.
Ç Ú‡·Îˈ 3 Ô‰ÒÚ‡‚ÎÂÌ˚ ÂÁÛθڇÚ˚ Ò‚flÁË
ÊË‚ÓÈ Ï‡ÒÒ˚ Ò „ÂÌÓÚËÔÓÏ ÔÓ Á‡ÏÂÌ MST 2244.
à ıÓÚfl ÔÓ ˝ÚÓÏÛ ÔÓ͇Á‡ÚÂβ ‚ 110 ‰ÌÂÈ Á̇˜ËÚÂθ-
퇷Îˈ‡ 1. ó‡ÒÚÓÚ˚ ‡ÎÎÂÎÂÈ Ë „ÂÌÓÚËÔÓ‚ ÔÓ ‰‚ÛÏ SNP, ‚˚fl‚ÎÂÌÌ˚Ï ‚ ÏËÓÒÚ‡ÚËÌÓ‚ÓÏ „ÂÌÂ
Û ÍÛ èÛ¯ÍËÌÒÍÓÈ ÔÓÓ‰˚ (n=139) îÉìè «ÉÂÌÓÙÓ̉»
SNP
MST2109
(n=139)
MST2244
(n=144)
ÉÂÌÓÚËÔ
ó‡ÒÚÓÚ‡ „ÂÌÓÚËÔÓ‚
GG
0,81
GA
0,16
AA
0,03
ëë
0,76
ëG
0,21
GG
0,03
ÄÎÎÂÎË
ó‡ÒÚÓÚ‡ ‡ÎÎÂÎÂÈ
G
0,89
A
0,11
ë
0,87
G
0,13
퇷Îˈ‡ 2. ÜË‚‡fl χÒÒ‡ („) ÍÛÓ˜ÂÍ Ë ÔÂÚÛ¯ÍÓ‚ èÛ¯ÍËÌÒÍÓÈ ÔÓÓ‰˚ ‚ Á‡‚ËÒËÏÓÒÚË
ÓÚ „ÂÌÓÚËÔ‡ ÔÓ Á‡ÏÂÌ MST 2109
ÜË‚‡fl χÒÒ‡ ÍÛÓ˜ÂÍ ‚ 7 ‰ÌÂÈ
AA
GA
GG
ë‰Ì ÔÓ ÒÚ‡‰Û
72±16 (n=2)
82±2 (n=21)
82±0,9 (n=107)
81±0,8 (n=138)
ÜË‚‡fl χÒÒ‡ ÔÂÚÛ¯ÍÓ‚ ‚ 7 ‰ÌÂÈ
89±3 (n=2)
86±2 (n=29)
89±0,9 (n=100)
88±0,8 (n=132)
ÜË‚‡fl χÒÒ‡ ÍÛÓ˜ÂÍ ‚ 49 ‰ÌÂÈ
823±33 (n=4)
738±17 (n=21)
772±9 (n=93)
771±8 (n=125)
ÜË‚‡fl χÒÒ‡ ÔÂÚÛ¯ÍÓ‚ ‚ 49 ‰ÌÂÈ
920 (n=1)
916±20 (n=25)
914±12 (n=91)
915±10 (n=118)
ÜË‚‡fl χÒÒ‡ ÍÛÓ˜ÂÍ ‚ 110 ‰ÌÂÈ
1714±87 (n=4)
1514±35 (n=22)
1570±15 (n=112)
1570±14 (n=142)
ÜË‚‡fl χÒÒ‡ ÔÂÚÛ¯ÍÓ‚ ‚ 110 ‰ÌÂÈ 2460±190 (n=2) 2197±37 (n=31)
2198±22 (n=102)
2201±19 (n=136)
26
О. В. Митрофанова и др. ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 27
Рубрика: Генетика и разведение животных
퇷Îˈ‡ 3. ÜË‚‡fl χÒÒ‡ („) ÍÛÓ˜ÂÍ Ë ÔÂÚÛ¯ÍÓ‚ èÛ¯ÍËÌÒÍÓÈ ÔÓÓ‰˚ ‚ Á‡‚ËÒËÏÓÒÚË
ÓÚ „ÂÌÓÚËÔ‡ ÔÓ Á‡ÏÂÌ MST 2244
CC
CG
GG
ë‰Ì ÔÓ ÒÚ‡‰Û
ÜË‚‡fl χÒÒ‡ ÍÛÓ˜ÂÍ ‚ 7 ‰ÌÂÈ
81±0.9 (n=105)
81±2 (n=28)
80±8 (n=2)
81±0,8 (n=107)
ÜË‚‡fl χÒÒ‡ ÔÂÚÛ¯ÍÓ‚ ‚ 7 ‰ÌÂÈ
89±0.9 (n=92)
86±2 (n=33)
89±3 (n=7)
88±0,8 (n=107)
ÜË‚‡fl χÒÒ‡ ÍÛÓ˜ÂÍ ‚ 49 ‰ÌÂÈ
769±9 (n=91)
768±17 (n=27)
793±58 (n=4)
771±8 (n=107)
ÜË‚‡fl χÒÒ‡ ÔÂÚÛ¯ÍÓ‚ ‚ 49 ‰ÌÂÈ
912±12 (n=82)
910±20 (n=30)
964±44 (n=6)
915±10 (n=107)
1572±15 (n=108) 1551±34 (n=29) 1621±98 (n=4)
1570±14 (n=107)
2195±22 (n=94)
2201±19 (n=107)
ÜË‚‡fl χÒÒ‡ ÍÛÓ˜ÂÍ ‚ 110 ‰ÌÂÈ
ÜË‚‡fl χÒÒ‡ ÔÂÚÛ¯ÍÓ‚ ‚ 110 ‰ÌÂÈ
2186±35 (n=35) 2353±93 (n=7)
ÌÓ ÍÛÔÌ ·˚ÎË Ë ÍÛÓ˜ÍË (1621±98 „), Ë ÔÂÚÛ¯ÍË (2353±93 „) Ò „ÂÌÓÚËÔÓÏ GG, ÌÓ ‰ÓÒÚÓ‚ÂÌ˚Â
ÓÚ΢Ëfl Ì ̇·Î˛‰‡ÎËÒ¸. ùÚÓ Ò‚flÁ‡ÌÓ Ò ÚÂÏ, ˜ÚÓ
ÒÂ‰Ë ‚ÒÂÈ ÔÓÔÛÎflˆËË èÛ¯ÍËÌÒÍËı ÍÛ ‚ ˝ÍÒÔÂËÏÂÌڇθÌÓÏ ıÓÁflÈÒÚ‚Â Ì‡Ï Û‰‡ÎÓÒ¸ ӷ̇ÛÊËÚ¸
Î˯¸ 4 ÍÛˈ˚ Ë 7 ÔÂÚÛ¯ÍÓ‚ Ò Ú‡ÍËÏ „ÂÌÓÚËÔÓÏ.
2. èÓ Á‡ÏÂÌ MST2209 ÓÚϘ‡ÂÚÒfl ÒÛ˘ÂÒÚ‚ÂÌÌÓ ÔÂӷ·‰‡ÌË ÓÒÓ·ÂÈ Ò „ÂÌÓÚËÔÓÏ GG Ë ÔÓ‚˚¯ÂÌ̇fl ˜‡ÒÚÓÚ‡ ‡ÎÎÂÎfl G ‚ ËÁÛ˜‡ÂÏÓÈ ÔÓÔÛÎflˆËË.
èÓ Á‡ÏÂÌ MST2244 ÔÂӷ·‰‡ÎË ÍÛ˚ Ò „ÂÌÓÚËÔÓÏ ëë, ‡ ˜‡ÒÚÓÚ‡ ‡ÎÎÂÎÂÈ Á̇˜ËÚÂθÌÓ ÒÏ¢Â̇
‚ ÒÚÓÓÌÛ ÔÂӷ·‰‡ÌËfl ‡ÎÎÂÎfl ë.
Ç˚‚Ó‰˚. 1. ë ÔÓÏÓ˘¸˛ ÔÓÎËÏÂ‡ÁÌÓÈ ˆÂÔÌÓÈ
‡͈ËË ‚ ÔÓÔÛÎflˆËË ÍÛ èÛ¯ÍËÌÒÍÓÈ ÔÓÓ‰˚ ·˚ÎË ‚˚fl‚ÎÂÌ˚ ‰‚ ӉÌÓÌÛÍÎÂÓÚˉÌ˚ Á‡ÏÂÌ˚ ‚ „ÂÌ GDF-8 ‚ ÔÓÎÓÊÂÌËflı 2209 Ë 2244.
3. ÑÓÒÚÓ‚ÂÌ˚ı ÓÚ΢ËÈ ÔÓ ÔÓ͇Á‡ÚÂÎflÏ ÊË‚ÓÈ Ï‡ÒÒ˚ ÏÂÊ‰Û Ô‰ÒÚ‡‚ËÚÂÎflÏË ‡Á΢Ì˚ı „ÂÌÓÚËÔÓ‚ ‚ èÛ¯ÍËÌÒÍÓÈ ÔÓӉ ӷ̇ÛÊÂÌÓ ÌÂ
·˚ÎÓ.
Литература
1. Thomas M., Langley B., Berry C., Sharma M., Kirk S., Bass J. and Kambadur R. (2000). Myostatin, a negative regulator of muscle growth, functions by inhibiting myoblast proliferation. J. Biol. Chem. 275,
40235–40243.
2. Mc Croskery S., Thomas M., Maxwell L., Sharma M. and Kambadur R. (2003). Myostatin negatively
regulates satellite cell activation and self-renewal, J. Cell. Biol. 162, 1135–1147.
3. Mc Pherron A. C., Lawler A. M. and Lee S. J. (1997). Regulation of skeletal muscle mass in mice by a new
TGF-beta superfamily member. Nature. 387, 83–90.
4. Mc Pherron A. C. and Lee S. J. (1997). Double muscling in cattle due to mutations in the myostatin
gene. Proc. Natl. Acad. Sci. 94, 12457–12461.
5. Kambadur R., Sharma M., Smith T. P. L. and Bass J. J. (1997). Mutations in myostatin (GDF8) in
double-muscled Belgian Blue and Piedmontese cattle. Genome Res. 7, 910–915.
6. Grobet L., Poncelet D., Royo L. J., Brouwers B., Pirottin D., Michaux C., Ménissier F., Zanotti M.,
Dunner S. and Georges M. (1998). Molecular definition of an allelic series of mutations disrupting the
myostatin function and causing double muscling in cattle. Mammal. Genome. 9, 210–213
7. Baron E. E., Wenceslau A. A., Alvares L. E., Nones K., Ruy D. C., Schmidt G. S., Zanella E. L., Coutinho
L. L. and Ledur M. C. (2002). High level of polymorphism in the myostatin chicken gene. Pp. 19–23
in Proc. 7th World Congr. Genet. Appl. Livest. Prod. Montpellier, France.
8. Ä. üÍӂ΂, Ç. íÂΈÍËÈ, ù. ë˝ÍÒÚÂ Ë ‰. ÇÎËflÌË „Â̇ „ÓÏÓ̇ ÓÒÚ‡ ̇ ıÓÁflÈÒÚ‚ÂÌÌ˚ ÔËÁ̇ÍË
ÔÚˈ˚ //èÚˈ‚ӉÒÚ‚Ó. 2013. ‹ 1. ë. 2–4.
9. Ye X., Brown S. R., Nones K., Coutinho L. L., Dekkers J. C. and Lamont S. J. (2007). Associations of
myostatin gene polymorphisms with performance and mortality traits in broiler chickens. Genet. Sel.
Evol. 39, 73–89.
10. Zhiliang G., Dahai Z., Ning L., Hui L., Xuemei D. and Changxin W. (2004). The single nucleotide
polymorphisms of the chicken myostatin gene are associated with skeletal muscle and adipose growth.
Sci. China C. Life Sci. 47, 25–30.
11. í˚˘ÂÌÍÓ Ç. à., åËÚÓÙ‡ÌÓ‚‡ é. Ç., ÑÂÏÂÌڸ‚‡ ç. Ç. éˆÂÌ͇ „ÂÌÂÚ˘ÂÒÍÓ„Ó ‡ÁÌÓÓ·‡ÁËfl ‚ ÔÓÓ‰‡ı
Ë ˝ÍÒÔÂËÏÂÌڇθÌ˚ı ÔÓÔÛÎflˆËflı ÍÛ Ò ÔÓÏÓ˘¸˛ Ñçä-ÙËÌ„ÂÔËÌÚËÌ„‡ // ëÂθÒÍÓıÓÁflÈÒÚ‚ÂÌ̇fl
·ËÓÎÓ„Ëfl. 2007. ‹ 4.ë.29–33.
12. í˚˘ÂÌÍÓ Ç. à., ÑÂÏÂÌڸ‚‡ ç. Ç, íÂΈÍËÈ Ç. è., üÍӂ΂ Ä. î. éˆÂÌ͇ „ÂÌÂÚ˘ÂÒÍÓ„Ó ‡ÁÌÓÓ·‡ÁËfl Û ÍÛ ̇ ÓÒÌÓ‚Â „ÂÌÓÏÌÓÈ ‰‡ÍÚËÎÓÒÍÓÔËË //ëÂθÒÍÓıÓÁflÈÒÚ‚ÂÌ̇fl ·ËÓÎÓ„Ëfl. 2002. ‹ 6. ë–43.
Связь генотипов по однонуклеотидным заменам в гене миостатина
с показателями живой массы у кур Пушкинской породы
27
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 28
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
4/2014
Mitrofanova O. V., Dementeva N. V., Tyschenko V. I., Yurchenko O. P., Vachrameev A. B.
Relationship between genotypes with single nucleotide changes
in myostatin and weight in Pushkin breed chickens
Abstract. Frequencies of two SNP in the GDF-8 gene in Pushkin chickens of experimental farm were analyzed using PCR-RFLP. The correlation of replacements with weight of males and females at 7, 49 and 110 days
was shown.
Keywords: GDF-8, PCR-RFLP, chickens, polymorphism, SNP.
Authors:
Mitrofanova Olga Victorovna — researcher, Ph.D. in Biological Sciences, Russian Research Institute for Farm
Animal Genetics and Breeding, +7 (921) 796-41-63; [email protected];
Dementeva Natalia Victorovna — researcher, Ph.D. in Biological Sciences Russian Research Institute for
Farm Animal Genetics and Breeding, +7 (921) 743-07-43; [email protected];
Tyschenko Valentina Ivanovna — researcher, Ph.D. in Biological Sciences, Russian Research Institute for
Farm Animal Genetics and Breeding;
Yurchenko Oleg Pavlovich — researcher, Ph.D. in Biological Sciences, Russian Research Institute for Farm
Animal Genetics and Breeding;
Vachrameev Anatolij Borisovich — researcher, Russian Research Institute for Farm Animal Genetics and
Breeding.
28
О. В. Митрофанова и др. ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 29
Рубрика: Генетика и разведение животных
УДК 636.22/28.082
О. В. Тулинова, Е. В. Живоглазова
Продуктивность первотелок Айрширской породы разного
происхождения и методов выведения их отцов
Аннотация. В молочном скотоводстве основное влияние на продуктивные качества потомства оказывают быки-производители. В ведущем хозяйстве РФ по разведению айрширского скота ООО «ПЗ «Новоладожский» на протяжении многих лет использовались быки разного происхождения. При получении от них
потомства применялись такие методы разведения, как внутрилинейный и кросс линий, в том числе без инбридинга и с инбридингом. В ходе исследования выявлено, что лучшие продуктивные качества отмечены
у потомков финских производителей, выведенных методом кросса линий с разной степенью инбридинга.
Ключевые слова: метод выведения, бык-отец, корова, инбридинг, продуктивность, происхождение.
Авторы:
Тулинова Ольга Васильевна — кандидат сельскохозяйственных наук, зав. лабораторией генетики и селекции айрширского скота ВНИИГРЖ, Санкт-Петербург-Пушкин, Московское шоссе, 55а, e-mail: [email protected];
Живоглазова Екатерина Владимировна — младший научный сотрудник лаборатории генетики и селекции айрширского скота ВНИИГРЖ, 196244, Санкт-Петербург-Пушкин, Московское шоссе, 55а, e-mail:
[email protected]
Ç Ò‚flÁË ÒÓ ÒÏÂÌÓÈ ÒÂÎÂ͈ËÓÌÌÓÈ ÔÓÎËÚËÍË ‚ ÒÓ‚ÂÏÂÌÌÓÏ ÏÓÎÓ˜ÌÓÏ ÒÍÓÚÓ‚Ó‰ÒÚ‚Â Ò ÎËÌÂÈÌÓ„Ó ‡Á‚‰ÂÌËfl ̇ ËÒÔÓθÁÓ‚‡ÌË ÎˉÂÓ‚ ÔÓÓ‰˚ ‚ÓÁÌË͇ÂÚ ÌÂÓ·ıÓ‰ËÏÓÒÚ¸ ÛÒËÎÂÌËfl ÍÓÌÚÓÎfl Á‡ ÒÚÂÔÂ̸˛
ËÌ·ˉËÌ„‡ Û ÔÓÚÓÏÍÓ‚ [1].
àÌ·ˉËÌ„ fl‚ÎflÂÚÒfl ÌÂÓÚ˙ÂÏÎÂÏÓÈ ˜‡ÒÚ¸˛ ÒÓ‚ÂÏÂÌÌÓ„Ó ‡Á‚‰ÂÌËfl ÊË‚ÓÚÌ˚ı, ÍÓÚÓ˚È ËÏÂÂÚ Í‡Í ÔÓÎÓÊËÚÂθÌÓ ‚ÎËflÌËÂ, ÚÓ ÂÒÚ¸ ÔÓ‚˚¯‡ÂÚ
ÍÓ΢ÂÒÚ‚Ó Ë Í‡˜ÂÒÚ‚Ó ÔÓ‰ÛÍÚË‚ÌÓÒÚË ÊË‚ÓÚÌÓ„Ó, Ú‡Í Ë ÓÚˈ‡ÚÂθÌÓÂ, ˜ÚÓ ÔÓfl‚ÎflÂÚÒfl ‚ ‚ˉÂ
ËÌ·‰ÌÓÈ ‰ÂÔÂÒÒËË [2].
ñÂθ Ë Á‡‰‡˜Ë. ñÂθ ̇¯Ëı ËÒÒΉӂ‡ÌËÈ Á‡Íβ˜‡Î‡Ò¸ ‚ ‚˚fl‚ÎÂÌËË ‚ÎËflÌËfl ÔÓËÒıÓʉÂÌËfl
Ë ÏÂÚÓ‰Ó‚ ‚˚‚‰ÂÌËfl ·˚ÍÓ‚-ÔÓËÁ‚Ó‰ËÚÂÎÂÈ Ì‡
ÔÓ‰ÛÍÚË‚Ì˚ ͇˜ÂÒÚ‚‡ ÔÂ‚ÓÚÂÎÓÍ.
åÂÚÓ‰˚. àÒÒΉӂ‡ÌËfl Ôӂ‰ÂÌ˚ ÔÓ ‰‡ÌÌ˚Ï
˝ÎÂÍÚÓÌÌÓÈ ·‡Á˚ «ëÂνÍÒ» ééé «èá «çÓ‚Ó·‰ÓÊÒÍËÈ» ãÂÌËÌ„‡‰ÒÍÓÈ Ó·Î‡ÒÚË. èÓ ËÚÓ„‡Ï ·ÓÌËÚËÓ‚ÍË 2013 „Ó‰‡ ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸ ÍÓÓ‚ ‚ Ò‰ÌÂÏ ÔÓ ÒÚ‡‰Û ÒÓÒÚ‡‚Ë· 8209 Í„, ‡ ÔÓ ÔÂ‚ÓÚÂÎÍ‡Ï —
7767 Í„ ÏÓÎÓ͇.
Ç Ó·‡·ÓÚÍÛ ‚Ó¯ÎË 87 ·˚ÍÓ‚-ÓÚˆÓ‚ ÒÚ‡‰‡ Ë 2989
Ëı ‰Ó˜ÂÂÈ. èÓËÒıÓʉÂÌË ÊË‚ÓÚÌ˚ı ÓÔ‰ÂÎflÎË
‚ Á‡‚ËÒËÏÓÒÚË ÓÚ ÏÂÒÚ‡ ÓʉÂÌËfl ÊË‚ÓÚÌ˚ı ÔÓ
‰‡ÌÌ˚Ï Í‡ÚÓ˜ÂÍ 1-ÏÓÎ Ë Ò‡ÈÚÓ‚ www.faba.fi, www.
cdn.ca, www.semex.com, www.vikinggenetics.com.
ê‡Ò˜ÂÚ ËÌ·ˉËÌ„‡ Ë ÎËÌÂÈÌÛ˛ ÔË̇‰ÎÂÊÌÓÒÚ¸
·˚ÍÓ‚ Ë ÍÓÓ‚ ÓÒÛ˘ÂÒÚ‚ÎflÎË Ò ÔÓÏÓ˘¸˛ ÍÓÏÔ¸˛ÚÂÌÓÈ ÔÓ„‡ÏÏ˚ «ëÉë-ÇçààÉêÜ».
ê‡Ò˜ÂÚ ÍÓ˝ÙÙˈËÂÌÚ‡ ̇‡ÒÚ‡ÌËfl „ÓÏÓÁË„ÓÚÌÓÒÚË (F) Ôӂ‰ÂÌ ÔÓ Ñ. Ä. äËÒÎÓ‚ÒÍÓÏÛ, Òӄ·Ò-
ÌÓ ÍÓÚÓÓÏÛ ‚˚‰ÂÎfl˛Ú ÒÎÂ‰Û˛˘Ë ÒÚÂÔÂÌË ËÌ·ˉËÌ„‡: ÚÂÒÌ˚È — ÔË ÍÓ˝ÙÙˈËÂÌÚ 0,250 Ë ·ÓΠ(25% Ë ·ÓÎÂÂ); ·ÎËÁÍËÈ — ÓÚ 0,249 (24,9) ‰Ó
0,125 (12,5%); ÛÏÂÂÌÌ˚È — ÓÚ 0,124 (12,4%) ‰Ó
0,031 (3,1%); ÓÚ‰‡ÎÂÌÌ˚È — ÏÂÌ 0,031 (ÏÂÌÂÂ
3,1%).
ÅËÓÏÂÚ˘ÂÒÍÛ˛ Ó·‡·ÓÚÍÛ ÔÓÎÛ˜ÂÌÌ˚ı ˝ÍÒÔÂËÏÂÌڇθÌ˚ı ‰‡ÌÌ˚ı ÔÓ‚Ó‰ËÎË Ó·˘ÂÔËÌflÚ˚ÏË ÒÚ‡ÚËÒÚ˘ÂÒÍËÏË ÏÂÚÓ‰‡ÏË (èÎÓıËÌÒÍËÈ
ç. Ä., 1969; åÂÍÛ¸Â‚‡ Ö. ä., 1977). å‡ÚÂˇÎ˚ ËÒÒΉӂ‡ÌËfl Ó·‡·ÓÚ‡Ì˚ ÒÚ‡ÚËÒÚ˘ÂÒÍË Ò ÔÓÏÓ˘¸˛ ÔÓ„‡ÏÏ˚ ExÒel ̇ èä.
êÂÁÛθڇÚ˚ Ë Ó·ÒÛʉÂÌËÂ. ÑÎfl ‰ÓÒÚËÊÂÌËfl
ÛÒÚÓÈ˜Ë‚Ó„Ó ÒÂÎÂ͈ËÓÌÌÓ„Ó ˝ÙÙÂÍÚ‡ ‚‡ÊÌÓ ÌÂ
ÚÓθÍÓ ÓÚ·Ë‡Ú¸ ÎÛ˜¯Ëı ÔÓ ÔÎÂÏÂÌÌ˚Ï Í‡˜ÂÒÚ‚‡Ï
·˚ÍÓ‚, ÌÓ Ë ‡ˆËÓ̇θÌÓ ËÒÔÓθÁÓ‚‡Ú¸ Ëı ‚ Ë̉˂ˉۇθÌ˚ı ÔÓ‰·Ó‡ı Í Ï‡ÚÓ˜ÌÓÏÛ ÔÓ„ÓÎÓ‚¸˛.
ç‡ ÔÓÚflÊÂÌËË ÏÌÓ„Ëı ÎÂÚ ‚ ÒÚ‡‰Â «çÓ‚Ó·‰ÓÊÒÍÓ„Ó» ËÒÔÓθÁÛ˛ÚÒfl ·˚ÍË ‡ÁÌÓ„Ó ÔÓËÒıÓʉÂÌËfl (êÓÒÒËfl, ä‡Ì‡‰‡, ëòÄ, îËÌÎfl̉Ëfl, ò‚ˆËfl) Ë ÔË̇‰ÎÂÊÌÓÒÚË (ÔÎÂÏÂÌÌ˚ Ô‰ÔËflÚËfl,
ËÏÔÓÚ ÒÂÏÂÌË). àÁ ‰‡ÌÌ˚ı Ú‡·Îˈ˚ 1 ‚ˉÌÓ, ˜ÚÓ
ÒÂ‰Ë ÍÓÓ‚ ‚˚·ÓÍË ÔÂӷ·‰‡˛Ú ÊË‚ÓÚÌ˚ ÙËÌÒÍÓ„Ó ÔÓËÒıÓʉÂÌËfl (n=1888), ËÁ ÍÓÚÓ˚ı ÓÍÓÎÓ ÔÓÎÓ‚ËÌ˚ ÔÓÎÛ˜ÂÌ˚ ÓÚ ·˚ÍÓ‚, ÔË̇‰ÎÂʇ˘Ëı
ÔÎÂÏÔ‰ÔËflÚËÏ êÓÒÒËË (n=923), ‡ ‰Û„Ë —
965 „ÓÎÓ‚ — ÓÚ Á‡‚ÓÁÌÓ„Ó ÒÂÏÂÌË.
Ç Ò‰ÌÂÏ ÔÓ ‚˚·ÓÍ ÍÓ˝ÙÙˈËÂÌÚ ËÌ·ˉËÌ„‡ ÒÚ‡‰‡ ‡‚ÂÌ 0,81%. ç‡Ë·ÓΠ‚˚ÒÓÍËÈ ˝ÚÓÚ ÔÓ͇Á‡ÚÂθ ËÏÂÎË ‰Ó˜ÂË ·˚ÍÓ‚ ÙËÌÒÍÓÈ ÒÂÎÂ͈ËË —
1,01%, ‚ ÚÓÏ ˜ËÒΠÍÓÓ‚˚ ÓÚ ·˚ÍÓ‚ ÔÎÂÏÔ‰ÔËflÚËÈ êî — 1,14% Ë 86 ÔÂ‚ÓÚÂÎÓÍ ÓÚ ÓÚ˜ÂÒÚ‚ÂÌÌ˚ı
Продуктивность первотелок Айрширской породы разного происхождения
и методов выведения их отцов
29
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 30
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
ÔÓËÁ‚Ó‰ËÚÂÎÂÈ, ‚˚‚‰ÂÌÌ˚ı ‚ ééé «èá «çÓ‚Ó·‰ÓÊÒÍËÈ», — 1,05%.
èË Ò‡‚ÌÂÌËË ÔÓ‰ÛÍÚË‚ÌÓÒÚË ‰Ó˜ÂÂÈ, ÔÓÎÛ˜ÂÌÌ˚ı ÓÚ ·˚ÍÓ‚ ‡ÁÌÓ„Ó ÔÓËÒıÓʉÂÌËfl, ‚ˉÌÓ,
˜ÚÓ Ì‡Ë‚˚Ò¯ËÈ Û‰ÓÈ Ë ÎÛ˜¯ËÈ ÔÓ͇Á‡ÚÂθ ÒÓ‰ÂʇÌËfl ÊË‡ ‚ ÏÓÎÓÍÂ, ËÏÂ˛Ú ‰Ó˜ÂË ÙËÌÒÍËı
ÔÓËÁ‚Ó‰ËÚÂÎÂÈ (7173 Í„ Ë 3,94%). Ç ˝ÚÓÈ „ÛÔÔÂ
ÎÛ˜¯ËÈ ÔÓ͇Á‡ÚÂθ ÔÓ Û‰Ó˛ ÓÚϘÂÌ Û ÔÂ‚ÓÚÂÎÓÍ,
ÔÓÎÛ˜ÂÌÌ˚ı ÓÚ ËÏÔÓÚÌÓ„Ó ÒÂÏÂÌË (7417 Í„), ‚ ÚÓÏ
˜ËÒΠÓÚ è. éÎ‚Ë — 8106 Í„ ÔË ÒÓ‰ÂʇÌËË ÊË‡ 4,07% Ë ·ÂÎ͇ 3,37% (n=40).
äÓÓ‚˚ ÓÚ˜ÂÒÚ‚ÂÌÌÓ„Ó ÔÓËÒıÓʉÂÌËfl (n=121)
ÛÒÚÛÔ‡˛Ú ‰Ó˜ÂflÏ ÙËÌÒÍËı ·˚ÍÓ‚ ̇ 187 Í„ ÏÓÎÓ͇ (6986 Í„ ÔÓÚË‚ 7173 Í„). ëÂ‰Ë ÌËı 86 ‰Ó˜ÂÂÈ ÓÚ ·˚ÍÓ‚, ÓʉÂÌÌ˚ı ‚ ééé «èá «çÓ‚Ó·‰ÓÊÒÍËÈ», ̇ 460 Í„ Ô‚ÓÒıÓ‰flÚ ÔÓ Û‰Ó˛ ‰Ó˜ÂÂÈ
·˚ÍÓ‚ ËÁ îÉìè èèá ëÉñ «ëÏÂ̇» (7119 ÔÓÚË‚ 6659 Í„).
ë‡Ï˚ ÌËÁÍË ۉÓË ÏÓÎÓ͇ (6390 Í„) Ó͇Á‡ÎËÒ¸ Û ÔÂ‚ÓÚÂÎÓÍ ‡ÏÂË͇ÌÒÍÓÈ ÒÂÎÂ͈ËË.
àÌÚÂÂÒ Ô‰ÒÚ‡‚ÎflÂÚ Ì ÚÓθÍÓ ÔÓËÒıÓʉÂÌË ·˚ÍÓ‚, ÌÓ Ë ÏÂÚÓ‰˚ Ëı ‚˚‚‰ÂÌËfl.
4/2014
Ä̇ÎËÁ ÏÂÚÓ‰Ó‚ ‚˚‚‰ÂÌËfl ·˚ÍÓ‚ ÔÓ͇Á‡Î, ˜ÚÓ
ÔÓËÁ‚Ó‰ËÚÂÎË ÓÚ˜ÂÒÚ‚ÂÌÌÓÈ, ¯‚‰ÒÍÓÈ Ë ÙËÌÒÍÓÈ ÒÂÎÂ͈ËË ·˚ÎË ÔÓÎÛ˜ÂÌ˚ ˜ËÒÚ˚Ï ÍÓÒÒÓÏ,
ÍÓÒÒÓÏ ÎËÌËÈ Ë ‚ÌÛÚËÎËÌÂÈÌ˚Ï ÏÂÚÓ‰ÓÏ Ò ‡ÁÌ˚ÏË ÒÚÂÔÂÌflÏË ËÌ·ˉËÌ„‡; ͇̇‰ÒÍË ·˚ÍË —
‚ÌÛÚËÎËÌÂÈÌ˚Ï ÏÂÚÓ‰ÓÏ Ë ÏÂÚÓ‰ÓÏ ÍÓÒÒ‡ ÎËÌËÈ; ‡ÏÂË͇ÌÒÍË — ‚ÌÛÚËÎËÌÂÈÌ˚Ï ÏÂÚÓ‰ÓÏ
Ò ÓÚ‰‡ÎÂÌÌ˚Ï ËÌ·ˉËÌ„ÓÏ.
åÂÚÓ‰ÓÏ ‚ÌÛÚËÎËÌÂÈÌÓ„Ó ‡Á‚‰ÂÌËfl ÒÓ Ò‰ÌËÏ ÍÓ˝ÙÙˈËÂÌÚÓÏ ËÌ·ˉËÌ„‡ 2,24%, ÔÓÎÛ˜ÂÌÓ 11 ·˚ÍÓ‚ ËÁ 87, ˜ÚÓ ÒÓÒÚ‡‚ÎflÂÚ 12,6%.
àÁ ‰‡ÌÌ˚ı Ú‡·Îˈ˚ 2 ‚ˉÌÓ, ˜ÚÓ ‰Ó˜ÂË ‚ÌÛÚËÎËÌÂÈÌ˚ı ·˚ÍÓ‚ ÙËÌÒÍÓ„Ó ÔÓËÒıÓʉÂÌËfl ÔË
ÛÏÂÂÌÌÓÏ ËÌ·ˉËÌ„Â Ô‚ÓÒıÓ‰flÚ ÓÒڇθÌ˚ı
ÔÓ Û‰Ó˛ (7831 Í„), ÌÓ ÛÒÚÛÔ‡˛Ú ÔÓ ÒÓ‰ÂʇÌ˲
ÊË‡ ‚ ÏÓÎÓÍ (3,81%). Ç ˝ÚÓÈ „ÛÔÔ ÊË‚ÓÚÌ˚ı
ÎÛ˜¯ËÏË ÔÓ Û‰Ó˛ fl‚Îfl˛ÚÒfl ‰Ó˜ÂË Í‡ÂθÒÍÓ„Ó
·˚͇ ãÂÔ‡ 533 (8201 Í„). ëÂ‰Ë ÓÚ‰‡ÎÂÌÌÓ ËÌ·ˉËÓ‚‡ÌÌ˚ı ÓÚ΢‡˛ÚÒfl ÔÓ ÔÓ‰ÛÍÚË‚ÌÓÒÚË
ÔÓÚÓÏÍË ¯‚‰ÒÍËı (6914 Í„) Ë ÙËÌÒÍËı (6912 Í„)
ÔÓËÁ‚Ó‰ËÚÂÎÂÈ, ÔÂ‚˚ ËÁ ÍÓÚÓ˚ı ËÏÂ˛Ú Ë ‚˚ÒÓÍÛ˛ ÊËÌÓÏÓÎÓ˜ÌÓÒÚ¸ (3,92%).
퇷Îˈ‡ 1. èÓ‰ÛÍÚË‚ÌÓÒÚ¸ ‰Ó˜ÂÂÈ ‚ Á‡‚ËÒËÏÓÒÚË ÓÚ ÒÚ‡Ì˚ ÔÓËÒıÓʉÂÌËfl
Ë ÔË̇‰ÎÂÊÌÓÒÚË ·˚ÍÓ‚ – ÓÚˆÓ‚
èÓËÒıÓʉÂÌË óËÒÎÓ
Ë ÔË̇‰ÎÂÊÌÓÒÚ¸ ·˚ÍÓ‚
èÂ‚ÓÚfiÎÍË
n
ËÌ·ˉËÌ„, %
Û‰ÓÈ, Í„
ÊË, %
·ÂÎÓÍ, %
ÊË‚‡fl χÒÒ‡, Í„
ÇÒ„Ó:
87
2989
0,81
7064±63
3,92±0,03
3,31±0,2
519±4
ÇÒ„Ó:
9
121
0,97
6986±98
3,94±0,02
3,33±0,01
523±4
7
86
1,05
7119±113
3,95±0,01
3,32±0,02
527±5
9
0,48
7878±70
3,88±0,03
3,30±0,02
537±4
2
35
0,76
6659±185
3,91±0,03
3,36±0,02
515±9
5
366
0,26
6634±60
3,88±0,01
3,22±0,00
515±2
èè êÓÒÒËË
4
360
0,26
6632±61
3,87±0,01
3,21±0,01
515±2
ëÂÏfl
1
6
0,40
6752±393
3,94±0,07
3,53±0,04
544±9
3,89±0,04
3,30±0,02
526±8
êÓÒÒËfl
‚ ÚÓÏ ˜ËÒÎÂ:
«çÓ‚Ó·‰ÓÊÒÍËÈ»
‚ Ú.˜. ÉÛÒ‡
«ëÏÂ̇»
ä‡Ì‡‰‡
ÇÒ„Ó:
‚ ÚÓÏ ˜ËÒÎÂ:
ëòÄ
ëÂÏfl
1
46
0,10
6390±191
64
1888
1,01
7173±25
3,94±0,00
3,32±0,00
519±1
29
923
1,14
6917±36
3,90±0,01
3,29±0,01
511±1
30
1,17
7570±21
3,90±0,022
3,31±0,022
537±2
35
965
0,87
7417±32
3,98±0,01
3,35±0,01
528±1
40
0,77
8106±27
4,07±0,02
3,33±0,02
535±4
3,93±0,01
3,31±0,01
519±2
îËÌÎfl̉Ëfl
ÇÒ„Ó:
Ç ÚÓÏ ˜ËÒÎÂ:
èè êÓÒÒËË
‚ Ú.˜. ïflÍÂ
ëÂÏfl
‚ Ú.˜. è. é΂Ë
ò‚ˆËfl
ëÂÏfl
8
568
0,56
7052±41
èè-ÔÎÂÏÔ‰ÔËflÚËfl
30
О. В. Тулинова, Е. В. Живоглазова ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 31
Рубрика: Генетика и разведение животных
퇷Îˈ‡ 2. èÓ‰ÛÍÚË‚ÌÓÒÚ¸ ‰Ó˜ÂÂÈ ·˚ÍÓ‚ ‡ÁÌÓ„Ó ÔÓËÒıÓʉÂÌËfl,
‚˚‚‰ÂÌÌ˚ı ‚ÌÛÚËÎËÌÂÈÌÓ
èÓËÒıÓʉÂÌËÂ
Ë ÔË̇‰ÎÂÊÌÓÒÚ¸
Å˚ÍË
n
èÂ‚ÓÚfiÎÍË
ËÌ·ˉËÌ„,
%
n
ËÌ·ˉËÌ„,
%
ÊË, %
·ÂÎÓÍ, %
ÊË‚‡fl
χÒÒ‡, Í„
6304±256
3,88±0,05
3,34±0,03
499±11
Û‰ÓÈ, Í„
éÚ‰‡ÎÂÌÌ˚È ËÌ·ˉËÌ„
êÓÒÒËfl
1
1,46
20
0,96
ä‡Ì‡‰‡
3
0,65
251
0,30
6688±81
3,85±0,01
3,19±0,01
517±3
ëòÄ
1
2,05
46
0,10
6390±191
3,89±0,04
3,30±0,02
526±8
ò‚ˆËfl
1
2,06
47
0,01
6914±141
3,92±0,04
3,27±0,02
530±5
îËÌÎfl̉Ëfl*
2
2,28
44
1,24
6912±165
3,86±0,03
3,30±0,02
511±6
529
ìÏÂÂÌÌ˚È ËÌ·ˉËÌ„
êÓÒÒËfl
1
4,60
1
0,46
5977
4,24
3,3
îËÌÎfl̉Ëfl*
2
4,83
66
0,98
7831±160
3,81±0,04
3,31±0,03
515±7
Ç ÚÓÏ ˜ËÒΠãÂÔ‡ 533
1
4,24
40
0,86
8221±10
3,80±0,00
3,25±0,07
525±26
*— èè êÓÒÒËË
îËÌÒÍË ÓÚˆ˚ ÔÂ‚ÓÚÂÎÓÍ ı‡‡ÍÚÂËÁÛ˛ÚÒfl
Ò‡Ï˚Ï ‚˚ÒÓÍËÏ ÍÓ˝ÙÙˈËÂÌÚÓÏ ËÌ·ˉËÌ„‡ —
2,28 Ë 4,83% ‚ Ó·ÂËı „ÛÔÔ‡ı ‡Á‚‰ÂÌËfl.
èÂ‚ÓÚÂÎÍË Í‡Ì‡‰ÒÍÓÈ ÒÂÎÂ͈ËË ÓÚ ‚ÌÛÚËÎËÌÂÈÌ˚ı ·˚ÍÓ‚ ‰ËÌÒÚ‚ÂÌÌ˚ ‚ „ÛÔÔ ÔÓ ÔÓËÒıÓʉÂÌ˲, ÍÚÓ ÔÓ͇Á˚‚‡˛Ú ÎÛ˜¯Ë ÂÁÛθڇÚ˚ ÔÓ
Û‰Ó˛ ÔÓ Ò‡‚ÌÂÌ˲ Ò ÍÓÒÒËÓ‚‡ÌÌ˚ÏË (6688 Í„
ÏÓÎÓ͇ ÔÓÚË‚ 6518 Í„, ÒÏ. Ú‡·Î. 3) ÔË Ì ‰ÓÒÚÓ‚ÂÌÓÈ ‡ÁÌˈÂ, ÌÓ Á̇˜ËÚÂθÌÓ ÓÚÒÚ‡˛Ú ÓÚ ÌËı
ÔÓ ÒÓ‰ÂʇÌ˲ ÊË‡ Ë ·ÂÎ͇ (3,85 ÔÓÚË‚ 3,93
Ë 3,19 ÔÓÚË‚ 3,27% ÒÓÓÚ‚ÂÚÒÚ‚ÂÌÌÓ).
åÂÚÓ‰ÓÏ ÍÓÒÒ‡ Ò ËÌ·ˉËÌ„ÓÏ ÔÓÎÛ˜ÂÌÓ 67 ·˚ÍÓ‚, ËÁ ÌËı 58 — Ò ÓÚ‰‡ÎÂÌÌ˚Ï ËÌ·ˉËÌ„ÓÏ.
ÑÓ˜ÂË ÓÚ‰‡ÎÂÌÌÓ ËÌ·ˉËÓ‚‡ÌÌ˚ı ·˚ÍÓ‚ ÓÚÂ-
˜ÂÒÚ‚ÂÌÌÓÈ, ¯‚‰ÒÍÓÈ Ë ÙËÌÒÍÓÈ ÒÂÎÂ͈ËË ÌÂÁ̇˜ËÚÂθÌÓ ÔÓ Û‰Ó˛ Ë ÒÛ˘ÂÒÚ‚ÂÌÌÓ ÔÓ Í‡˜ÂÒÚ‚ÂÌÌ˚Ï ÔÓ͇Á‡ÚÂÎflÏ ÏÓÎÓ͇ Ô‚ÓÒıÓ‰flÚ ÔÓÚÓÏÍÓ‚
ÔÓËÁ‚Ó‰ËÚÂÎÂÈ, ‚˚‚‰ÂÌÌ˚ı ÍÓÒÒÓÏ ÎËÌËÈ Ò ÛÏÂÂÌÌ˚Ï ËÌ·ˉËÌ„ÓÏ.
èÂ‚ÓÚÂÎÍË, ÔÓÎÛ˜ÂÌÌ˚ ÓÚ ÙËÌÒÍÓ„Ó ÒÂÏÂÌË
ÛÏÂÂÌÌÓ ËÌ·ˉËÓ‚‡ÌÌ˚ı ÍÓÒÒËÓ‚‡ÌÌ˚ı ·˚ÍÓ‚, ËÏÂ˛Ú Ò‡Ï˚È ‚˚ÒÓÍËÈ Û‰ÓÈ — 7448 Í„ ÏÓÎÓ͇, ÌÓ ÒÓ Á̇˜ËÚÂθÌÓ ·ÓΠÌËÁÍËÏË ÒÓ‰ÂʇÌËÂÏ
ÊË‡ Ë ·ÂÎ͇ ÔÓ Ò‡‚ÌÂÌ˲ Ò ‰Û„ËÏË ÊË‚ÓÚÌ˚ÏË ‚ ˝ÚÓÈ „ÛÔÔÂ.
ÑÓ˜ÂË ¯‚‰ÒÍËı ÓÚˆÓ‚, ÔÓÎÛ˜ÂÌÌ˚ı ÏÂÚÓ‰ÓÏ
ÍÓÒÒ‡ ÎËÌËÈ Ò ÓÚ‰‡ÎÂÌÌ˚Ï ËÌ·ˉËÌ„ÓÏ, ÔÓ͇Á‡ÎË ÔÓ Ò‡‚ÌÂÌ˲ Ò ‚ÌÛÚËÎËÌÂÈÌ˚ÏËË Ë Ì ËÌ·Ë-
퇷Îˈ‡ 3. èÓ‰ÛÍÚË‚ÌÓÒÚ¸ ‰Ó˜ÂÂÈ ·˚ÍÓ‚ ‡ÁÌÓ„Ó ÔÓËÒıÓʉÂÌËfl,
‚˚‚‰ÂÌÌ˚ı ÏÂÚÓ‰ÓÏ ÍÓÒÒ‡ ÎËÌËÈ Ò ËÌ·ˉËÌ„ÓÏ
èÓËÒıÓʉÂÌËÂ
Ë ÔË̇‰ÎÂÊÌÓÒÚ¸
Å˚ÍË
n
ËÌ·ˉËÌ„,
%
èÂ‚ÓÚfiÎÍË
ËÌ·ˉËÌ„,
%
n
Û‰ÓÈ, Í„
ÊË, %
·ÂÎÓÍ, %
ÊË‚‡fl
χÒÒ‡, Í„
éÚ‰‡ÎÂÌÌ˚È ËÌ·ˉËÌ„
êÓÒÒËfl
6
0,93
85
1,06
7132±114
3,94±0,02
3,32±0,02
527±5
ä‡Ì‡‰‡
2
0,25
115
0,17
6518±72
3,93±0,01
3,27±0,02
510±4
ò‚ˆËfl
4
0,74
260
0,81
7155±67
3,93±0,01
3,30±0,2
510±3
îËÌÎfl̉Ëfl
46
1,10
1299
0,93
7177±29
4,00±0,01
3,34±0,01
521±1
èè
17
1,17
536
1,10
6890±48
3,92±0,01
3,30±0,01
511±2
ëÂÏfl
29
0,97
763
0,80
7379±45
4,00±0,01
3,37±0,01
527±2
‚ ÚÓÏ ˜ËÒÎÂ:
ìÏÂÂÌÌ˚È ËÌ·ˉËÌ„
îËÌÎfl̉Ëfl
9
3,81
311
1,47
7035±68
3,87±0,01
3,29±0,01
514±3
èè
6
3,77
194
1,44
6786±76
3,88±0,02
3,29±0,01
503±4
ëÂÏfl
3
3,88
117
1,48
7448±35
3,84±0,01
3,28±0,01
533±2
‚ ÚÓÏ ˜ËÒÎÂ:
Продуктивность первотелок Айрширской породы разного происхождения
и методов выведения их отцов
31
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 32
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
‰ËÓ‚‡ÌÌ˚ÏË ÎÛ˜¯Ë ÂÁÛθڇÚ˚ ÔÓ Û‰Ó˛ Ë ÊËÌÓÒÚË ÏÓÎÓ͇ (7155 Í„ Ë 3,93%).
чΠ·˚ÎË ËÁÛ˜ÂÌ˚ ÔÓ‰ÛÍÚË‚Ì˚ ͇˜ÂÒÚ‚‡
ÍÓÓ‚ ÓÚ ÓÚˆÓ‚, ‚˚‚‰ÂÌÌ˚ı ÔÛÚÂÏ ÍÓÒÒ‡ ÎËÌËÈ
·ÂÁ ËÌ·ˉËÌ„‡ (Ú‡·Î. 4).
Ç ˝ÚÓÈ „ÛÔÔ ·˚ÍÓ‚ 168 ÍÓÓ‚ ÙËÌÒÍÓÈ ÒÂÎÂ͈ËË ‰‡ÎË ÔÓ 7204 Í„ ÏÓÎÓ͇, ËÁ ÍÓÚÓ˚ı Û 85 ‰Ó˜ÂÂÈ ÓÚ ÒÂÏÂÌË ÙËÌÒÍËı ·˚ÍÓ‚ ÔÓÎÛ˜ÂÌ ÎÛ˜¯ËÈ
ÂÁÛÎ¸Ú‡Ú — 7712 Í„ ÏÓÎÓ͇ ÔË ÒÓ‰ÂʇÌËË ÊË‡ 3,97%, ·ÂÎ͇ 3,29%.
óËÒÎÂÌÌÓ ÔÂËÏÛ˘ÂÒÚ‚Ó ÔÓÚÓÏÍÓ‚ ÙËÌÒÍËı
·˚ÍÓ‚ ‚ ‚˚·ÓÍ Ì ÔÓÁ‚ÓÎflÂÚ ‚˚fl‚ËÚ¸ ‚ÎËflÌËÂ
ÏÂÚÓ‰‡ ‚˚‚‰ÂÌËfl ·˚͇ ̇ ÔÓ‰ÛÍÚË‚Ì˚ ͇˜ÂÒÚ‚‡
Â„Ó ‰Ó˜ÂÂÈ. èÓ˝ÚÓÏÛ ·˚Î Ôӂ‰ÂÌ ‡Ì‡ÎËÁ ÔÓ‰ÛÍÚË‚ÌÓÒÚË ÔÂ‚ÓÚÂÎÓÍ ÌÂÁ‡‚ËÒËÏÓ ÓÚ ÔÓËÒıÓʉÂÌËfl Ëı ÓÚˆÓ‚ (Ú‡·Î. 5).
àÁ ‰‡ÌÌ˚ı Ú‡·Îˈ˚ ‚ˉÌÓ, ˜ÚÓ ÔÂ‚ÓÚÂÎÍË ÍÓÒÒËÓ‚‡ÌÌ˚ı ·˚ÍÓ‚ Ò ÓÚ‰‡ÎÂÌÌ˚Ï ËÌ·ˉËÌ„ÓÏ Ë ·ÂÁ
ËÌ·ˉËÌ„‡ Ì ËÏÂ˛Ú ÒÛ˘ÂÒÚ‚ÂÌÌ˚ı ‡Á΢ËÈ ÔÓ
Û‰Ó˛ ÏÂÊ‰Û ÒÓ·ÓÈ Ë ÌÂÁ̇˜ËÚÂθÌÓ ÓÚ΢‡˛ÚÒfl ÔÓ
͇˜ÂÒÚ‚ÂÌÌ˚Ï ÔÓ͇Á‡ÚÂÎflÏ ÏÓÎÓ͇. ÑÓ˜ÂË ÛÏÂÂÌÌÓ ËÌ·ˉËÓ‚‡ÌÌ˚ı ÍÓÒÒËÓ‚‡ÌÌ˚ı ÔÓËÁ-
4/2014
‚Ó‰ËÚÂÎÂÈ Ì ‰ÓÒÚÓ‚ÂÌÓ ÛÒÚÛÔ‡˛Ú ËÏ ÔÓ Û‰Ó˛
(7035 Í„) Ë Á̇˜ËÚÂθÌÓ ÔÓ ÒÓ‰ÂʇÌ˲ ÊË‡ ‚ ÏÓÎÓÍ (3,87%).
èÓÚÓÏÍË ‚ÌÛÚËÎËÌÂÈÌ˚ı ÔÓËÁ‚Ó‰ËÚÂÎÂÈ ÛÒÚÛÔ‡˛Ú ÔÂ‚ÓÚÂÎÍ‡Ï ÍÓÒÒËÓ‚‡ÌÌ˚ı ËÌ·‰Ì˚ı ·˚ÍÓ‚ ̇ 271 Í„ ÏÓÎÓ͇, 0,11% ÊË‡ Ë 0,08% ·ÂÎ͇.
é‰Ì‡ÍÓ 67 ÍÓÓ‚ ÓÚ ÛÏÂÂÌÌÓ ËÌ·ˉËÓ‚‡ÌÌ˚ı
·˚ÍÓ‚ ˝ÚÓÈ „ÛÔÔ˚ ̇‰ÓËÎË 7803 Í„ ÏÓÎÓ͇. çÓ
˝ÚÓ, ÒÍÓ ‚Ò„Ó, Ì ÔÂËÏÛ˘ÂÒÚ‚Ó ‰‡ÌÌÓ„Ó ÏÂÚÓ‰‡ ‚˚‚‰ÂÌËfl, ‡ ÂÁÛÎ¸Ú‡Ú ‚ÎËflÌËfl ÔÎÂÏÂÌÌ˚ı ͇˜ÂÒÚ‚ ·˚͇ ãÂÔ‡ 533.
Ç˚‚Ó‰˚. Ç ıӉ ËÒÒΉӂ‡ÌËfl ‚˚fl‚ÎÂÌÓ, ˜ÚÓ
ÎÛ˜¯Ë ÔÓ‰ÛÍÚË‚Ì˚ ͇˜ÂÒÚ‚‡ ÓÚϘÂÌ˚ Û ÔÓÚÓÏÍÓ‚ ÙËÌÒÍËı ÔÓËÁ‚Ó‰ËÚÂÎÂÈ, ‚˚‚‰ÂÌÌ˚ı ÏÂÚÓ‰ÓÏ ÍÓÒÒ‡ ÎËÌËÈ Ò ‡ÁÌÓÈ ÒÚÂÔÂ̸˛ ËÌ·ˉËÌ„‡.
çÓ ˝ÚÓ ‚ ÓÒÌÓ‚ÌÓÏ ÓÔ‰ÂÎflÂÚÒfl ˜ËÒÎÂÌÌ˚Ï ÔÂËÏÛ˘ÂÒÚ‚ÓÏ ÔÓ„ÓÎÓ‚¸fl ˝ÚËı „ÛÔÔ ÊË‚ÓÚÌ˚ı.
é‰ÌÓ‚ÂÏÂÌÌÓ ÏÓÊÌÓ Ò‰Â·ڸ ‚˚‚Ó‰, ˜ÚÓ Ì‡ ÎÛ˜¯Ë ۉÓË ÔÓÚÓÏÍÓ‚ ÙËÌÒÍËı ÍÓÒÒËÓ‚‡ÌÌ˚ı ·˚ÍÓ‚ ‚ÎËfl˛Ú Ì ÒÚÓθÍÓ ÏÂÚÓ‰˚ Ëı ‚˚‚‰ÂÌËfl, ÒÍÓθÍÓ ÔÎÂÏÂÌÌ˚ ͇˜ÂÒÚ‚‡ Ò‡ÏËı ÔÓËÁ‚Ó‰ËÚÂÎÂÈ.
퇷Îˈ‡ 4. èÓ‰ÛÍÚË‚ÌÓÒÚ¸ ‰Ó˜ÂÂÈ ·˚ÍÓ‚ ‡ÁÌÓ„Ó ÔÓËÒıÓʉÂÌËfl,
‚˚‚‰ÂÌÌ˚ı ÏÂÚÓ‰ÓÏ ˜ËÒÚÓ„Ó ÍÓÒÒ‡
èÂ‚ÓÚfiÎÍË
èÓËÒıÓʉÂÌËÂ
Ë ÔË̇‰ÎÂÊÌÓÒÚ¸
óËÒÎÓ
·˚ÍÓ‚
n
ËÌ·ˉËÌ„, %
Û‰ÓÈ, Í„
ÊË, %
·ÂÎÓÍ, %
ÊË‚‡fl χÒÒ‡, Í„
êÓÒÒËfl
1
15
0,50
7133±215
3,94±0,06
3,39±0,03
537±10
ò‚ˆËfl
3
261
0,42
7044±60
3,92±0,01
3,31±0,01
526±3
îËÌÎfl̉Ëfl
5
168
0,72
7204±92
3,95±0,02
3,28±0,01
523±4
Ç ÚÓÏ ˜ËÒÎÂ: èè
2
83
0,77
6676±120
3,93±0,02
3,26±0,01
522±6
ëÂÏfl
3
85
0,67
7712±15
3,97±0,01
3,29±0,02
524±6
퇷Îˈ‡ 5. ᇂËÒËÏÓÒÚ¸ ÔÓ‰ÛÍÚË‚ÌÓÒÚË ÔÂ‚ÓÚÂÎÓÍ ÓÚ ÏÂÚÓ‰‡ ‚˚‚‰ÂÌËfl Ëı ÓÚˆÓ‚
Å˚ÍË
èÂ‚ÓÚfiÎÍË
åÂÚÓ‰ ‚˚‚‰ÂÌËfl
·˚ÍÓ‚-ÓÚˆÓ‚
n
ËÌ·ˉËÌ„,
%
n
ËÌ·ˉËÌ„,
%
Û‰ÓÈ, Í„
ÊË, %
·ÂÎÓÍ, %
ÊË‚‡fl
χÒÒ‡, Í„
óËÒÚ˚È ÍÓÒÒ
9
0,00
444
0,59
7133±61
3,94±0,2
3,29±0,01
525±4
äÓÒÒ ÎËÌËÈ
Ò ËÌ·ˉËÌ„ÓÏ
67
0,90
2070
0,96
7114±45
3,97±0,01
3,32±0,02
518±5
éÚ‰‡ÎÂÌÌ˚È
58
1,30
1759
0,87
7128±51
3,98±0,01
3,33±0,01
519±5
ìÏÂÂÌÌ˚È
9
3,81
311
1,47
7035±68
3,87±0,01
3,29±0,01
514±3
ÇÌÛÚËÎËÌÂÈ-Ì˚È
11
2,39
475
0,46
6843±96
3,86±0,03
3,24±0,02
518±6
‚ ÚÓÏ ˜ËÒÎÂ:
‚ ÚÓÏ ˜ËÒΠËÌ·ˉËÌ„:
32
ÓÚ‰‡ÎÂÌÌ˚È
8
1,51
408
0,38
6686±56
3,86±0,05
3,23±0,03
517±11
ÛÏÂÂÌÌ˚È
3
4,71
67
0,97
7803±84
3,81±0,01
3,31±0,02
151±15
О. В. Тулинова, Е. В. Живоглазова ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 33
Рубрика: Генетика и разведение животных
Литература
1. Ü˂ӄ·ÁÓ‚‡ Ö. Ç. ÇÎËflÌË ‡ÁÌ˚ı ÏÂÚÓ‰Ó‚ ‚˚‚‰ÂÌËfl ÍÓÓ‚ ‡È¯ËÒÍÓÈ ÔÓÓ‰˚ ̇ Ëı ÔÓ‰ÛÍÚË‚Ì˚Â
͇˜ÂÒÚ‚‡/Ö. Ç. Ü˂ӄ·ÁÓ‚‡ //ë·ÓÌËÍ Ì‡Û˜Ì˚ı ÚÛ‰Ó‚ ÔÓ Ï‡ÚÂË‡Î‡Ï Ì‡Û˜ÌÓ-Ô‡ÍÚ˘ÂÒÍÓÈ ÍÓÌÙÂÂ̈ËË (24–25 ÓÍÚfl·fl 2013 „., êìè «ç‡Û˜ÌÓ- Ô‡ÍÚ˘ÂÒÍËÈ ˆÂÌÚ çÄç Å·ÛÒË ÔÓ ÊË‚ÓÚÌÓ‚Ó‰ÒÚ‚Û». — ÜÓ‰ËÌÓ, 2013. — ë.87–88.
2. ŇÒÛÍÓ‚‡ é. Ö. êÂÁÛθڇÚ˚ ËÒÔÓθÁÓ‚‡ÌËfl ËÌ·ˉËÌ„‡ ÔË ‡ÁÌ˚ı ÏÂÚÓ‰‡ı ÔÓ‰·Ó‡ ÍÓÓ‚ ‚ ÒÚ‡‰Â áÄé
èá «ê‡·ËÚˈ˚»/é. Ö. ŇÒÛÍÓ‚‡ // ÄÍÚۇθÌÓÒÚ¸ ÔÓ·ÎÂÏ˚ „ÂÌÂÚËÍË, ÒÂÎÂ͈ËË Ë ‚ÓÒÔÓËÁ‚Ó‰ÒÚ‚‡
ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı //ë·ÓÌËÍ Ì‡Û˜Ì˚ı ÚÛ‰Ó‚ ÇçààÉêÜ. — ëè·, 2011. — ë. 53.
Tulinova О. V., Zhivoglazova E. V.
Productivity daughters of bulls of different origin
Abstract. The main influence on the productive qualities of cows have a bulls-makers. In Novoladozhsky
pedigree farm for many years used bulls of different origin, and their daughters in the breeding methods such
as pure cross breeding, cross lines, cross lines with inbreeding and intra-line. The best productive qualities
observed in the descendants of Finnish producers derived method of cross lines with varying degrees of inbreeding.
Key words: breeding methods, bulls-fathers, cow, inbreeding, productivity, parentage.
Authors:
Tulinova Olga Vasilyevna — PhD of Agriculture Chief of Laboratory of genetics and selection of Ayrshire
cattle of Russian Research Institute of Genetics and Farm Animals Breeding, +7 (921) 305-80-06, e-mail:
[email protected];
Zhivoglazova Ekaterina Vladimirovna — researcher of Russian Research Institute of Genetics and Farm Animals Breeding, Laboratory of Genetics and Breeding cattle Ayrshire, e-mail: [email protected]
Продуктивность первотелок Айрширской породы разного происхождения
и методов выведения их отцов
33
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 34
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
4/2014
УДК 636.082
О. Е. Барсукова, Е. Г. Логунова
Улучшение воспроизводительных качеств коров
Аннотация. В статье показана возможность улучшения воспроизводства за счёт генетического отбора
быков голштинской породы по оплодотворяемости коров, по индексу DPR (Daughter Pregnancy Rate). Данные американских исследователей показывают, что оценка быка по DPR, равная +1.0 снижает сервис период на 4 дня и имеет на 1% больше вероятности стать стельными в течение периода охоты, чем у дочерей
быка с оценкой 0. Улучшение оплодотворяемости на 1% за счёт отбора быков приводит к повышению удоя
на 200 фунтов ежегодно. В условиях племзавода «Октябрьский» Кировской области (8177 кг молока) при
использовании быков североамериканской селекции выявлено, что наименьший сервис-период наблюдался у коров, отцы которых имели более высокий DPR (от 2,6 до 2,7).
Ключевые слова: молочная корова, голштинский бык, воспроизводство, сервис-период, оплодотворяемость коров, оплодотворяемость тёлок, признаки здоровья, молочная продуктивность, селекция, генетика.
Авторы:
Барсукова Ольга Евгеньевна — кандидат сельскохозяйственных наук, ведущий научный сотрудник
ВНИИГРЖ, 196601, С.-Петербург-Пушкин, Московское шоссе, 55а, тел.: 8 (812) 451-79-62, e-mail: [email protected];
Логунова Елена Геннадиевна — главный зоотехник-селекционер, ЗАО племзавод «Октябрьский»,
613411, Кировская область, Куменский р-он, п. Вичевщина, ул. Северихина, 29, тел.: 8 (3343) 3-31-43.
Ç ÔÓÒΉÌË „Ó‰˚ ‚ ‡Á‚ËÚ˚ı ÒÚ‡Ì‡ı ÏÓÎÓ˜ÌÓ„Ó ÊË‚ÓÚÌÓ‚Ó‰ÒÚ‚‡ ÒÂÎÂ͈Ëfl ÒÍÓÚ‡ ̇Ô‡‚ÎÂ̇ ̇
‚˚‚‰ÂÌË Á‰ÓÓ‚˚ı Ë ÔÎÓ‰Ó‚ËÚ˚ı ÍÓÓ‚ Ò ÓÔÚËχθÌÓÈ ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸˛, ‚˚ÏÂÌÂÏ Ë ÌÓ„‡ÏË ÔË„Ó‰Ì˚ÏË Í ‰ÎËÚÂθÌÓÈ ˝ÍÒÔÎÛ‡Ú‡ˆËË ‚ ÛÒÎÓ‚Ëflı
ÔÓÏ˚¯ÎÂÌÌÓÈ ÚÂıÌÓÎÓ„ËË.
Ç Ó·˘ÂÏ Ë̉ÂÍÒ ÔÓÊËÁÌÂÌÌÓÈ ÔË·˚ÎË Lifetime Net Merit (LNM), ÔÓ ‰‡ÌÌ˚Ï ù. äÓ·Û̇ [1],
ÔËÁ̇ÍË Á‰ÓÓ‚¸fl ÍÓÓ‚ ÒÓÒÚ‡‚Îfl˛Ú 48%. ä ÌËÏ
ÓÚÌÓÒflÚÒfl: ÔÓ‰ÛÍÚ˂̇fl ÊËÁ̸ 22%, ÒÓχÚ˘ÂÒÍËÂ
ÍÎÂÚÍË — 10%, ÓÔÎÓ‰ÓÚ‚ÓflÂÏÓÒÚ¸ ÍÓÓ‚ 11%,
ÒÔÓÒÓ·ÌÓÒÚ¸ Í ÓÚfiÎÛ 5%. èÓ‰ÛÍÚË‚Ì˚ ÔËÁ̇ÍË
‚ Ë̉ÂÍÒ ËÏÂ˛Ú 35%, ÚËÔ ÚÂÎÓÒÎÓÊÂÌËfl — 17%.
à̉ÂÍÒ ÔÓÊËÁÌÂÌÌÓÈ ÔË·˚ÎË ÔÓ͇Á˚‚‡ÂÚ ˜ËÒÚÛ˛ ÔË·˚θ, ÔËÌÓÒËÏÛ˛ Ò‰ÌÂÈ ‰Ó˜Â¸˛ ·˚͇ ̇ ÔÓÚflÊÂÌËË Âfi ÊËÁÌË [2].
é‰ÌËÏ Ëı ˝ÙÙÂÍÚË‚Ì˚ı Ë̉Ë͇ÚÓÓ‚ Á‰ÓÓ‚¸fl
ÍÓÓ‚ fl‚ÎflÂÚÒfl Ë̉ÂÍÒ DPR (Daughter Pregnancy Rate) — ÓÔÎÓ‰ÓÚ‚ÓflÂÏÓÒÚ¸ ÍÓÓ‚ (ËÎË ÛÓ‚Â̸ ÒÚÂθÌÓÒÚÂÈ ‰Ó˜ÂÂÈ), ‡Á‡·ÓÚ‡ÌÌ˚È ‚ ëòÄ
‚ 2003 „Ó‰Û ‰Îfl ÓˆÂÌÍË „ÂÌÂÚ˘ÂÒÍÓ„Ó ‚Í·‰‡ ·˚ÍÓ‚ ‚ ÛÎÛ˜¯ÂÌË ‚ÓÒÔÓËÁ‚Ó‰ÒÚ‚‡ ‚ ÒÚ‡‰‡ı. Ç Ë̉ÂÍÒ ÔÓÊËÁÌÂÌÌÓÈ ÔË·˚ÎË ËÏÂÂÚ 11%. ê‡ÌÊËÛÂÚ ÔÓËÁ‚Ó‰ËÚÂÎÂÈ Ì‡ ÒÔÓÒÓ·ÌÓÒÚË Ëı ‰Ó˜ÂÂÈ
Ò‚Ó‚ÂÏÂÌÌÓ ÒÚ‡ÌÓ‚ËÚ¸Òfl ÒÚÂθÌ˚ÏË Ì‡ ÔÓÚflÊÂÌËË Í‡Ê‰Ó„Ó 21-‰Ì‚ÌÓ„Ó ˆËÍ· ÔÓ ËÒÚ˜ÂÌËË ÔÓÒÎÂÓÚÂθÌÓ„Ó ÔÂËÓ‰‡ ÓÊˉ‡ÌËfl. àÏÂÂÚ ‚˚ÒÓÍÛ˛
˝ÍÓÌÓÏ˘ÂÒÍÛ˛ ˆÂÌÌÓÒÚ¸. ìÎÛ˜¯ÂÌË ÒÚÂÔÂÌË ÓÔÎÓ‰ÓÚ‚ÓflÂÏÓÒÚË Ì‡ 1% Á‡ Ò˜fiÚ „ÂÌÂÚ˘ÂÒÍÓ„Ó ÓÚ·Ó‡ ÔË‚Ó‰ËÚ Í ÔÓ‚˚¯ÂÌ˲ Û‰Ófl ̇ 200 ÙÛÌÚÓ‚
̇ ÍÓÓ‚Û ÂÊ„ӉÌÓ [3].
34
à̉ÂÍÒ DPR ÌÂÔÓÒ‰ÒÚ‚ÂÌÌÓ Ò‚flÁ‡Ì Ò ÒÂ‚ËÒÔÂËÓ‰ÓÏ, Ò ËÌÚÂ‚‡ÎÓÏ ÓÚ ÓÚfi· ‰Ó ÔÎÓ‰ÓÚ‚ÓÌÓ„Ó ÓÒÂÏÂÌÂÌËfl. éˆÂÌ͇ DPR ·˚͇ ‡‚̇fl +1,0
ÓÁ̇˜‡ÂÚ, ˜ÚÓ Û ‰Ó˜ÂÂÈ ˝ÚÓ„Ó ·˚͇ ̇ 1% ·Óθ¯Â
‚ÂÓflÚÌÓÒÚË ÒÚ‡Ú¸ ÒÚÂθÌ˚ÏË ‚ Ú˜ÂÌË ÔÂËÓ‰‡
ÓıÓÚ˚, ˜ÂÏ Û ‰Ó˜ÂÂÈ ·˚͇ Ò ÓˆÂÌÍÓÈ 0. +1,0 DPR
ÒÌËʇÂÚ ÒÂ‚ËÒ-ÔÂËÓ‰ ̇ 4 ‰Ìfl.
ÑˇԇÁÓÌ DPR ‰Îfl ‡ÍÚË‚Ì˚ı „ÓίÚËÌÒÍËı ·˚ÍÓ‚ ̇ ‡‚„ÛÒÚ 2013 „Ó‰‡ ÔÓ ‰‡ÌÌ˚Ï, ÓÔÛ·ÎËÍÓ‚‡ÌÌ˚Ï ‡ÏÂË͇ÌÒÍÓÈ ÍÓÏÔ‡ÌËÂÈ CRI (ëËùÄÈ) ̇
Ò‚ÓfiÏ Ò‡ÈÚ [4], ÒÓÒÚ‡‚ÎflÎ ÓÚ -4,8 ‰Ó +3,9. ê‡ÁÌˈ‡ ÔÓ ÒÂ‚ËÒ-ÔÂËÓ‰Û — 34,8 ‰ÌÂÈ. Ç ‡ÏÂË͇ÌÒÍËı
ÒÚ‡‰‡ı ÒÚÓËÏÓÒÚ¸ Ó‰ÌÓ„Ó ÊË‚ÓÚÌÓ„Ó Á‡ ͇ʉ˚È
‰ÓÔÓÎÌËÚÂθÌ˚È ‰Â̸ ÒÂ‚ËÒ-ÔÂËÓ‰‡ ‚ Ò‰ÌÂÏ
‚‡¸ËÛÂÚ ÓÚ 1,5 ‰Ó 4,0 ‰ÓηÓ‚ Ë ÒÔˆËÙ˘̇
‰Îfl Í‡Ê‰Ó„Ó ÒÚ‡‰‡. Ç Î˛·ÓÈ ÒËÚÛ‡ˆËË, ˜ÂÏ ÏÂ̸¯Â
ÒÂ‚ËÒ-ÔÂËÓ‰, ÚÂÏ ·Óθ¯Â ÔË·˚θ [5]. Ñ. ï‡ÌÒÓÌ [6] ÔÓ͇Á‡Î, ˜ÚÓ Û ‰Ó˜ÂÂÈ ·˚ÍÓ‚ Ò ·ÓΠ‚˚ÒÓÍËÏË ÔÓ͇Á‡ÚÂÎflÏË DPR ÛÎÛ˜¯‡ÂÚÒfl ‚ÓÒÔÓËÁ‚Ó‰ËÚÂθ̇fl ÙÛÌ͈Ëfl (Ú‡·Î.1).
ìÎÛ˜¯ÂÌË ÔÎÓ‰Ó‚ËÚÓÒÚË ÍÓÓ‚, ËÒÔÓθÁÛfl ÔÂ‰ӂ˚ ËÌÒÚÛÏÂÌÚ˚ „ÂÌÂÚ˘ÂÒÍÓ„Ó ÓÚ·Ó‡, ÓÒÓ·ÂÌÌÓ ‡ÍÚۇθÌÓ ‰Îfl ̇¯Ëı ÒÚ‡‰.
àÒÒΉӂ‡ÌËfl ÔÓ‚Ó‰ËÎË ‚ ÔÎÂÏÁ‡‚Ӊ «éÍÚfl·¸ÒÍËÈ» äËÓ‚ÒÍÓÈ Ó·Î‡ÒÚË. èÓ„ÓÎÓ‚¸Â ÍÛÔÌÓ„Ó pÓ„‡ÚÓ„Ó ÒÍÓÚ‡ ̇ҘËÚ˚‚‡ÂÚ 6608 „ÓÎÓ‚, ‚ ÚÓÏ
˜ËÒΠ2100 ÍÓpÓ‚. ÉÂÌÂÚ˘ÂÒÍÓ ÒÓ‚Â¯ÂÌÒÚ‚Ó‚‡ÌË χÚÓ˜ÌÓ„Ó ÒÚ‡‰‡ ÓÒÛ˘ÂÒÚ‚ÎflÎÓÒ¸ ÔË ËÒÔÓθÁÓ‚‡ÌËË „ÓίÚËÌÒÍËı ·˚ÍÓ‚ ‡Á΢ÌÓ„Ó ÔÓËÒıÓʉÂÌËfl: „Óη̉ÒÍÓ„Ó, ‰‡ÚÒÍÓ„Ó, ÌÂψÍÓ„Ó, ‡ Ú‡ÍÊÂ
ÔÓËÁ‚Ó‰ËÚÂÎÂÈ, ÔÓÎÛ˜ÂÌÌ˚ı ‚ ÔÎÂÏÁ‡‚Ó‰‡ı ãÂО. Е. Барсукова, Е. Г. Логунова ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 35
Рубрика: Генетика и разведение животных
퇷Îˈ‡ 1. ᇂËÒËÏÓÒÚ¸ ÒÚÂÔÂÌË ÓÔÎÓ‰ÓÚ‚ÓflÂÏÓÒÚË ÔÂ‚ÓÚfiÎÓÍ ÓÚ Ë̉ÂÍÒ‡ DPR ·˚͇
DPR ·˚͇
Conception rate (ÒÚÂÔÂ̸ ÒÚÂθÌÓÒÚË
̇ 1 ˆËÍÎ)
Services Per Conception (‡ÒıÓ‰ ÒÔÂÏ˚
̇ ÔÎÓ‰ÓÚ‚ÓÌÓ Á‡˜‡ÚËÂ)
ÏÂ̸¯Â 0
33%
3,1
ÓÚ 0,0 ‰Ó 1,0
38%
2,7
ÓÚ 1,1 ‰Ó 2,0
43%
2,3
ÌËÌ„‡‰ÒÍÓÈ, åÓÒÍÓ‚ÒÍÓÈ Ë äËÓ‚ÒÍÓÈ Ó·Î‡ÒÚÂÈ
(éÄé «åÓÒÍÓ‚ÒÍÓ», éÄé «ÉñÇ», éÄé «äËÓ‚ÒÍÓ»). Ç ÔÓÒΉÌ ‚ÂÏfl ‡ÍÚË‚ÌÓ ËÒÔÓθÁÛ˛ÚÒfl
·˚ÍË Ò‚ÂÓ‡ÏÂË͇ÌÒÍÓÈ ÒÂÎÂ͈ËË. ëÔÂχ ÔÓÒÚÛÔ‡ÂÚ ‚ êÓÒÒ˲ ËÁ Ú‡ÍËı ÍÓÏÔ‡ÌËÈ Í‡Í: 14-WWS,
7-Select Sires, 200-Semex Alliance, 29-ABS Global,
11-Alta Genetics USA. ᇠÔÂËÓ‰ Ò 2008 ÔÓ 1 Í‚‡ڇΠ2014 „Ó‰‡ ·˚ÎÓ ÓˆÂÌÂÌÓ ‚ ÛÒÎÓ‚Ëflı ıÓÁflÈÒÚ‚‡
82 ·˚͇ ÔÓ ÔÓ͇Á‡ÚÂÎflÏ 4264 ÔÂ‚ÓÚfiÎÓÍ. ç‡Ë·Óθ¯Â ˜ËÒÎÓ ÛÎÛ˜¯‡ÚÂÎÂÈ ÔÓ Û‰Ó˛ ÓÚϘÂÌÓ ÒÂ‰Ë ·˚ÍÓ‚ ‡ÏÂË͇ÌÒÍÓ„Ó ÔÓËÒıÓʉÂÌËfl, ÔÓ ÊËÛ — ÒÂ‰Ë ·˚ÍÓ‚ ÌÂψÍÓ„Ó Ë Í‡Ì‡‰ÒÍÓ„Ó, ÔÓ
·ÂÎÍÛ — „Óη̉ÒÍÓ„Ó. é‰ÌÓ‚ÂÏÂÌÌ˚Ï ÛÎÛ˜¯ÂÌËÂÏ ÊË‡ Ë ·ÂÎ͇ ÓÚ΢‡ÎËÒ¸ „Óη̉ÒÍË ÔÓËÁ‚Ó‰ËÚÂÎË. Ç Ú‡·Îˈ 2 Ô‰ÒÚ‡‚ÎÂÌ˚ ‰‡ÌÌ˚ ÔÓ
‰Ë̇ÏËÍ ÏÓÎÓ˜ÌÓÈ ÔÓ‰ÛÍÚË‚ÌÓÒÚË Á‡ fl‰ ÎÂÚ.
Ç 2013 „Ó‰Û ÏÓÎӘ̇fl ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸ ÍÓÓ‚
ÔÓ Á‡ÍÓ̘ÂÌÌÓÈ Î‡ÍÚ‡ˆËË ÔÓ ‰‡ÌÌ˚Ï ·ÓÌËÚËÓ‚ÍË ÒÓÒÚ‡‚Ë· 8177 Í„ ÏÓÎÓ͇ Ò ÒÓ‰ÂʇÌËÂÏ ÊË‡ 3,98% Ë ÒÓ‰ÂʇÌËÂÏ ·ÂÎ͇ 3,18%. èÓ Ò‡‚ÌÂÌ˲ Ò 2009 „Ó‰ÓÏ Ò‰Ì„ӉӂÓÈ ÙÂÌÓÚËÔ˘ÂÒÍËÈ
˝ÙÙÂÍÚ ÔÓ Û‰Ó˛ ÒÓÒÚ‡‚ËÎ +243 Í„ ÏÓÎÓ͇, ÔÓ ÏÓÎÓ˜ÌÓÏÛ ÊËÛ +10 Í„, ÔÓ ÏÓÎÓ˜ÌÓÏÛ ·ÂÎÍÛ +9 Í„.
ëΉÛÂÚ ÓÚÏÂÚËÚ¸, ˜ÚÓ Á‡ ˝ÚÓÚ ÔÂËÓ‰ ÒÂ‚ËÒ-ÔÂËÓ‰ Û ÍÓÓ‚ Û‚Â΢ËÎÒfl ̇ 17 ‰ÌÂÈ. èÓ Ô˘ËÌÂ
̇Û¯ÂÌËfl ‚ÓÒÔÓËÁ‚Ó‰ËÚÂθÌÓÈ ÒÔÓÒÓ·ÌÓÒÚË ‚ ıÓÁflÈÒÚ‚Â ÂÊ„ӉÌÓ ‚˚·˚‚‡ÂÚ ‚ Ò‰ÌÂÏ ‰Ó 34,2%,
‚ ÚÓÏ ˜ËÒΠ‰Ó 43,1% ÔÂ‚ÓÚfiÎÓÍ. 51,0% ÍÓÓ‚
ËÏÂ˛Ú ÒÂ‚ËÒ-ÔÂËÓ‰ ·ÓΠ120 ‰ÌÂÈ.
ÑÎfl ‚˚fl‚ÎÂÌËfl Ù‡ÍÚÓÓ‚, ÔÓ‚ÎËfl‚¯Ëı ̇ ÒÌËÊÂÌË ‚ÓÒÔÓËÁ‚Ó‰ËÚÂθÌÓÈ ÙÛÌ͈ËË, ·˚ÎË ÔӇ̇ÎËÁËÓ‚‡Ì˚ ·˚ÍË-ÔÓËÁ‚Ó‰ËÚÂÎË Ò‚ÂÓ‡ÏÂË͇ÌÒÍÓÈ ÒÂÎÂ͈ËË ÔÓ Ë̉ÂÍÒÛ DPR (ÓˆÂÌ͇ ·˚͇
̇ ‡‚„ÛÒÚ 2014 „Ó‰‡ [7]) Ë ÛÓ‚Ì˛ ÒÂ‚ËÒ-ÔÂËÓ‰‡ Û Ëı ‰Ó˜ÂÂÈ, Á‡ÍÓ̘˂¯Ë ·ÍÚ‡ˆË˛ ‚ 2012 —
1 Í‚‡ڇΠ2014 „Ó‰‡. Å˚ÍË (n=23) ·˚ÎË ÓˆÂÌÂÌ˚ ÔÓ Í‡˜ÂÒÚ‚Û ÔÓÚÓÏÒÚ‚‡, Í‡Í ÔÓ ÔÓ‰ÛÍÚË‚ÌÓÒÚË, Ú‡Í Ë ÔÓ ÒÂ‚ËÒ-ÔÂËÓ‰Û (Ú‡·Î. 3).
àÁ ‰‡ÌÌ˚ı Ú‡·Îˈ˚ ÒΉÛÂÚ, ˜ÚÓ Û ‰Ó˜ÂÂÈ ·˚ÍÓ‚ Ò ÓÚˈ‡ÚÂθÌ˚Ï Á̇˜ÂÌËÂÏ DPR ÓÚ -3,0 ‰Ó
-2,9 ̇·Î˛‰‡ÎÒfl Ò‡Ï˚È ‚˚ÒÓÍËÈ ÒÂ‚ËÒ-ÔÂËÓ‰
(187 ‰ÌÂÈ Ë +28 ‰ÌÂÈ Í Ò‚ÂÒÚÌˈ‡Ï) ÔË ˝ÚÓÏ ÔÓ
ÛÓ‚Ì˛ Û‰Ófl ˝ÚË ÔÂ‚ÓÚfiÎÍË Ô‚˚¯‡ÎË Ò‚ÂÒÚÌˈ ̇ 354 Í„ ÏÓÎÓ͇. èÓ ÎËÚÂ‡ÚÛÌ˚Ï ‰‡ÌÌ˚Ï
ÏÂÊ‰Û Ë̉ÂÍÒÓÏ DPR Ë Û‰ÓÂÏ ÒÛ˘ÂÒÚ‚ÛÂÚ ÓÚˈ‡ÚÂθ̇fl Á‡‚ËÒËÏÓÒÚ¸, ‡‚̇fl r= -0,22 (8).
퇷Îˈ‡ 2. ï‡‡ÍÚÂËÒÚË͇ ÍÓÓ‚ ÔÓ ÏÓÎÓ˜ÌÓÈ ÔÓ‰ÛÍÚË‚ÌÓÒÚË
Á‡ 305 ‰ÌÂÈ ÔÓÒΉÌÂÈ Á‡ÍÓ̘ÂÌÌÓÈ Î‡ÍÚ‡ˆËË ÔÓ ‚ÒÂÏÛ ÔÓ„ÓÎÓ‚¸˛
èÓ͇Á‡ÚÂÎË
ÉÓ‰˚
2009
2010
2011
2012
2013
óËÒÎÓ „ÓÎÓ‚
1654
1543
1589
1580
1613
ëÂ‚ËÒ-ÔÂËÓ‰, ‰ÌÂÈ
127
131
136
143
144
ì‰ÓÈ, Í„
6964
7328
7868
8052
8177
ÜË, %
3,98
3,95
4,05
4,04
3,98
ÅÂÎÓÍ, %
3,07
3,11
3,16
3,18
3,18
åÓÎÓ˜Ì˚È ÊË, Í„
277
290
318
325
325
åÓÎÓ˜Ì˚È ·ÂÎÓÍ, Í„
214
228
248
256
260
퇷Îˈ‡ 3. ÇÎËflÌË DPR ̇ ÒÂ‚ËÒ-ÔÂËÓ‰ ÍÓÓ‚-ÔÂ‚ÓÚfiÎÓÍ
ëÂ‚ËÒ-ÔÂËÓ‰, ‰ÌÂÈ
ìÓ‚Â̸ ë‰ÌËÈ óËÒÎÓ èÓ‰ÛÍÚË‚ÌÓÒÚ¸ Á‡ 305 ‰ÌÂÈ 1 ·ÍÚ‡ˆËË
DPR
DPR
·˚ÍÓ‚ óËÒÎÓ ‰Ó˜ÂÂÈ ì‰ÓÈ, Í„ ± Í Ò‚ÂÒÚÌˈ‡Ï „ÓÎÓ‚ Ò‰ÌËÈ ± Í Ò‚ÂÒÚÌˈ‡Ï
-3,0...-2,9
-2,9
4
74
7919
+354
71
187
+28
1,2...-0,1
-0,5
9
292
7440
+167
282
165
+5
0,2...0,9
0,4
3
212
7066
-183
207
163
+2
1,0...1,4
1,2
5
225
7229
-35
222
150
-11
2,6...2,7
2,7
2
45
7109
-173
43
147
-12
Улучшение воспроизводительных качеств коров
35
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 36
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
èÓ ÏÂ ÔÓ‚˚¯ÂÌËfl Ë̉ÂÍÒ‡ DPR ·˚ÍÓ‚ ÒÂ‚ËÒ-ÔÂËÓ‰ Û ‰Ó˜ÂÂÈ ÒÌËʇÎÒfl. ë‡Ï˚È ÌËÁÍËÈ ÔÓ͇Á‡ÚÂθ ̇·Î˛‰‡ÎÒfl Û ÍÓÓ‚, ÓÚˆ˚ ÍÓÚÓ˚ı ËÏÂÎË
̇˂˚Ò¯ËÈ Ë̉ÂÍÒ DPR ÓÚ 2,6 ‰Ó 2,7. èÓ Ò‡‚ÌÂÌ˲ ÒÓ Ò‚ÂÒÚÌˈ‡ÏË ÔÓÌËÊÂÌË ÒÂ‚ËÒ-ÔÂËÓ‰‡
̇ 12 ‰ÌÂÈ (Ú‡·Î.2)
ç‡ ‚Â΢ËÌÛ Ë̉ÂÍÒ‡ DPR ‚ÎËflÂÚ Ë̉ÂÍÒ HCR
(ÓÔÎÓ‰ÓÚ‚Ófl˛˘‡fl ÒÔÓÒÓ·ÌÓÒÚ¸ ÚfiÎÓÍ) Ë CCR (ÓÔÎÓ‰ÓÚ‚Ófl˛˘‡fl ÒÔÓÒÓ·ÌÓÒÚ¸ ÍÓÓ‚). èË ‡ÒÔ‰ÂÎÂÌËË ·˚ÍÓ‚ ÔÓ Ë̉ÂÍÒÛ CCR Ó͇Á‡ÎÓÒ¸, ˜ÚÓ Ò‡-
4/2014
Ï˚È ‚˚ÒÓÍËÈ ÒÂ‚ËÒ-ÔÂËÓ‰ ÓÚϘÂÌ ‚ ËÌÚÂ‚‡ÎÂ
CCR ÓÚ -5,7 ‰Ó -0,3, Ò‡Ï˚È ÌËÁÍËÈ — ÓÚ 1,3 ‰Ó
5,0 (Ú‡·Î. 3).
í‡ÍËÏ Ó·‡ÁÓÏ, ‰Îfl ÛÎÛ˜¯ÂÌËfl ‚ÓÒÔÓËÁ‚Ó‰ÒÚ‚‡ ‚ ÒÚ‡‰‡ı ÌÂÓ·ıÓ‰ËÏÓ ÓÚ·Ë‡Ú¸ ·˚ÍÓ‚ Ò ÔÓÎÓÊËÚÂθÌ˚Ï Á̇˜ÂÌËÂÏ Ë̉ÂÍÒ‡ DPR. é·‡˘‡Ú¸
Ú‡ÍÊ ‚ÌËχÌË ̇ Ë̉ÂÍÒ˚ HCR Ë CCR. ÑÎfl
ÍÓÌÚÓÎfl Ë ÏÓÌËÚÓËÌ„‡ ÒÂ‚ËÒ-ÔÂËÓ‰‡ ‚ ÒÚ‡‰Â,
ÓˆÂÌË‚‡Ú¸ ·˚ÍÓ‚ ÔÓ ÛÓ‚Ì˛ ÒÂ‚ËÒ-ÔÂËÓ‰‡ Û Ëı
‰Ó˜ÂÂÈ.
퇷Îˈ‡ 4. ÇÎËflÌË CCR ̇ ÒÂ‚ËÒ-ÔÂËÓ‰ ÍÓÓ‚-ÔÂ‚ÓÚfiÎÓÍ
èÓ‰ÛÍÚË‚ÌÓÒÚ¸ Á‡ 305 ‰ÌÂÈ 1 ·ÍÚ‡ˆËË
ëÂ‚ËÒ-ÔÂËÓ‰, ‰ÌÂÈ
ìÓ‚Â̸ ë‰ÌËÈ óËÒÎÓ
CCR
CCR
·˚ÍÓ‚ óËÒÎÓ ‰Ó˜ÂÂÈ ì‰ÓÈ, Í„ ± Í Ò‚ÂÒÚÌˈ‡Ï „ÓÎÓ‚ Ò‰ÌËÈ ± Í Ò‚ÂÒÚÌˈ‡Ï
-5,7...-0,3
-3,2
12
364
7479
+209
351
170
0,2...1,0
0,8
7
359
1,3...5,0
2,2
4
125
+10
7156
-90
353
158
-3
7115
-185
121
149
-11
Литература
1. A. Coburn. Associate Vice President – Dairy Genetics, Genex. Updated Economic Index Promotes Profitability. January 2010.
2. ä‡Ú‡ÎÓ„ ·˚ÍÓ‚ ÔÓËÁ‚Ó‰ËÚÂÎÂÈ, 2012. ééé «åÓÎӘ̇fl äÓÏÔ‡ÌËfl «ÉÂÌÂÚË͇». Cooperative Resources
Internation, ÒÚ. 34.
3. P. J. Hansen Improving dairy cow fertility through genetics. Department of Animal Sciences. University
of Florida, Gainesville. Proceedings 44th Florida Dairy Production Conference, Gainesville, May 1, 2007.
page 23–29.
4. ë‡ÈÚ ÍÓÏÔ‡ÌËË CRI (ëËùÄÈ) http: //international.crinet.com/USDA-CDCB Evaluates the Cow’s Contribution to a Herds Pregnancy Rate for a Reason: DPR makes a difference.
5. A. Coburn. Associate Vice President — Dairy Genetics, Genex. Let Your Cows Work for You. April 2010.
6. Jenny Hanson. Communications Manager, CRI. Selection for Lifetime Net Merit Improves Health Traits.
August 2009
7. ë‡ÈÚ˚: www.cdn.ca, www.accelgen.com
8. L. B. Hansen. Is Genetics a Cure for Reproductive Loss? Department of Animal Science, University of Minnesota, St.Paul. ë‡ÈÚ: www.ansci.umn.edu/.../cfans_asset_408074.pdf
Barsukova O. E., Logunova E. G.
Improving dairy cow fertility
Abstract. The article shows the possibility of improving the reproduction due to genetic selection of Holstein
bulls for cows fertility using index DPR (Daughter Pregnancy Rate). American researchers have shown that
the evaluation of the bull with DPR +1.0 reduces open days for 4 days and daughters of these sires have 1% more
likely to become pregnant during one heat than the daughters of a bull with a 0. Improved fertility by 1% due to
the selection bulls leads to an increase in milk yield for 200 pounds per year. The smallest open days period was
observed in cows whose fathers had high DPR (from 2.6 to 2.7) in ZAO «October» Kirov region (8177 kg of milk).
Key words: dairy cows, holstein bull, fertility, daughter pregnancy rate, cow conception rate, heifer conception rate, health traits, milk production, selection, genetics.
Authors:
Barsukova Olga Evgenevna — PhD Russian Research Institute of Farm Animal Genetics & Breeding, 196601,
St.Peterburg-Pushkin, Moskovskoe shosse, 55а, tel.: 8 (812) 451-79-62, e-mail: [email protected];
Logunova Elena Gennadievna — top–manager, ZAO «October», 613411, Kirov region, Kumenski area, s. Vichevshina, street Severichina, 29, tel.: 8 (3343) 3-31-43.
36
О. Е. Барсукова, Е. Г. Логунова ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 37
Рубрика: Генетика и разведение животных
УДК 636.4.082.12
М. А. Леонова, Л. В. Гетманцева, А. В. Усатов
Роль гена пролактина и его рецептора в формировании
признаков продуктивности сельскохозяйственных животных
Аннотация. В статье проанализированы частоты аллелей и генотипов по гену рецептора пролактина
(PRLR) у свиней породы ландрас и по гену пролактина (PRL) у коров красной степной породы. Установлена
связь полиморфизма этих генов с показателями продуктивности исследуемых животных. Определены
«желательные» генотипы.
Ключевые слова: PRLR, PRL, коровы, свиньи, воспроизводительные качества, молочная продуктивность.
Авторы:
М. А. Леонова — научный сотрудник ЮФУ, ФГБОУ ВПО ДонГАУ, e-mail: [email protected];
Л. В. Гетманцева — заведующая лабораторией молекулярной диагностики и биотехнологии с/х животных, кандидат с.-х. наук ФГБОУ ВПО ДонГАУ, e-mail: [email protected];
А. В. Усатов — заведующий лаборатории изменчивости генома ЮФУ, доктор биологических наук, профессор, [email protected]
ǂ‰ÂÌËÂ. Ç Ì‡ÒÚÓfl˘Â ‚ÂÏfl ‚ Ò‚flÁË Ò ‡Á‚ËÚËÂÏ ÏÓÎÂÍÛÎflÌÓÈ „ÂÌÂÚËÍË Ë ·ËÓÎÓ„ËË ÔÓfl‚Ë·Ҹ ‚ÓÁÏÓÊÌÓÒÚ¸ ˉÂÌÚËÙË͇ˆËË „ÂÌÓ‚, ̇ÔflÏÛ˛
ËÎË ÍÓÒ‚ÂÌÌÓ Ò‚flÁ‡ÌÌ˚ı Ò ıÓÁflÈÒÚ‚ÂÌÌÓ-ÔÓÎÂÁÌ˚ÏË ÔËÁ͇̇ÏË. Ç˚fl‚ÎÂÌË Ô‰ÔÓ˜ÚËÚÂθÌ˚ı Ò ÚÓ˜ÍË ÁÂÌËfl ÒÂÎÂ͈ËË ‚‡ˇÌÚÓ‚ Ú‡ÍËı „ÂÌÓ‚ Û ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı ÔÓÁ‚ÓÎflÂÚ, ̇fl‰Û
Ò Ú‡‰ËˆËÓÌÌ˚Ï ÓÚ·ÓÓÏ ÔÓ ÙÂÌÓÚËÔÛ, ÔÓ‚Ó‰ËÚ¸
ÒÂÎÂÍˆË˛ ÌÂÔÓÒ‰ÒÚ‚ÂÌÌÓ Ì‡ ÛÓ‚Ì Ñçä (χÍÂ-Á‡‚ËÒËχfl ÒÂÎÂ͈Ëfl) [4].
Ç ÔÂ‰ÌÂÈ ‰ÓΠ„ËÔÓÙËÁ‡ ‚˚‡·‡Ú˚‚‡ÂÚÒfl Ó‰ËÌ
ËÁ „Ó̇‰ÓÚÓÔÌ˚ı „ÓÏÓÌÓ‚ — ÔÓ·ÍÚËÌ (PRL)
(·ÍÚÓ„ÂÌÌ˚È, βÚÂÓÚÓÔÌ˚È). èÓ ÒÚÛÍÚÛÂ Ë ·ËÓÎӄ˘ÂÒÍËÏ Ò‚ÓÈÒÚ‚‡Ï ÔÓ·ÍÚËÌ ËÏÂÂÚ Ó·˘Ë ˜ÂÚ˚ Ò „ËÔÓÙËÁ‡Ì˚Ï „ÓÏÓÌÓÏ ÓÒÚ‡ (GH, ÒÓχÚÓÚÓÔËÌ) [3].
ÉÓÏÓÌ˚ ‰‡ÌÌÓ„Ó ÒÂÏÂÈÒÚ‚‡ ‚ ÚÓÈ ËÎË ËÌÓÈ ÒÚÂÔÂÌË ‚ÎËfl˛Ú ̇ ÓÒÚÓ‚Û˛, ‡Ì‡·Ó΢ÂÒÍÛ˛, „ËÔÂ„ÎËÍÂÏ˘ÂÒÍÛ˛, ÎËÔÓÎËÚ˘ÂÒÍÛ˛ Ë Î‡ÍÚÓ„ÂÌÌÛ˛
‡ÍÚË‚ÌÓÒÚ¸ [7].
Ç ÒÓ‚ÂÏÂÌÌÓÈ ÎËÚÂ‡ÚÛ Á‡„ËÒÚËÓ‚‡ÌÓ
·ÓΠ100 ‡Á΢Ì˚ı ˝ÙÙÂÍÚÓ‚ ÔÓ·ÍÚË̇, Ӊ̇ÍÓ ·Óθ¯‡fl ˜‡ÒÚ¸ ËÁ ÌËı Ò‚flÁ‡Ì‡ Ò ‡ÁÏÌÓÊÂÌËÂÏ
Ë Î‡ÍÚ‡ˆËÂÈ. èÓ‰ ‰ÂÈÒÚ‚ËÂÏ ÔÓ·ÍÚË̇ ÔÓ‚˚¯‡ÂÚÒfl ÒÂÍˆËfl ÏÓÎÓÁË‚‡, ÔÓËÒıÓ‰ËÚ Â„Ó ÒÓÁ‚‡ÌË ‚ ÁÂÎÓ ÏÓÎÓÍÓ. éÌ ‰ÂÈÒÚ‚ÛÂÚ Ì‡ ÏÓÎÓ˜Ì˚Â
‡Î¸‚ÂÓÎ˚ Ë ÒÔÓÒÓ·ÒÚ‚ÛÂÚ ÒËÌÚÂÁÛ Ë ÒÂÍˆËË ·ÂÎÍÓ‚ ÏÓÎÓ͇. ùÚÓ „ÓÏÓÌ, ‚ ÔÂ‚Û˛ Ó˜Â‰¸ ÓÚ‚ÂÚÒÚ‚ÂÌÂÌ Á‡ ÒËÌÚÂÁ ÏÓÎÓ˜ÌÓ„Ó ·ÂÎ͇, ·ÍÚÓÁ˚, ÎËÔˉӂ Ë ‚ÒÂı ÓÒÌÓ‚Ì˚ı ÍÓÏÔÓÌÂÌÚÓ‚ ÏÓÎÓ͇ [8].
êˆÂÔÚÓ ÔÓ·ÍÚË̇ (PRLR) ÓÚÌÓÒËÚÒfl Í ÏÂÏ·‡ÌÌ˚Ï ˆÂÔÚÓ‡Ï, ‡ÒÒÓˆËËÓ‚‡ÌÌ˚Ï Ò ˆËÚÓÔ·ÁχÚ˘ÂÒÍËÏË ÔÓÚÂËÌÍË̇Á‡ÏË (Ú‡Í Ì‡Á˚‚‡ÂÏ˚ÏË
«üÌÛÒ-ÍË̇Á‡ÏË», ËÎË ÍË̇Á‡ÏË ÒÂÏÂÈÒÚ‚‡ JAK)
Ë fl‚ÎflÂÚÒfl ÔÓ‚Ó‰ÌËÍÓÏ „ÓÏÓ̇θÌÓ„Ó Ò˄̇·,
Í‡Í ‰Îfl ÔÓ·ÍÚË̇, Ú‡Í Ë ‰Îfl „ÓÏÓ̇ ÓÒÚ‡ [5].
ÅËÓÎӄ˘ÂÒÍË ҂ÓÈÒÚ‚‡ ÔÓ·ÍÚË̇ Ë Â„Ó ˆÂÔÚÓ‡ Ë Ëı Óθ ‚ ÙËÁËÓÎӄ˘ÂÒÍËı ÔÓˆÂÒÒ‡ı
‚ Ó„‡ÌËÁÏ ÔÓÒÎÛÊËÎË ÔÓ‚Ó‰ÓÏ Ôӂ‰ÂÌË ËÒÒΉӂ‡ÌËÈ, ̇Ô‡‚ÎÂÌÌ˚ı ̇ ËÁÛ˜ÂÌËfl ‚ÎËflÌËfl
˝ÚËı „ÂÌÓ‚ ̇ ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸ ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı.
Ç Ò‚flÁË Ò ˝ÚËÏ ˆÂθ ‡·ÓÚ˚ ÓÔ‰ÂÎËÚ¸ ‚ÎËflÌËÂ
„ÂÌÓ‚ PRL Ë PRLR ̇ ÔÓ‰ÛÍÚË‚Ì˚ ͇˜ÂÒÚ‚‡
ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı.
å‡ÚÂˇÎ˚ Ë ÏÂÚÓ‰˚ ËÒÒΉӂ‡ÌËfl. é·˙ÂÍÚÓÏ
ËÒÒΉӂ‡ÌËfl ÒÎÛÊËÎË Ò‚ËÌÓχÚÍË ÔÓÓ‰˚ ·̉‡Ò (n=56) Ë ÍÓÓ‚˚ Í‡ÒÌÓÈ ÒÚÂÔÌÓÈ ÔÓÓ‰˚
(n=38). ÇÎËflÌË „ÂÌÓÚËÔÓ‚ ̇ ÂÔÓ‰ÛÍÚË‚Ì˚Â
͇˜ÂÒÚ‚‡ Ò‚ËÌÂÈ ÓˆÂÌË‚‡ÎË ÔÓ ÍÓ΢ÂÒÚ‚Û ÔÓÓÒflÚ
ÔË ÓʉÂÌËË („ÓÎ.), ÏÌÓ„ÓÔÎӉ˲ („ÓÎ.), χÒÒÂ
„ÌÂÁ‰‡ ÔË ÓʉÂÌËË (Í„). ÑÎfl ‡Ì‡ÎËÁ‡ ·˚ÎË ‚ÁflÚ˚ ‰‡ÌÌ˚ ÔÓ ÔÂ‚˚Ï ÚÂÏ ÓÔÓÓÒ‡Ï. èÓ‰ÛÍÚË‚Ì˚ ͇˜ÂÒÚ‚‡ Û ÍÓÓ‚ ÓˆÂÌË‚‡ÎË ÔÓ Û‰Ó˛ Á‡ ·ÍÚ‡ˆË˛ (Í„), ÒÓ‰ÂʇÌ˲ ÊË‡ (%) Ë ·ÂÎ͇ (%)
‚ ÏÓÎÓÍÂ.
ÑÎfl Ôӂ‰ÂÌËfl ÏÓÎÂÍÛÎflÌÓ-„ÂÌÂÚ˘ÂÒÍËı ËÒÒΉӂ‡ÌËÈ Û Ò‚ËÌÂÈ ·˚ÎË ÓÚÓ·‡Ì˚ Ó·‡Áˆ˚ Ú͇ÌË Ò Û¯ÌÓÈ ‡ÍÓ‚ËÌ˚ ÔÎÓ˘‡‰¸˛ 1 ÒÏ2, ‡ „ÂÌÓÏÌÛ˛
Ñçä ÍÓÓ‚ ‚˚‰ÂÎflÎË ËÁ 200 ÏÍÎ ˆÂθÌÓÈ ÍÓ‚Ë
Ò ÔËÏÂÌÂÌËÂÏ Ì‡·Ó‡ ‡„ÂÌÚÓ‚ DIAtom DNA
Prep 100 (ééé «çèî ÉÂÌ··»).
Ä̇ÎËÁ ÔÓ‚Ó‰ËÎË ÏÂÚÓ‰ÓÏ èñê-èÑêî (ÔÓÎËÏÂ‡ÁÌÓÈ ˆÂÔÌÓÈ ‡͈ËË — ÔÓÎËÏÓÙËÁÏ ‰ÎËÌ
ÂÒÚË͈ËÓÌÌ˚ı Ù‡„ÏÂÌÚÓ‚). êÂÒÚËÍˆË˛ ‡ÏÔÎËÙˈËÓ‚‡ÌÌÓ„Ó Ù‡„ÏÂÌÚ‡ „Â̇ PRLR ÔÓ‚Ó‰ËÎË Ò ˝Ì‰ÓÌÛÍ·ÁÓÈ AluI [5], ‡ „Â̇ PRL c ˝Ì‰ÓÌÛÍ·ÁÓÈ RsaI. èÓ ÂÁÛÎ¸Ú‡Ú‡Ï ÏÓÎÂÍÛÎflÌÓ —
„ÂÌÂÚ˘ÂÒÍÓ„Ó ‡Ì‡ÎËÁ‡ ÓÔ‰ÂÎflÎË Ì‡Î˘ËÂ Ë ˜‡ÒÚÓÚÛ ‡ÎÎÂÎÂÈ Ë „ÂÌÓÚËÔÓ‚.
Ä̇ÎËÁ Ë Ó·ÒÛʉÂÌË ÂÁÛθڇÚÓ‚. ç‡ Ò„ӉÌfl¯ÌËÈ ‰Â̸ „ÂÌ ˆÂÔÚÓ‡ ÔÓ·ÍÚË̇ (PRLR)
Роль гена пролактина и его рецептора в формировании признаков
продуктивности сельскохозяйственных животных
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 38
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
4/2014
ÑÎfl „Â̇ PRL ÛÒÚ‡ÌÓ‚ÎÂ̇ Ò‚flÁ¸ Ò ‡Á΢Ì˚ÏË
ıÓÁflÈÒÚ‚ÂÌÌÓ ÔÓÎÂÁÌ˚ÏË ÔËÁ͇̇ÏË ÊË‚ÓÚÌ˚ı
[3], ‚ ÚÓÏ ˜ËÒÎÂ Ò ÏÓÎÓ˜ÌÓÈ ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸˛,
ÛÓ‚ÌÂÏ ·ÂÎ͇ Ë ÊË‡ ‚ ÏÓÎÓÍ ÍÓÓ‚.
ì ÍÓÓ‚ „ÂÌ PRL ÎÓ͇ÎËÁÓ‚‡Ì ‚ 23 ıÓÏÓÒÓÏÂ, ÒÓÒÚÓËÚ ËÁ ÔflÚË ˝ÍÁÓÌÓ‚ Ë ˜ÂÚ˚Âı ËÌÚÓÌÓ‚
èӂ‰ÂÌÌ˚È ‡Ì‡ÎËÁ ‚ÓÒÔÓËÁ‚Ó‰ËÚÂθÌ˚ı ͇- Ë ËÏÂÂÚ ‡ÁÏÂ ÓÍÓÎÓ 10 Ú˚Ò. Ô.Ó. [7].
˜ÂÒÚ‚ Ò‚ËÌÓχÚÓÍ ÔÓÓ‰˚ ·̉‡Ò ‚ Á‡‚ËÒËÏÓÒÚË
èӂ‰ÂÌÌ˚ ̇ÏË ËÒÒΉӂ‡ÌËfl „ÂÌÂÚ˘ÂÓÚ „ÂÌÓÚËÔÓ‚ „Â̇ PRLR ÔÓ͇Á‡Î ̇΢ˠ‰ÓÒÚÓ- ÒÍÓÈ ÒÚÛÍÚÛ˚ Í‡ÒÌÓÈ ÒÚÂÔÌÓÈ ÔÓÓ‰˚ ÍÓÓ‚ ÔÓ
‚ÂÌÓ„Ó ‚ÎËflÌËfl ‰‡ÌÌÓ„Ó „Â̇ ̇ ÍÓ΢ÂÒÚ‚Ó ÔÓ- ‰‡ÌÌ˚Ï ÔÓÎËÏÓÙËÁχ „Â̇ ÔÓ·ÍÚË̇ (PRL)
ÓÒflÚ ÔË ÓʉÂÌËË, ÏÌÓ„ÓÔÎÓ‰ËÂ Ë Ï‡ÒÒÛ „ÌÂÁ‰‡ ÔÓ͇Á‡ÎË Ì‡Î˘Ë „ÂÌÓÚËÔÓ‚ ÄÄ, ÄG Ë GG Ò ˜‡ÔË ÓʉÂÌËË.
ÒÚÓÚÓÈ 6,3; 31,3; 62,5%, ÒÓÓÚ‚ÂÚÒÚ‚ÂÌÌÓ (ËÒ.1).
Ç ËÒÒΉÛÂÏÓÈ ÔÓÔÛÎflˆËË ÔÂӷ·‰‡Î „ÂÌÓÚËÔ ç‡Ë·Óθ¯Û˛ ˜‡ÒÚÓÚÛ ËÏÂÎ ‡ÎÎÂθ G (78,1) Ë „ÂÄÄ (48,4%), ÍÓÚÓ˚È Ë ·˚Î ÓÔ‰ÂÎÂÌ ‚ ͇˜ÂÒÚ‚Â ÌÓÚËÔ GG (62,5%).
«Ê·ÚÂθÌÓ„Ó» „ÂÌÓÚËÔ‡. ë‚ËÌÓχÚÍË „ÂÌÓÚËÔ‡
Ç ËÒÒΉӂ‡ÌËflı, Ôӂ‰ÂÌÌ˚ı Alfonso Ò ÒÓÄÄ ÔÓ Ò‡‚ÌÂÌ˲ Ò ‡Ì‡ÎÓ„‡ÏË „ÂÌÓÚËÔ‡ ÇÇ ËÏÂÎË ‡‚ÚÓ‡ÏË [6] ̇ ‡ÏÂË͇ÌÓ-¯‚‰ÒÍÓÏ ÚËÔ ÍÓÓ‚,
·Óθ¯Â ÍÓ΢ÂÒÚ‚Ó ÔÓÓÒflÚ ÔË ÓʉÂÌËË, ÏÌÓ„Ó- ̇ÔÓÚË‚ ÔÂӷ·‰‡Î ‡ÎÎÂθ Ä (87,7), a ˜‡ÒÚÓÚ‡
ÔÎÓ‰ËÂ Ë Ï‡ÒÒÛ „ÌÂÁ‰‡ ÔË ÓʉÂÌËË Ì‡ 2,3 Ë 1,7 ‡ÎÎÂÎfl G ÒÓÒÚ‡‚ËÎa 13,3. ó‡ÒÚÓÚ˚ „ÂÌÓÚËÔÓ‚ ÄÄ,
„ÓÎ. Ë 2,5 Í„, ÒÓÓÚ‚ÂÚÒÚ‚ÂÌÌÓ. ë‚ËÌÓχÚÍË „ÂÌÓ- ÄG Ë GG ·˚ÎË 78,4; 17,2; Ë 4,4 % ÒÓÓÚ‚ÂÚÒÚ‚ÂÌÌÓ.
ÚËÔ‡ ÄÇ/PRLR ÔÓ ‚ÓÒÔÓËÁ‚Ó‰ËÚÂθÌ˚Ï Í‡˜ÂêÂÁÛθڇÚ˚ ËÒÒΉӂ‡ÌËÈ í˛Î¸ÍË̇ c ÒÓ‡‚ÚÓ‡ÒÚ‚‡Ï Á‡ÌËχÎË ÔÓÏÂÊÛÚÓ˜ÌÓ ÔÓÎÓÊÂÌË [5].
ÏË [2] Û ˜ËÒÚÓÔÓÓ‰Ì˚ı Ë ÔÓÏÂÒÌ˚ı ÔÓ „ÓίÚËÌÇ ËÒÒΉӂ‡ÌËflı Vincent Ò ÒÓ‡‚ÚÓ‡ÏË [8] ·˚- ÒÍÓÈ ÔÓӉ ·˚ÍÓ‚-ÔÓËÁ‚Ó‰ËÚÂÎÂÈ ÔÓ ÎÓÍÛÒÛ „ÂÎÓ ËÁÛ˜ÂÌÓ ‚ÎËflÌË ÔÓÎËÏÓÙËÁχ „Â̇ PRLR ̇ PRL ÔÓ͇Á‡ÎË, ˜ÚÓ ËÁ 70 ·˚ÍÓ‚ 53 (75,7%) ËÏÂÎË
‚ ÔflÚË ‡Á΢Ì˚ı ÒËÌÚÂÚ˘ÂÒÍËı ÎËÌËflı Ò‚ËÌÂÈ — „ÂÌÓÚËÔ ÄÄ, 16 (22,9 %) — ÄÇ Ë 1 (1,4%) — ÇÇ.
ÍÛÔÌÓÈ ·ÂÎÓÈ, ·̉‡Ò, ‰˛ÓÍ Ë ÔÓÏÂÒÂÈ ÍÛÔ- èË ˝ÚÓÏ ˜‡ÒÚÓÚ‡ ‡ÎÎÂÎfl Ä ÒÓÒÚ‡‚Ë· 0,87, ‡ ‡Î̇fl ·Â·fl ı ÏÂȯ‡Ì. Å˚ÎÓ Ì‡È‰ÂÌÓ, ˜ÚÓ „ÂÌÓÚËÔ ÔÓ ÎÂÎfl Ç — 0,13.
ÎÓÍÛÒÛ PRLR ÒÚ‡ÚËÒÚ˘ÂÒÍË ‰ÓÒÚÓ‚ÂÌÓ ‚ÎËflÂÚ
ó‡ÒÚÓÚ‡ ‡ÎÎÂÎfl Ä „Â̇ PRL ‚ ÒÚ‡‰‡ı ÍÛÔÌÓ„Ó
̇ Ó·˘Â ÍÓ΢ÂÒÚ‚Ó ÔÓÓÒflÚ, ÏÌÓ„ÓÔÎӉˠ‚ ÚÂı Ó„‡ÚÓ„Ó ÒÍÓÚ‡ ˜ÂÌÓ-ÔÂÒÚÓÈ, ‰ÊÂÒÂÈÒÍÓÈ, ıÓÎËÁ ÔflÚË ËÒÒΉӂ‡ÌÌ˚ı ÎËÌËflı. Ç ÒËÌÚÂÚ˘ÂÒÍÓÈ ÏÓ„ÓÒÍÓÈ, flÓÒ·‚ÒÍÓÈ, ÒËÏÏÂÌڇθÒÍÓÈ ÔÓÓ‰
ÎËÌËË ÍÛÔÌÓÈ ·ÂÎÓÈ ÔÓÓ‰˚ (400 Ò‚ËÌÓχÚÓÍ, ÒÓÒÚ‡‚Ë· 0,3081–0,8533 [7]. ÅÓΠ‚˚ÒÓ͇fl ˜‡1197 ÓÔÓÓÒÓ‚) ÊË‚ÓÚÌ˚Â Ò „ÂÌÓÚËÔÓÏ ÄÄ ËÏÂÎË ÒÚÓÚ‡ ‡ÎÎÂÎfl Ä „Â̇ PRL ÓÚϘ‡Î‡Ò¸ ÒÂ‰Ë ÍÓÓ‚
‚ Ò‰ÌÂÏ Ì‡ 0,66 ÔÓÓÒÂÌ͇ ·Óθ¯Â, ˜ÂÏ ÊË‚ÓÚÌ˚ ˜ÂÌÓ-ÔÂÒÚÓÈ ÔÓÓ‰˚ 0,8533, ÔË ˝ÚÓÏ Ì‡ËÏÂ̸¯‡fl
Ò „ÂÌÓÚËÔ‡ÏË ÄÇ Ë ÇÇ. ç‡Ë·Óθ¯Â ‚ÎËflÌË ÔÓ- ˜‡ÒÚÓÚ‡ ‡ÎÎÂÎfl Ä ·˚· Û ÊË‚ÓÚÌ˚ı ‰ÊÂÒÂÈÒÍÓÈ
ÎËÏÓÙËÁχ „Â̇ PRLR ·˚ÎÓ Ó·Ì‡ÛÊÂÌÓ ‚ ÒËÌ- ÔÓÓ‰˚ — 0,3081 [8].
ÚÂÚ˘ÂÒÍÓÈ ÎËÌËË ÔÓÓ‰˚ ·̉‡Ò — ‡ÁÌˈ‡
àÒÒΉӂ‡ÌËfl, Ôӂ‰ÂÌÌ˚ Ozdemir ̇ ‡ÁÌ˚ı
ÏÂÊ‰Û „ÂÌÓÚËÔÓÏ ÄÄ Ë ÇÇ ÒÓÒÚ‡‚Ë· ·ÓΠӉ- ÔÓÓ‰‡ı ÍÛÔÌÓ„Ó Ó„‡ÚÓ„Ó ÒÍÓÚ‡ ‡Á΢ÌÓ„Ó Ì‡ÌÓ„Ó ÔÓÓÒÂÌ͇ ̇ ÓÔÓÓÒ.
Ô‡‚ÎÂÌËfl ÔÓ‰ÛÍÚË‚ÌÓÒÚË, Ú‡ÍÊ ÔÓ͇Á˚‚‡ÎË
‡Á΢‡˛˘Ë ˜‡ÒÚÓÚ˚ ‡ÎÎÂÎÂÈ Ë „ÂÌÓÚËÔÓ‚ ÔÓ „ÂÌÛ PRL [8].
èÓÎÛ˜ÂÌÌ˚ ̇ÏË ‰‡ÌÌ˚ (Ú‡·Î.1) ÔÓ͇Á‡ÎË ‚ÎËflÌË ÔÓÎËÏÓÙËÁχ „Â̇ PRL
̇ ÔÓ‰ÛÍÚË‚Ì˚ ͇˜ÂÒÚ‚‡ ÍÓÓ‚ Í‡ÒÌÓÈ
ÒÚÂÔÌÓÈ ÔÓÓ‰˚.
í‡Í, ÊË‚ÓÚÌ˚ „ÂÌÓÚËÔ‡ AA ÓÚ΢‡ÎËÒ¸
ÎÛ˜¯ËÏ Û‰ÓÂÏ Á‡ ·ÍÚ‡ˆË˛ Ë Ô‚ÓÒıÓ‰ËÎË
‡Ì‡ÎÓ„Ó‚ „ÂÌÓÚËÔ‡ AG ̇ 388,2 Ë „ÂÌÓÚËÔ‡ GG ̇ 564,1 Í„. ÇÎËflÌË „ÂÌÓÚËÔÓ‚ „Â̇ PRL ̇ ÍÓ΢ÂÒÚ‚Ó ÊË‡ Ë ·ÂÎ͇ ‚ ÏÓÎÓÍ ËÒÒΉÛÂÏÓÈ ÔÓÔÛÎflˆËË ÛÒÚ‡ÌÓ‚ÎÂÌÓ
ÌÂ ·˚ÎÓ.
Рис. 1. Частота аллелей и генотипов гена PRL/RsaI
fl‚ÎflÂÚÒfl Ó‰ÌËÏ ËÁ ÔÂÒÔÂÍÚË‚Ì˚ı „ÂÌÓ‚, ÓÔ‰ÂÎfl˛˘Ëı ÂÔÓ‰ÛÍÚË‚Ì˚ ÙÛÌ͈ËË Ò‚ËÌÂÈ. ÉÂÌ ˆÂÔÚÓ‡ ÔÓ·ÍÚË̇ Û Ò‚ËÌÂÈ ÎÓ͇ÎËÁÓ‚‡Ì ̇ 16 ıÓÏÓÒÓÏÂ. чÌÌ˚È ÎÓÍÛÒ Ó͇Á‡ÎÒfl ·ÎËÁÓÍ Í ÚÂÏ ÛÊÂ
ËÁ‚ÂÒÚÌ˚Ï Ï‡ÍÂ‡Ï, ӷ̇ÛÊÂÌÌ˚Ï Ì‡ 16 ıÓÏÓÒÓÏ — S0006, GHR Ë S0077 [8].
퇷Îˈ‡ 1. ì‰ÓÈ Ë ÒÓ‰ÂʇÌË ÊË‡ Ë ·ÂÎ͇ ‚ ÏÓÎÓÍ ÍÓÓ‚ ‡Á΢Ì˚ı „ÂÌÓÚËÔÓ‚ ÔÓ „ÂÌÛ PRL
ÉÂÌÓÚËÔ ÔÓ „ÂÌÛ PRL
ÄÄ
ÄG
GG
38
ì‰ÓÈ Á‡ 305 ÒÛÚ. ·ÍÚ‡ˆËË, Í„
5815,5±201,0*
5427,3±227,0
5251,4±196,5
åÑÜ, %
3,90±0,07
3,95±0,01
3,88±0,03
åÑÅ, %
3,15±0,02
3,12±0,01
3,10±0,006
М. А. Леонова и др. ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 39
Рубрика: Генетика и разведение животных
êÂÁÛθڇÚ˚ ËÒÒΉӂ‡ÌËÈ Alfonso c ÒÓ‡‚ÚÓ‡ÏË [6] ÔÓ͇Á‡ÎË, ˜ÚÓ ÊË‚ÓÚÌ˚Â Ò „ÂÌÓÚËÔÓÏ ÄÄ ËÏÂÎË ·Óθ¯Û˛ ‚˚‡·ÓÚÍÛ ÏÓÎÓ͇ ‚ ÔÂËÓ‰ ·ÍÚ‡ˆËË,
˜ÂÏ ÊË‚ÓÚÌ˚Â Ò „ÂÌÓÚËÔÓÏ ÄG Ë GG (<0,05),
˜ÚÓ Òӄ·ÒÛÂÚÒfl Ò Ì‡¯ËÏË ÂÁÛθڇڇÏË.
àÒÒΉӂ‡ÌËfl, Ôӂ‰ÂÌÌ˚ Dybus Ò ÒÓ‡‚ÚÓ‡ÏË Ì‡ ·Óθ¯ÓÈ ÔÓÔÛÎflˆËË ÏÂÒÚÌ˚ı ÍÓÓ‚ Ú‡Í ÊÂ
ÔÓ͇Á‡ÎË, ˜ÚÓ Û ÍÓÓ‚ Ò „ÂÌÓÚËÔÓÏ ÄÄ „Â̇ PRL
·˚ÎÓ ·ÓΠ‚˚ÒÓÍÓ ÒÓ‰ÂʇÌË ÏÓÎÓ˜ÌÓ„Ó ·ÂÎ͇,
˜ÂÏ Û ÍÓÓ‚ Ò „ÂÌÓÚËÔ‡ÏË ÄG Ë GG [8].
ÌÓÒÚË Ò‚ËÌÂÈ Ò Û˜ÂÚÓÏ ÔÓÓ‰ÌÓÈ ÔË̇‰ÎÂÊÌÓÒÚË.
ÑÎfl ÍÓÓ‚ Í‡ÒÌÓÈ ÒÚÂÔÌÓÈ ÔÓÓ‰˚ «Ê·ÚÂθÌ˚Ï» ÛÒÚ‡ÌÓ‚ÎÂÌ „ÂÌÓÚËÔ AA/PRL, Á‡ÍÂÔÎÂÌËÂ
ÍÓÚÓÓ„Ó ‚ ËÒÒΉÛÂÏÓÈ ÔÓÔÛÎflˆËË ·Û‰ÂÚ ÒÔÓÒÓ·ÒÚ‚Ó‚‡Ú¸ ÔÓ‚˚¯ÂÌ˲ ÏÓÎÓ˜ÌÓÈ ÔÓ‰ÛÍÚË‚ÌÓÒÚË
ÍÓÓ‚. èÓÎÛ˜ÂÌÌ˚ ÂÁÛθڇÚ˚ ÔÓ͇Á˚‚‡˛Ú, ˜ÚÓ
ÌÂÓ·ıÓ‰ËÏÓ ÔÓ‚Ó‰ËÚ¸ ‰‡Î¸ÌÂȯË ËÒÒΉӂ‡ÌËfl
̇ ·Óθ¯ÂÈ „ÛÔÔ ÊË‚ÓÚÌ˚ı, Ú‡Í Í‡Í ËÏÂÂÚÒfl
ÔÓÎÓÊËÚÂθ̇fl ÚẨÂ̈Ëfl Û‚Â΢ÂÌËfl χÒÒÓ‚ÓÈ
‰ÓÎË ·ÂÎ͇ Û ÍÓÓ‚ Ò „ÂÌÓÚËÔÓÏ ÄÄ.
Ç˚‚Ó‰˚. Ç ÂÁÛθڇÚ Ôӂ‰ÂÌÌ˚ı ËÒÒΉӂ‡ÌËÈ ÔÓÎÛ˜ÂÌ˚ ÂÁÛθڇÚ˚, ÔÓ‰Ú‚Âʉ‡˛˘Ë ‚ÓÁÏÓÊÌÓÒÚ¸ ËÒÔÓθÁÓ‚‡ÌËfl „Â̇ PRLR ‚ ͇˜ÂÒÚ‚Â
„ÂÌÂÚ˘ÂÒÍÓ„Ó Ï‡ÍÂ‡ ‰Îfl ÔÓ‚˚¯ÂÌËfl ÔÓ‰ÛÍÚË‚-
í‡ÍËÏ Ó·‡ÁÓÏ, ÔÓÎÛ˜ÂÌÌ˚ ‰‡ÌÌ˚ ÔÓ͇Á˚‚‡˛Ú ‚ÎËflÌË Ó‰ÒÚ‚ÂÌÌ˚ı „ÂÌÓ‚ PRL Ë PRLR
̇ ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸ ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı.
Литература
1. ÉÂÚχ̈‚‡ ã. Ç. ÇÁ‡ËÏÓÒ‚flÁ¸ ÔÓÎËÏÓÙËÁχ „Â̇ LIF/DRAIII Ò ÔÓ‰ÛÍÚË‚Ì˚ÏË Í‡˜ÂÒÚ‚‡ÏË Ò‚ËÌÂÈ./
ã. Ç. ÉÂÚχ̈‚‡, å. Ä. ãÂÓÌÓ‚‡, é. ã. íÂÚ¸flÍÓ‚‡ Ä. Ç. ìÒ‡ÚÓ‚. //ÇÓÔÓÒ˚ ÌÓχÚË‚ÌÓ-Ô‡‚Ó‚Ó„Ó
„ÛÎËÓ‚‡ÌËfl ‚ ‚ÂÚÂË̇ËË. 2014. ‹ 3. ë. 36–39
2.í˛Î¸ÍËÌ ë. Ç., ÄıÏÂÚÓ‚ í. å., LJÎËÛÎÎË̇ ù. î., LJÙËÌ ê. ê. èÓÎËÏÓÙËÁÏ ÔÓ „ÂÌ‡Ï ÒÓχÚÓÚÓÔË̇,
ÔÓ·ÍÚË̇, ÎÂÔÚË̇, Ë ÂÓ„ÎÓ·ÛÎË̇ ·˚ÍÓ‚-ÔÓËÁ‚Ó‰ËÚÂÎÂÈ. LJ‚ËÎÓ‚ÒÍËÈ ÊÛ̇Π„ÂÌÂÚËÍË Ë ÒÂÎÂ͈ËË, 2012, ÚÓÏ 16, ‹ 4/2, ë.1008–1012
3. ãÂÓÌÓ‚‡ å. Ä. èÂÒÔÂÍÚË‚Ì˚ „ÂÌ˚-χÍÂ˚ ÔÓ‰ÛÍÚË‚ÌÓÒÚË ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı./å. Ä. ãÂÓÌÓ‚‡, Ä. û. äÓÎÓÒÓ‚, Ä. Ç. ꇉ˛Í, Ö. å. ÅÛ·ÎËÍ ‰. //åÓÎÓ‰ÓÈ Û˜ÂÌ˚È. 2013. ‹ 12 (59). ë. 612–614.
4. ãÂÓÌÓ‚‡ å. Ä. àÌÚÂÌÒËÙË͇ˆËfl ÒÂÎÂ͈ËÓÌÌÓ„Ó ÔÓˆÂÒÒ‡ ‚ ÊË‚ÓÚÌÓ‚Ó‰ÒÚ‚Â Ò ËÒÔÓθÁÓ‚‡ÌËÂÏ ÏÂÚÓ‰‡
èñê./å. Ä. ãÂÓÌÓ‚‡, Ä. û. äÓÎÓÒÓ‚, Ä. Ö. ë‚flÚÓ„ÓÓ‚‡, Ä. Ç. ꇉ˛Í, ç. î. ŇÍÓ‚ //«åÓÎÓ‰ÓÈ
Û˜fiÌ˚È». ‹ 11 (70). à˛Î¸, 2014 „. ë.172–175.
5. ãÂÓÌÓ‚‡ å. Ä. ÇÓÒÔÓËÁ‚Ó‰ËÚÂθÌ˚ ͇˜ÂÒÚ‚‡ Ò‚ËÌÂÈ ÔÓÓ‰˚ ·̉‡Ò ‡ÁÌ˚ı „ÂÌÓÚËÔÓ‚ ÔÓ „Â̇Ï
PRLR Ë åë4R/ãÂÓÌÓ‚‡ å. Ä., ë‚flÚÓ„ÓÓ‚‡ Ä. Ö. //èÓÎËÚÂχÚ˘ÂÒÍËÈ ÒÂÚ‚ÓÈ ˝ÎÂÍÚÓÌÌ˚È Ì‡Û˜Ì˚È
ÊÛ̇ΠäÛ·‡ÌÒÍÓ„Ó „ÓÒÛ‰‡ÒÚ‚ÂÌÌÓ„Ó ‡„‡ÌÓ„Ó ÛÌË‚ÂÒËÚÂÚ‡ (ç‡Û˜Ì˚È ÊÛ̇ΠäÛ·ÉÄì) [ùÎÂÍÚÓÌÌ˚È ÂÒÛÒ]. – ä‡ÒÌÓ‰‡: äÛ·ÉÄì, 2014. — ‹09(103). – IDA [articleID]: 1031409065. http: //
ej.kubagro.ru/2014/09/pdf/65.pdf
6. Alfonso E., Rojas R., Herrera G., Lemus C. et al. Polymorphism of the prolactin gene (PRL) and its relationship with milk production in American Swiss cattle. African Journal of Biotechnology Vol. 11(29),
pp. 7338–7343, 10 April, 2012
7. Dong C. H., Song X. M., Zhang L., Jiang J. F.Jiang. New insights into the prolactin-RsaI (PRL-RsaI)
locus in Chinese Holstein cows and its effect on milk performance traits.Genetic and Molecular Research.
12 (4): 5766–5773 November, 2013
8. Khaizaran Z., Al-Razem F. Analysis of selected milk traits in Palestinian Holstein-Friesian cattle in relation
to genetic polymorphism. Journal of Cell and Animal BiologyVol. 8(5), pp. 74–85, April 2014
ꇷÓÚ‡ ‚˚ÔÓÎÌÂ̇ ÔË ÔÓ‰‰ÂÊÍ åËÌËÒÚÂÒÚ‚‡ Ó·‡ÁÓ‚‡ÌËfl Ë Ì‡ÛÍË êî, ÔÓÂÍÚ ‹ 40.91.2014/ä.
Leonova M. A., Getmantseva L. V., Usatov A. V.
Role of the gene of prolactin and its receptor in the formation
of productivity traits farm animals
Abstract. The article analyzes the frequency of alleles and genotypes of prolactin receptor gene (PRLR) in
pigs Landrace and gene prolactin (PRL) in cows of red steppe breed.The connection between the polymorphisms
of these genes with indicators of productivity test animals.Defined «desirable» genotypes.
Key words: PRLR, PRL, cows, pigs, reproductive performance, milk production.
Authors:
M. A. Leonova — Scientist officer SFU, DSAU, [email protected];
L. V. Getmantseva — Head of the Laboratory of Molecular Diagnostics and Biotechnology with farm animals,
the candidate of agricultural Sciences Don State Agrarian University, e-mail: [email protected];
A. V. Usatov — Head of Laboratory of genome variability, Sc.D., Professor of SFU, e-mail: [email protected]
This research was supported by the Russian Ministry of Education and Science, project no. 40.91.2014/K.
Роль гена пролактина и его рецептора в формировании признаков
продуктивности сельскохозяйственных животных
39
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 40
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
4/2014
УДК 636.22/.28.084.523
Л. В . Романенко, В. И. Волгин, З. Л. Федорова
Углеводное питание коров с удоем 9000 кг молока
за лактацию и выше
Аннотация. В предлагаемой авторами статье представлены исследования по углеводному питанию высокопродуктивных коров, рационы кормления, биохимический состав крови и молока по сезонам года.
Ключевые слова: высокопродуктивные коровы, рационы, биохимия крови, молока, сезоны года.
Авторы:
Романенко Л. В. — доктор сельскохозяйственных наук, ведущий научный сотрудник лаборатории кормления высокопродуктивных животных, ВНИИГРЖ, Санкт-Петербург–Пушкин, Московское шоссе, 55а;
Волгин В. И. — доктор сельскохозяйственных наук, заведующий лабораторией кормления высокопродуктивных животных, академик РАЕ, заслуженный деятель науки РФ, профессор ВНИИГРЖ, Санкт-Петербург–Пушкин, Московское шоссе, 55а;
Федорова З. Л. — старший научный сотрудник лаборатории кормления высокопродуктивных животных,
ВНИИГРЖ, Санкт-Петербург–Пушкин, Московское шоссе, 55а.
ǂ‰ÂÌËÂ. ê‡ÎËÁ‡ˆËfl ÒÓÁ‰‡ÌÌÓ„Ó ‚ ıÓÁflÈÒÚ‚‡ı
ãÂÌËÌ„‡‰ÒÍÓÈ Ó·Î‡ÒÚË ‚˚ÒÓÍÓ„Ó „ÂÌÂÚ˘ÂÒÍÓ„Ó
ÔÓÚÂ̈ˇ· ÏÓÎÓ˜ÌÓÈ ÔÓ‰ÛÍÚË‚ÌÓÒÚË ˜ÂÌÓ-ÔÂÒÚÓ„Ó ÒÍÓÚ‡ (Ò‚˚¯Â 9000 Í„ ÏÓÎÓ͇) ‚Ó ÏÌÓ„ÓÏ
Á‡‚ËÒËÚ ÓÚ ÔÓÎÌÓˆÂÌÌÓÒÚË ÍÓÏÎÂÌËfl. éÌ ÓÔ‰ÂÎflÂÚÒfl ‚ Á̇˜ËÚÂθÌÓÈ ÒÚÂÔÂÌË Í‡˜ÂÒÚ‚ÓÏ ÍÓÏÓ‚ÓÈ ·‡Á˚. é̇ ‚ ÔÓÒΉÌË „Ó‰˚ ÔÂÚÂÔ· ·Óθ¯Ë ËÁÏÂÌÂÌËfl. Ç ıÓÁflÈÒÚ‚‡ı ӷ·ÒÚË, Ë ‚ ˆÂÎÓÏ
ÔÓ ë‚ÂÓ-á‡Ô‡‰ÌÓÏÛ „ËÓÌÛ, Á̇˜ËÚÂθÌÓ ÒÓÍ‡˘Â̇ Á‡„ÓÚӂ͇ ÒÂ̇. Ç ‡ˆËÓ̇ı Á̇˜ËÚÂθÌÓ Û‚Â΢ÂÌÓ ÍÓ΢ÂÒÚ‚Ó ÒËÎÓÒ‡ ËÁ ÔÓ‰‚flÎÂÌÌ˚ı ÁÂÎÂÌ˚ı ÍÓÏÓ‚. Ç ÒÂÌÂ, ÒÂ̇ÊÂ, ÒËÎÓÒÂ Ë ÔÓ‰‚flÎÂÌÌÓÏ
ÁÂÎÂÌÓÏ ÍÓÏ ÔË Ì‡Û¯ÂÌËË ÚÂıÌÓÎÓ„ËË Á‡„ÓÚÓ‚ÍË ÂÁÍÓ ÒÌËʇÂÚÒfl ÒÓ‰ÂʇÌË ҇ı‡‡. Ç Ò‚flÁË
Ò ˝ÚËÏ, ‚ÓÁÌË͇˛Ú ·Óθ¯Ë ÔÓ·ÎÂÏ˚ Ò Ó·ÂÒÔ˜ÂÌËÂÏ ÊË‚ÓÚÌ˚ı, ÓÒÓ·ÂÌÌÓ ‚˚ÒÓÍÓÔÓ‰ÛÍÚË‚Ì˚ı,
΄ÍÓÛÒ‚ÓflÂÏ˚ÏË Û„Î‚Ӊ‡ÏË (Ò‡ı‡ÓÏ). ÇÒΉÒÚ‚Ë ˝ÚÓ„Ó Ò‡ı‡Ó-ÔÓÚÂËÌÓ‚Ó ÓÚÌÓ¯ÂÌË ˜‡ÒÚÓ
Ì ‚˚ıÓ‰ËÚ Á‡ Ô‰ÂÎ˚ 0,25:1 (ÌÓχ Ì ÌËÊÂ
0,8:1). ùÚÓ ÔË‚Ó‰ËÚ Í ÒÌËÊÂÌ˲ ˝ÙÙÂÍÚË‚ÌÓÒÚË
ËÒÔÓθÁÓ‚‡ÌËfl ÔÓÚÂË̇ Ë Í‡ÓÚË̇ ‚ Ó„‡ÌËÁÏÂ
ÍÓÓ‚, ̇Û¯ÂÌ˲ ˝ÌÂ„ÂÚ˘ÂÒÍÓ„Ó Ë Û„Î‚ӉÌÓÊËÓ‚Ó„Ó Ó·ÏÂ̇ Ë ÔÓ·ÎÂÏ‡Ï Ò ‡ÎËÁ‡ˆËÂÈ „ÂÌÂÚ˘ÂÒÍÓ„Ó ÔÓÚÂ̈ˇ· ÏÓÎÓ˜ÌÓÈ ÔÓ‰ÛÍÚË‚ÌÓÒÚË Ë ‚ÓÒÔÓËÁ‚Ó‰ÒÚ‚ÓÏ [1,2,3,5].
ÇÂ‰Û˘Ë ÒÔˆˇÎËÒÚ˚ ÏÌÓ„Ëı ÍÓÏÔ‡ÌËÈ ·Óθ¯Ó ‚ÌËχÌË ۉÂÎfl˛Ú Ò‡ı‡Û ÒËÎÓÒ‡. éÌË Ò˜Ë-
Ú‡˛Ú, ˜ÚÓ Ò‡ı‡ ÒËÎÓÒ‡ Ô‚‡˘‡ÂÚÒfl ‚ Ó„‡ÌËÁÏÂ
ÍÓÓ‚ ‚ ÔÓÔËÓÌÓ‚Û˛ ÍËÒÎÓÚÛ, ‡ Á‡ÚÂÏ ‚ „βÍÓÁÛ. ë‡ı‡ ÒËÎÓÒ‡ ÌÂθÁfl Á‡ÏÂÌËÚ¸ Ò‡ı‡ÓÏ Ï·ÒÒ˚ (Ô‡ÚÓÍË). èÓ Ëı ÏÌÂÌ˲, ËÁ Ò‡ı‡‡ Ï·ÒÒ˚ ÌÂ
Ó·‡ÁÛÂÚÒfl „βÍÓÁ‡ Ë ÛÓ‚Â̸ Ò‡ı‡‡ („βÍÓÁ˚)
‚ ÍÓ‚Ë Ì ÔÓ‚˚¯‡ÂÚÒfl. ë˜ËÚ‡ÂÚÒfl, ˜ÚÓ ÌÓχθÌ˚È ÛÓ‚Â̸ „βÍÓÁ˚ ‰ÓÎÊÂÌ ·˚Ú¸ ÓÍÓÎÓ 65 Ï„ %
(3,61 ÏÏÓθ/Î). èË ÌËÁÍÓÏ Â„Ó ÛÓ‚Ì ÚÓθÍÓ
Û 22% ÍÓÓ‚ ̇ÒÚÛÔ‡ÂÚ ÓÔÎÓ‰ÓÚ‚ÓÂÌË ÔË ÔÂ‚ÓÏ
ÓÒÂÏÂÌÂÌËË. èË ÓÔÚËχθÌÓÏ ÛÓ‚Ì „βÍÓÁ˚
‚ ÍÓ‚Ë 53% ÍÓÓ‚ ÒÚ‡ÌÓ‚flÚÒfl ÒÚÂθÌ˚ÏË ÔÓÒΠÔÂ‚Ó„Ó ÓÒÂÏÂÌÂÌËfl, ‡ ÔË ‚˚Ò¯ÂÏ — 56% [1, 3, 4, 5].
ìÒÎÓ‚Ëfl, χÚÂˇÎ˚ Ë ÏÂÚÓ‰˚ ËÒÒΉӂ‡ÌËÈ.
Ç Ò‚flÁË Ò ˝ÚËÏ ·˚Î Ôӂ‰ÂÌ Ì‡Û˜ÌÓ-ıÓÁflÈÒÚ‚ÂÌÌ˚È ÓÔ˚Ú Ì‡ ÍÓÓ‚‡ı Ò ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸˛ Ò‚˚¯Â
9000 Í„ ÏÓÎÓ͇ ‚ ÒÚÓÈÎÓ‚˚È Ë Ô‡ÒڷˢÌ˚È ÔÂËÓ‰˚ (Ú‡·Î.1).
Å˚ÎË ÒÙÓÏËÓ‚‡Ì˚ ‰‚ „ÛÔÔ˚ ÔÓ‰ÓÔ˚ÚÌ˚ı
ÊË‚ÓÚÌ˚ı, ÔÓ 8 „ÓÎÓ‚ ‚ ͇ʉÓÈ (ÍÓÌÚÓθ̇fl
Ë ÓÔ˚Ú̇fl) ÔÓ ÔË̈ËÔÛ Ô‡-‡Ì‡ÎÓ„Ó‚ Ò Û˜ÂÚÓÏ
‚ÓÁ‡ÒÚ‡, ÊË‚ÓÈ Ï‡ÒÒ˚, ÏÓÎÓ˜ÌÓÈ ÔÓ‰ÛÍÚË‚ÌÓÒÚË
Á‡ 305 ‰ÌÂÈ Ô‰˚‰Û˘ÂÈ Î‡ÍÚ‡ˆËË, ‚Â΢ËÌ Ò‰ÌÂÒÛÚÓ˜ÌÓ„Ó Û‰Ófl Ë ÊË‡ ‚ ÏÓÎÓÍÂ. èÓ‰ÓÔ˚ÚÌ˚ı
ÊË‚ÓÚÌ˚ı ÒÓ‰ÂʇÎË ‚ Ó‰Ë̇ÍÓ‚˚ı ÛÒÎÓ‚Ëflı. Ç Ì‡˜‡Î ÓÔ˚Ú‡ ÍÓÓ‚˚ ̇ıÓ‰ËÎËÒ¸ ‚ ÔÂ‚ÓÈ Ù‡Á ·ÍÚ‡ˆËË (1–100 ‰ÌÂÈ).
퇷Îˈ‡ 1. ï‡‡ÍÚÂËÒÚË͇ ÔÓ‰ÓÔ˚ÚÌ˚ı ÍÓÓ‚
40
ÉÛÔÔ‡
n
ÜË‚‡fl χÒÒ‡,
Í„
äÓÌÚÓθ̇fl
8
éÔ˚Ú̇fl
8
èÓ‰ÛÍÚË‚ÌÓÒÚ¸ Á‡ 305 ‰ÌÂÈ Ô‰¯ÂÒÚ‚Û˛˘ÂÈ ÓÔ˚ÚÛ Î‡ÍÚ‡ˆËË
ì‰ÓÈ, Í„
ÜË, %
åÓÎÓ˜Ì˚È ÊË, Í„
586 ±17
9443±156
3,60 ±0,08
339,9
600±18
9379 ±162
3,60 ±0,04
337,6
Л. В. Романенко и др. ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 41
Рубрика: Генетика и разведение животных
Ç ÒÚÓÈÎÓ‚˚È ÔÂËÓ‰ ÍÓÓ‚˚ ÓÔ˚ÚÌÓÈ „ÛÔÔ˚
‚ ÓÚ΢ˠÓÚ ÍÓÌÚÓθÌÓÈ ÔÓÎÛ˜‡ÎË ‚ ÒÛÚÍË ‚ ÒÓÒÚ‡‚ ‡ˆËÓ̇ 0,25 Í„ Ò‡ı‡ÌÓ„Ó ÒËÓÔ‡ Ò ÒÓ‰ÂʇÌËÂÏ 78% „βÍÓÁ˚. Ç Ô‡ÒڷˢÌ˚È ÔÂËÓ‰ ÍÓÏÎÂÌË ÍÓÓ‚ Ó·ÂËı „ÛÔÔ ·˚ÎÓ Ó‰Ë̇ÍÓ‚˚Ï. àÁÛ˜‡ÎË
‚ÎËflÌË ÓÔÚËÏËÁ‡ˆËË Û„Î‚ӉÌÓ„Ó ÔËÚ‡ÌËfl ÍÓÓ‚
̇ ‡ÎËÁ‡ˆË˛ Ëı „ÂÌÂÚ˘ÂÒÍÓ„Ó ÔÓÚÂ̈ˇ· ÔÓ‰ÛÍÚË‚ÌÓÒÚË Ë ÙËÁËÓÎӄ˘ÂÒÍÓ ÒÓÒÚÓflÌËÂ.
èË Ôӂ‰ÂÌËË ÓÔ˚ÚÓ‚ Û˜ËÚ˚‚‡ÎË ÍÓÏÎÂÌËÂ
ÍÓÓ‚, ·‡ÎË ÔÓ·˚ ÍÓÏÓ‚ Ë ÔÓ‚Ó‰ËÎË Ëı ‡Ì‡ÎËÁ ‚ ÒÓÓÚ‚ÂÚÒÚ‚ËË Ò ÏÂÚӉ˘ÂÒÍËÏË ÛÍÓ‚Ó‰ÒÚ‚‡ÏË Ë ÔÓÒÓ·ËflÏË (û. ä. éÎθ, 1962; Ö. å. ÜÛ‡‚΂‡, 1963; Ç. ü. ÄÌÚÓÌÓ‚‡, è. ç. ÅÎËÌÓ‚‡,
1971; Ç. à. ÇÓ΄Ë̇, ã. ë. Ü·Ó‚ÒÍÓ„Ó, 1974;
û. à. ê‡ÂˆÍÓÈ, ç. è. ÑÓÁ‰ÂÌÍÓ, ë. à. ãËÔχÌ,
1975; è. í. ã·‰‚‡, Ä. í. ìÒӂ˘‡, 1976; Ö. Ä. èÂÚÛıÓ‚ÓÈ, ê. î. ÅÂÒÒ‡‡·Ó‚ÓÈ Ë ‰., 1981; Ö. Ä. èÂÚÛıÓ‚ÓÈ Ë ‰., 1982; Ç. Ä. ê‡ÁÛÏÓ‚‡, 1982, 1986).
ëÛıÓ ‚¢ÂÒÚ‚Ó ÍÓÏÓ‚ ÓÔ‰ÂÎflÎË ‚ÂÒÓ‚˚Ï ÏÂÚÓ‰ÓÏ, ‡ÁÓÚ — ÏÂÚÓ‰ÓÏ ä¸Â艇Îfl, Ò˚ÓÈ ÊË —
ÏÂÚÓ‰ÓÏ ë. Ç. êÛ¯ÍÓ‚ÒÍÓ„Ó, Ò˚Û˛ ÍÎÂÚ˜‡ÚÍÛ —
ÏÂÚÓ‰ÓÏ ä˛¯ÌÂ‡-ɇÌÂ͇ ‚ ÏÓ‰ËÙË͇ˆËË äÓ„‡Ì,
Ò‡ı‡‡ — ˆÂÌÚËÙÛÊÌ˚Ï ÏÂÚÓ‰ÓÏ ÅÂÚ‡Ì‡, Ò˚Û˛ ÁÓÎÛ — ÏÂÚÓ‰ÓÏ ÓÁÓÎÂÌËfl, ͇θˆËfl — ÍÓÏÔÎÂÍÒÓÏÂÚ˘ÂÒÍËÏ ÏÂÚÓ‰ÓÏ, ÙÓÒÙÓ — ÍÓÎÓÏÂÚ˘ÂÒÍËÏ ÏÂÚÓ‰ÓÏ, ω¸ Ë ˆËÌÍ — ÔÓ û. ä. éÎβ,
ÍÓ·‡Î¸Ú — ÔÓ å. ã. ñ‡ÔÛ, ÈÓ‰ — ˆÂËÈ-‡ÒÂÌËÚÌ˚Ï ÏÂÚÓ‰ÓÏ, ͇ÓÚËÌ — ÔÓ à. ä. åÛË.
é ÒÓÒÚÓflÌËË Ó·ÏÂÌÌ˚ı ÔÓˆÂÒÒÓ‚ Ë ÔÓÎÌÓˆÂÌÌÓÒÚË ÍÓÏÎÂÌËfl ÒÛ‰ËÎË ÔÓ ·ËÓıËÏ˘ÂÒÍËÏ ÔÓ͇Á‡ÚÂÎflÏ ÍÓ‚Ë Ë ÏÓÎÓ͇.
Ç ÍÓ‚Ë ÓÔ‰ÂÎflÎË ÔÓ͇Á‡ÚÂÎË, ı‡‡ÍÚÂËÁÛ˛˘Ë ÒÓÒÚÓflÌË ·ÂÎÍÓ‚Ó„Ó Ó·ÏÂ̇ — Ó·˘ËÈ
·ÂÎÓÍ, Ù‡ÍˆËË ·ÂÎ͇ (‡Î¸·ÛÏËÌ, „ÎÓ·ÛÎËÌ), ·ÂÎÍÓ‚˚È Ë̉ÂÍÒ Ë ÏӘ‚ËÌÛ. ï‡‡ÍÚÂËÁÛ˛˘Ë ˝ÌÂ„ÂÚ˘ÂÒÍËÈ Ë Û„Î‚ӉÌÓ-ÊËÓ‚ÓÈ Ó·ÏÂÌ — „βÍÓÁÛ, ÍÂÚÓÌÓ‚˚ Ú·; ÏËÌÂ‡Î¸Ì˚È Ó·ÏÂÌ —
͇θˆËÈ, ÌÂÓ„‡Ì˘ÂÒÍËÈ ÙÓÒÙÓ Ë Ëı ÒÓÓÚÌÓ¯ÂÌËÂ, Ó·˘ËÈ ÈÓ‰ Ë ÂÁÂ‚ÌÛ˛ ˘ÂÎÓ˜ÌÓÒÚ¸; ı‡‡ÍÚÂËÁÛ˛˘Ë ‚ËÚ‡ÏËÌÌÛ˛ Ó·ÂÒÔ˜ÂÌÌÓÒÚ¸ ÏÓÎÓ˜Ì˚ı ÍÓÓ‚ — ͇ÓÚËÌ.
Ç ÏÓÎÓÍ ÍÓÓ‚ ÓÔ‰ÂÎflÎË: ÍÂÚÓÌÓ‚˚ Ú·,
ÏӘ‚ËÌÛ, Ó·˘ËÈ ÈÓ‰, Ó·˘ËÈ Í‡Î¸ˆËÈ, Ó·˘ËÈ
ÙÓÒÙÓ.
äÓ‚¸ ËÒÒΉӂ‡ÎË Ì‡ ÒÓ‰ÂʇÌË ӷ˘Â„Ó ·ÂÎ͇ Ë Â„Ó Ù‡ÍˆËÈ ·ËÛÂÚÓ‚˚Ï ÏÂÚÓ‰ÓÏ ÔÓ ã. à.
ëÎÛˆÍÓÏÛ (1964), „βÍÓÁÛ ÓÔ‰ÂÎflÎË ˝ÌÁËχÚ˘ÂÒÍËÏ ÍÓÎÓËÏÂÚ˘ÂÒÍËÏ ÏÂÚÓ‰ÓÏ, ÏӘ‚ËÌÛ
ÍÓ‚Ë Ë ÏÓÎÓ͇ ÓÔ‰ÂÎflÎË Û‡ÁÌ˚Ï ÙÂÌÓÎ-„ËÔÓıÎÓˉÌ˚Ï ÏÂÚÓ‰ÓÏ, ÍÂÚÓÌÓ‚˚ Ú· ÍÓ‚Ë Ë ÏÓÎÓ͇ — ÒÔÂÍÚÓÙÓÚÓÏÂÚ˘ÂÒÍËÏ ÏÂÚÓ‰ÓÏ, ͇θˆËÈ
ÍÓ‚Ë — ÚËÎÓÌÓÏÂÚ˘ÂÒÍËÏ ÏÂÚÓ‰ÓÏ Ò ÙÎÛÓÂÍÒÓÌÓÏ, ÂÁÂ‚ÌÛ˛ ˘ÂÎÓ˜ÌÓÒÚ¸ — ÚËÚÓÏÂÚ˘ÂÒÍËÏ ÏÂÚÓ‰ÓÏ ÔÓ Ç. î. äÓÓÏ˚ÒÎÓ‚Û Ë ã. Ä. äÛ‰-
fl‚ˆÂ‚ÓÈ (1972), ÌÂÓ„‡Ì˘ÂÒÍËÈ ÙÓÒÙÓ ÍÓ‚Ë —
ÒÔÂÍÚÓÙÓÚÓÏÂÚ˘ÂÒÍËÏ ÏÂÚÓ‰ÓÏ ‚ ÏÓ‰ËÙË͇ˆËË
Ç. à. ÇÓ΄Ë̇ (1969), ‚ ÏÓÎÓÍ — ÍÓÎÓËÏÂÚ˘ÂÒÍËÏ ÏÂÚÓ‰ÓÏ, Ó·˘ËÈ ÈÓ‰ ÍÓ‚Ë Ë ÏÓÎÓ͇ — ˆÂËÈ-‡ÒÂÌËÚÌ˚Ï ÏÂÚÓ‰ÓÏ ÔÓ É. ë. ëÚÂÔ‡ÌÓ‚Û (1969),
͇ÓÚËÌ ÍÓ‚Ë — ÍÓÎÓËÏÂÚ˘ÂÒÍËÏ ÏÂÚÓ‰ÓÏ.
Ç ÏÓÎÓÍ ÔÓÏËÏÓ ÊË‡ Ë ·ÂÎ͇ ÓÔ‰ÂÎflÎË ÒÓ‰ÂʇÌË ÍÂÚÓÌÓ‚˚ı ÚÂÎ, ÏӘ‚ËÌ˚ Ë ÈÓ‰‡. èË
ËÒÒΉӂ‡ÌËË ÍÓÏÓ‚, ÍÓ‚Ë Ë ÏÓÎÓ͇ (‚ ··Ó‡ÚÓËË ÍÓÏÎÂÌËfl ‚˚ÒÓÍÓÔÓ‰ÛÍÚË‚Ì˚ı ÔÎÂÏÂÌÌ˚ı ÊË‚ÓÚÌ˚ı Éçì ÇçààÉêÜ) ÔÓθÁÓ‚‡ÎËÒ¸
Ó·˘ÂÔËÌflÚ˚ÏË ÏÂÚÓ‰Ë͇ÏË ÁÓÓÚÂıÌ˘ÂÒÍËı Ë ·ËÓıËÏ˘ÂÒÍËı ‡Ì‡ÎËÁÓ‚.
Ä̇ÎËÁ Ë Ó·ÒÛʉÂÌË ÂÁÛθڇÚÓ‚. ç‡ Ì‡˜‡ÎÓ
ÓÔ˚Ú‡ ÒÛÚÓ˜Ì˚È Û‰ÓÈ ÏÓÎÓ˜Ì˚ı ÍÓÓ‚ ÒÓÒÚ‡‚ÎflÎ
31–32 Í„ ÏÓÎÓ͇. Ç ÁËÏÌÂ-‚ÂÒÂÌÌËÈ ÓÔ˚ÚÌ˚È ÔÂËÓ‰ ‡ˆËÓÌ˚ ÔÓ‰ÓÔ˚ÚÌ˚ı ÍÓÓ‚ ÒÓÒÚÓflÎË ËÁ ÒÂ̇, ÒËÎÓÒ‡, ÍÓÏ·ËÍÓχ, ÊÓχ ÒÛıÓ„Ó, Ò‡ı‡ÌÓ„Ó
ÒËÓÔ‡ (ÓÔ˚Ú̇fl „ÛÔÔ‡) Ë ÏËÌÂ‡Î¸ÌÓ-‚ËÚ‡ÏËÌÌÓÈ ÔÓ‰ÍÓÏÍË (Ú‡·Î. 2).
ꇈËÓÌ˚ ÍÓÓ‚ ÓÔ˚ÚÌÓÈ „ÛÔÔ˚ ÓÚ΢‡ÎËÒ¸
ÓÚ ÍÓÌÚÓθÌÓÈ ÚÂÏ, ˜ÚÓ ‚ ÌËı ·˚ÎÓ Û‚Â΢ÂÌÓ
ÍÓ΢ÂÒÚ‚Ó Ò‡ı‡‡ ̇ 28,2% (̇ 197 „) Á‡ Ò˜ÂÚ ‰ÓÔÓÎÌËÚÂθÌÓ„Ó Ò͇ÏÎË‚‡ÌËfl 0,25 Í„ Ò‡ı‡ÌÓ„Ó
ÒËÓÔ‡. ë‡ı‡Ó-ÔÓÚÂËÌÓ‚Ó ÓÚÌÓ¯ÂÌË ÒÓÒÚ‡‚ËÎÓ 0,32:1 ÔÓÚË‚ 0,25:1 ‚ ÍÓÌÚÓÎÂ.
Ç 1 Í„ ÒÛıÓ„Ó ‚¢ÂÒÚ‚‡ ‡ˆËÓÌÓ‚ ÔÓ‰ÓÔ˚ÚÌ˚ı
ÍÓÓ‚ ÒÓ‰ÂʇÎÓÒ¸ 10,8 åÑÊ Ó·ÏÂÌÌÓÈ ˝ÌÂ„ËË,
172,5–173,0 „ Ò˚Ó„Ó ÔÓÚÂË̇, 33,1–41,8 „ Ò‡ı‡‡, 43,3–43,8 „ Ò˚Ó„Ó ÊË‡ Ë 17,4–17,5% Ò˚ÓÈ ÍÎÂÚ˜‡ÚÍË, ÍÓ΢ÂÒÚ‚Ó Ò‡ı‡‡ + Í‡ıχ· ÒÓÒÚ‡‚ËÎÓ 21,4% ÓÚ ÒÛıÓ„Ó ‚¢ÂÒÚ‚‡. Ç 1 Í„ ÒÛıÓ„Ó
‚¢ÂÒÚ‚‡ ÍÓ̈ÂÌÚ‡ˆËfl ÏËÌÂ‡Î¸Ì˚ı ‚¢ÂÒÚ‚ Ë ‚ËÚ‡ÏËÌÓ‚ ÒÓÒÚ‡‚Ë·: ͇θˆËfl — 7,1 „, ÙÓÒÙÓ‡ —
5,6–5,7, χ„ÌËfl — 2,0, ÒÂ˚ — 2,4 „, ÏÂ‰Ë —
10,2–10,3 Ï„, ˆËÌ͇ — 48,2–48,6 Ï„, χ„‡Ìˆ‡ —
52,2 Ï„, ÈÓ‰‡ — 1,0 Ï„, ͇ÓÚË̇ — 22,0–22,1 Ï„,
‚ËÚ‡ÏË̇ Ñ — 1,6 Ú˚Ò. åÖ Ë ‚ËÚ‡ÏË̇ Ö — 69,9 Ï„.
Ç ‡ˆËÓ̇ı ÔÓ‰ÓÔ˚ÚÌ˚ı ÍÓÓ‚ ÓÚϘ‡ÎÒfl ̉ÓÒÚ‡ÚÓÍ Í‡ÓÚË̇.
Ç Ô‡ÒڷˢÌ˚È ÔÂËÓ‰ ÍÓÓ‚˚ ÔÓθÁÓ‚‡ÎËÒ¸
‰Ó΄ÓÎÂÚÌËÏË ÍÛθÚÛÌ˚ÏË Ô‡Òڷˢ‡ÏË. Ç ÒÚÓÈΠÓÌË ÔÓÎÛ˜‡ÎË ÒÂÌÓ, ÁÂÎÂÌÛ˛ ÔÓ‰ÍÓÏÍÛ ËÁ Ó‰ÌÓÎÂÚÌËı Ú‡‚, ÍÓÏ·ËÍÓÏ Ë Ô‡ÚÓÍÛ (Ú‡·Î. 3).
àÒÒΉӂ‡ÌËfl ÍÓ‚Ë ‚ ̇˜‡Î ÓÔ˚Ú‡ ‚ Ô‰‚‡ËÚÂθÌ˚È ÔÂËÓ‰ ÔÓ͇Á‡ÎË, ˜ÚÓ Û ÔÓ‰ÓÔ˚ÚÌ˚ı
ÍÓÓ‚ ÔÓ ·Óθ¯ËÌÒÚ‚Û ÔÓ͇Á‡ÚÂÎÂÈ Ì ̇·Î˛‰‡ÎÓÒ¸ ÒÛ˘ÂÒÚ‚ÂÌÌ˚ı ‡Á΢ËÈ (Ú‡·Î. 4).
èÓ Ò‡‚ÌÂÌ˲ ÒÓ ÒÚÓÈÎÓ‚˚Ï ÔÂËÓ‰ÓÏ ‚ 1 Í„
ÒÛıÓ„Ó ‚¢ÂÒÚ‚‡ ÎÂÚÌÂ„Ó ‡ˆËÓ̇ ÒÓ‰ÂʇÎÓÒ¸
·Óθ¯Â Ó·ÏÂÌÌÓÈ ˝ÌÂ„ËË (11,0 åÑÊ), Ò˚Ó„Ó
ÔÓÚÂË̇ (183 „) Ë Ò‡ı‡‡ (84,7 „). ë‡ı‡ÓÔÓÚÂËÌÓ‚Ó ÓÚÌÓ¯ÂÌË ÒÓÒÚ‡‚ËÎÓ 0,62:1. äÓ΢ÂÒÚ‚Ó
Ò‡ı‡‡ + Í‡ıχ· ·˚ÎÓ ‚ ‡ˆËÓÌ ‚ Ô‰Â·ı
Углеводное питание коров с удоем 9000 кг молока за лактацию и выше
41
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 42
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
4/2014
퇷Îˈ‡ 2. ë‰ÌÂÒÛÚÓ˜Ì˚ ‡ˆËÓÌ˚ ÔÓ‰ÓÔ˚ÚÌ˚ı ÍÓÓ‚ ‚ ÒÚÓÈÎÓ‚˚È ÔÂËÓ‰
äÓχ Ë ÔÓ‰ÍÓÏÍË
ëÂÌÓ ÏÌÓ„ÓÎÂÚÌËı Ú‡‚, Í„
ëËÎÓÒ ÏÌÓ„ÓÎÂÚÌËı Ú‡‚, Í„
äÓÏ·ËÍÓÏ, Í„
ÜÓÏ ÒÛıÓÈ, Í„
òÓÚ ÔÓ‰ÒÓÎ̘ÌËÍÓ‚˚È, Í„
ë‡ı‡Ì˚È ÒËÓÔ, Í„
åÂÎ ÍÓÏÓ‚ÓÈ, „
èÓ‚‡ÂÌ̇fl ÒÓθ, „
äÓÏÓ‚˚ı ‰ËÌˈ
é·ÏÂÌÌÓÈ ˝ÌÂ„ËË, åÑÊ
ëÛıÓ„Ó ‚¢ÂÒÚ‚‡, Í„
ë˚Ó„Ó ÔÓÚÂË̇, „
èÂ‚‡ËÏÓ„Ó ÔÓÚÂË̇, „
ä‡ıχ·, „
ë‡ı‡‡, „
ë˚Ó„Ó ÊË‡, „
ë˚ÓÈ ÍÎÂÚ˜‡ÚÍË, „
ä‡Î¸ˆËfl, „
îÓÒÙÓ‡, „
凄ÌËfl, „
ä‡ÎËfl, „
ëÂ˚, „
ÜÂÎÂÁ‡, Ï„
å‰Ë, Ï„
ñËÌ͇, Ï„
äÓ·‡Î¸Ú‡, Ï„
å‡„‡Ìˆ‡, Ï„
âÓ‰‡, Ï„
ä‡ÓÚË̇, Ï„
ÇËÚ‡ÏË̇ Ñ, Ú˚Ò. åÖ
ÇËÚ‡ÏË̇ Ö, Ï„
ÉÛÔÔ‡
äÓÌÚÓθ̇fl
3
24
13,5
1,2
0,5
—
100
0,1
ëÓ‰ÂÊËÚÒfl ‚ ‡ˆËÓÌÂ:
21,5
232,9
21,1
3652
2799
3817
698
925
3709
150
120
43
298
51
3791
217
1025
15,6
1101
21,4
465
34,4
1476
éÔ˚Ú̇fl
3
24,5
13,5
1,2
0,5
0,25
100
0,1
21,9
237,2
21,4
3692
2823
3818
895
930
3740
152
121
44
312
52
3799
219
1032
17,7
1117
21,6
473
34,5
1497
퇷Îˈ‡ 3. ë‰ÌÂÒÛÚÓ˜Ì˚È ‡ˆËÓÌ ÔÓ‰ÓÔ˚ÚÌ˚ı ÍÓÓ‚ ‚ Ô‡ÒڷˢÌ˚È ÔÂËÓ‰
äÓχ Ë ÔÓ‰ÍÓÏÍË
Í„
äÓχ Ë ÔÓ‰ÍÓÏÍË
í‡‚‡ Ô‡ÒÚ·Ë˘Ì‡fl
35
äÓÏ·ËÍÓÏ
9
áÂÎÂ̇fl ÔÓ‰ÍÓÏ͇
14
è‡ÚÓ͇
0,5
ëÂÌÓ
äÓÏÓ‚˚ı ‰ËÌˈ
é·ÏÂÌÌÓÈ ˝ÌÂ„ËË, åÑÊ
42
1
èÓ‚‡ÂÌ̇fl ÒÓθ
Ç ‡ˆËÓÌ ÒÓ‰ÂÊËÚÒfl:
18,4
凄ÌËfl, „
207,3
ä‡ÎËfl, „
Í„
0,1
47
245
ëÛıÓ„Ó ‚¢ÂÒÚ‚‡, Í„
18,8
ëÂ˚, „
53
ë˚Ó„Ó ÔÓÚÂË̇, „
3440
ÜÂÎÂÁ‡, Ï„
1870
èÂ‚‡ËÏÓ„Ó ÔÓÚÂË̇, „
2571
å‰Ë, Ï„
120
ä‡ıχ·, „
2886
ñËÌ͇, Ï„
398
ë‡ı‡‡, „
1593
äÓ·‡Î¸Ú‡, Ï„
13,2
ë˚Ó„Ó ÊË‡, „
750
å‡„‡Ìˆ‡, Ï„
867
ë˚ÓÈ ÍÎÂÚ˜‡ÚÍË, „
3583
âÓ‰‡, Ï„
21,3
ä‡Î¸ˆËfl, „
160
ä‡ÓÚË̇, Ï„
1549
îÓÒÙÓ‡, „
100
ÇËÚ‡ÏË̇ Ö, Ï„
3366
Л. В. Романенко и др. ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 43
Рубрика: Генетика и разведение животных
퇷Îˈ‡ 4. ÅËÓıËÏ˘ÂÒÍË ÔÓ͇Á‡ÚÂÎË ÍÓ‚Ë ÔÓ‰ÓÔ˚ÚÌ˚ı ÍÓÓ‚
‚ Ô‰‚‡ËÚÂθÌ˚È ÔÂËÓ‰ (ÒÚÓÈÎÓ‚˚È ÔÂËÓ‰)
èÓ͇Á‡ÚÂÎË
ÉÛÔÔ‡
äÓÌÚÓθ̇fl
éÔ˚Ú̇fl
é·˘ËÈ ·ÂÎÓÍ, „ %
9,01 ± 0,18
8,98 ± 0,08
Äθ·ÛÏËÌ, „ %
3,77 ± 0,16
3,97 ± 0,10
ÉÎÓ·ÛÎËÌ, „ %
5,24 ± 0,15
5,01 ± 0,24
Ä/É
0,72 ± 0,04
0,79 ± 0,04
åӘ‚Ë̇, ÏÏÓθ/Î
6,33 ± 0,48
6,17 ± 0,26
ÉβÍÓÁ‡, ÏÏÓθ/Î
1,90 ± 0,19
2,02 ± 0,14
äÂÚÓÌÓ‚˚ Ú·, Ï„ %
4,46 ± 0,36
3,65 ± 0,16
ä‡Î¸ˆËÈ, Ï„ %
12,17 ± 0,23
12,00 ± 0,23
çÂÓ„. ÙÓÒÙÓ, Ï„ %
6,03 ± 0,18
6,25 ± 0,18
ë‡:ê
2,02:1
1,92:1
âÓ‰, ÏÍ„ %
2,46 ± 0,31
2,02 ± 0,32
ä‡ÓÚËÌ, Ï„ %
0,25 ± 0,03
0,15 ± 0,02*
*— ê<0,05
23,8% ÓÚ ÒÛıÓ„Ó ‚¢ÂÒÚ‚‡. Ç 1 Í„ ÒÛıÓ„Ó ‚¢ÂÒÚ‚‡
ÒÓ‰ÂʇÌË ͇θˆËfl ÒÓÒÚ‡‚ËÎÓ 8,5 „, ÙÓÒÙÓ‡ —
5,3 „, χ„ÌËfl — 2 „, ÒÂ˚ — 2,8 „, ÏËÍÓ˝ÎÂÏÂÌÚÓ‚ — ÏÂ‰Ë — 6,4 Ï„, ˆËÌ͇ — 21,2 Ï„, ÍÓ·‡Î¸Ú‡ —
0,7 Ï„, χ„‡Ìˆ‡ — 46 Ï„, ÈÓ‰‡ — 1,13 Ï„, ͇ÓÚË̇ — 82,4 Ï„ Ë ‚ËÚ‡ÏË̇ Ö — 179 Ï„.
ëΉÛÂÚ ÓÚÏÂÚËÚ¸, ˜ÚÓ ‚ ÍÓ‚Ë Û ÍÓÓ‚ Ó·ÂËı
„ÛÔÔ ‚˚fl‚ÎÂÌÓ ËÁ·˚ÚÓ˜ÌÓ ÒÓ‰ÂʇÌË ӷ˘Â„Ó
·ÂÎ͇ (9,01–8,98 „ % ÔË ÌÓÏ 7–9 „ %), „ÎÓ·ÛÎË̇ Ë ÏӘ‚ËÌ˚. ëÓ‰ÂʇÌË „βÍÓÁ˚, ÈÓ‰‡
Ë Í‡ÓÚË̇ ·˚ÎÓ ÌËÊ ÙËÁËÓÎӄ˘ÂÒÍÓÈ ÌÓÏ˚
ÔÓ Ô˘ËÌ Ëı ‰ÂÙˈËÚ‡ ‚ ‡ˆËÓ̇ı.
àÒÒΉӂ‡ÌËfl ÔÓ͇Á‡ÎË, ˜ÚÓ ÓÔÚËÏËÁ‡ˆËfl ÍÓÏÎÂÌËfl ÍÓÓ‚ ÓÔ˚ÚÌÓÈ „ÛÔÔ˚ ÔÓ ÒÓ‰ÂʇÌ˲ Ò‡ı‡‡ ÒÔÓÒÓ·ÒÚ‚Ó‚‡Î‡ ÎÛ˜¯ÂÈ ‡ÎËÁ‡ˆËË Ëı „ÂÌÂÚ˘ÂÒÍÓ„Ó ÔÓÚÂ̈ˇ· ÔÓ ÔÓ‰ÛÍÚË‚ÌÓÒÚË. åÓÎӘ̇fl
ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸, Á‡ ÔÂËÓ‰ ÓÔ˚Ú‡, ‚ ÍÓÌÚÓθÌÓÈ
„ÛÔÔ ÒÓÒÚ‡‚Ë· 6606 Í„ ÏÓÎÓ͇ 4 % ÊËÌÓÒÚË,
‚ ÓÔ˚ÚÌÓÈ „ÛÔÔ 7830 Í„ ÏÓÎÓ͇ Ú‡ÍÓÈ Ê ÊËÌÓÒÚË, ˜ÚÓ ‚˚¯Â ̇ 18,5 %. íÓθÍÓ ÔÓ ÍÓ̈ÂÌÚ‡ˆËË
͇ÓÚË̇ ‚ Ò˚‚ÓÓÚÍ ÍÓ‚Ë ‡ÁÌˈ‡ ÏÂÊ‰Û „ÛÔÔ‡ÏË ·˚· ÒÚ‡ÚËÒÚ˘ÂÒÍË ‰ÓÒÚÓ‚ÂÌÓÈ (ê <0,05).
àÒÒΉӂ‡ÌËfl ·ËÓıËÏ˘ÂÒÍËı ÔÓ͇Á‡ÚÂÎÂÈ ÏÓÎÓ͇ ÔÓ͇Á‡ÎË, ˜ÚÓ Û ‚˚ÒÓÍÓÔÓ‰ÛÍÚË‚Ì˚ı ÔÓ‰ÓÔ˚ÚÌ˚ı ÍÓÓ‚ Ó˜Â̸ χÎÓ ÒÓ‰ÂʇÎÓÒ¸ ÏӘ‚ËÌ˚ (1,46 ÏÏÓθ/Î ÔË ÌÓÏ 3,5–5,5 ÏÏÓθ/Î),
Ë Ó·˘Â„Ó ÈÓ‰‡ (32,0–44,6 ÏÍ„/Î ÔË ÌÓÏ 60–
130 ÏÍ„/Î).
Ç ÒÚÓÈÎÓ‚˚È ÔÂËÓ‰ ÓÔÚËÏËÁ‡ˆËfl ۄ΂ӉÌÓ„Ó
ÔËÚ‡ÌËfl ÍÓÓ‚ ÓÔ˚ÚÌÓÈ „ÛÔÔ˚ ÔÓÎÓÊËÚÂθÌÓ
Ò͇Á‡Î‡Ò¸ ̇ ÌÂÍÓÚÓ˚ı ·ËÓıËÏ˘ÂÒÍËı ÔÓ͇Á‡ÚÂÎflı ÍÓ‚Ë (Ú‡·Î. 5).
퇷Îˈ‡ 5. ÅËÓıËÏ˘ÂÒÍË ÔÓ͇Á‡ÚÂÎË ÍÓ‚Ë ÔÓ‰ÓÔ˚ÚÌ˚ı ÍÓÓ‚ ‚ ÒÚÓÈÎÓ‚˚È ÔÂËÓ‰
èÓ͇Á‡ÚÂÎË
é·˘ËÈ ·ÂÎÓÍ, „ %
Äθ·ÛÏËÌ, „ %
ÉÎÓ·ÛÎËÌ, „ %
Ä/É
åӘ‚Ë̇, ÏÏÓθ/Î
ÉβÍÓÁ‡, ÏÏÓθ/Î
äÂÚÓÌÓ‚˚ Ú·, Ï„ %
ä‡Î¸ˆËÈ, Ï„ %
çÂÓ„‡Ì˘ÂÒÍËÈ ÙÓÒÙÓ, Ï„ %
ë‡:ê
âÓ‰, ÏÍ„ %
ä‡ÓÚËÌ, Ï„ %
ÉÛÔÔ‡
äÓÌÚÓθ̇fl
9,72 ± 0,22
3,25 ± 0,12
6,47 ± 0,17
0,50 ± 0,02
7,67 ± 0,74
1,68 ± 0,07
3,89 ± 0,10
11,88 ± 0,19
5,83 ± 0,17
2,04:1
3,35 ± 0,25
0,48 ± 0,06
éÔ˚Ú̇fl
9,77 ± 0,24
3,49 ± 0,15
6,28 ± 0,23
0,55 ± 0,03
6,87 ± 0,43
2,03 ± 0,05***
3,42 ± 0,11**
12,47 ± 0,15
5,59 ± 0,11
2,23:1
4,28 ± 0,27*
0,63 ± 0,05*
*— ê<0,05; **— ê<0,01; ***— ê<0,001
Углеводное питание коров с удоем 9000 кг молока за лактацию и выше
43
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 44
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
äÓ̈ÂÌÚ‡ˆËfl „βÍÓÁ˚ Û ÌËı ·˚· ‚˚¯Â ̇
20,8% (ê<0,001), ‡ ÍÂÚÓÌÓ‚˚ı ÚÂÎ, ̇ӷÓÓÚ, ÏÂ̸¯Â ̇ 12,1% (ê<0,01). èÓ ÛÓ‚Ì˛ ÈÓ‰‡ ÍÓÓ‚˚
ÓÔ˚ÚÌÓÈ „ÛÔÔ˚ Ô‚ÓÒıÓ‰ËÎË ÍÓÌÚÓθÌÛ˛ ̇
27,8% (ê<0,05) Ë Í‡ÓÚË̇ — ̇ 31,2% (ê<0,05).
ùÚÓ Ò‚Ë‰ÂÚÂθÒÚ‚ÛÂÚ Ó ÚÓÏ, ˜ÚÓ ÓÔÚËÏËÁ‡ˆËfl ۄ΂ӉÌÓ„Ó ÔËÚ‡ÌËfl Ó͇Á‡Î‡ ÔÓÎÓÊËÚÂθÌÓ ‚ÎËflÌËÂ
̇ ÈÓ‰Ì˚È Ó·ÏÂÌ Ë ÛÒ‚ÓÂÌË ͇ÓÚË̇ ËÁ ÍÓÏÓ‚.
äÓ΢ÂÒÚ‚Ó ÈÓ‰‡ ‚ ÏÓÎÓÍ ‚ÓÁÓÒÎÓ ‰Ó 102,6 ÏÍ„/Î
(ê <0,001), ˜ÚÓ ÒÓÓÚ‚ÂÚÒÚ‚Ó‚‡ÎÓ ÙËÁËÓÎӄ˘ÂÒÍÓÈ ÌÓÏÂ.
äÓ΢ÂÒÚ‚Ó Ó·˘Â„Ó ·ÂÎ͇ ‚ Ò˚‚ÓÓÚÍ ÍÓ‚Ë
ıÓÚfl Ë Ô‚ÓÒıÓ‰ËÎÓ ÙËÁËÓÎӄ˘ÂÒÍÛ˛ ÌÓÏÛ,
ÌÓ Ó̇ ·˚· ÌÂÒÍÓθÍÓ ÌËÊÂ, ˜ÂÏ ‚ ÒÚÓÈÎÓ‚˚È
ÔÂËÓ‰ (Ú‡·Î. 6).
èÓ‚˚¯ÂÌË ÍÓ΢ÂÒÚ‚‡ Ò‡ı‡‡ ‚ ‡ˆËÓ̇ı ÍÓÓ‚ ‚ Ô‡ÒڷˢÌ˚È ÔÂËÓ‰ ÔÓÎÓÊËÚÂθÌÓ Ò͇Á‡ÎÓÒ¸
̇ ‚Â΢ËÌ ÏÌÓ„Ëı ·ËÓıËÏ˘ÂÒÍËı ÔÓ͇Á‡ÚÂÎÂÈ
ÍÓ‚Ë. í‡Í, ÛÓ‚Â̸ Ò‡ı‡‡ ‚ ÍÓ‚Ë Á‡ÏÂÚÌÓ ‚ÓÁÓÒ Ò 1,68–1,90 ÏÏÓθ/Î ‰Ó 3,03 ÏÏÓθ/Î ËÎË
̇ 59,5–80,3% Ë ·˚Î ‚ Ô‰Â·ı ÙËÁËÓÎӄ˘ÂÒÍÓÈ ÌÓÏ˚. ëÓ‰ÂʇÌË ÍÂÚÓÌÓ‚˚ı ÚÂÎ ÒÓÓÚ‚ÂÚÒÚ‚ÂÌÌÓ ÒÌËÁËÎÓÒ¸ Ò 3,89–4,46 Ï„ % ‰Ó 2,10 Ï„%
ËÎË Ì‡ 46–53 %. í‡ÍÊ ÓÚϘÂÌÓ Á̇˜ËÚÂθÌÓÂ
ÒÌËÊÂÌË ÏӘ‚ËÌ˚ ‚ ÍÓ‚Ë ‰Ó Ô‰ÂÎÓ‚ ÙËÁËÓÎӄ˘ÂÒÍÓÈ ÌÓÏ˚ (‰Ó 5,16 ÏÏÓθ/Î). ìÎÛ˜¯ÂÌËÂ
ۄ΂ӉÌÓ„Ó ÔËÚ‡ÌËfl ÔÓ‰ÓÔ˚ÚÌ˚ı ÍÓÓ‚ ‚ Ô‡ÒڷˢÌ˚È ÔÂËÓ‰ Ú‡ÍÊ ÒÔÓÒÓ·ÒÚ‚Ó‚‡ÎÓ ÎÛ˜¯ÂÏÛ ÛÒ‚ÓÂÌ˲ ÈÓ‰‡ ËÁ ÍÓÏÓ‚, ˜ÚÓ ÔË‚ÂÎÓ Í ‚ÓÁ‡ÒÚ‡Ì˲
ÈÓ‰‡ ‚ ÍÓ‚Ë ‰Ó 6,7 ÏÍ„ % Ò 2,46–3,35 ÏÍ„ % ‚ Ò‡‚ÌÂÌËË ÒÓ ÒÚÓÈÎÓ‚˚È ÔÂËÓ‰ÓÏ „Ó‰‡.
Ç Ô‡ÒڷˢÌ˚È ÔÂËÓ‰ Ò‰ÌÂÒÛÚÓ˜Ì˚È Û‰ÓÈ ÍÓÓ‚ ÓÔ˚ÚÌÓÈ „ÛÔÔ˚ ÒÓÒÚ‡‚ËÎ 29,6 Í„ ÔË (P<0.05),
ÍÓÌÚÓθÌÓÈ 25 Í„. àÒÒΉӂ‡ÌËfl ÔÓ͇Á‡ÎË, ˜ÚÓ
ÓÔÚËÏËÁ‡ˆËfl ÍÓÏÎÂÌËfl ÍÓÓ‚ ÓÔ˚ÚÌÓÈ „ÛÔÔ˚
ÔÓ ÒÓ‰ÂʇÌ˲ Ò‡ı‡‡ ÒÔÓÒÓ·ÒÚ‚Ó‚‡Î‡ ÎÛ˜¯ÂÈ ‡ÎËÁ‡ˆËË Ëı „ÂÌÂÚ˘ÂÒÍÓ„Ó ÔÓÚÂ̈ˇ· ÔÓ ÔÓ‰ÛÍÚË‚ÌÓÒÚË. åÓÎӘ̇fl ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸, Á‡ ÔÂËÓ‰
4/2014
ÓÔ˚Ú‡ (305 ‰ÌÂÈ), ‚ ÍÓÌÚÓθÌÓÈ „ÛÔÔ ÒÓÒÚ‡‚Ë· 6606 Í„ ÏÓÎÓ͇ 4% ÊËÌÓÒÚË, ‚ ÓÔ˚ÚÌÓÈ „ÛÔÔ 7830 Í„ ÏÓÎÓ͇ Ú‡ÍÓÈ Ê ÊËÌÓÒÚË, ˜ÚÓ ‚˚¯Â
̇ 18,5%. ç‡ 100-È ‰Â̸ ·ÍÚ‡ˆËË ‚ ÓÔ˚ÚÌÓÈ „ÛÔÔ ·˚ÎÓ ÓÒÂÏÂÌÂÌÓ 7 ÍÓÓ‚, ‡ ‚ ÍÓÌÚÓθÌÓÈ 5.
Ç˚‚Ó‰˚. ç‡ ÓÒÌÓ‚‡ÌËË Ôӂ‰ÂÌÌ˚ı ËÒÒΉӂ‡ÌËÈ ÓÔÚËÏËÁ‡ˆËfl ۄ΂ӉÌÓ„Ó ÔËÚ‡ÌËfl ÍÓÓ‚
Ò „ÂÌÂÚ˘ÂÒÍËÏ ÔÓÚÂ̈ˇÎÓÏ ÔÓ‰ÛÍÚË‚ÌÓÒÚË Ò‚˚¯Â 9000 Í„ ÏÓÎÓ͇ ‚ Ô‡ÒڷˢÌ˚È ÔÂËÓ‰ ‚ ÔÂ‚Û˛ ÔÓÎÓ‚ËÌÛ Î‡ÍÚ‡ˆËË (Û‚Â΢ÂÌË ÍÓ΢ÂÒÚ‚‡
Ò‡ı‡‡ ‚ ‡ˆËÓÌ ̇ 28,2% Á‡ Ò˜ÂÚ Ò͇ÏÎË‚‡ÌËfl
Ò‡ı‡ÌÓ„Ó ÒËÓÔ‡ Ò 78% „βÍÓÁ˚) ÒÔÓÒÓ·ÒÚ‚Ó‚‡Î‡ ·ÓΠ‚˚ÒÓÍÓÈ Â„Ó ‡ÎËÁ‡ˆËË ( ‚ ̇¯ÂÏ ÓÔ˚Ú ̇ 0,6–18,5%).ìÎÛ˜¯ËÎËÒ¸ ·ËÓıËÏ˘ÂÒÍËÂ
ÔÓ͇Á‡ÚÂÎË ÍÓ‚Ë, ı‡‡ÍÚÂËÁÛ˛˘Ë ÒÓÒÚÓflÌËÂ
ۄ΂ӉÌÓ-ÊËÓ‚Ó„Ó Ó·ÏÂ̇ (ÍÂÚÓÌÓ‚˚ Ú·, „βÍÓÁ‡). Ç Ô‡ÒڷˢÌ˚È ÔÂËÓ‰ ÔÓ‚˚¯ÂÌË ÍÓ΢ÂÒÚ‚‡ Ò‡ı‡‡ ‚ ÒÛıÓÏ ‚¢ÂÒÚ‚Â ‡ˆËÓÌÓ‚ Ò 3,3–4,2%
‰Ó 8,5% ÒÔÓÒÓ·ÒÚ‚Ó‚‡ÎÓ ÌÓχÎËÁ‡ˆËË ÏÌÓ„Ëı
·ËÓıËÏ˘ÂÒÍËı ÔÓ͇Á‡ÚÂÎÂÈ ÍÓ‚Ë. ÇÓÁÓÒ ÛÓ‚Â̸ Ò‡ı‡‡ ‚ ÍÓ‚Ë (Ò 1,68–1,90 ÏÏÓθ/Î ‰Ó
3,03 ÏÏÓθ/Î) Ë ÔÓ˜ÚË ‰ÓÒÚË„ ÙËÁËÓÎӄ˘ÂÒÍÓÈ
ÌÓÏ˚ (3,33–3,61). äÓ̈ÂÌÚ‡ˆËfl ÏӘ‚ËÌ˚ Ë ÍÂÚÓÌÓ‚˚ı ÚÂÎ ÛÏÂ̸¯Ë·Ҹ ̇ 46–53 %.
ç‡¯Ë ËÒÒΉӂ‡ÌËfl ÔÓ͇Á‡ÎË, ˜ÚÓ ÓÔÚËÏËÁ‡ˆËfl ÛÓ‚ÌÂÈ ˝ÌÂ„ËË Ë Û„Î‚Ӊӂ ‚ ‡ˆËÓ̇ı ‚˚ÒÓÍÓÔÓ‰ÛÍÚË‚Ì˚ı ÍÓÓ‚ ÔÓ ÔÂËÓ‰‡Ï ·ÍÚ‡ˆËË
Ë ÒÛıÓÒÚÓfl Ó͇Á˚‚‡Î‡ ÔÓÎÓÊËÚÂθÌÓ ‚ÎËflÌË ̇
ÙËÁËÓÎӄ˘ÂÒÍÓ ÒÓÒÚÓflÌË ÊË‚ÓÚÌ˚ı Ë ·ËÓıËÏ˘ÂÒÍË ÔÓ͇Á‡ÚÂÎË ÍÓ‚Ë ‚ Ëı Ó„‡ÌËÁÏÂ, ‡
Ú‡ÍÊ ӷÏÂÌ ‚¢ÂÒÚ‚, ‚ ˜‡ÒÚÌÓÒÚË, ˝ÌÂ„ÂÚ˘ÂÒÍËÈ, ·ÂÎÍÓ‚˚È, ۄ΂ӉÌ˚È Ë ÏËÌÂ‡Î¸Ì˚È.
ç‡ ÓÒÌÓ‚‡ÌËË ˝ÚËı Ë ÏÌÓ„Ëı ‰Û„Ëı Ôӂ‰ÂÌÌ˚ı ËÒÒΉӂ‡ÌËÈ ‚ ‚Â‰Û˘Ëı ıÓÁflÈÒÚ‚‡ı ãÂÌËÌ„‡‰ÒÍÓÈ Ó·Î‡ÒÚË ·˚ÎË ÛÒÓ‚Â¯ÂÌÒÚ‚Ó‚‡Ì˚ ÌÓχÚË‚˚ ·ËÓıËÏ˘ÂÒÍËı ÔÓ͇Á‡ÚÂÎÂÈ ÍÓ‚Ë Û ÍÎËÌ˘ÂÒÍË Á‰ÓÓ‚˚ı ÍÓÓ‚ ÔÓ Ó·˘ÂÏÛ ·ÂÎÍÛ, „βÍÓÁÂ,
ÍÂÚÓÌÓ‚˚Ï Ú·Ï, Ó·˘ÂÏÛ ÈÓ‰Û.
퇷Îˈ‡ 6. ÅËÓıËÏ˘ÂÒÍË ÔÓ͇Á‡ÚÂÎË ÍÓ‚Ë Ë ÏÓÎÓ͇ ÔÓ‰ÓÔ˚ÚÌ˚ı ÍÓÓ‚
‚ Ô‡ÒڷˢÌ˚È ÔÂËÓ‰
44
èÓ͇Á‡ÚÂÎË
äÓ‚¸
åÓÎÓÍÓ
é·˘ËÈ ·ÂÎÓÍ, „%
9,34 ± 0,13
—
Äθ·ÛÏËÌ, „ %
3,37 ± 0,08
—
ÉÎÓ·ÛÎËÌ, „ %
5,97 ± 0,17
—
Ä/É
0,56
—
ÉβÍÓÁ‡, ÏÏÓθ/Î
3,03 ± 0,13
—
ä‡Î¸ˆËÈ, Ï„ %
11,80 ± 0,26
—
ë‡ : ê
2,34:1
—
âÓ‰, ÏÍ„ %
6,70 ± 0,30
82,40 ± 6,20
ä‡ÓÚËÌ, Ï„ %
0,99 ± 0,06
—
Л. В. Романенко и др. ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 45
Рубрика: Генетика и разведение животных
Литература
1. ÇÓ΄ËÌ Ç. à., ÅË·ËÍÓ‚‡ Ä. ë., êÓχÌÂÌÍÓ ã. Ç., åÓÓÁÓ‚ ç. ç. ëËÒÚÂχ ÍÓÏÎÂÌËfl ‚˚ÒÓÍÓÔÓ‰ÛÍÚË‚Ì˚ı ÍÓÓ‚. — áÓÓÚÂıÌËfl — 2000„. — ‹ 8. — ë.16–18.
2. ÇÓ΄ËÌ Ç. à. ÇÎËflÌË ҇ı‡‡ Ë Í‡ÓÚË̇ Ú‡‚flÌ˚ı ÍÓÏÓ‚ ̇ ÏÓÎÓ˜ÌÛ˛ ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸ ÍÓÓ‚. //ëÂÎÂ͈ËÓÌÌÓ-„ÂÌÂÚ˘ÂÒÍË ÏÂÚÓ‰˚ ÔÓ‚˚¯ÂÌËfl ÔÓ‰ÛÍÚË‚ÌÓÒÚË ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı./ë·.
̇ۘ. Ú. ÇçààÉêÜ, — ë.-è·., 2004. — ë.93–94.
3. ÇÓ΄ËÌ Ç. à., ÅË·ËÍÓ‚‡ Ä. ë., êÓχÌÂÌÍÓ ã. Ç. éÔÚËÏËÁ‡ˆËfl ÔËÚ‡ÌËfl ‚˚ÒÓÍÓÔÓ‰ÛÍÚË‚Ì˚ı ÍÓÓ‚.
//ÜË‚ÓÚÌÓ‚Ó‰ÒÚ‚Ó êÓÒÒËË. — ‹ 3. — 2005. — ë.27–28.
4. ê‡ÎËÁ‡ˆËfl „ÂÌÂÚ˘ÂÒÍÓ„Ó ÔÓÚÂ̈ˇ· ÔÓ‰ÛÍÚË‚ÌÓÒÚË ‚ ÏÓÎÓ˜ÌÓÏ ÒÍÓÚÓ‚Ó‰Òڂ ̇ ÓÒÌÓ‚Â ÓÔÚËÏËÁ‡ˆËË
ÒËÒÚÂÏ˚ ÍÓÏÎÂÌËfl (ÂÍÓÏẨ‡ˆËË)/ÇÓ΄ËÌ Ç. à., èÓıÓÂÌÍÓ è. ç., êÓχÌÂÌÍÓ ã. Ç., ÅË·ËÍÓ‚‡ Ä. ë.,
î‰ÓÓ‚‡ á. ã. Ë ‰. å.:åëïêî îÉçì «êÓÒËÌÙÓχ„ÓÚÂı», 2006. 36 Ò.
5. êÓχÌÂÌÍÓ ã. Ç. éÔÚËÏËÁ‡ˆËfl ÍÓÏÎÂÌËfl ‚˚ÒÓÍÓÔÓ‰ÛÍÚË‚Ì˚ı „ÓίÚËÌËÁËÓ‚‡ÌÌ˚ı ÍÓÓ‚ ˜ÂÌÓÔÂÒÚÓÈ ÔÓÓ‰˚. Ä‚ÚÓÂÙÂ‡Ú ‰ËÒÒÂÚ‡ˆËË Ì‡ ÒÓËÒ͇ÌË ۘÂÌÓÈ ÒÚÂÔÂÌË ‰ÓÍÚÓ‡ ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ̇ÛÍ — ÇÂÎËÍËÈ çÓ‚„ÓÓ‰ — 2009 „. — 41 Ò.
Romanenko L. V., Volgin V. I., Fedorova Z. L.
Carbohydrate nutrition of cows with milk production in 9000 kg
and higher per lactation
Abstract. The present article includes a research on carbohydrate diet of high-productive cows, feed rations,
the biochemical composition of the blood and milk by seasons of year.
Key words: heifers, ration, biochemistry of blood and milk, seasons.
Authors:
Romanenko Lidiya — PhD, researcher, Russian Research Institute for Farm Animal Genetics & Breeding;
Volgin Vasiliy — PhD, Professor, Academic of RAE, head of nutrition’laboratory of Russian Research Institute
for Farm Animal Genetics & Breeding;
Fedorova Zoya — PhD, researcher, Russian Research Institute for Farm Animal Genetics & Breeding,
Углеводное питание коров с удоем 9000 кг молока за лактацию и выше
45
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 46
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
4/2014
УДК 636.22/28.084.523
Б. И. Протасов, В. И. Волгин, К. В. Племяшов, И. М. Комиссаров
Об одном из приемов совершенствования эффективности
кормления жвачных
Аннотация. Сравнительно новым приемом в кормлении жвачных является использование минерально-витаминных болюсов. Замена содержащихся в них низко-биодоступных микроэлементов на высокобиодоступные, а синтетических жирорастворимых витаминов на концентраты экстрактов растений, отличающихся антиоксидантным, гормонопоэтическим, лактотропным, гонадотропным и иммуннопротекторным свойством повышает их лактогенное влияние у высокопродуктивных коров.
Ключевые слова: болюс, концентрат экстракта корня элеутерококка колючего, концентрат настойки
эхинацеи пурпурной, шрот эхинацеи пурпурной, низко-биодоступные и высоко-биодоступные микроэлементы, молочная продуктивность коров.
Авторы:
Протасов Борис Иванович — ведущий научный сотрудник лаборатории кормления высокопродуктивных животных ФГБНУ ВНИИГРЖ д.б.н., профессор,e-mail: [email protected];
Волгин Василий Ильич — заведующий лабораторией кормления высокопродуктивных животных
ФГБНУ ВНИИГРЖ, д. с.-х. н., профессор, заслуженный деятель науки РФ;
Племяшов Кирилл Владимирович — директор ФГБНУ ВНИИГРЖ, д.в.н., профессор e-mail: [email protected];
Комиссаров И. М. — ст.н.с. лаборатории, к.б.н.
ǂ‰ÂÌËÂ. ì Ê‚‡˜Ì˚ı ÊË‚ÓÚÌ˚ı ËÌÚÂÌÒË‚ÌÓÒÚ¸
Ôˢ‚‡ÂÌËfl ‚ ÒÛ˘ÂÒÚ‚ÂÌÌÓÈ ÒÚÂÔÂÌË ÓÔ‰ÂÎflÂÚÒfl ‡ÍÚË‚ÌÓÒÚ¸˛ ÏËÍÓÙÎÓ˚ Ô‰ÊÂÎÛ‰ÍÓ‚. éÚ
˝ÚÓ„Ó Á‡‚ËÒËÚ ÔÓÎÌÓÚ‡ ÛÒ‚ÓflÂÏÓÒÚË ÏËÍÓ- Ë Ï‡ÍÓ˝ÎÂÏÂÌÚÓ‚, ‚ËÚ‡ÏËÌÓ‚ Ë ‰Û„Ëı ‚‡ÊÌ˚ı ·ËÓÎӄ˘ÂÒÍË ‡ÍÚË‚Ì˚ı ÍÓÏÔÓÌÂÌÚÓ‚ ÍÓÏÓ‚. óÚÓ·˚
ÒÌËÁËÚ¸ ˝ÚÛ Á‡‚ËÒËÏÓÒÚ¸, Á‡ Û·ÂÊÓÏ ‡Á‡·ÓÚ‡Ì
Ò‡‚ÌËÚÂθÌÓ ÌÓ‚˚È ÔËÂÏ — ‚‚‰ÂÌË ‚‡ÊÌÂȯËı
ÏËÍÓ- Ë Ï‡ÍÓ˝ÎÂÏÂÌÚÓ‚, ‚ËÚ‡ÏËÌÓ‚, ÙÂÏÂÌÚÓ‚
Ë ‰Û„Ëı ·ËÓÎӄ˘ÂÒÍË ‡ÍÚË‚Ì˚ı ÔÂÔ‡‡ÚÓ‚ ÌÂÔÓÒ‰ÒÚ‚ÂÌÌÓ ‚ ۷ˆ ‚ ‚Ë‰Â Ú‡Í Ì‡Á˚‚‡ÂÏ˚ı ·ÓβÒÓ‚. ÅÓβÒ˚ Ô‰ÒÚ‡‚Îfl˛Ú ÒÓ·ÓÈ Í‡ÔÒÛÎ˚ ‰ÎËÌÓÈ
10–12 ÒÏ, ‰Ë‡ÏÂÚÓÏ 3,5–5 ÒÏ Ë ‚ÂÒÓÏ ‚ Ô‰Â·ı 100–110 „, ̇ÔÓÎÌÂÌÌ˚ ‚‡ÊÌÂȯËÏË ‰Îfl
ÊË‚ÓÚÌÓ„Ó ÏËÍÓ- Ë Ï‡ÍÓ˝ÎÂÏÂÌÚ‡ÏË, ‚ËÚ‡ÏË̇ÏË, ÙÂÏÂÌÚ‡ÏË Ë ‰Û„ËÏË ·ËÓÎӄ˘ÂÒÍË ‚‡ÊÌ˚ÏË
ÍÓÏÔÓÌÂÌÚ‡ÏË. èÓËÁ‚Ó‰flÚÒfl ·ÓβÒ˚ ÛÚËÎËÁËÛ˛˘ËÂÒfl ‚ Ó„‡ÌËÁÏ ‚ Ú˜ÂÌË ÒÛÚÓÍ Ë ÔÓÎÓÌ„ËÓ‚‡ÌÌÓ„Ó ‰ÂÈÒÚ‚Ëfl ‚ÔÎÓÚ¸ ‰Ó 180 ‰ÌÂÈ. ÑÓ͇Á‡ÌÓ Ëı
ÒÛ˘ÂÒÚ‚ÂÌÌÓ ÔÓÎÓÊËÚÂθÌÓ ‚ÎËflÌË ̇ Ó·ÏÂÌÌ˚Â
ÔÓˆÂÒÒ˚ Û ‚˚ÒÓÍÓÔÓ‰ÛÍÚË‚Ì˚ı ÍÓÓ‚ [1, 2, 3].
çÂÔÓÒ‰ÒÚ‚ÂÌÌÓ ‚ ۷ˆ ÊË‚ÓÚÌÓ„Ó ÓÌË ‚‚Ó‰flÚÒfl
Ò ÔÓÏÓ˘¸˛ ÒÔˆˇθÌ˚ı ‡ÔÔÎË͇ÚÓÓ‚. êÛ·ˆÓ‚ÓÈ ÔÂËÒڇθÚËÍÓÈ ÓÌË ÔÂÂÏ¢‡˛ÚÒfl ‚ ÒÂÚÍÛ,
„‰Â Ë Ì‡ıÓ‰flÚÒfl ‚ÂÒ¸ ÔÂËÓ‰ ‡ÒÚ‚ÓÂÌËfl, Ó·ÂÒÔ˜˂‡fl, Ú‡ÍËÏ Ó·‡ÁÓÏ, ÔÓÒÚÛÔÎÂÌË Ëı ÒÓ‰ÂÊËÏÓ„Ó ÌÂÔÓÒ‰ÒÚ‚ÂÌÌÓ ‚ ÍÓ‚flÌÓ ÛÒÎÓ, ‚ Á̇˜ËÚÂθÌÓÈ ÒÚÂÔÂÌË ÏËÌÛfl ÛÚËÎËÁ‡ˆË˛ ÒÓ‰ÂÊËÏÓ„Ó
Û·ˆÓ‚ÓÈ ÏËÍÓÙÎÓÓÈ. Ç ÌÂÍÓÚÓ˚ı Òڇ̉‡Ú-
46
Ì˚ı ËÏÔÓÚÌ˚ı ·ÓÎ˛Ò‡ı, ‚ ˜‡ÒÚÌÓÒÚË, ‚ „Óη̉ÒÍÓÏ — «ùÌÂ‰ÊË», ÒÛÚÓ˜ÌÓÈ ÔÓ‰ÓÎÊËÚÂθÌÓÒÚË ‰ÂÈÒÚ‚Ëfl ‚ Ó„‡ÌËÁÏÂ, ÛÒÚ‡ÌÓ‚ÎÂÌÓ ÒÓ‰ÂʇÌËÂ
̉ÓÒÚ‡ÚÓ˜ÌÓ ‡ÍÚË‚Ì˚ı ÍÓÏÔÓÌÂÌÚÓ‚. Ç ˜‡ÒÚÌÓÒÚË,
˝ÚÓ ÌÂÍÓÚÓ˚ ÌËÁÍÓ-·ËÓ‰ÓÒÚÛÔÌ˚ ÏËÍÓ˝ÎÂÏÂÌÚ˚ Ë ÒËÌÚÂÚ˘ÂÒÍË ÊËÓ‡ÒÚ‚ÓËÏ˚ ‚ËÚ‡ÏËÌ˚,
ËÁ‚ÂÒÚÌ˚ χÎÓÈ ·ËÓÎӄ˘ÂÒÍÓÈ ‡ÍÚË‚ÌÓÒÚ¸˛ [4].
Ç Ì‡¯Ëı ËÒÒΉӂ‡ÌËflı ·˚· ÔÓÒÚ‡‚ÎÂ̇ Á‡‰‡˜‡ —
ËÁÛ˜ËÚ¸ ‚ÓÁÏÓÊÌÓÒÚ¸ Á‡ÏÂÌ˚ ÏËÍÓ˝ÎÂÏÂÌÚÓ‚ ÌËÁÍÓÈ ·ËÓ‰ÓÒÚÛÔÌÓÒÚË Ì‡ ‚˚ÒÓÍÓ-·ËÓ‰ÓÒÚÛÔÌ˚Â, ‡ ÒËÌÚÂÚ˘ÂÒÍËı ‚ËÚ‡ÏËÌÓ‚ — ̇ ÍÓ̈ÂÌÚ‡Ú˚ ÒÔËÚÓ‚˚ı ˝ÍÒÚ‡ÍÚÓ‚ ‡ÒÚÂÌËÈ, Ò ‰Ó͇Á‡ÌÌÓÈ Ì‡¯ËÏË
ÓÔ˚Ú‡ÏË ‚˚ÒÓÍÓÈ Î‡ÍÚÓ„ÂÌÌÓÈ, „Ó̇‰ÓÚÓÔÌÓÈ
ËËÏÏÛÌÌÓÍÓÂÍÚÓÌÓÈ ‡ÍÚË‚ÌÓÒÚ¸˛. Ç ˜‡ÒÚÌÓÒÚË, ˝ÚÓ ÔÂÔ‡‡Ú˚ ËÁ ÍÓÌfl ˝ÎÂÛÚÂÓÍÓÍ͇ ÍÓβ˜Â„Ó [5–9]. ì ÌËı ӷ̇ÛÊÂÌÓ ÒÚËÏÛÎËÛ˛˘ÂÂ
‚ÎËflÌË ̇ ‡‰ÂÌÓ„ËÔÓÙËÁ‡ÌÛ˛ ÒÂÍÂˆË˛ Ú‡ÍËı
·ÍÚÓ„ÂÌÌ˚ı „ÓÏÓÌÓ‚ Í‡Í ÒÓχÚÓÚÓÔÌ˚È, ÔÓ·ÍÚËÌ, ‡ Ú‡ÍÊ ̇ ÒÂÍÂˆË˛ Ó‰ÌÓ„Ó ËÁ ‚‡ÊÌÂȯËı
ÔÓÎÓ‚˚ı „ÓÏÓÌÓ‚ — ÔÓ„ÂÒÚÂÓ̇ [10, 11, 12].
ÇÚÓ˚Ï ·ËÓÎӄ˘ÂÒÍË ‡ÍÚË‚Ì˚Ï ÔÂÔ‡‡ÚÓÏ, ÍÓ̈ÂÌÚ‡Ú ÍÓÚÓÓ„Ó ‚‚Ó‰ËÎÒfl ‚ ·ÓβÒ, ·˚· ̇ÒÚÓÈ͇ ˝ıË̇ˆÂË ÔÛÔÛÌÓÈ, Ò‡‚ÌËÚÂθÌÓ Ì‰‡‚ÌÓ
ÒÚ‡‚¯‡fl Ô‰ÏÂÚÓÏ ÔËÒڇθÌÓ„Ó ËÌÚÂÂÒ‡ ˝ÍÒÔÂËÏÂÌÚ‡ÚÓÓ‚ Ë ‚ ̇¯Ëı ÓÔ˚Ú‡ı ÔÓ͇Á‡‚¯‡fl
ÒÚËÏÛÎËÛ˛˘Â ‚ÎËflÌË ̇ ·ÍÚ‡ˆËÓÌÌÛ˛ Ë ‚ÓÒÔÓËÁ‚Ó‰ËÚÂθÌÛ˛ ÙÛÌÍˆË˛ Û ÍÓÓ‚. Ç ˝ıË̇ˆÂÂ
ӷ̇ÛÊÂÌÓ ÒËθÌ˚ ‡ÌÚËÓÍÒˉ‡ÌÚÌ˚Â, ËÏÏÛÌÌÓÔÓÚÂÍÚÓÌ˚Â, ·‡ÍÚÂˈˉÌ˚Â, ‡‰‡ÔÚÓ„ÂÌÌ˚Â
Б. И. Протасов и др. ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 47
Рубрика: Генетика и разведение животных
Ò‚ÓÈÒÚ‚‡ Ë ˆÂÎËÚÂθÌÓ ‚ÎËflÌË ̇ ·ÓÎÂÁÌË ÂÔÓ‰ÛÍÚË‚Ì˚ı Ó„‡ÌÓ‚ [13, 14, 17 Ë ‰.].
Ç ËÒÒΉӂ‡ÌËflı ÛÒÚ‡ÌÓ‚ÎÂÌÓ, ˜ÚÓ ˝ÙÙÂÍÚË‚ÌÓÒÚ¸ ÔÂÔ‡‡ÚÓ‚ ‡‰‡ÔÚÓ„ÂÌÌÓ„Ó Ò‚ÓÈÒÚ‚‡ ÒÛ˘ÂÒÚ‚ÂÌÌÓ ‚ÓÁ‡ÒÚ‡ÂÚ ÔË ÔËÏÂÌÂÌËË Ëı ‚ ÔÂÂıÓ‰Ì˚ ÔÂËÓ‰˚ ÙÓÏËÓ‚‡ÌËfl Ë ÙÛÌ͈ËÓ̇θÌÓ„Ó
ÒÚ‡ÌÓ‚ÎÂÌËfl Ó„‡ÌÓ‚ Ë ÒËÒÚÂÏ Ó„‡ÌËÁχ, Ò‚flÁ‡ÌÌ˚ı Ë ÓÔ‰ÂÎfl˛˘Ëı ‡ÎËÁ‡ˆË˛ ıÓÁflÈÒÚ‚ÂÌÌÓÔÓÎÂÁÌ˚ı ÔËÁ̇ÍÓ‚ ÊË‚ÓÚÌÓ„Ó [9]. èÓ‰Ó·Ì˚Â
ÔÂËÓ‰˚ Ò͇˜ÍÓÓ·‡ÁÌ˚ı ÔÂÂÒÚÓÂÍ Ó·ÏÂÌÌ˚ı
ÔÓˆÂÒÒÓ‚ ̇Á˚‚‡˛Ú «‰ÓÏË̇ÌÚÌ˚ÏË» [18], «ÔÂÂÎÓÏÌ˚ÏË» [19] Ë «ÍËÚ˘ÂÒÍËÏË Ù‡Á‡ÏË» [20].
Ç Ú‡ÍË ÒÚ‡‰ËË ‡Á‚ËÚËfl ÛÒÍÓÂÌÌÓ ÏÂÌfl˛ÚÒfl ÚÓÙ˘ÂÒÍË ÔÓˆÂÒÒ˚ Ë ÒÔÓÒÓ· ÔÂÂ‡·ÓÚÍË Ô·ÒÚ˘ÂÒÍËı Ò‰ÒÚ‚, ÔÓËÒıÓ‰ËÚ ÛÒÚ‡Ìӂ͇ „ÂÌÂÚ˘ÂÒÍÓÈ
ÔÓ„‡ÏÏ˚ ̇ ·Û‰Û˘Â ‡Á‚ËÚËÂ, ‰ÂÒËÌıÓÌËÁ‡ˆËfl ·ËÓÎӄ˘ÂÒÍËı ËÚÏÓ‚ ÓÒÚ‡, ‡Á‚ËÚË Ó„‡ÌÓ‚ Ë ÒËÒÚÂÏ Ó„‡ÌËÁχ, ÔÓ‚˚¯ÂÌË ˜Û‚ÒÚ‚ËÚÂθÌÓÒÚË ÍÎÂÚÓÍ Í ÒÚËÏÛÎËÛ˛˘ËÏ Ë ÚÓÏÓÁfl˘ËÏ
‚ÓÁ‰ÂÈÒÚ‚ËflÏ [17]. é‰ÌËÏ ËÁ ÔËÏÂÓ‚ ‰ÓÏË̇ÌÚÌÓ„Ó ÒÓÒÚÓflÌËfl Û ÏÎÂÍÓÔËÚ‡˛˘Ëı fl‚ÎflÂÚÒfl ‡ÌÌËÈ ÔÓÒÎÂÓ‰Ó‚ÓÈ ÔÂËÓ‰, Ú‡ÍÚÛÂÏ˚È Í‡Í «Î‡ÍÚ‡ˆËÓÌ̇fl ‰ÓÏË̇ÌÚ‡ [15,21]. ÑÎfl ÔËÏÂÌÂÌËfl
ÒÚËÏÛÎËÛ˛˘Ëı ÔÂÔ‡‡ÚÓ‚ ˝ÚÓÚ ÔÂËÓ‰ ̇˷ÓΠÔÎÓ‰ÓÚ‚ÓÂÌ, ˜ÚÓ ‰Ó͇Á‡ÌÓ ‚ ̇¯Ëı ˝ÍÒÔÂËÏÂÌÚ‡ı, ̇ۘÌÓ-ıÓÁflÈÒÚ‚ÂÌÌ˚ı ÓÔ˚Ú‡ı Ë ‚ ıÓÁ‰Ó„Ó‚ÓÌ˚ı ‡·ÓÚ‡ı Ò ‚̉ÂÌËÂÏ ‡Á‡·ÓÚ‡ÌÌÓ„Ó
ÒÔÓÒÓ·‡ [22] ‚ ÔÓËÁ‚Ó‰ÒÚ‚Ó Û ‡ÁÌ˚ı ‚ˉӂ ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı [6-12].
ùÍÒÔÂËÏÂÌÚ˚ ÔÓ‚Ó‰ËÎË Ì‡ ÏÓÎÓ˜ÌÓ-ÚÓ‚‡ÌÓÏ
ÍÓÏÔÎÂÍÒÂ Ò ÔË‚flÁÌ˚Ï ÒÓ‰ÂʇÌËÂÏ «èÛ‰ÓÏfl„Ë» áÄé «ë·‚flÌ͇ å», ɇژËÌÒÍÓ„Ó ‡ÈÓ̇ ãÂÌËÌ„‡‰ÒÍÓÈ Ó·Î‡ÒÚË Ì‡ ÍÓÓ‚‡ı ˜ÂÌÓ-ÔÂÒÚÓÈ
ÔÓÓ‰˚ Ò ‡ÁÌÓÈ ÍÓ‚ÌÓÒÚ¸˛ ÔÓ „ÓίÚËÌÒÍÓÈ ÔÓÓ‰Â, ÒÓ Ò‰ÌÂÈ ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸˛ ÒÚ‡‰‡ 7300 Í„
ÏÓÎÓ͇ ̇ ÍÓÓ‚Û. ÅÓβÒ˚ ÍÓÓ‚‡Ï ‚‚Ó‰ËÎË Ì‡
2–3-È ‰ÌË ÔÓÒΠÓÚ·. Ç‚Ó‰ËÎË ‰‚‡Ê‰˚, Ò ËÌÚÂ‚‡ÎÓÏ 2–3 ‰Ìfl. àÒÔ˚Ú˚‚‡ÎË Ë Ó‰ÌÓ‚ÂÏÂÌÌÓ ‚‚‰ÂÌË 2-ı ·ÓβÒÓ‚.
èӂ‰ÂÌÓ ‰‚‡ ÓÔ˚Ú‡. Ç ÔÂ‚ÓÏ ÓÔ˚Ú (ÛÒÚ‡ÌÓ‚Ó˜ÌÓÏ) ÔÓËÁ‚Ó‰ËÎÓÒ¸ Ò‡‚ÌÂÌË ˝ÙÙÂÍÚË‚ÌÓÒÚË
ËÏÔÓÚÌ˚ı ·ÓβÒÓ‚ Ò ·ÓÎ˛Ò‡ÏË Ì‡¯ÂÈ ˆÂÔÚÛ˚.
Ç ÔÓ‚ÚÓÌÓÏ ÓÔ˚Ú ̇ ‡‰ÂÍ‚‡ÚÌÓÏ ÔÓ ˜ËÒÎÂÌÌÓÒÚË
ÔÓ„ÓÎÓ‚¸Â ËÁÛ˜‡ÎË Î‡ÍÚÓ„ÂÌÌÛ˛ ‡ÍÚË‚ÌÓÒÚ¸ Û ·ÓβÒÓ‚, ËÁ„ÓÚÓ‚ÎÂÌÌ˚ı ÔÓ Ì‡¯ÂÈ ˆÂÔÚÛÂ Ë ÔÓ͇Á‡‚¯Ëı ‚ ÛÒÚ‡ÌÓ‚Ó˜ÌÓÏ ÓÔ˚Ú ̇˷ÓΠ‚˚ÒÓÍË ÔÓÎÓÊËÚÂθÌ˚ ÂÁÛθڇÚ˚.
é· ˝ıË̇ˆÂ ÔÛÔÛÌÓÈ, ËÒÔÓθÁÛÂÏÓÈ ÔË ÍÓÏÔÎÂÍÚÓ‚‡ÌËË ÒÓ‰ÂÊËÏÓ„Ó ·ÓÎ˛Ò‡, ËÁ‚ÂÒÚÌÓ, ˜ÚÓ
˝ÚÓ ÏÌÓ„ÓÎÂÚÌ ‡ÒÚÂÌË ÛÒÔ¯ÌÓ ÔÓËÁ‡ÒÚ‡ÂÚ
‚ ç˜ÂÌÓÁÂÏÌÓÈ ÁÓÌ ÒÚ‡Ì˚, ˜ÚÓ ‰Â·ÂÚ Â ÔÓÚÂ̈ˇθÌÓ Ì‡‰ÂÊÌ˚Ï ËÒÚÓ˜ÌËÍÓÏ Ò˚¸fl ‰Îfl ÔÓÎÛ˜ÂÌËfl ‚˚ÒÓÍÓˆÂÌÌ˚ı ÎÂ͇ÒÚ‚ÂÌÌ˚ı ÔÂÔ‡‡ÚÓ‚.
ÇҠ ˜‡ÒÚË ÒÓ‰ÂÊ‡Ú Ï‡ÒÒÛ ˆÂÌÌ˚ı ·ËÓÎӄ˘ÂÒÍË
‡ÍÚË‚Ì˚ı ‚¢ÂÒÚ‚, ‡ ‚ ÒڷΠÒÓ‰ÂÊËÚÒfl ‚ ‚˚ÒÓÍÓÈ ÍÓ̈ÂÌÚ‡ˆËË ‚ËÚ‡ÏËÌ ë. àÁ ÒÓ͇ ÒÚ·ÎÂÈ
ÏÂÚÓ‰ÓÏ ‚˚Òۯ˂‡ÌËfl ‚ÓÁÏÓÊÌÓ ÔÓÎÛ˜ÂÌË ڇ·ÎÂÚÓÍ [23], ˜ÚÓ Ó·Î„˜‡ÂÚ Á‡‰‡˜Û ËÒÔÓθÁÓ‚‡ÌËfl Ëı
‚ ËÁ„ÓÚÓ‚ÎÂÌËË ·ÓβÒÓ‚. íÓ, ˜ÚÓ ‡ÒÚÂÌË ÔË„Ó‰ÌÓ ‰Îfl ÍÛθÚË‚ËÓ‚‡ÌËfl ‚ ç˜ÂÌÓÁÂÏÌÓÈ ÁÓÌ ÒÓÁ‰‡ÂÚ ‚ÂҸχ ÔÂÒÔÂÍÚË‚Ì˚È ËÒÚÓ˜ÌËÍ ÔÓÎÛ˜ÂÌËfl ‚˚ÒÓÍÓˆÂÌÌ˚ı ÔÂÔ‡‡ÚÓ‚. Ç Ò‚flÁË Ò ÚÂÏ,
˜ÚÓ ‚ ÎËÚÂ‡ÚÛ Ì‰ÓÒÚ‡ÚÓ˜ÌÓ Ò‚Â‰ÂÌËÈ Ó ÔËÏÂÌÂÌËË ÔÂÔ‡‡ÚÓ‚ ˝ıË̇ˆÂË ÔÛÔÛÌÓÈ ‚ ÓÔ˚Ú‡ı
̇ ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı, ÔÂʉ ˜ÂÏ
ËÒÔ˚Ú˚‚‡Ú¸  ‚ ·ÓÎ˛Ò‡ı, ·˚Î Ôӂ‰ÂÌ ÓÔ˚Ú ÔÓ
ËÁÛ˜ÂÌ˲ ‚ÎËflÌËfl  ¯ÓÚ‡ ̇ ÏÓÎÓ˜ÌÛ˛ ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸ Ë ÔÓ͇Á‡ÚÂÎË ‚ÓÒÔÓËÁ‚Ó‰ËÚÂθÌÓÈ ÙÛÌ͈ËË ÔË Ò͇ÏÎË‚‡ÌËË Â„Ó ‚˚ÒÓÍÓÔÓ‰ÛÍÚË‚Ì˚Ï
ÍÓÓ‚‡Ï ‚ ÒÏÂÒË Ò ÒËÎÓÒÓÏ Ë ÒÂ̇ÊÓÏ.
àÒÔÓθÁÓ‚‡ÎË ¯ÓÚ ˝ıË̇ˆÂË ÔÛÔÛÌÓÈ, ÍÓÚÓ˚È ÔÓÎÛ˜‡ÎË Ò ë.-èÂÚÂ·Û„ÒÍÓÈ ıËÏËÍÓ-Ù‡χˆÂ‚Ú˘ÂÒÍÓÈ Ù‡·ËÍË. òÓÚ ‚˚Òۯ˂‡ÎË Ë ËÁÏÂθ˜‡ÎË ‰Ó Ô˚΂ˉÌÓ„Ó ÒÓÒÚÓflÌËfl. ë͇ÏÎË‚‡ÎË
Â„Ó ÍÓÓ‚‡Ï ‚ ÒÏÂÒË Ò ÒËÎÓÒÓÏ ËÎË ÒÂ̇ÊÓÏ ‚ ÔÂ‚˚ 10 ‰ÌÂÈ ÔÓÒΠÚ·. èÂÔ‡‡Ú ‚ ‚ˉ ¯ÓÚ‡
ËÒÔÓθÁÓ‚‡ÎË, ËÒıÓ‰fl ËÁ ÓÔ˚Ú‡ ÔËÏÂÌÂÌËfl ˝ÎÂÛÚÂÓÍÓÍÍÓ‚Ó„Ó ¯ÓÚ‡ [9]. Ç Â„Ó ˝ÍÒÚ‡ÍÚÂ, ÔÓÒÎÂ
ËÁÏÂθ˜ÂÌËfl ‰Ó Ô˚ÎÂÓ·‡ÁÌÓ„Ó ÒÓÒÚÓflÌËfl, ˝ÎÂÍÚÓÙÓÂÚ˘ÂÒÍËÏ ‡Ì‡ÎËÁÓÏ Ó·Ì‡ÛÊË‚‡ÎËÒ¸ ÒΉ˚ ˝ÎÂÛÚÂÓÁˉӂ. Ç ÓÔ˚Ú‡ı ̇ ÏÓÎÓ˜ÌÓ-ÚÓ‚‡ÌÓÈ
ÙÂÏ «èÛ‰ÓÏfl„Ë», ‡ ÔÓÁÊ ‚ ÓÔ˚Ú‡ı ̇ ÙÂÏÂ
«è‡ı‡¸» ÒÓ‚ıÓÁ‡ «ÑÂÚÒÍÓÒÂθÒÍËÈ», Ò͇ÏÎË‚‡ÌËÂ Â„Ó ‚ ÒÏÂÒË Ò ÍÓ̈ÂÌÚËÓ‚‡ÌÌ˚ÏË ÍÓχÏË
ÚÂÎflÚ‡Ï ‚ 3–4-ı ÏÂÒfl˜ÌÓÏ ‚ÓÁ‡ÒÚ ÒÔÓÒÓ·ÒÚ‚Ó‚‡ÎÓ
ÔÓ‚˚¯ÂÌ˲ Ò‰ÌÂÒÛÚÓ˜Ì˚ı ÔË‚ÂÒÓ‚ Ò ‰ÎËÚÂθÌ˚Ï ÔÓÎÓÊËÚÂθÌ˚Ï ÔÓÒΉÂÈÒÚ‚ËÂÏ [8]. Ç ÛÒÚ‡ÌÓ‚Ó˜ÌÓÏ ÓÔ˚Ú ÔÓ ËÒÔ˚Ú‡Ì˲ ‚ÎËflÌËfl ̇ ÏÓÎÓ˜ÌÛ˛ ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸ ‡Á΢Ì˚ı ‚ˉӂ ·ÓβÒÓ‚
ËÒÔÓθÁÓ‚‡ÌÓ 12 ÔÓ‰ÓÔ˚ÚÌ˚ı Ë 4 ÍÓÌÚÓθÌ˚ı
ÍÓÓ‚˚. éÒÌÓ‚ÌÓÈ ÓÔ˚Ú Ôӂ‰ÂÌ Ì‡ 24 ÔÓ‰ÓÔ˚ÚÌ˚ı Ë 13 ÍÓÌÚÓθÌ˚ı ÍÓÓ‚‡ı.
êÂÁÛθڇÚ˚ ËÒÒΉӂ‡ÌËÈ Ë Ó·ÒÛʉÂÌËÂ. Ç ÔÓ‰ÓÔ˚ÚÌÛ˛ Ë ÍÓÌÚÓθÌÛ˛ „ÛÔÔ˚ ÔÓ‰·Ë‡ÎËÒ¸
‚˚ÒÓÍÓÔÓ‰ÛÍÚË‚Ì˚ ÍÓÓ‚˚. Ç˚ÒÛ¯ÂÌÌ˚È ¯ÓÚ
ËÁÏÂθ˜‡ÎË, Òϯ˂‡ÎË Ò ÒËÎÓÒÓÏ ËÎË ÒÂ̇ÊÓÏ
Ë ÔÓˆËÓÌÌÓ Á‡‰‡‚‡ÎË ‚ ÛÚÂÌÌ ÍÓÏÎÂÌË ÍÓÓ‚‡Ï ‚ Ú˜ÂÌË 10 ‰ÌÂÈ, ̇˜Ë̇fl ÒÓ ‰Ìfl ÓÚ·. í‡ÍËÂ
ÒÏÂÒË ÍÓÓ‚‡ÏË ‚ÂҸχ ÓıÓÚÌÓ ÔÓ‰‡ÎËÒ¸. ì ÍÓÓ‚ ÍÓÌÚÓÎËÓ‚‡Î‡Ò¸ ÏÓÎӘ̇fl ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸
Ë ÒÓ‰ÂʇÌË ÏÓÎÓ˜ÌÓ„Ó ÊË‡ Á‡ ·ÍÚ‡ˆË˛, ‚ ˆÂÎÓÏ. êÂÁÛθڇÚ˚ ÓÔ˚Ú‡ Ô‰ÒÚ‡‚ÎÂÌ˚ ̇ Ú‡·Î. 1.
è˂‰ÂÌÌ˚ ‰‡ÌÌ˚ ҂ˉÂÚÂθÒÚ‚Û˛Ú Ó ÚÓÏ,
˜ÚÓ ¯ÓÚ ˝ıË̇ˆÂË ÔÛÔÛÌÓÈ, ÔÓÒΠÒÔˆˇθÌÓÈ ÔÓ‰„ÓÚÓ‚ÍË Ó·Î‡‰‡ÂÚ ÒÛ˘ÂÒÚ‚ÂÌÌÓÈ Î‡ÍÚÓ„ÂÌÌÓÈ Ë „Ó̇‰ÓÚÓÔÌÓÈ ‡ÍÚË‚ÌÓÒÚ¸˛.
Ç ÛÒÚ‡ÌÓ‚Ó˜ÌÓÏ ÓÔ˚Ú ËÁÛ˜‡ÎË ˝ÙÙÂÍÚË‚ÌÓÒÚ¸
‡ÁÌ˚ı ‚ˉӂ Ë ÏÓ‰ËÙË͇ˆËÈ ·ÓβÒÓ‚. ç‡Ë·ÓÎÂÂ
˝ÙÙÂÍÚË‚Ì˚Ï Ó͇Á‡ÎÒfl ·ÓβÒ, ‡Á‡·ÓÚ‡ÌÌ˚È ÔÓ
̇¯ÂÈ ˆÂÔÚÛÂ. Ç ÒÎÂ‰Û˛˘ÂÏ ÓÔ˚Ú Ò‡‚ÌË‚‡ÎË
Â„Ó ˝ÙÙÂÍÚË‚ÌÓÒÚ¸ Ò ÍÓÌÚÓÎÂÏ (ÍÓÌÚÓθÌ˚ÏË
Ò‚ÂÒÚÌˈ‡ÏË) (Ú‡·Î. 2).
Об одном из приёмов совершенствования эффективности кормления жвачных
47
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 48
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
4/2014
퇷Îˈ‡ 1. ÇÎËflÌË Ò͇ÏÎË‚‡ÌËfl ¯ÓÚ‡ ˝ıË̇ˆÂË ÔÛÔÛÌÓÈ Ì‡ ÏÓÎÓ˜ÌÛ˛ ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸
Ë ‰ÎËÚÂθÌÓÒÚ¸ ÒÂ‚ËÒ-ÔÂËÓ‰‡ Û ÍÓÓ‚
åÓÎӘ̇fl ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸ ‚ „Ó‰,
Ô‰¯ÂÒÚ. „Ó‰Û
ÓÔ˚Ú‡ (Í„)
8643,4±86,6
Ç % Í „Ó‰Û
ÓÔ˚Ú‡ Í Ô‰¯ÂÒÚ.
åÓÎӘ̇fl ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸ ‚ „Ó‰,
Ô‰¯ÂÒÚ. „Ó‰Û
ÓÔ˚Ú‡ (Í„)
8492,1±187,6
äÓÌÚÓθÌ˚ ÍÓÓ‚˚ (n=12)
ëÂ‚ËÒ-ÔÂËÓ‰
åÓÎӘ̇fl ÔÓ± ‚ „Ó‰ ÓÔ˚Ú‡
‚ „Ó‰ Ô‰¯ÂÒÚ.
‰ÛÍÚË‚ÌÓÒÚ¸ ‚
Í Ô‰¯ÂÒÚ.
„Ó‰Û ÓÔ˚Ú‡
„Ó‰ ÓÔ˚Ú‡ (Í„)
(Í„)
(‰ÌÂÈ)
8436,7±208,6
-206,7
182,4±25,1
ëÂ‚ËÒ-ÔÂËÓ‰
‚ „Ó‰ ÓÔ˚Ú‡
(‰ÌÂÈ)
± „Ó‰ ÓÔ˚Ú‡
Í Ô‰¯ÂÒÚ.
(‰ÌÂÈ)
177,9±28,6
-4,5
-2,4
èÓ‰ÓÔ˚ÚÌ˚Â ÍÓÓ‚˚ (n=12)
ëÂ‚ËÒ-ÔÂËÓ‰
åÓÎӘ̇fl ÔÓ± ‚ „Ó‰ ÓÔ˚Ú‡
‚ „Ó‰ Ô‰¯ÂÒÚ.
‰ÛÍÚË‚ÌÓÒÚ¸ ‚
Í Ô‰¯ÂÒÚ.
„Ó‰Û ÓÔ˚Ú‡
„Ó‰ ÓÔ˚Ú‡ (Í„)
(Í„)
(‰ÌÂÈ)
9051,8±189,5
+558*
171,7±20,8
+6,6
-2,5
ëÂ‚ËÒ-ÔÂËÓ‰
‚ „Ó‰ ÓÔ˚Ú‡
(‰ÌÂÈ)
± „Ó‰ ÓÔ˚Ú‡
Í Ô‰¯ÂÒÚ.
(‰ÌÂÈ)
120,3±24,7
-51,4
-29
á‰ÂÒ¸ Ë ‚ ‰Û„Ëı Ú‡·Îˈ‡ı — ÓÚÏÂÚ͇*- ‰ÓÒÚÓ‚ÂÌ˚ ‡Á΢Ëfl ÔË ê≥0,1
퇷Îˈ‡ 2. ÇÎËflÌË ·ÓβÒÓ‚ ̇ ÏÓÎÓ˜ÌÛ˛ ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸ ÍÓÓ‚ ÔÂ‚˚ 3 ÏÂÒflˆ‡ ·ÍÚ‡ˆËË
ä΢͇ ÍÓÓ‚˚
àÌ‚. ‹
èÛ˜Ë̇
êÂÔ‡
É‡Ì¸
ч¯Â̸͇
ÅÓÚ‚‡
îË„Û‡
äÌÓÔ͇
㇄Û̇
ñ‡‚̇
ãËÎËfl
ч¯Â̸͇
Ö„ÓÁ‡
êÂÔ‡
Ç Ò‰ÌÂÏ
± ‚ %% Í Ô‰˚‰Û˘ÂÏÛ
9168
1177
11029
9111
10160
9120
10079
9145
9042
10130
10077
10231
10022
ì‰ÓÈ ‚ „Ó‰
ÓÔ˚Ú‡ (Í„)
3406
2828
3061
2475
2176
2555
2386
2592
2915
2757
2802
2804
3055
2695,5±96
„Ó‰Û
ÅÂÈ͇
9101
ëÂθ‚Ë̇
10219
îËÚ‡
11002
å‡È͇
10125
ë͇Á͇
10213
èÛ¯Ë̇
11050
ÇÂÌÂ‡
10047
ÅÂÎ͇
10196
çӘ͇
10076
èÓÎfl˜Í‡
9103
Äˉ‡
9023
äËÒ‡
11008
Ä„¸fl
11001
ÉÓÎˈ‡
11025
ÉÂÁ‡
10145
ëÏÓÓ‰‡
10195
ãËÁ‡
10058
ê‡ÁÎÛ͇
10234
Ñ˛ÊË̇
10126
êÂÚË‚‡fl
10176
îË„Û‡
10165
ÉÓ˜Ëˆ‡
11045
ëÌÂÊËÌ͇
10106
êÓÒ‡
10171
Ç Ò‰ÌÂÏ
± ‚ % Í Ô‰˚‰Û˘ÂÏÛ „Ó‰Û
± ‚ % Í ÍÓÌÚÓβ
48
ì‰ÓÈ ‚ „Ó‰ Ô‰.
„Ó‰Û ÓÔ˚Ú‡ (Í„)
äÓÌÚÓθÌ˚ ÍÓÓ‚˚
3
2930
2
2851
2
2680
3
2492
2
1981
3
2364
2
2734
3
2720
3
2936
2
2642
2
2290
2
2292
2
2740
2559,1±74,1
ã‡ÍÚ‡ˆËfl
èÓ‰ÓÔ˚ÚÌ˚Â ÍÓÓ‚˚
3
2881
2
2808
2
2639
2
2608
2
2332
2
2560
2
2746
2
2004
2
2312
3
2380
3
2112
2
3029
2
2049
2
2668
2
2072
2
2237
2
2208
2
2366
2
2184
2
2856
2
2231
2
2541
2
3056
2
2548
2472,0±60,0
3008
2971
2911
2599
2341
3293
2941
2271
2535
2725
2601
3175
2001
2912
2426
2348
2258
2669
2412
3548
2186
2547
3242
2824
2696,0±81
±„Ó‰ ÓÔ˚Ú‡
Í Ô‰. (Í„)
+150,2
+5,3
+224
+9,1
+3,8
Б. И. Протасов и др. ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 49
Рубрика: Генетика и разведение животных
Ç ÛÒÚ‡ÌÓ‚Ó˜ÌÓÏ ÓÔ˚Ú ӷ̇ÛÊÂÌÓ, ˜ÚÓ ÔÓ‰
‚ÎËflÌËÂÏ Òڇ̉‡ÚÌÓ„Ó ·ÓÎ˛Ò‡ «ùÌÂ‰ÊË» ÏÓÎӘ̇fl ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸ ÔÓ‚˚ÒË·Ҹ Û ÍÓÓ‚ ÔÓ
Ò‡‚ÌÂÌ˲ Ò Ô‰¯ÂÒÚ‚Û˛˘ËÏ „Ó‰ÓÏ Ì‡ 4,0%,
Ë Ì‡ 2,9% ÔÓ Ò‡‚ÌÂÌ˲ Ò ÍÓÌÚÓÎÂÏ, ‡ ÔÓ‰ ‚ÎËflÌËÂÏ ·ÓÎ˛Ò‡ Ò Ì‡¯ÂÈ ˆÂÔÚÛÓÈ ÒÓÓÚ‚ÂÚÒÚ‚ÂÌÌÓ
̇ 11,9% Ë Ì‡ 10,9%.
чÌÌ˚ ڇ·Î. 2 ҂ˉÂÚÂθÒÚ‚Û˛Ú Ó ÚÓÏ, ˜ÚÓ Á‡
3 ÏÂÒflˆ‡ ÓÚ ÔÓ‰ÓÔ˚ÚÌ˚ı ÍÓÓ‚ ̇‰ÓÂÌÓ ‚ Ò‰ÌÂÏ
̇ 47 ÎËÚÓ‚ ÏÓÎÓ͇ ·Óθ¯Â, ˜ÂÏ ÓÚ ÍÓÌÚÓθÌ˚ı.
ëÚÓËÏÓÒÚ¸ 2-ı ·ÓβÒÓ‚ Ò Ì‡¯ÂÈ ˆÂÔÚÛÓÈ, ËÁ‡ÒıÓ‰Ó‚‡ÌÌ˚ı ̇ Ó‰ÌÛ ÍÓÓ‚Û ÒÓÒÚ‡‚ÎflÂÚ 260 Û·ÎÂÈ. èË Ì˚̯ÌÂÈ Á‡„ÓÚÓ‚ËÚÂθÌÓÈ ÒÚÓËÏÓÒÚË
(1 Í„ ÏÓÎÓ͇ ÓÍÓÎÓ 12 Û·. Á‡ 1 Í„) ÓÍÛÔ‡ÂÏÓÒÚ¸
Á‡Ú‡Ú ·ÓΠ˜ÂÏ ÚÂıÍ‡Ú̇fl.
éÔ˚Ú˚ ÔÓ͇Á‡ÎË ˆÂÎÂÒÓÓ·‡ÁÌÓÒÚ¸ ‚˚·‡ÌÌÓ„Ó Ì‡Ô‡‚ÎÂÌËfl ÏÓ‰ÂÌËÁ‡ˆËË ·ÓβÒÓ‚ Ë ÌÂÓ·ıÓ‰ËÏÓÒÚ¸ ‰‡Î¸ÌÂȯËı ÔÓËÒÍÓ‚ ÔÓ Ëı ÒÓ‚Â¯ÂÌÒÚ‚Ó‚‡Ì˲.
ë‡‚ÌË‚‡Î‡Ò¸ ˝ÙÙÂÍÚË‚ÌÓÒÚ¸ ·ÓβÒÓ‚ ÒÓ‰Âʇ˘Ëı ‚ ͇˜ÂÒÚ‚Â ·ËÓÎӄ˘ÂÒÍË ‡ÍÚË‚ÌÓÈ ‰Ó·‡‚ÍË
ÚÓθÍÓ Ó‰ËÌ ˝ÎÂÛÚÂÓÍÓÍÍ Ë Â„Ó ÒÓ˜ÂÚ‡ÌËÂ Ò ˝ıË̇ˆÂÂÈ ÔÛÔÛÌÓÈ. êÂÁÛθڇÚ˚ ˝ÍÒÔÂËÏÂÌÚ‡ Ô‰ÒÚ‡‚ÎÂÌ˚ ̇ Ú‡·Îˈ 3.
éÔ˚Ú˚ ÔÓ͇Á‡ÎË, ˜ÚÓ ˝ıË̇ˆÂfl ÔÛÔÛ̇fl ӷ·‰‡ÂÚ ‚ÂҸχ ÒÛ˘ÂÒÚ‚ÂÌÌ˚Ï Î‡ÍÚÓ„ÂÌÌ˚Ï ‰ÂÈ-
ÒÚ‚ËÂÏ Ë ÔË ÔËÏÂÌÂÌËË ‚ ÒÓÒÚ‡‚ ·ÓÎ˛Ò‡. ùÚÓ ‰‡ÂÚ ÓÒÌÓ‚‡ÌË ‰Îfl Ôӂ‰ÂÌËfl ‰‡Î¸ÌÂȯËı ËÒÒΉӂ‡ÌËÈ ÔÓ ÓÔ‰ÂÎÂÌ˲  ҂ÓÈÒÚ‚ Û ‰Û„Ëı ‚ˉӂ
Ë ÔÓÎÓ‚ÓÁ‡ÒÚÌ˚ı „ÛÔÔ ÊË‚ÓÚÌ˚ı. è‰ÒÚ‡‚ÎflÂÚÒfl ‚ÂҸχ ÔÂÒÔÂÍÚË‚Ì˚Ï Á‡„ÓÚӂ͇  ¯ÓÚ‡ ‰Îfl
ËÒÔÓθÁÓ‚‡ÌËfl ‚ ͇˜ÂÒÚ‚Â ÍÓÏÓ‚Ó„Ó ÔÂÏËÍÒ‡ ‰Îfl
ÒÚËÏÛÎflˆËË ‚ÓÒÔÓËÁ‚Ó‰ËÚÂθÌÓÈ ÙÛÌ͈ËË Û ‚˚ÒÓÍÓÔÓ‰ÛÍÚË‚Ì˚ı ÍÓÓ‚, Û ÍÓÚÓ˚ı ˝Ú‡ ÙÛÌ͈Ëfl
ÓÒÓ·ÂÌÌÓ ˜‡ÒÚÓ ÔÓÌËÊÂ̇ [2,3].
çÓ‚‡fl ˆÂÔÚÛ‡ ·ÓÎ˛Ò‡ Ô‰ÒÚ‡‚ÎflÂÚÒfl ·ÓÎÂÂ
Ô‰ÔÓ˜ÚËÚÂθÌÓÈ ‰Îfl ‚̉ÂÌËfl ‚ ÚÂıÌÓÎӄ˲ ÔÓËÁ‚Ó‰ÒÚ‚‡ ÏÓÎÓ͇ ÔÓ Ò‡‚ÌÂÌ˲ Ò ËÏÔÓÚÌ˚Ï ·ÓβÒÓÏ «ùÌÂ‰ÊË». Ç ‰‡Î¸ÌÂȯÂÏ Ì ËÒÍβ˜ÂÌÓ
ËÁÛ˜ÂÌË ‚ ÒÓÒÚ‡‚ ·ÓβÒÓ‚ ‰Û„Ëı ËÁ‚ÂÒÚÌ˚ı ÎÂ͇ÒÚ‚ÂÌÌ˚ı ‡ÒÚÂÌËÈ Ë Ëı ÍÓÏÔÓÁˈËÈ, Í‡Í ˝ÚÓ
ÛÊ ÔÓ‚Ó‰ËÚ¸Òfl ‚ ‰Û„Ëı ̇Ô‡‚ÎÂÌËflı ËÒÒΉӂ‡ÌËÈ [16].
àÁ Ôӂ‰ÂÌÌ˚ı ËÒÒΉӂ‡ÌËÈ Ó˜Â‚Ë‰ÌÓ, ˜ÚÓ
‚‚‰ÂÌË ‰‡ÌÌÓ„Ó ÒÔÓÒÓ·‡ ÔÓ‰ÍÓÏÍË Î‡ÍÚËÛ˛˘Ëı ÍÓÓ‚ ‚ ÚÂıÌÓÎӄ˘ÂÒÍË ÒıÂÏ˚ ÔÓËÁ‚Ó‰ÒÚ‚‡
ÏÓÎÓ͇ ÒÔÓÒÓ·ÌÓ ÒÛ˘ÂÒÚ‚ÂÌÌÓ Â„Ó ÔÓ‚˚ÒËÚ¸. ç‡ ÔÓ‚ÂÒÚÍ ‰Ìfl Ôӂ‰ÂÌË ¯ËÓÍËı ÔÓËÁ‚Ó‰ÒÚ‚ÂÌÌ˚ı ËÒÔ˚Ú‡ÌËÈ ‰‡ÌÌÓ„Ó ÔËÂχ Ò ÔËÏÂÌÂÌËÂÏ
·ÓβÒÓ‚, ‡Á‡·ÓÚ‡ÌÌ˚ı ‚ ··Ó‡ÚÓËË ÍÓÏÎÂÌËfl
‚˚ÒÓÍÓÔÓ‰ÛÍÚË‚Ì˚ı ÊË‚ÓÚÌ˚ı ÇçààÉêÜ.
퇷Îˈ‡ 3. ÇÎËflÌË ·ÓβÒÓ‚ ̇ ÏÓÎÓ˜ÌÛ˛ ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸ ÍÓÓ‚ ÔÂ‚˚ 3 ÏÂÒflˆ‡ ·ÍÚ‡ˆËË
Çˉ ·ÓÎ˛Ò‡
ì‰ÓË Á‡ ÔÂ‚˚ 3 ÏÂÒflˆ‡
·ÍÚ‡ˆËË ‚ „Ó‰ Ô‰¯.
„Ó‰Û ÓÔ˚Ú‡ (Í„)
ì‰ÓË Á‡ ÔÂ‚˚ 3 ÏÂÒ.
·ÍÚ‡ˆËË ‚ „Ó‰ ÓÔ˚Ú‡
(Í„)
± ‚ % Û‰ÓÈ ‚ „Ó‰ ÓÔ˚Ú‡
ÔÓ Ò‡‚ÌÂÌ˲ Ò Ô‰¯.
äÓ̈ÂÌÚ‡Ú ˝ÍÒÚ‡ÍÚ‡
˝ÎÂÛÚÂÓÍÓÍ͇ (n-6)
2537,8±142,8
2640,33±190,1
+4,0
äÓ̈ÂÌÚ‡Ú˚ ˝ÍÒÚ‡ÍÚ‡
˝ÎÂÛÚÂÓÍÓÍ͇ Ë ˝ıË̇ˆÂË (n-18)
2439,1±54,1
2726±91,1
+11,8*
Литература
1. äÓÓ˜ÍË̇ Ö. Ä. é·ÏÂÌ ‚¢ÂÒÚ‚ Û ‚˚ÒÓÍÓÔÓ‰ÛÍÚË‚Ì˚ı ÍÓÓ‚ ÔË ‚‚‰ÂÌËË ‚ËÚ‡ÏËÌÌÓ-ÏËÌÂ‡Î¸Ì˚ı
ÍÓÏÔÎÂÍÒÓ‚ ÔÓÎÓÌ„ËÓ‚‡ÌÌÓ„Ó ‰ÂÈÒÚ‚Ëfl //ë·. ÉÂÌÂÚË͇ Ë ‡Á‚‰ÂÌË ÊË‚ÓÚÌ˚ı. ëè·. ‹1, Ò. 29–33.
2. ëÚÂÍÓθÌËÍÓ‚ Ä. Ä., èÎÂÏfl¯Ó‚ ä. Ç., äÓÓ˜ÍË̇ Ö. Ä. éÔ˚Ú ÔËÏÂÌÂÌËfl ‚ËÚ‡ÏËÌÌÓ-ÏËÌÂ‡Î¸Ì˚ı
ÔÂÔ‡‡ÚÓ‚ ÔÓÎÓÌ„ËÓ‚‡ÌÌÓ„Ó ‰ÂÈÒÚ‚Ëfl ‚ ÏÓÎÓ˜ÌÓÏ ÒÍÓÚÓ‚Ó‰ÒÚ‚Â. //ÇÓÔÓÒ˚ ÌÓχÚË‚ÌÓ-Ô‡‚Ó‚Ó„Ó
„ÛÎËÓ‚‡ÌËfl ‚ ‚ÂÚÂË̇ËË. ëè·. 2013. ‹1, Ò. 137–142.
3. ëÚÂÍÓθÌËÍÓ‚ Ä. Ä., èÎÂÏfl¯Ó‚ ä. Ç., äÓÓ˜ÍË̇ Ö. Ä. ÇÎËflÌË ‚ËÚ‡ÏËÌÌÓ-ÏËÌÂ‡Î¸Ì˚ı ·ÓβÒÓ‚
ÔÓÎÓÌ„ËÓ‚‡ÌÌÓ„Ó ‰ÂÈÒÚ‚Ëfl ̇ ·ÂÎÍÓ‚Ó-ۄ΂ӉÌ˚È Ó·ÏÂÌ ‚¢ÂÒÚ‚ ‚˚ÒÓÍÓÔÓ‰ÛÍÚË‚Ì˚ı ÍÓÓ‚ //ÇÓÔÓÒ˚ ÌÓχÚË‚ÌÓ-Ô‡‚Ó‚Ó„Ó „ÛÎËÓ‚‡ÌËfl ‚ ‚ÂÚÂË̇ËË. 2013. ëè·. ‹1, Ò.134–137.
4. êÂÍÓÏẨ‡ˆËË ÔÓ ÔËÏÂÌÂÌ˲ ÏËÌÂ‡Î¸ÌÓ-‚ËÚ‡ÏËÌÌ˚ı ·ÓβÒÓ‚ ‰Îfl ÍÛÔÌÓ„Ó Ó„‡ÚÓ„Ó ÒÍÓÚ‡. ÉÓ‰ÌÓ,2010.
5. ÇÓ΄ËÌ Ç. à., äÓÏËÒÒ‡Ó‚ à. å., èÓÚ‡ÒÓ‚ Å. à. é ÌÓ‚ÓÈ ÚÂıÌÓÎÓ„ËË ÔÓ‚˚¯ÂÌËfl ÔÓ‰ÛÍÚË‚ÌÓÒÚË
ÊË‚ÓÚÌ˚ı//«ìÒÔÂıË ÒÓ‚ÂÏÂÌÌÓ„Ó ÂÒÚÂÒÚ‚ÓÁ̇ÌËfl» å., 2009,‹ 7.
6. îËÎËÔÔÓ‚ Ç. î., á۷ˆ í. è., èÓÚ‡ÒÓ‚ Å. à., äÓÏËÒÒ‡Ó‚ à. å. ÉÂχÚÓÎӄ˘ÂÒÍË ÔÓ͇Á‡ÚÂÎË Ë ÔÓ‰ÛÍÚË‚ÌÓÒÚ¸ ÍÓÓ‚ ÔÓ‰ ‚ÎËflÌËÂÏ ˝ÎÂÛÚÂÓÍÓÍ͇ ‚ ÛÒÎÓ‚Ëflı è˜ÂÒÍÓ„Ó ë‚Â‡ //«ëÂθÒÍÓıÓÁflÈÒÚ‚ÂÌ̇fl ·ËÓÎÓ„Ëfl». å. 1988, ‹ 1, Ò.56–58.
7. îËÎËÔÔÓ‚‡ ã. Ä., èÓÚ‡ÒÓ‚ Å. à. é ·ÍÚÓ„ÂÌÌÓÏ ‰ÂÈÒÚ‚ËË ˝ÎÂÛÚÂÓÍÓÍ͇ Û ÍÓÓ‚ ‡ÁÌÓÈ ÒÚÂÒÒÓÛÒÚÓȘ˂ÓÒÚË //«åÓÎÓ˜ÌÓÂ Ë ÏflÒÌÓ ÒÍÓÚÓ‚Ó‰ÒÚ‚Ó». å. 1089, ‹ 3, Ò. 34–35.
Об одном из приёмов совершенствования эффективности кормления жвачных
49
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 50
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
4/2014
8. èÓÚ‡ÒÓ‚ Å. à., äÓÏËÒÒ‡Ó‚ å., âÓÌ„ÔËÌ„ äÒÛ. ùÎÂÛÚÂÓÍÓÍÍ — ÔÂÒÔÂÍÚË‚Ì˚È ÒÚËÏÛÎflÚÓ ÔÓ‰ÛÍÚË‚ÌÓÒÚË ÊË‚ÓÚÌ˚ı. ëè·. 2012.
9. èÓÚ‡ÒÓ‚ Å. à., äÓÏËÒÒ‡Ó‚ à. å. ëÚ‡Ú„Ëfl ÔËÏÂÌÂÌËfl ‡‰‡ÔÚÓ„ÂÌÓ‚ ‰Îfl ÒÚËÏÛÎflˆËË ÔÓ‰ÛÍÚË‚ÌÓÒÚË Û ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı// «ëÂθÒÍÓıÓÁflÈÒÚ‚ÂÌ̇fl ·ËÓÎÓ„Ëfl» å. 2012. ‹ 6, Ò.12–23.
10. èÓÚ‡ÒÓ‚ Å. à. é ·ÍÚÓ„ÂÌÌÓÏ Ò‚ÓÈÒÚ‚Â ˝ÎÂÛÚÂÓÍÓÍ͇. «ëÂθÒÍÓıÓÁflÈÒÚ‚ÂÌ̇fl ·ËÓÎÓ„Ëfl» å. 1983.,
‹ 6, Ò. 36–39.
11. äÓÏËÒÒ‡Ó‚ à. å. ÇÎËflÌË ˝ÎÂÛÚÂÓÍÓÍ͇ ̇ ÒÂÍÂˆË˛ ‚‡ÊÌÂȯËı ·ÍÚÓ„ÂÌÌ˚ı „ÓÏÓÌÓ‚. å‡ÚÂ.
ìò ÇÒÂÒÓ˛ÁÌÓ„Ó ÒËÏÔÓÁËÛχ ÔÓ ÙËÁËÓÎÓ„ËË Ë ·ËÓıËÏËË Î‡ÍÚ‡ˆËË. å. 1990. Ò. 97–98.
12. èÓÚ‡ÒÓ‚ Å. à. ëÚËÏÛÎflˆËfl ˝ÎÂÛÚÂÓÍÓÍÍÓÏ ÔÓfl‚ÎÂÌËfl ÔÓ‰ÛÍÚË‚Ì˚ı ‚ÓÁÏÓÊÌÓÒÚÂÈ Û ÍÓÓ‚ ̇
ÏÓÎÓ˜Ì˚ı ÍÓÏÔÎÂÍÒ‡ı. «ëÂθÒÍÓıÓÁflÈÒÚ‚ÂÌ̇fl ·ËÓÎÓ„Ëfl», å. 1988. ‹ 2, Ò. 34–37.
13. Éӯ‚ÓÈ í. Ä., äÓ‚‡Î¸ Ç. ç., ÇÓÌÒ͇fl ã. Ç., äÎ˯ à. ç. äÓÏ·ËÌËÓ‚‡ÌÌ˚È ÔÂÔ‡‡Ú ̇ ÓÒÌÓ‚Â
ÒÛıÓ„Ó ˝ÍÒÚ‡ÍÚ‡ ˝ıË̇ˆÂË ÔÛÔÛÌÓÈ ‰Îfl ÍÓÏÔÎÂÍÒÌÓ„Ó Î˜ÂÌËfl Ë ÔÓÙË·ÍÚËÍË ËÏÏÛÌÌÓ‰ÂÙˈËÚÌ˚ı ÒÓÒÚÓflÌËÈ. ë·. «àÌÌÓ‚‡ˆËÓÌÌ˚ ÔÓ‰ıÓ‰˚ Í ËÁÛ˜ÂÌ˲ ˝ıË̇ˆÂË». å. 2013, Ò. 130–133.
14. ïÂÒË̇ ù. à. ÇÎËflÌË Echinaceapurpurea (L) Moench ̇ ÙËÁ˘ÂÒÍÛ˛ ‡·ÓÚÓÒÔÓÒÓ·ÌÓÒÚ¸ ‚ ÛÒÎÓ‚Ëflı
ıÓÌ˘ÂÒÍÓ„Ó ¯Ûχ.
15. 剂‰‚ à. ä., 邘‡ÂÌÍÓ Ç. è. ÑË̇ÏË͇ ·ÍÚ‡ˆËË Û ÍÓÓ‚ //«ÜË‚ÓÚÌÓ‚Ó‰ÒÚ‚Ó». — å. 1987. —
‹ 5, Ò. 31–33.
16. ëËÏÓÌÓ‚‡ ç. Ç., ÑÓÓ‚ÒÍËı Ç. Ä., òÚ‡·Â„ å. Ä. ëËÏÓÌÓ‚ ç. è. ÇÎËflÌË ̇ÒÚÓfl ̇ ÓÒÌÓ‚Â Ò·Ó‡
Í‡ÔË‚˚, ·ÂÂÁ˚ Ë ÔÓ‰ÓÓÊÌË͇ ̇ ËÌÚÂÌÒË‚ÌÓÒÚ¸ ÔÓˆÂÒÒÓ‚ ÔÂÓÍÒˉ‡ˆËË ‚ ÛÒÎÓ‚Ëflı ÛθÚ‡ÙËÓÎÂÚÓ‚Ó„Ó Ó·ÎÛ˜ÂÌËfl. «ÅËÓÎÓ„Ëfl Ë Ô‡ÚÓÎÓ„Ëfl ‰˚ı‡ÌËfl». å. 2012., ‹ 7, Ò. 90–94.
17. 凈ÂÔ‡ à. Ç., ÉË„Ó¸Â‚‡ ç. î., åËÌ˯ËÌ à. î. ÇÎËflÌË ˝ıË̇ˆÂË ÔÛÔÛÌÓÈ Ì‡ ÓÍÒˉ‡ÌÚÌÛ˛
ÒËÒÚÂÏÛ ÔÓ˜ÂÍ Í˚Ò ÔË ËÌÚÓÍÒË͇ˆËË ÚÂÚ‡ıÎÓÏÂÚ‡ÌÓÏ //ïËÏËÍÓ-Ù‡χˆÂ‚Ú˘ÂÒÍËÈ ÊÛ̇Î, å.,
2012, Ú. 46, Ò. 37–38.
18. ᇷ‡ÎÛ‚ É. à. ÑÓÏË̇ÌÚÌ˚È ‚ˉ ‰ÂflÚÂθÌÓÒÚË ‚ ˝‚ÓβˆËË ÏÎÂÍÓÔËÚ‡˛˘Ëı // ÇÂÒÚÌËÍ êìÑç. å.
2001, Ò. 80–84.
19. ÅÓ„Óβ·ÒÍËÈ ë. à. é Á‡‰‡˜‡ı ÛÔ‡‚ÎÂÌËfl ÓÌÚÓ„ÂÌÂÁÓÏ Ò.-ı. ÊË‚ÓÚÌ˚ı. Ç ÍÌ. «á‡ÍÓÌÓÏÂÌÓÒÚË Ë̉˂ˉۇθÌÓ„Ó ‡Á‚ËÚËfl» //«ç‡Û͇», å., 1964., Ò. 7–10.
20. íÂθˆÓ‚ ã. à. é ‚˚‡˘Ë‚‡ÌËË ‚˚ÒÓÍÓÔÓ‰ÛÍÚË‚ÌÓ„Ó ÍÛÔÌÓ„Ó Ó„‡ÚÓ„Ó ÒÍÓÚ‡ //ÇÂÒÚÌËÍ êÄëïç.
å. 2005. ‹ 1, Ò. 82–84.
21. É‡˜Â‚ à. à., ɇ·̈‚ Ç. è. îËÁËÓÎÓ„Ëfl ·ÍÚ‡ˆËË ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı//å. «äÓÎÓÒ». 1976.
22. èÓÚ‡ÒÓ‚ Å. à. ëÔÓÒÓ· ÔÓ‚˚¯ÂÌËfl ÏÓÎÓ˜ÌÓÈ ÔÓ‰ÛÍÚË‚ÌÓÒÚË ÊË‚ÓÚÌ˚ı. è‡ÚÂÌÚ ‹854355. Å˛ÎÎÂÚÂ̸ ‹ 30.
23. ᇄÛÏÂÌÌËÍÓ‚ Ç. Å., åÓΘ‡ÌÓ‚‡ Ä. Ç., Ň·‡Â‚‡ Ö. û., èÂÚÓ‚‡ Ä. è. àÁÛ˜ÂÌË ̇ÍÓÔÎÂÌËfl ‡ÒÍÓ·ËÌÓ‚ÓÈ ÍËÒÎÓÚ˚ ‚ Ú‡‚ ˝ıË̇ˆÂË ÔÛÔÛÌÓÈ Ò‚ÂÊÂÈ Ë ‚ ÔÓ‰ÛÍÚ‡ı  ÔÂÂ‡·ÓÚÍË //ïËÏËÍÓ-Ù‡χˆÂ‚Ú˘ÂÒÍËÈ ÊÛ̇Î. å. 2014. íÓÏ 48, ‹ 10. Ò. 39–42.
Protasov B. I., Volgin V. I., Plemyashov K. V., Komissarov I. M.
About one of method of animals improvement of feeding
Abstract. In the bolyus akh of the Dutch production on i replacement of low bio available microcells on
highly bio dostuny and syntetic fatsoluble vitamins on concentrates vegetable adaptogeny action significantly
increase the influence on dairy efficiency of cows stimulating them
Keywords: bolyus, high and low bio dostuny microcells, syntetic fatsolublevitamins, cocentrates, vegetable,
adaptogeny.
Authors:
B. I. Protasov — lyding scientific worker, doctor of biological science, professor;
V. I. Volgin — shef of laboratory feeding of high level productivity animals, doctor of agricultural science;
K. V. Plemyashov — director of institute, Doctor of Veterinary Science, professor;
I. M. Komissarov — high scientific worker, doctor of biological science.
50
Б. И. Протасов и др. ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 51
Рубрика: Краткие сообщения
УДК 576.32/.36
И. Ш. Шапиев, Д. А. Буханцева, Л. Г. Мороз
Влияние сверхмалых концентраций 2-бензимидазол-1-ил1-уксусной кислоты на устойчивость сперматозоидов
при осмотическом и холодовом шоке
Аннотация. В целях поиска способов повышающих устойчивость сперматозоидов к криоконсервации
исследовали влияние 2-бензимидазол-1-ил-1-уксусной уксусной кислоты на живучесть сперматозоидов
в условиях холодового и осмотического шока. Показано что 2-бензимидазол-1-ил-1-уксусная кислота в концентрации 10–13 мМол/л повышает живучесть сперматозоидов.
Ключевые слова: сперматозоиды быков, 2-бензимидазол-1-ил-1-уксусная кислота, шок осмотический,
холодовой, приживаемость.
Авторы:
Шапиев Исмаил Шапиевич — доктор с.-х. наук, зав. отдела воспроизводства с.-х. животных, ВНИИГРЖ,
тел.: +7 (921) 655-62-47;
Буханцева Дарина Алексеевна — аспирант отдела воспроизводства, ВНИИГРЖ;
Мороз Людмила Григорьевна — кандидат биологических наук, отдел воспроизводства, ВНИИГРЖ.
ǂ‰ÂÌËÂ. çÂÒÏÓÚfl ̇ ‰ÓÒÚË„ÌÛÚ˚ ÛÒÔÂıË
‚ ӷ·ÒÚË ÍËÓÍÓÌÒÂ‚‡ˆËË ÒÔÂχÚÓÁÓˉӂ ÒÂθÒÍÓıÓÁflÈÒÚ‚ÂÌÌ˚ı ÊË‚ÓÚÌ˚ı ÔÓÒΠÁ‡ÏÓ‡ÊË‚‡ÌËfl ÒÔÂÏ˚ ·˚ÍÓ‚ 40–50% ÍÎÂÚÓÍ ÔÓ„Ë·‡ÂÚ. èÓ˝ÚÓÏÛ ÔÓËÒÍ ÒÔÓÒÓ·Ó‚, ÔÓ‚˚¯‡˛˘Ëı ÛÒÚÓȘ˂ÓÒÚ¸
ÒÔÂχÚÓÁÓˉӂ Í Á‡ÏÓ‡ÊË‚‡Ì˲, ÓÒÚ‡ÂÚÒfl ‡ÍÚۇθÌÓÈ ÔÓ·ÎÂÏÓÈ [1, 2, 3, 4]. é‰ÌËÏ ËÁ ÔÓ‰ıÓ‰Ó‚,
̇Ô‡‚ÎÂÌÌ˚ı ̇ ÔÓ‚˚¯ÂÌË ÒÓı‡ÌÌÓÒÚË ÒÔÂχÚÓÁÓˉӂ ÔÓÒΠÍËÓÍÓÌÒÂ‚‡ˆËË ÒÔÂÏ˚ fl‚ÎflÂÚÒfl ÔÓËÒÍ ‚¢ÂÒÚ‚, Û‚Â΢˂‡˛˘Ëı ÛÒÚÓȘ˂ÓÒÚ¸ ÒÔÂχÚÓÁÓˉӂ Í Á‡ÏÓ‡ÊË‚‡Ì˲. Ç ˝ÚÓÏ
ÓÚÌÓ¯ÂÌËË Ô‰ÒÚ‡‚Îfl˛Ú ËÌÚÂÂÒ ËÒÒΉӂ‡ÌËfl
ÔÓ ËÁÛ˜ÂÌ˲ ‚ÎËflÌËfl χÎ˚ı Ë Ò‚ÂıχÎ˚ı ÍÓ̈ÂÌÚ‡ˆËÈ ·ËÓÎӄ˘ÂÒÍË ‡ÍÚË‚Ì˚ı ‚¢ÂÒÚ‚ ̇
ÌÂÒÔˆËÙ˘ÂÒÍÛ˛ ÂÁËÒÚÂÌÚÌÓÒÚ¸ ÍÎÂÚÓÍ, Ú͇ÌÂÈ
Ë Ó„‡ÌËÁÏÓ‚ [5]. àÁ Ù‡ÍÚÓÓ‚, ‚ÎËfl˛˘Ëı ̇ ‚˚ÊË‚‡ÂÏÓÒÚ¸ ÒÔÂχÚÓÁÓˉӂ ÔË ÍËÓÍÓÌÒÂ‚‡ˆËË,
‚˚‰ÂÎfl˛ÚÒfl: ÛÒÚÓȘ˂ÓÒÚ¸ ÒÔÂχÚÓÁÓˉӂ Í «ıÓÎÓ‰Ó‚ÓÏÛ ¯ÓÍÛ» Ë ËÁÏÂÌÂÌËflÏ ÓÒÏÓÚ˘ÂÒÍÓ„Ó
‰‡‚ÎÂÌËfl, ‚ÓÁÌË͇˛˘Ëı ÔË ‡Á·‡‚ÎÂÌËË Ë Á‡ÏÓ‡ÊË‚‡ÌËË-ÓÚڇ˂‡ÌËË ÒÔÂÏ˚. àÁ‚ÂÒÚÌÓ, ˜ÚÓ ÔÓËÁ‚Ó‰Ì˚ ‰Ë·‡ÁÓ· ÏÓ„ÛÚ ÔÓ‚˚¯‡Ú¸ ÛÒÚÓȘ˂ÓÒÚ¸
ÍÎÂÚÓÍ Í ÔÓ‚Âʉ‡˛˘ÂÏÛ ‚ÓÁ‰ÂÈÒڂ˲ ‡Á΢Ì˚ı
Ù‡ÍÚÓÓ‚ ‚ ÌËÁÍËı ÍÓ̈ÂÌÚ‡ˆËflı [6, 7, 8]. ê‡Ì ·˚ÎÓ ÔÓ͇Á‡ÌÓ [9], ˜ÚÓ 2-·ÂÌÁËÏˉ‡ÁÓÎ-1-ËÎ1-ÛÍÒÛÒ̇fl ÍËÒÎÓÚ‡ ÔË ‰Ó·‡‚ÎÂÌËË ‚ ÒÂ‰Û ‰Îfl
‡Á·‡‚ÎÂÌËfl ÒÔÂÏ˚ ‚ ÍÓ̈ÂÌÚ‡ˆËË 10-13 åÓÎfl
Û‚Â΢˂‡ÂÚ ÊË‚Û˜ÂÒÚ¸ ÒÔÂχÚÓÁÓˉӂ. è‰ÒÚ‡‚ÎflÂÚÒfl ËÌÚÂÂÒÌ˚Ï ‰ÂÈÒÚ‚Ë ‚¢ÂÒÚ‚ ˝ÚÓ„Ó Í·ÒÒ‡ Ò‚ÂıχÎ˚ı ÍÓ̈ÂÌÚ‡ˆËflı ̇ ÛÒÚÓȘ˂ÓÒÚ¸
ÒÔÂχÚÓÁÓˉӂ ÔË ‡Á·‡‚ÎÂÌËË ÒÔÂÏ˚ ‚ Ò‰‡ı
Ò ‡ÁÌÓÈ ÓÒÏÓÎflÌÓÒÚ¸˛.
ñÂθ ËÒÒΉӂ‡ÌËÈ. àÒÒΉӂ‡Ú¸ ‚ÎËflÌË 2·ÂÌÁËÏˉ‡ÁÓÎ-1-ËÎ-1-ÛÍÒÛÒÌÓÈ ÍËÒÎÓÚ˚ ‚ ÍÓ̈ÂÌÚ-
‡ˆËË 10-13 åÓÎfl ̇ ÛÒÚÓȘ˂ÓÒÚ¸ ÒÔÂχÚÓÁÓˉӂ ·˚ÍÓ‚ ÔË ‡Á·‡‚ÎÂÌËË ÒÔÂÏ˚ Ò ‡ÁÌÓÈ ÓÒÏÓÎflÌÓÒÚ¸˛ Ë ÔË ıÓÎÓ‰Ó‚ÓÏ ¯ÓÍÂ.
å‡ÚÂË‡Î Ë ÏÂÚÓ‰˚. å‡ÚÂˇÎÓÏ ËÒÒΉӂ‡ÌËfl ÒÎÛÊË· ÒÔÂχ ·˚ÍÓ‚ îÉìè «ç‚ÒÍÓ» Ò ËÒıÓ‰ÌÓÈ ‡ÍÚË‚ÌÓÒÚ¸˛ ÓÚ 5 ‰Ó 7 ·‡ÎÎÓ‚, Ú.Â. Ì ‰ÓÔÛ˘ÂÌÌÛ˛ Í Á‡ÏÓ‡ÊË‚‡Ì˲ ‰Îfl ÔÓËÁ‚Ó‰ÒÚ‚ÂÌÌ˚ı
ˆÂÎÂÈ ÔÓ ËÒıÓ‰ÌÓÈ ‡ÍÚË‚ÌÓÒÚË. àÒÔÓθÁÓ‚‡ÎË ÏÂÚÓ‰ ‡Á‰ÂÎÂÌÌÓ„Ó ˝flÍÛÎflÚ‡. ëÓÒÚ‡‚ ÓÒÌÓ‚ÌÓÈ Ò‰˚ ‰Îfl ‡Á·‡‚ÎÂÌËfl ÒÔÂÏ˚: ·ÍÚÓÁ‡ 11,5 „, ‰ËÒÚËÎÎËÓ‚‡Ì̇fl ‚Ó‰‡ 100 Ï„, ÔË ÓÒÏÓÎflÌÓÒÚË
336 ÏåÓÎ/Î. éÒÏÓÎflÌÓÒÚ¸ Ò‰˚ ËÁÏÂÌflÎË ‚ Ô‰Â·ı 246…366 ÏMoÎ/Î Á‡ Ò˜ÂÚ ËÁÏÂÌÂÌËfl ÍÓ̈ÂÌÚ‡ˆËË Î‡ÍÚÓÁ˚.
Ç ÓÔ˚ÚÌ˚ı ‚‡ˇÌÚ‡ı ‚ ÒÂ‰Û ‰ÓÔÓÎÌËÚÂθÌÓ
‚ÌÓÒËÎË 2-·ÂÌÁËÏˉ‡ÁÓÎ-1-ËÎ-1-ÛÍÒÛÒÌÛ˛ ÍËÒÎÓÚÛ ‚ ÍÓ̈ÂÌÚ‡ˆËË 10-13åÓÎfl. èÓˆÂÌÚ ÔÓ‰‚ËÊÌ˚ı
ÍÎÂÚÓÍ, ÔÓÒΠ‡Á·‡‚ÎÂÌËfl, ÓˆÂÌË‚‡ÎÒfl Ò‡ÁÛ, ˜ÂÂÁ ˜‡Ò Ë ˜ÂÂÁ ‰‚‡ ˜‡Ò‡ ÔÓÒΠı‡ÌÂÌËfl ÔË ÚÂÏÔÂ‡ÚÛ 400ë. ïÓÎÓ‰Ó‚ÓÈ ¯ÓÍ ÒÔÂχÚÓÁÓˉӂ
‚˚Á˚‚‡ÎË ÒÌËÊÂÌËÂÏ ÚÂÏÔÂ‡ÚÛ˚ ‡Á·‡‚ÎÂÌÌÓÈ
ÒÔÂÏ˚ ÓÚ 200ë ‰Ó +40ë ‚ Ú˜ÂÌË 2 ÏËÌ. éˆÂÌÍÛ
ÒÓÒÚÓflÌËfl ÒÔÂχÚÓÁÓˉӂ ÔÓ‚Ó‰ËÎË ÏÂÚÓ‰ÓÏ
Ù‡ÁÓ‚Ó-ÍÓÌÚ‡ÒÚÌÓÈ ÏËÍÓÒÍÓÔËË.
êÂÁÛθڇÚ˚ Ë Ó·ÒÛʉÂÌËÂ. Ç ÔÂ‚ÓÈ ÒÂËË
ÓÔ˚ÚÓ‚ ËÁÛ˜‡ÎË ‚ÎËflÌË 2-·ÂÌÁËÏˉ‡ÁÓÎ-1-ËÎ-1ÛÍÒÛÒÌÓÈ ÍËÒÎÓÚ˚ ‚ ÍÓ̈ÂÌÚ‡ˆËË Ì‡ ÒÓı‡ÌÌÓÒÚ¸
ÒÔÂχÚÓÁÓˉӂ ·˚ÍÓ‚ ÔË ‡ÁÌÓÏ ÓÒÏÓÚ˘ÂÒÍÓÏ
‰‡‚ÎÂÌËË. ä‡Í ‚ˉÌÓ ËÁ Ú‡·Îˈ˚ 1 Ò‡ÁÛ ÔÓÒΠ‡Á·‡‚ÎÂÌËfl ÒÔÂÏ˚ Ò‰ÓÈ Ò ·ÓΠÌËÁÍËÏ ËÎË ‚˚ÒÓÍËÏ ÓÒÏÓÚ˘ÂÒÍËÏ ‰‡‚ÎÂÌËÂÏ, ÓÚÌÓÒËÚÂθÌÓ Ò‰˚ Ò ÓÒÏÓÎflÌÓÒÚ¸˛ 336 ÏåÓθ/Î (ËÁÓÚÓÌ˘ÌÓÈ
‰Îfl ÒÔÂÏ˚ ·˚͇), ̇·Î˛‰‡ÂÚÒfl ÂÁÍÓ ÒÌËÊÂÌËÂ
Влияние сверхмалых концентраций 2-бензимидазол-1-ил-1-уксусной кислоты
на устойчивость сперматозоидов при осмотическом и холодовом шоке
51
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 52
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
4/2014
ÔÓ‰‚ËÊÌÓÒÚË ÒÔÂχÚÓÁÓˉӂ. èË ˝ÚÓÏ ÍÓ΢ÂÒÚ‚Ó
ÔÓ‰‚ËÊÌ˚ı ÍÎÂÚÓÍ ‚ „ËÔÓÚÓÌ˘ÂÒÍÓÈ Ë „ËÔÂÚÓÌ˘ÂÒÍÓÈ Ò‰‡ı Ò 2-·ÂÌÁËÏˉ‡ÁÓÎ-1-ËÎ-1-ÛÍÒÛÒÌÓÈ ÍËÒÎÓÚÓÈ ·Óθ¯Â ˜ÂÏ ‚ Ò‰‡ı ·ÂÁ 2-·ÂÌÁËÏˉ‡ÁÓÎ-1-ËÎ1-ÛÍÒÛÒÌÓÈ-ÍËÒÎÓÚ˚.
‚ ÓÔ˚Ú ÔÓ Ò‡‚ÌÂÌ˲ ÍÓÌÚÓÎÂÏ, ‚˚¯Â ÔÓˆÂÌÚ
ÔÓ‰‚ËÊÌÓÒÚË Ë ÒÓÒÚ‡‚ÎflÂÚ 14±1,6%.
àÒÒΉӂ‡ÌË ÒÓı‡ÌÌÓÒÚË ‡ÍÓÒÓÏ˚ Ë Ê„ÛÚË͇ ÒÔÂχÚÓÁÓˉӂ, Ì ‚˚fl‚ËÎÓ ‰ÓÒÚÓ‚ÂÌ˚ı
‡Á΢ËÈ ÔÓ ‚ÎËflÌ˲ 2-·ÂÌÁËÏˉ‡ÁÓÎ-1-ËÎ-1-ÛÍÒÛÒÌÓÈ ÍËÒÎÓÚ˚ ÓÚÌÓ¯ÂÌ˲ Í ÍÓÌÚÓβ ‚Ó ‚ÒÂı
‚‡ˇÌÚ‡ı (Ú‡·Îˈ‡ 2). Ç˚fl‚ÎÂÌÓ ÚÓθÍÓ ‚ÎËflÌËÂ
ÓÒÏÓÎflÌÓÒÚË Ò‰˚ ̇ ÏÓÙÓÎӄ˘ÂÒÍÛ˛ ÒÚÛÍÚÛÛ ÍÎÂÚÓÍ.
ìÏÂ̸¯ÂÌËÂ, ËÎË Û‚Â΢ÂÌË ÓÒÏÓÎflÌÓÒÚË
Ò‰˚ ÓÚÌÓÒËÚÂθÌÓ ·‡ÁÓ‚ÓÈ (336 ÏåÓθ/Î) ̇
30 ÏåÓθ/Î, ÔË‚Ó‰ËÚ Í ÛÏÂ̸¯ÂÌ˲ ‰ÓÎË ÔÓ‰‚ËÊÌ˚ı ÍÎÂÚÓÍ Ì‡ 32–36% ÒÂ‰Â Ò ·ÂÁ 2-·ÂÌÁËÏˉ‡ÁÓÎ-1-ËÎ-1-ÛÍÒÛÒÌÓÈ ÍËÒÎÓÚÓÈ. Ç ÒÂ‰Â Ò 2-·ÂÌÁËÏˉ‡ÁÓÎ-1-ËÎ-1-ÛÍÒÛÒÌÓÈ ÍËÒÎÓÚÓÈ ‰ÓÎfl ÔÓ‰‚ËÊÌ˚ı
ÍÎÂÚÓÍ ÛÏÂ̸¯‡ÂÚÒfl ̇ 18–20%.
Ç ÒÎÂ‰Û˛˘ÂÈ ÒÂËË ÓÔ˚ÚÓ‚ ËÒÒΉӂ‡ÎË ‚ÎËflÌË 2-·ÂÌÁËÏˉ‡ÁÓÎ-1-ËÎ-1-ÛÍÒÛÒÌÓÈ ÍËÒÎÓÚ˚ ̇
ÛÒÚÓȘ˂ÓÒÚ¸ ÒÔÂχÚÓÁÓˉӂ ·˚ÍÓ‚ Í ıÓÎÓ‰Ó‚ÓÏÛ ¯ÓÍÛ (Ú‡·Îˈ‡ 3). ä‡Í ‚ˉÌÓ, ‚ ÍÓÌÚÓθÌÓÈ
Ò‰ ÔÓÒΠıÓÎÓ‰Ó‚Ó„Ó ¯Ó͇ 40% ÒÔÂχÚÓÁÓˉӂ ÓÚ Ëı ËÒıÓ‰ÌÓ„Ó ÍÓ΢ÂÒÚ‚‡ ÔÓÚÂflÎË ÔÓÒÚÛÔ‡ÚÂθÌÛ˛ ‰‚Ë„‡ÚÂθÌÛ˛ ‡ÍÚË‚ÌÓÒÚ¸, ‚ ÚÓ ‚ÂÏfl
Í‡Í ‚ ÓÔ˚ÚÌÓÈ Ò‰ ÔÓÚÂflÎË ÔÓÒÚÛÔ‡ÚÂθÌÛ˛
ÔÓ‰‚ËÊÌÓÒÚ¸ 26% ÍÎÂÚÓÍ.
èË ‡Á·‡‚ÎÂÌËË ÒÔÂÏ˚ ÔË ÚÂÏÔÂ‡ÚÛ 200ë
‚ ÒÂ‰Â Ò ÓÒÏÓÎflÌÓÒÚ¸˛ 336 ÏåÓθ/Î Ò ‰Ó·‡‚ÎÂÌËÂÏ 2-·ÂÌÁËÏˉ‡ÁÓÎ-1-ËÎ-1-ÛÍÒÛÒÌÓÈ ÍËÒÎÓÚ˚
(ÓÔ˚Ú) Ë ·ÂÁ ‰Ó·‡‚ÎÂÌËfl (ÍÓÌÚÓθ) ‡Á΢Ëfl ‚ ‡ÍÚË‚ÌÓÒÚË ÒÔÂÏ˚ Ì ‡Á΢‡ÂÚÒfl. é‰Ì‡ÍÓ ˜ÂÂÁ ˜‡Ò
Ë ˜ÂÂÁ ‰‚‡ ˜‡Ò‡ ÔÓÒΠı‡ÌÂÌËfl ÔË ÚÂÏÔÂ‡ÚÛÂ
400ë ‚ ÓÔ˚Ú ÔÓ‰‚ËÊÌÓÒÚ¸ ÒÔÂχÚÓÁÓˉӂ ÒÓÓÚ‚ÂÚÒÚ‚ÂÌÌÓ Ì‡ 12 Ë 15% ‚˚¯Â, ˜ÂÏ ‚ ÍÓÌÚÓÎÂ.
ëÓÔÓÒÚ‡‚Îflfl ‰‡ÌÌ˚ ÂÁÛθڇÚÓ‚ ÓÔ˚ÚÓ‚ ÔÓ
‚ÎËflÌ˲ 2-·ÂÌÁËÏˉ‡ÁÓÎ-1-ËÎ-1-ÛÍÒÛÒÌÓÈ ÍËÒÎÓÚ˚ ̇ ÔÂÂÊË‚‡ÂÏÓÒÚ¸ ÒÔÂχÚÓÁÓˉӂ Ë Ëı ÏÓÙÓÎӄ˲ ÔË ÓÒÏÓÚ˘ÂÒÍÓÏ Ë ıÓÎÓ‰Ó‚ÓÏ ¯ÓÍÂ
ÏÓÊÌÓ Ô‰ÔÓÎÓÊËÚ¸, ˜ÚÓ ËÒÒΉÛÂÏÓ ‚¢ÂÒÚ‚Ó
Ì Ó͇Á˚‚‡ÂÚ Ì‡·Î˛‰‡ÂÏÓ هÁÓ‚Ó-ÍÓÌÚ‡ÒÚÌÓÈ
ÏËÍÓÒÍÓÔËÂÈ Á‡˘ËÚÌÓ„Ó ‰ÂÈÒÚ‚Ëfl ̇ ÒÓı‡ÌÌÓÒÚ¸
Ç „ËÔÓÓÒÏÓÚ˘ÂÒÍËı ÛÒÎÓ‚Ëflı ˜ÂÂÁ ˜‡Ò ÔÓÒÎÂ
ı‡ÌÂÌËfl ‡Á·‡‚ÎÂÌÌÓÈ ÒÔÂÏ˚ ‚ ÍÓÌÚÓΠ̇·Î˛‰‡ÂÚÒfl ÔÓÎ̇fl „Ë·Âθ ÒÔÂχÚÓÁÓˉӂ, ‡ ‚ ÓÔ˚ÚÂ
̇·Î˛‰‡ÂÚÒfl ÒÓı‡ÌÂÌË ÔÓ‰‚ËÊÌÓÒÚË Û 6–12%
ÍÎÂÚÓÍ. Ç „ËÔÂÓÒÏÓÚ˘ÂÒÍËı ÛÒÎÓ‚Ëflı, ˜ÂÂÁ ˜‡Ò,
퇷Îˈ‡ 1. ÇÎËflÌË 2-·ÂÌÁËÏˉ‡ÁÓÎ-1-ËÎ-1-ÛÍÒÛÒÌÓÈ ÍËÒÎÓÚ˚ ‚ ÍÓ̈ÂÌÚ‡ˆËË 10-13 åÓÎfl
̇ ÒÓı‡ÌÌÓÒÚ¸ ÒÔÂχÚÓÁÓˉӂ ·˚ÍÓ‚ ÔË ‡ÁÌÓÏ ÓÒÏÓÚ˘ÂÒÍÓÏ ‰‡‚ÎÂÌËË (n=11)
éÒÏÓÎflÌÓÒÚ¸,
mMol/L
èÓˆÂÌÚ ÔÓ‰‚ËÊÌ˚ı ÍÎÂÚÓÍ ÔÓÒΠ‡Á·‡‚ÎÂÌËfl ÒÔÂÏ˚
ë‡ÁÛ ÔÓÒΠ‡Á·‡‚ÎÂÌËfl
ÍÓÌÚÓθ
ÓÔ˚Ú
366
28±4,8
336
60±3,2A
306
24±2,4b
276
246
˜ÂÂÁ ˜‡Ò
˜ÂÂÁ 2 ˜‡Ò‡
ÍÓÌÚÓθ
ÓÔ˚Ú
42±5,8
10±0,9
14±1,6
0
0
60±3,2B
29±3,7d
41±3,3d
11i±2,4
26i±3,0
40±4,4b
11±1,6e
19±2,7e
0
6±1,6
15±2,2c
31±4,0c
0
12±1,5
0
0
4±2,4*
20±3,2
0
6±1,8
0
0
‡
aa; bb; cc; dd; ee; ii; Aa; Ab; Bb; Ba
‡
*
ê<0,01;
gg
g
ÍÓÌÚÓθ
g
ÓÔ˚Ú
P<0,05
퇷Îˈ‡ 2. ÇÎËflÌË 2-·ÂÌÁËÏˉ‡ÁÓÎ-1-ËÎ-1-ÛÍÒÛÒÌÓÈ ÍËÒÎÓÚ˚ ‚ ÍÓ̈ÂÌÚ‡ˆËË 10-15
̇ ÏÓÙÓÎӄ˲ ÒÔÂχÚÓÁÓˉӂ ÔË ‡ÁÌÓÏ ÓÒÏÓÚ˘ÂÒÍÓÏ ‰‡‚ÎÂÌËË (n=11).
éÒÏÓÎflÌÓÒÚ¸,
mMol/L
365
336
307
277
248
52
LJˇÌÚ
çÓχθÌ˚Â,
%
燷Ûı¯ËÂ
‡ÓÒÓÏ˚, %
ë‚Ó·Ó‰Ì˚Â
„ÓÎÓ‚ÍË, %
èÓ‚ÂʉÂÌËÂ
Ê„ÛÚË͇, %
éÚÔ‡‚¯ËÈ
ÍÓÎÔ‡˜ÂÍ, %
ÓÔ˚Ú
44,5±1,4
11,2±1,5
3,0±0,5
24,9±0,8
15,0±0,5
ÍÓÌÚÓθ
40,7±0,8
11,8±1,3
3,1±0,6
26,6±1,2
16,5±0,8
ÓÔ˚Ú
83,6±1,2
2,4±0,6
1,4±0,5
9,0±0,4
1,9±0,5
ÍÓÌÚÓθ
83,3±1,2
2,4±0,5
1,6±0,5
9,1±0,4
2,0±0,5
ÓÔ˚Ú
37,8±1,6
14,7±1,1
2,5±0,6
30,5±1,6
13,0±1,4
ÍÓÌÚÓθ
35,5±1,6
15,6±1,0
2,6±0,7
31,1±1,3
13,6±1,4
ÓÔ˚Ú
33,7±2,0
15,4±0,9
3,6±0,6
32,0±1,9
13,9±1,4
ÍÓÌÚÓθ
31,4±1,8
15,8±0,9
3,7±0,6
33,0±1,7
14,4±1,5
ÓÔ˚Ú
30,3±2,1
16,4±1,0
5,0±0,8
31,8±1,7
15,1±1,3
ÍÓÌÚÓθ
28,2±1,9
16,6±0,6
5,3±0,9
33,6±1,5
14,8±0,8
И. Ш. Шапиев и др. ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 53
Рубрика: Краткие сообщения
퇷Îˈ‡ 3. ÇÎËflÌË 2-·ÂÌÁËÏˉ‡ÁÓÎ-1-ËÎ-1-ÛÍÒÛÒÌÓÈ ÍËÒÎÓÚ˚ ‚ ÍÓ̈ÂÌÚ‡ˆËË 10-13 ÏÓÎfl ̇
ÛÒÚÓȘ˂ÓÒÚ¸ ÒÔÂχÚÓÁÓˉӂ Í ıÓÎÓ‰Ó‚ÓÏÛ ¯ÓÍÛ (n=11)
LJˇÌÚ
èÓˆÂÌÚ ÔÓÒÚÛÔ‡ÚÂθÌÓ ÔÓ‰‚ËÊÌ˚ı ÍÎÂÚÓÍ
ÑÓ ıÓÎÓ‰Ó‚Ó„Ó ¯Ó͇
èÓÒΠıÓÎÓ‰Ó‚Ó„Ó ¯Ó͇
äÓÌÚÓθ
59± 2,8
19± 3,1
éÔ˚Ú
59± 3,5
33± 1,5*
‡ÍÓÒÓÏÌÓ„Ó ˜ÂıÎË͇ Ë ı‚ÓÒÚ‡ ÒÔÂχÚÓÁÓˉӂ.
燷≇ÂÏ˚ ‚̯ÌË ÏÓÙÓÎӄ˘ÂÒÍË ËÁÏÂÌÂÌËfl Ò‚flÁ‡Ì˚ Ò ÂÁÍËÏ ËÁÏÂÌÂÌËÂÏ ÓÒÏÓÚ˘ÂÒÍÓ„Ó
‰‡‚ÎÂÌËfl Ò‰˚ — „ËÔÂÚÓÌËÂÈ ËÎË „ËÔÓÚÓÌËÂÈ.
èË ˝ÚÓÏ Ë ÔË ËÁÏÂÌÂÌËË ÓÒÏÓÎflÌÓÒÚË ÔË ‡Á·‡‚ÎÂÌËË ÒÔÂÏ˚ Ò‰ÓÈ Ë ÔË ıÓÎÓ‰Ó‚ÓÏ ¯ÓÍÂ
2-·ÂÌÁËÏˉ‡ÁÓÎ-1-ËÎ-1 ÛÍÒÛÒ̇fl-ÍËÒÎÓÚ‡ ÔÓ‚˚¯‡ÂÚ
ÔÂÂÊË‚‡ÂÏÓÒÚ¸ ÒÔÂχÚÓÁÓˉӂ ÔË ÚÂÏÔÂ‡ÚÛÂ
400ë. åÓÊÌÓ Ô‰ÔÓÎÓÊËÚ¸, ̇·Î˛‰‡ÂÏÓ fl‚ÎÂÌË ÒÍÓ ҂flÁ‡ÌÓ Ò Á‡˘ËÚÌ˚Ï ‰ÂÈÒÚ‚ËÂÏ 2-·ÂÌÁËÏˉ‡ÁÓÎ-1-ËÎ-1-ÛÍÒÛÒÌÓÈ ÍËÒÎÓÚ˚ ̇ ÏÂÏ·‡ÌÌ˚ ÒÚÛÍÚÛ˚ ÏËÚÓıÓ̉ËÈ ÒÔÂχÚÓÁÓˉӂ.
Литература
1. Chaveiro A., Liu J., Mullen S., Woelders H. & Critser J. K. Determination of bull sperm membrane permeability to water and cryoprotectants using a concentration-dependent self-quenching fluorophore //Cryobiology 2004. ‹ 48. . 72–80.
2. Chaveiro A., Machado L., Frijters A., Engel B., Woelders H.. Improvement of parameters of freezing
medium and freezing protocol for bull sperm using two osmotic supports //Theriogenology 2006. vol. 65,
n. 9. pp. 1875–1890.
3. Amirat-Briand L., Bencharif D., Vera-Munoz O., Bel Hadj Ali H., Destrumelle S., Desherces S., Schmidt E.,
Anton M., Tainturier D. Effect of glutamine on post-thaw motility of bull spermatozoa after association
with LDL (low density lipoproteins) extender: Preliminary results // Theriogenology. — 2009. Vol. 71,
8. . 1209–121.
4. Gilmore J. A., Liu J., Gao D. Y., Critser Y. K. Determination of optimal cryoprotectans and procedurs for
their addition and removal from human spermatozoa. Hum Reprod. 1997. — 1: 112–118.
5. ÅÛ·ÍÓ‚‡ Ö. Å. éÒÓ·ÂÌÌÓÒÚË ‰ÂÈÒÚ‚Ëfl Ò‚ÂıχÎ˚ı ‰ÓÁ ·ËÓÎӄ˘ÂÒÍË ‡ÍÚË‚Ì˚ı ‚¢ÂÒÚ‚ Ë ÙËÁ˘ÂÒÍËı
Ù‡ÍÚÓÓ‚ ÌËÁÍÓÈ ËÌÚÂÌÒË‚ÌÓÒÚË //êÓÒÒËÈÒÍËÈ ıËÏ˘ÂÒÍËÈ ÊÛ̇Î, 1999. Ú. XLIII, ‹ 5, Ò. 3–11.
6. ëˉÓÓ‚ é. Ä. ÇÎËflÌË ‰Ë·‡ÁÓ· ̇ ‚ÂÏfl ÔÂÂÊË‚‡ÌËfl ÒÔÂχÚÓÁÓˉӂ //å‡ÚÂˇÎ˚ ̇ۘÌÓ„Ó Òӂ¢‡ÌËfl ÔÓ ‚ÓÔÓÒ‡Ï Ù‡ËÓÍÓÎӄ˘ÂÒÍÓÈ „ÛÎflˆËË ÍÎÂÚÓ˜ÌÓÈ ÂÁËÒÚÂÌÚÌÓÒÚË. — 1963 — Ò. 18–20.
7. Ä̉‚‡ Ö. ç. ÇÎËflÌË ‰Ë·‡ÁÓ·, ‡ Ú‡ÍÊ ÌÂÍÓÚÓ˚ı ÒÚËÏÛÎflÚÓÓ‚ Ë ËÌ„Ë·ËÚÓÓ‚ ·ÂÎÍÓ‚Ó„Ó ÒËÌÚÂÁ‡
̇ ÚÂÔÎÓÛÒÚÓȘ˂ÓÒÚ¸ ÔÓÚÌflÊÌÓÈ Ï˚¯ˆ˚ Îfl„Û¯ÍË.//ëËÌÚÂÁ ·ÂÎ͇ Ë ÂÁËÒÚÂÌÚÌÓÒÚ¸ ÍÎÂÚÓÍ, ã., 1971. —
Ò. 36–45.
8. ò‡ÔË‚ à. ò., åÓÓÁ ã. É., äÓ‚‡ÎÂÌÍÓ É. è. ÇÎËflÌË ÒËÌÚÂÚ˘ÂÒÍËı ‡ÌÚËÓÍÒˉ‡ÌÚÓ‚ Ë ÔÓËÁ‚Ó‰Ì˚ı
·ÂÌÁËÏˉ‡ÁÓ· ̇ ÓÔÎÓ‰ÓÚ‚ÓflÂÏÓÒÚ¸ Ò‚ËÌÓχÚÓÍ //Å˛ÎÎ. ÇçààÉêÜ. — ‚. 128. — 1991. Ò. 5–7.
9. ÅÛı‡ÌˆÂ‚‡ Ñ. Ä., ï‡ËÚÓÌÓ‚ ë. Ä. ÇÎËflÌË ÔÓËÁ‚Ó‰Ì˚ı ·ÂÌÁËÏˉ‡ÁÓ· ̇ ÔÂÂÊË‚‡ÂÏÓÒÚ¸ ÒÔÂχÚÓÁÓˉӂ ·˚ÍÓ‚ // å‡ÚÂ. ÍÓÌÙÂÂ̈ËË «ÉÂÌÂÚË͇ Ë ÒÂÎÂ͈Ëfl ‚ ÊË‚ÓÚÌÓ‚Ó‰Òڂ» ëè·-èÛ¯ÍËÌ. —
2011. — Ò. 184–187
Shapiev I. Sh., Buhantseva D. A., Moroz L. G.
Influence of ultra low 2-benzimidazol-1-yl-1-acetic acid concentrations on spermatozoa survival ability in osmotic and cold shock
Abstract. Influence of 2-benzimidazole-1-yl-acetic acetic acid on survival ability of cryopreserved sperm in
cold and osmotic shock was studied. It was shown that 2-benzimidazol-1-yl-1-acetic acid in concentration of
10–13 mMol / L increases the vitality of spermatozoa.
Keywords: bull sperm, 2-benzimidazole-1-yl-1-acetic acid, osmotic and cold shock, survival ability.
Authors:
Shapiev Ismail Shapievich — Dr. agric. Sci., Laboratory of Animal Reproduction, Russian research institute
of farm animal genetics and breeding, tel. 7(921) 655-62-47
Buhantseva Darina Alekseevna — post Graduate Student, Junior Researcher of Laboratory of Animal Reproduction, Russian research institute of farm animal genetics and breeding.
Moroz Ludmila Grigorjevna — candidate of Biological Sciences, Laboratory of Animal Reproduction, Russian
research institute of farm animal genetics and breeding.
Влияние сверхмалых концентраций 2-бензимидазол-1-ил-1-уксусной кислоты
на устойчивость сперматозоидов при осмотическом и холодовом шоке
53
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 54
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ Рубрика: Генетика и разведение животных
4/2014
Краткие сообщения
Рубрика
УДК 636.22/28.082
Л. В. Бондарчук
Качество спермопродукции быков-производителей
бурых пород Сумской области
Аннотация. Полученные результаты по количественным и качественным показателям спермопродукции
племенных быков бурых пород в условиях Сумского государственного селекционного центра, указывают
на то, что наилучшими показателями характеризуются быки-производители швицкой породы североамериканской селекции.
Ключевые слова: бурые породы, быки-производители, спермопродукция, качество.
Автор:
Лариса Владимировна Бондарчук — кандидат сельскохозяйственных наук, доцент, Сумский национальный аграрный университет.
ǂ‰ÂÌËÂ. ÉÂÌÂÚ˘ÂÒÍËÈ ÔÓ„ÂÒÒ ‚ ÊË‚ÓÚÌÓ‚Ó‰ÒÚ‚Â ‚ ÔÓÎÌÓÈ ÏÂ Á‡‚ËÒËÚ ÓÚ ËÒÔÓθÁÓ‚‡ÌËfl
·˚ÍÓ‚-ÔÓËÁ‚Ó‰ËÚÂÎÂÈ Ò ‚˚ÒÓÍËÏ „ÂÌÂÚ˘ÂÒÍËÏ ÔÓÚÂ̈ˇÎÓÏ. Å·„Ó‰‡fl ÏÂÚÓ‰Û ËÒÍÛÒÒÚ‚ÂÌÌÓ„Ó ÓÒÂÏÂÌÂÌËfl ÊË‚ÓÚÌ˚ı „ÎÛ·ÓÍÓÁ‡ÏÓÓÊÂÌÌÓÈ ÒÔÂÏÓÈ
‚ ÒÂÎÂ͈ËË ÍÛÔÌÓ„Ó Ó„‡ÚÓ„Ó ÒÍÓÚ‡ ÓÚ˚‚‡˛ÚÒfl
Á̇˜ËÚÂθÌ˚ ÔÂÒÔÂÍÚË‚˚. ꇈËÓ̇θÌÓ ËÒÔÓθÁÓ‚‡ÌË ÔÎÂÏÂÌÌ˚ı ·˚ÍÓ‚-ÔÓËÁ‚Ó‰ËÚÂÎÂÈ ÔÓÁ‚ÓÎflÂÚ Ì‡ÍÓÔËÚ¸ ‰ÓÒÚ‡ÚÓ˜ÌÓ ÍÓ΢ÂÒÚ‚Ó „‡ÏÂÚ
Ò ‚˚ÒÓÍËÏË ÔÓ͇Á‡ÚÂÎflÏË ‚ÓÒÔÓËÁ‚Ó‰ËÚÂθÌÓÈ
ÒÔÓÒÓ·ÌÓÒÚË.
é·ÁÓ ÎËÚÂ‡ÚÛ˚. Ç Ò‚ÓËı ËÒÒΉӂ‡ÌËflı
ç. á. ŇÒÓ‚ÒÍËÈ (1992), â. á. ëË‡ˆÍËÈ (1992),
Ç. à. ㇉˚͇ (1997), R. G. Holroyd (2002),
å. à. ҢÂÌÍÓ (2006) Ë ‰. ÓÔ‰ÂÎËÎË, ˜ÚÓ ÒÓ‰ÂʇÌËÂ, ‚˚‡˘Ë‚‡ÌËÂ Ë ˝ÙÙÂÍÚË‚ÌÓ ËÒÔÓθÁÓ‚‡ÌË ·˚ÍÓ‚-ÔÓËÁ‚Ó‰ËÚÂÎÂÈ fl‚ÎflÂÚÒfl Ô‰ÏÂÚÓÏ ÓÒÓ·Ó„Ó ‚ÌËχÌËfl ÒÂÎÂ͈ËÓÌÂÓ‚ ‚ ÛÒÎÓ‚Ëflı
ÒÍ¢˂‡ÌËfl ÔË ‚˚‚‰ÂÌËË ÌÓ‚˚ı ÔÓÓ‰ Ë ÚËÔÓ‚
ÒÍÓÚ‡. ÑÓ͇Á‡ÌÓ, ˜ÚÓ 90–95% ̇ÒΉÒÚ‚ÂÌÌÓÒÚË
ÔÓËÁ‚Ó‰ËÚÂÎÂÈ ‚ÎËflÂÚ Ì‡ „ÂÌÂÚ˘ÂÒÍÓ ÛÎÛ˜¯ÂÌË ÏÓÎÓ˜Ì˚ı ÔÓÓ‰. èÓ˝ÚÓÏÛ ÓˆÂÌ͇ ÔÎÂÏÂÌÌÓÈ
ˆÂÌÌÓÒÚË ·˚ÍÓ‚-ÔÓËÁ‚Ó‰ËÚÂÎÂÈ ‚Ó ‚ÒÂı ÒÚ‡Ì‡ı
ÏË‡ Ò ‚˚ÒÓÍÓ‡Á‚ËÚ˚Ï ÊË‚ÓÚÌÓ‚Ó‰ÒÚ‚‡Ï ‚ ÛÒÎÓ‚Ëflı ÍÛÔÌÓχүڇ·ÌÓÈ ÒÂÎÂ͈ËË ËÏÂÂÚ Ó˜Â̸ ‚‡ÊÌÓ Á̇˜ÂÌË ‰Îfl Ëı ‰‡Î¸ÌÂÈ¯Â„Ó ËÒÔÓθÁÓ‚‡ÌËfl.
ñÂθ Ë Á‡‰‡˜Ë. ì˜ËÚ˚‚‡fl ÚÓ, ˜ÚÓ „ÂÌÂÚ˘ÂÒÍËÈ
χÚÂˇΠÔÎÂÏÂÌÌ˚ı ·˚ÍÓ‚, ÍÓÚÓ˚ ̇ ÔÓÚflÊÂÌËË ‰‚‡‰ˆ‡ÚË ÔÓÒΉÌËı ÎÂÚ, ·Î‡„Ó‰‡fl ÏÂÚÓ‰Û ËÒÍÛÒÒÚ‚ÂÌÌÓ„Ó ÓÒÂÏÂÌÂÌËfl, ¯ËÓÍÓ ËÒÔÓθÁÓ‚‡ÎÒfl
‚ ıÓÁflÈÒÚ‚‡ı ‚ÒÂı ÙÓÏ ÒÓ·ÒÚ‚ÂÌÌÓÒÚË, ̇¯Ë ËÒÒΉӂ‡ÌËfl, ·˚ÎË Ì‡Ô‡‚ÎÂÌ˚ ̇ ÍÓÏÔÎÂÍÒÌÓ ËÁÛ˜ÂÌË ‚ÓÒÔÓËÁ‚Ó‰ËÚÂθÌÓÈ ÒÔÓÒÓ·ÌÓÒÚË ·˚ÍÓ‚ÔÓËÁ‚Ó‰ËÚÂÎÂÈ ·Û˚ı ÔÓÓ‰ ÔÓ Í‡˜ÂÒÚ‚ÂÌÌ˚Ï Ë ÍÓ΢ÂÒÚ‚ÂÌÌ˚Ï ÔÓ͇Á‡ÚÂÎflÏ ÒÔÂÏÓÔÓ‰Û͈ËË.
54
å‡ÚÂË‡Î Ë ÏÂÚÓ‰˚ ËÒÒΉӂ‡ÌËfl. å‡ÚÂˇÎÓÏ ËÒÒΉӂ‡ÌËÈ Òڇ· ·‡Á‡ ‰‡ÌÌ˚ı (ÙÓχ 1-ÏÓÎ,
ÊÛ̇ΠÔËıÓ‰‡ Ë ‡ÒıÓ‰‡ ÒÔÂÏ˚) ÔÎÂÏÂÌÌ˚ı
·˚ÍÓ‚ ·Û˚ı ÔÓÓ‰ ëÛÏÒÍÓ„Ó „ÓÒÛ‰‡ÒÚ‚ÂÌÌÓ„Ó
ÒÂÎÂ͈ËÓÌÌÓ„Ó ˆÂÌÚ‡ Ò ËÒÔÓθÁÓ‚‡ÌËÂÏ ÒËÒÚÂÏ˚
IVOS ‰Îfl ÓÔ‰ÂÎÂÌËfl ͇˜ÂÒÚ‚ÂÌÌ˚ı ÔÓ͇Á‡ÚÂÎÂÈ ÒÔÂÏ˚: Ó·˙ÂÏ ˝flÍÛÎflÚ‡ (ÏÎ), ÍÓ̈ÂÌÚ‡ˆËfl
ÒÔÂÏË‚ (ÏÎ‰./ÏÎ), ‡ÍÚË‚ÌÓÒÚ¸ ÒÔÂÏË‚ (%),
ÍÓ΢ÂÒÚ‚Ó ÒÔÂÏ˚ ‰Îfl ËÒÔÓθÁÓ‚‡ÌËfl (‰ÓÁ), ÓÒÚ‡ÚÓÍ Á‡ÏÓÓÊÂÌÌÓÈ ÒÔÂÏ˚ ̇ ̇˜‡ÎÓ „Ó‰‡ (‰ÓÁ),
ÓÒÂÏÂÌÂÌÓ ‚ Ô‰Â·ı ӷ·ÒÚË (‰ÓÁ), ÓÒÂÏÂÌÂÌÓ
χÚÓÍ („ÓÎÓ‚), ‡ÒÚÂÎËÎÓÒ¸ ̇ ÔÓÚflÊÂÌËË „Ó‰‡
(„ÓÎÓ‚), ÔÓÎÛ˜ÂÌÓ ÔËÔÎÓ‰‡ („ÓÎÓ‚). èÓÓ‰ÌÛ˛
ÔË̇‰ÎÂÊÌÓÒÚ¸ ÓÔ‰ÂÎflÎË ÔÓ „Â̇Îӄ˘ÂÒÍËÏ
ÒıÂχÏ. ÇÎËflÌË ÓÚ‰ÂθÌ˚ı Ù‡ÍÚÓÓ‚ Ë Ëı ÍÓÏ·ËÌËÓ‚‡ÌË ÓÔ‰ÂÎflÎË ÔÛÚÂÏ Ó‰ÌÓ- Ë ‰‚ÛıÙ‡ÍÚÓÌÓ„Ó ‰ËÒÔÂÒËÓÌÌÓ„Ó ‡Ì‡ÎËÁ‡ ‰Îfl ÌÂ‡‚ÌÓÏÂÌ˚ı ÒÚ‡ÚËÒÚ˘ÂÒÍËı ÍÓÏÔÎÂÍÒÓ‚. ÅËÓÏÂÚ˘ÂÒÍÛ˛
Ó·‡·ÓÚÍÛ ‚ÒÂı ÔÓÎÛ˜ÂÌÌ˚ı ÂÁÛθڇÚÓ‚ ÔÓ‚ÂÎË
ÏÂÚÓ‰ÓÏ ‚‡ˇˆËÓÌÌÓÈ ÒÚ‡ÚËÒÚËÍË ÔÓ Ö. ä. åÂÍÛ¸Â‚ÓÈ [4].
êÂÁÛθڇÚ˚ ËÒÒΉӂ‡ÌËÈ. ÑÎfl ‡Ì‡ÎËÁ‡ ·˚ÎË
ÓÚÓ·‡Ì˚ 57 ÔÓËÁ‚Ó‰ËÚÂÎÂÈ, ÍÓÚÓ˚ ÓÚÌÓÒflÚÒfl
Í ÚÂÏ ÔÓÓ‰‡Ï: η‰ËÌÒ͇fl — 25 „ÓÎÓ‚, ÛÍ‡ËÌÒ͇fl ·Û‡fl ÏÓÎӘ̇fl — 12 „ÓÎÓ‚, ¯‚ˈ͇fl, Ò ‰ÓÎÂÈ ÍÓ‚Ë Ò‚ÂÓ‡ÏÂË͇ÌÒÍËı ¯‚ˈ‚ (BS) —
62,6–87% — 17 „ÓÎÓ‚. ÜË‚ÓÚÌ˚ ÔÂ‚ÓÈ „ÛÔÔ˚
·˚ÎË ÔÓÎÛ˜ÂÌ˚ ‚ ıÓÁflÈÒÚ‚‡ı ëÛÏÒÍÓÈ Ë ï‡¸ÍÓ‚ÒÍÓÈ Ó·Î‡ÒÚÂÈ, ·˚ÍË ÛÍ‡ËÌÒÍÓÈ ·ÛÓÈ ÏÓÎÓ˜ÌÓÈ
ÔÓÓ‰˚ ËÏÂ˛Ú Ú‡ÍÊ ÓÚ˜ÂÒÚ‚ÂÌÌÓ ÔÓËÒıÓʉÂÌËÂ, ‡ ¯‚ˈÍË ÔÓËÁ‚Ó‰ËÚÂÎË ËÏÔÓÚËÓ‚‡Ì˚ ËÁ
ÒÚ‡Ì á‡Ô‡‰ÌÓÈ Ö‚ÓÔ˚ Ë ëòÄ. ÇÒ ÊË‚ÓÚÌ˚Â
ËÏÂ˛Ú ˝ÍÒÚÂ¸Â, ı‡‡ÍÚÂÌ˚È ‰Îfl ‰‡ÌÌ˚ı ÔÓÓ‰
Ë Ì‡Ô‡‚ÎÂÌËfl ÔÓ‰ÛÍÚË‚ÌÓÒÚË.
Л. В. Бондарчук ©
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 55
Рубрика: Генетика и разведение животных
èË ËÁÛ˜ÂÌËË Í‡˜ÂÒÚ‚‡ ÒÔÂÏ˚ ·˚ÍÓ‚ ÛÒÚ‡ÌÓ‚ÎÂÌÓ, ˜ÚÓ ÔÓ Ó·˙ÂÏÛ ˝flÍÛÎflÚ‡ ‰ÓÒÚÓ‚ÂÌÓÈ ‡ÁÌˈ˚ Ì ̇·Î˛‰‡ÂÚÒfl. ùÚÓÚ ÔÓ͇Á‡ÚÂθ ÔÓ ÔÂ‚ÓÈ
„ÛÔÔ ÒÓÒÚ‡‚ËÎ 7,88±0,11,ÔÓ ‚ÚÓÓÈ Ë ÚÂÚ¸ÂÈ
7,65±0,15 Ë ÍÓ˝ÙÙˈËÂÌÚ˚ ‚‡ˇˆËË ÒÓÓÚ‚ÂÚÒÚ‚ÂÌÌÓ 5,17,7,01 Ë 6,45.
Ä̇ÎËÁËÛfl ÔÓ͇Á‡ÚÂÎË ‚ÓÒÔÓËÁ‚Ó‰ËÚÂθÌÓÈ
ÒÔÓÒÓ·ÌÓÒÚË, ÍÓÚÓ˚ Ô˂‰ÂÌ˚ ‚ Ú‡·Îˈ 1, ÒΉÛÂÚ ÓÚÏÂÚËÚ¸, ˜ÚÓ Ó·˙ÂÏ ˝flÍÛÎflÚ‡ ÏÂÊ‰Û ÊË‚ÓÚÌ˚ÏË ÔÂ‚ÓÈ Ë ÚÂÚ¸ÂÈ „ÛÔÔÓÈ ËÏÂÂÚ Á̇˜ËÚÂθÌÛ˛
‡ÁÌˈÛ. éÚ 4,65 Û ·˚ÍÓ‚ η‰ËÌÒÍÓÈ ÔÓÓ‰˚
Û‚Â΢˂‡ÂÚÒfl ‰Ó 5,8 Û ÊË‚ÓÚÌ˚ı ¯‚ˈÍÓÈ ÔÓÓ‰˚. í‡Í‡fl Ê ÚẨÂ̈Ëfl ÔÓÒÎÂÊË‚‡ÂÚÒfl Ë ÔÓ
ÔÓ͇Á‡ÚÂÎflÏ ‡ÍÚË‚ÌÓÒÚË ÒÔÂÏË‚. ŇΠ‡ÍÚË‚ÌÓÒÚË
Ò 6,4‚ÓÁ‡ÒÚ‡ÂÚ ‰Ó 6,87 Û ÊË‚ÓÚÌ˚ı Ò ÍÓ‚¸˛ BS.
ùÚÓ ÔÓ‰Ú‚Âʉ‡ÂÚÒfl Ë ÔË ‡Ì‡ÎËÁ ‡ÍÚË‚ÌÓÒÚË
ÒÔÂÏ˚ ÔÓÒΠÓÚڇ˂‡ÌËfl. ÜË‚ÓÚÌ˚ ÛÍ‡ËÌÒÍÓÈ
·ÛÓÈ ÏÓÎÓ˜ÌÓÈ ÔÓÓ‰˚ Ë ¯‚ˈÍÓÈ ËÏÂÂÚ ·‡Î ‡ÍÚË‚ÌÓÒÚË ÒÔÂÏ˚ ̇ ÛÓ‚Ì 3,91.
å˚ ‡ÒÒ˜ËÚ‡ÎË ÍÓ˝ÙÙˈËÂÌÚ ÍÓÂÎflˆËË, ÍÓÚÓ˚È ÔÓ͇Á˚‚‡ÂÚ ‚Â΢ËÌÛ Ò‚flÁË ÏÂÊ‰Û ÔÓ͇Á‡-
ÚÂÎflÏË. èÓÎÓÊËÚÂθ̇fl Ò‚flÁ¸ ÔÓ ÔÂ‚ÓÈ „ÛÔÔÂ
ÔÓËÁ‚Ó‰ËÚÂÎÂÈ ÒÛ˘ÂÒÚ‚ÛÂÚ ÏÂÊ‰Û ÔÓ͇Á‡ÚÂÎflÏË:
Ó·˙ÂÏ-ÍÓ̈ÂÌÚ‡ˆËfl (0,39), Ó·˙ÂÏ-‡ÍÚË‚ÌÓÒÚ¸ (0,35).
èÓ ‚ÚÓÓÈ „ÛÔÔ ҂flÁ¸ ÔÓÎÓÊËÚÂθ̇fl ÏÂʉÛ
‚ÒÂÏË ÔÓ͇Á‡ÚÂÎflÏË, Ӊ̇ÍÓ, ̇˷Óθ¯‡fl ÏÂʉÛ
Ó·˙ÂÏÓÏ Ë ‡ÍÚË‚ÌÓÒÚ¸˛ (0,45), ‡ ̇ËÏÂ̸¯‡fl ÏÂÊ‰Û ‡ÍÚË‚ÌÓÒÚ¸˛ Ë ÍÓ΢ÂÒÚ‚Ó ˝flÍÛÎflÚ‡ (0,001). ùÚ‡
ÚẨÂ̈Ëfl ÒÓı‡ÌË·Ҹ Ë ÔÓ ÔÓ͇Á‡ÚÂÎflÏ ·˚ÍÓ‚
¯‚ˈÍÓÈ ÔÓÓ‰˚, „‰Â ÔÓÒÎÂÊË‚‡ÂÚÒfl ̇˷Óθ¯ËÈ
ÍÓ˝ÙÙˈËÂÌÚ ÍÓÂÎflˆËË ÏÂÊ‰Û Ó·˙ÂÏÓÏ Ë ‡ÍÚË‚ÌÓÒÚ¸˛ (0,77) Ë Ì‡ËÏÂ̸¯ËÈ ÏÂÊ‰Û ‡ÍÚË‚ÌÓÒÚ¸˛
ÒÔÂÏ˚ Ë ÍÓ΢ÂÒÚ‚ÓÏ ˝flÍÛÎflÚ‡ (0,33).
éÚϘÂÌÓ ‰ÓÒÚÓ‚ÂÌÓ ‚ÎËflÌË „ÂÌÓÚËÔ‡ ÔÓ
BS ̇ ‰ÎËÚÂθÌÓÒÚ¸ ÔÎÂÏÂÌÌÓ„Ó ËÒÔÓθÁÓ‚‡ÌËfl
Ë, Í‡Í ÒΉÒÚ‚Ë ˝ÚÓ„Ó, ÔÓ ÍÓ΢ÂÒÚ‚Û ÒÔÂÏ˚,
ÍÓÚÓ‡fl ÔÓÎÛ˜Â̇ Á‡ ‚ÂÏfl ËÒÔÓθÁÓ‚‡ÌËfl.
Ç˚‚Ó‰˚. í‡ÍËÏ Ó·‡ÁÓÏ, ËÒıÓ‰fl ËÁ ÔÓÎÛ˜ÂÌÌ˚ı ‰‡ÌÌ˚ı, ÎÛ˜¯ËÏË ÔÓ ÔÓ͇Á‡ÚÂÎflÏ ‚ÓÒÔÓËÁ‚Ó‰ËÚÂθÌÓÈ ÒÔÓÒÓ·ÌÓÒÚË, Ó͇Á‡ÎËÒ¸ ÊË‚ÓÚÌ˚Â
¯‚ˈÍÓÈ ÔÓÓ‰˚ Ò ÍÓ‚¸˛ Ò‚ÂÓ‡ÏÂË͇ÌÒÍËı
¯‚ˈ‚.
퇷Îˈ‡ 1.
ÉÛÔÔ˚
I
é·˙ÂÏ, ÒÏ3
ÄÍÚË‚ÌÓÒÚ¸, ·‡Î
äÓ̈ÂÌÚ‡ˆËfl
ÏÎ‰/ÏÎ
å±m
Cv, %
ÄÍÚË‚ÌÓÒÚ¸ ÔÓÒÎÂ
ÓÚڇ˂‡ÌËfl
Cv, %
å±m
Cv,%
á‡ÏÓÓÊÂÌÓ, ‰ÓÁ
å±m
Cv,%
å±m
Cv, %
å±m
4,65±0,05
4,2
6,40±0,02
1,37
0,95±0,02
5,45
842,3±12,96
6,23
3,82±0,02
2,4
II
5,7±0,08
3,4
6,65±0,02
1,44
0,88±0,03
3,46
879,71±34,36
12,55
3,91±0,01
0,7
III
5,8±20,09
5,64
6,87±0,03
1,54
0,92±0,03
3,36
1053,21±42,2
13,21
3,91±0,01
0,75
Литература
1. ŇÒÓ‚Ò¸ÍËÈ å. á., êÛ‰ËÍ ß. Ä., ÅÛÍ‡Ú Ç. è./ÇËÓ˘Û‚‡ÌÌfl, ÓˆiÌ͇ i ‚ËÍÓËÒÚ‡ÌÌfl ÔÎi‰ÌËÍi‚ — ä.:
ìÓʇÈ, 1992. — 216 Ò.
2. ҢÂÌÍÓ å. ß., 燉ÚÓ˜iÈ Ç. å. Çi‰Ú‚Ó̇ Á‰‡ÚÌiÒÚ¸ ·Û„‡ª‚-ÔÎi‰ÌËÍi‚ iÁÌËı ÔÓi‰ // á·iÌËÍ Ì‡ÛÍ.
Ô. ãÛ„‡ÌÒ¸ÍÓ„Ó çÄì. — ãÛ„‡ÌÒ¸Í, 2006. — ÇËÔ. 69 (92). — ë. 84–87.
3. ㇉Ë͇ Ç. ß., êÛ·ˆÓ‚ ß. é. ÇÔÎË‚ ÒÔÓi‰ÌÂÌÓ„Ó ÒÔ‡˛‚‡ÌÌfl ̇ iÒÚ, ÓÁ‚ËÚÓÍ Ú‡ ÔÎÂÏiÌÌi flÍÓÒÚi ·Û„‡ª‚-ÔÎi‰ÌËÍi‚ ·ÛËı ÔÓi‰ // ç‡ÛÍ.-‚ËÓ·. Å˛Î. «ëÂÎÂ͈ifl». — ä˪‚. — 1997. ‹ 4. — ë.29–31.
4. åÂÍÛ¸Â‚‡ Ö. ä. ÅËÓÏÂÚËfl ‚ ÊË‚ÓÚÌÓ‚Ó‰ÒÚ‚Â. — å.: äÓÎÓÒ, 1984–311 Ò.
5. R. G. Holroyd, V. J. Doogan, J. De Faveri, G. Fordyce, M. R. McGowan1, J. D Bertram, D. M Vankan,
L. A. Fitzpatrick, G. A Jayawardhana, R. G Miller Bull selection and use in northern Australia. Calf output and predictors of fertility of bulls in multiple-sire herds Animal Reproduction Science. Volume 71, Issues 1–2, Pages 67–79, May 15, 2002
6. ëi‡ˆ¸ÍËÈ â. á. ÑË̇Ïi͇ ÔÓ͇ÁÌËÍi‚ ÒÔÂÏÓÔÓ‰ÛÍÚË‚ÌÓÒÚi ·Û„‡ª‚-ÔÎi‰ÌËÍi‚ Ï’flÒÌËı ÔÓi‰/ëi‡ˆ¸ÍËÈ â. á., ÅÓÈÍÓ é. Ç. //ÇiÒÌ. ëÛÏÒ¸ÍÓ„Ó Ì‡ˆ. ‡„‡. ÛÌ-ÚÛ. — ëÛÏË, 2002. — ÇËÔ. 7. — ë. 225—227.
Bondarchuk L. V.
Quality semen sires brown breeds from sumy region
Abstract. The results obtained by quantitative and qualitative indicators of sperm of breeding bulls brown
breeds in conditions of Sumy State selection center indicate that the best indicators are characterized sires
Brown Swiss of North American breeding.
Key words: brown breed, sires, sperm production, quality.
Author:
Bondarchuk L. V. — candidate of agricultural sciences, Sumy National Agrarian University.
Качество спермопродукции быков-производителей бурых пород Сумской области
55
Magazine-4-2014_Layout 1 23.12.2014 11:27 Page 56
ГЕНЕТИКА И РАЗВЕДЕНИЕ ЖИВОТНЫХ
4/2014
Требования к оформлению научных статей
è‰ÓÒÚ‡‚ÎflÂÏ˚Â Í ÔÛ·ÎË͇ˆËË ÒÚ‡Ú¸Ë ‰ÓÎÊÌ˚ ÒÓ‰Âʇڸ ÂÁÛθڇÚ˚ ̇ۘÌ˚ı ËÒÒΉӂ‡ÌËÈ
‚ ӷ·ÒÚË „ÂÌÂÚËÍË Ë ‡Á‚‰ÂÌËfl ÊË‚ÓÚÌ˚ı. ëÚ‡Ú¸Ë
ÔÓıÓ‰flÚ ÓÚ·Ó ̇ ÍËÚÂËÈ ‡ÍÚۇθÌÓÒÚË Ë ÌÓ‚ËÁÌ˚ ‡ÒÒχÚË‚‡ÂÏ˚ı ̇ۘÌ˚ı ÔÓ·ÎÂÏ.
é·˙ÂÏ ÔÛ·ÎË͇ˆËË, ‚Íβ˜‡fl ÔËÎÓÊÂÌËfl, ÌÂ
‰ÓÎÊÂÌ Ô‚˚¯‡Ú¸ 10 ÒÚ‡Ìˈ ‰Îfl ÒÚ‡ÚÂÈ ÔÓ·ÎÂÏÌÓ„Ó ı‡‡ÍÚÂ‡ Ë 6 ÒÚ‡Ìˈ — ‰Îfl ÒÓÓ·˘ÂÌËÈ ÔÓ ˜‡ÒÚÌ˚Ï ‚ÓÔÓÒ‡Ï. ëÚ‡Ú¸Ë ‰ÓÎÊÌ˚ ·˚Ú¸
ÓÙÓÏÎÂÌ˚ ̇ ÎËÒÚ‡ı ÙÓχڇ Ä4, ¯ËÙÚ — Times New Roman, ‡ÁÏÂ — 14 ÔÚ, ÏÂÊÒÚÓ˜Ì˚È
ËÌÚÂ‚‡Î — 1,5. èÓÎfl Ò‚ÂıÛ Ë ÒÌËÁÛ — 2 ÒÏ,
ÒÔ‡‚‡ Ë Ò΂‡ — 3 ÒÏ, ‡·Á‡ˆ — 1 ÒÏ (Ì Á‡‰‡‚‡Ú¸ Ôӷ·ÏË), ÙÓÏ‡Ú — ÍÌËÊÌ˚È.
ÖÒÎË ÒÚ‡Ú¸fl ·˚· ËÎË ·Û‰ÂÚ ÓÚÔ‡‚ÎÂ̇ ‚ ‰Û„ÓÂ
ËÁ‰‡ÌË ÌÂÓ·ıÓ‰ËÏÓ ÒÓÓ·˘ËÚ¸ Ó· ˝ÚÓÏ ‰‡ÍˆËË.
éÙÓÏÎÂÌË ÒÚ‡Ú¸Ë
ë΂‡ ‚ ‚ÂıÌÂÏ Û„ÎÛ ·ÂÁ ‡·Á‡ˆ‡ Ô˜‡Ú‡ÂÚÒfl
ìÑä ÒÚ‡Ú¸Ë (ÔÓ‚ÂflÈÚ ÍÓÂÍÚÌÓÒÚ¸ ‚˚·‡ÌÌÓ„Ó ìÑä ̇ Ò‡ÈÚ ÇÒÂÓÒÒËÈÒÍÓ„Ó àÌÒÚËÚÛÚ‡ ç‡Û˜ÌÓÈ Ë íÂıÌ˘ÂÒÍÓÈ àÌÙÓχˆËË — ÇàçËíà).
çËÊÂ, ˜ÂÂÁ ÔÓ·ÂÎ, ÔÓ ˆÂÌÚÛ ÒÚÓÍË Ì‡Á‚‡ÌË ÒÚ‡Ú¸Ë (̇Á‚‡ÌË ÒÚ‡Ú¸Ë ‰ÓÎÊÌÓ ÓÚ‡Ê‡Ú¸ ÓÒÌÓ‚ÌÛ˛ ˉ² ‚˚ÔÓÎÌÂÌÌÓ„Ó ËÒÒΉӂ‡ÌËfl, ·˚Ú¸
ÔÓ ‚ÓÁÏÓÊÌÓÒÚË Í‡ÚÍËÏ) ÊËÌ˚Ï ¯ËÙÚÓÏ Á‡„·‚Ì˚ÏË ·ÛÍ‚‡ÏË, Á‡ÚÂÏ ˜ÂÂÁ ÔÓ·ÂÎ ÒÚÓ˜Ì˚ÏË
·ÛÍ‚‡ÏË — ËÌˈˇÎ˚ Ë Ù‡ÏËÎËfl ‡‚ÚÓ‡. èÓÒÎÂ
˝ÚÓ„Ó ˜ÂÂÁ ÔÓ·ÂÎ — ‡ÌÌÓÚ‡ˆËfl (40-50 ÒÎÓ‚),
Ò ÌÓ‚Ó„Ó ‡·Á‡ˆ‡ — Íβ˜Â‚˚ ÒÎÓ‚‡ (3-6). чÎÂÂ
ÚÂÍÒÚ ÒÚ‡Ú¸Ë, ·Ë·ÎËÓ„‡Ù˘ÂÒÍËÈ ÒÔËÒÓÍ Ë ÂÙÂ‡Ú ÒÚ‡Ú¸Ë (Ó·˙ÂÏ ÂÙÂ‡Ú‡ 1200-1800 Ô˜. ÁÌ.).
чΠÌÂÓ·ıÓ‰ËÏÓ ‡ÁÏÂÒÚËÚ¸ ̇ ‡Ì„ÎËÈÒÍÓÏ
flÁ˚ÍÂ: ̇Á‚‡ÌË ÒÚ‡Ú¸Ë, ‡ÌÌÓÚ‡ˆË˛, Íβ˜Â‚˚Â
ÒÎÓ‚‡, ·Ë·ÎËÓ„‡Ù˘ÂÒÍËÈ ÔÂ˜Â̸ Ë Ò‚Â‰ÂÌËfl
Ó· ‡‚ÚÓ‡ı.
퇷Îˈ˚ Ô‰ÓÒÚ‡‚Îfl˛ÚÒfl ‚ ‰‡ÍÚÓ Word
Ò ÔËÒ‚ÓÂÌËÂÏ ËÏ ÔÓfl‰ÍÓ‚˚ı ÌÓÏÂÓ‚ (퇷Îˈ‡ 1
Ë Ú.‰.) Ë Ì‡Á‚‡ÌËÈ, Ô‡‡ÏÂÚ˚ Ú‡·Îˈ ‰ÓÎÊÌ˚
·˚Ú¸ ‚ ÍÌËÊÌÓÏ ÙÓχÚÂ.
îÓÏÛÎ˚ — ‚ Òڇ̉‡ÚÌÓÏ ‰‡ÍÚÓ ÙÓÏÛÎ
Word, ÔÓ‰Ú‚Âʉ‡˛˘Ë ÙËÁ˘ÂÒÍÛ˛ ÒÛÚ¸ ËÒÒΉӂ‡ÌËfl (ÔÓˆÂÒÒ‡), Ô‰ÒÚ‡‚Îfl˛ÚÒfl ·ÂÁ ‡Á‚ÂÌÛÚ˚ı χÚÂχÚ˘ÂÒÍËı ÔÂÓ·‡ÁÓ‚‡ÌËÈ. Ç ÍÓ̈Â
‚ ÍÛ„Î˚ı ÒÍӷ͇ı ÒÚ‡‚ËÚÒfl ÔÓfl‰ÍÓ‚˚È ÌÓÏÂ,
ÒÒ˚Î͇ ̇ ÌÓÏÂ ÙÓÏÛÎ˚ ‚ ÚÂÍÒÚ ڇÍÊ Û͇Á˚‚‡ÂÚÒfl ‚ ÍÛ„Î˚ı ÒÍӷ͇ı.
àÎβÒÚ‡ˆËË Í Òڇڸ (ÔË Ì‡Î˘ËË) ‚ Òڇ̉‡ÚÌ˚ı „‡Ù˘ÂÒÍËı ÙÓχڇı, Ó·flÁ‡ÚÂθÌÓ Ò ÔÓ‰ËÒÛÌÓ˜ÌÓÈ ÔÓ‰ÔËÒ¸˛ (Ì ·ÓΠ4). ãËÌËË „‡ÙËÍÓ‚
Ë ËÒÛÌÍÓ‚ ‚ Ù‡ÈΠ‰ÓÎÊÌ˚ ·˚Ú¸ Ò„ÛÔÔËÓ‚‡Ì˚.
ÅË·ÎËÓ„‡Ù˘ÂÒÍË ÒÒ˚ÎÍË ‰ÓÎÊÌ˚ ·˚Ú¸ ÓÙÓÏÎÂÌ˚ ‚ ÒÓÓÚ‚ÂÚÒÚ‚ËË Ò Ééëí ê 7.0.5-2008 «ÅË·ÎËÓ„‡Ù˘ÂÒ͇fl ÒÒ˚Î͇», ‚ ‚ˉ ӷ˘Â„Ó ÒÔËÒ͇
‚ ÔÓfl‰Í ˆËÚËÓ‚‡ÌËfl, ‚ ÚÂÍÒÚ Û͇Á˚‚‡ÂÚÒfl ÒÒ˚Î͇ Ò ÌÓÏÂÓÏ.
ëÒ˚Î͇ ‰‡fiÚÒfl ‚ Ó·˚˜ÌÓÏ ÚÂÍÒÚÓ‚ÓÏ ÙÓχÚÂ,
‚ Í‚‡‰‡ÚÌ˚ı ÒÍӷ͇ı. üÁ˚Í ÔÛ·ÎË͇ˆËË ÛÒÒÍËÈ
ËÎË ‡Ì„ÎËÈÒÍËÈ.
56
èË Ì‡ÔËÒ‡ÌËË: «Ç‚‰ÂÌË», «ìÒÎÓ‚Ëfl, χÚÂˇÎ˚ Ë ÏÂÚÓ‰˚ ËÒÒΉӂ‡ÌËÈ», «Ä̇ÎËÁ Ë Ó·ÒÛʉÂÌË ÂÁÛθڇÚÓ‚», «Ç˚‚Ó‰˚».
Ç ‡Á‰ÂΠ«Ç‚‰ÂÌË» Ô‰·„‡ÂÚÒfl ÔÓÒÚ‡Ìӂ͇
ÔÓ·ÎÂÏ˚, ‰ÓÎÊ̇ ·˚Ú¸ ÒÙÓÏÛÎËÓ‚‡Ì‡ Ë Ó·ÓÒÌÓ‚‡Ì‡ ˆÂθ ‡·ÓÚ˚ Ë, ÂÒÎË ÌÂÓ·ıÓ‰ËÏÓ, ‡ÒÒÏÓÚÂ̇  ҂flÁ¸ Ò ‚‡ÊÌ˚ÏË Ì‡Û˜Ì˚ÏË Ë Ô‡ÍÚ˘ÂÒÍËÏË Ì‡Ô‡‚ÎÂÌËflÏË, ‰‡ÂÚÒfl ÚÂÓÂÚ˘ÂÒÍÓÂ
Ó·ÓÒÌÓ‚‡ÌË ËÒÒΉӂ‡ÌËfl. ÑÓÎÊÌ˚ ÔËÒÛÚÒÚ‚Ó‚‡Ú¸ ÒÒ˚ÎÍË Ì‡ ÔÛ·ÎË͇ˆËË ÔÓÒΉÌËı ÎÂÚ, ‚ ‰‡ÌÌÓÈ Ó·Î‡ÒÚË ‚Íβ˜‡fl Á‡Û·ÂÊÌ˚ı ‡‚ÚÓÓ‚.
Ç ÒÎÂ‰Û˛˘ÂÏ ‡Á‰ÂΠ‡ÒÍ˚‚‡˛ÚÒfl ÓÒÓ·ÂÌÌÓÒÚË ‰‡ÌÌÓ„Ó ËÒÒΉӂ‡ÌËfl, ÔË‚Ó‰flÚÒfl ÛÒÎÓ‚Ëfl, χÚÂˇÎ˚ Ë ÏÂÚÓ‰˚ ËÒÒΉӂ‡ÌËÈ.
É·‚Ì˚È ‡Á‰ÂÎ ÒÚ‡Ú¸Ë ÔÓÒ‚fl˘‡ÂÚÒfl Ô‰ÒÚ‡‚ÎÂÌ˲, ‡Ì‡ÎËÁÛ Ë Ó·ÒÛʉÂÌ˲ ÂÁÛθڇÚÓ‚. èÓÎÛ˜ÂÌÌ˚ ÂÁÛθڇÚ˚ ‰ÓÎÊÌ˚ ·˚Ú¸ ÓÒ‚Â˘ÂÌ˚ Ò ÚÓ˜ÍË ÁÂÌËfl Ëı ̇ۘÌÓÈ ÌÓ‚ËÁÌ˚ Ë ÒÓÔÓÒÚ‡‚ÎÂÌ˚
Ò ÒÓÓÚ‚ÂÚÒÚ‚Û˛˘ËÏË ËÁ‚ÂÒÚÌ˚ÏË ‰‡ÌÌ˚ÏË.
Ç Á‡‚Â¯ÂÌËË Ô‰ÒÚ‡‚Îfl˛ÚÒfl ‚˚‚Ó‰˚ Ë ÂÍÓÏẨ‡ˆËË.
—
—
—
–
–
–
Ä‚ÚÓ˚ Ô‰ÓÒÚ‡‚Îfl˛Ú (Ó‰ÌÓ‚ÂÏÂÌÌÓ):
ÒÚ‡Ú¸˛ ‚ Ô˜‡ÚÌÓÏ ‚ˉÂ, ·ÂÁ ÛÍÓÔËÒÌ˚ı ‚ÒÚ‡‚ÓÍ, ̇ Ó‰ÌÓÈ ÒÚÓÓÌ Òڇ̉‡ÚÌÓ„Ó ÎËÒÚ‡, ÔÓ‰ÔËÒ‡ÌÌÛ˛ ̇ ÔÓÒΉÌÂÏ ÎËÒÚ ‚ÒÂÏË ‡‚ÚÓ‡ÏË.
ÒÚ‡Ú¸˛ ‚ ˝ÎÂÍÚÓÌÌÓÏ ‚ˉÂ, ͇ʉ‡fl ÒÚ‡Ú¸fl
‰ÓÎÊ̇ ·˚Ú¸ ‚ ÓÚ‰ÂθÌÓÏ Ù‡ÈÎÂ. Ç ËÏÂÌË Ù‡È· Û͇Á˚‚‡ÂÚÒfl Ù‡ÏËÎËfl ÔÂ‚Ó„Ó ‡‚ÚÓ‡.
҂‰ÂÌËfl Ó· ‡‚ÚÓ‡ı (‚ Ô˜‡ÚÌÓÏ Ë ˝ÎÂÍÚÓÌÌÓÏ
‚ˉÂ): î.à.é. (ÔÓÎÌÓÒÚ¸˛), Û˜Â̇fl ÒÚÂÔÂ̸,
Û˜fiÌÓ Á‚‡ÌËÂ, ‰ÓÎÊÌÓÒÚ¸, ÔÓÎÌÓ ̇ËÏÂÌÓ‚‡ÌË Ó„‡ÌËÁ‡ˆËË, ÚÂÎÂÙÓÌ Ë ‡‰ÂÒ ‰Îfl Ò‚flÁË,
e-mail; ˝ÚË Ê ҂‰ÂÌËfl ̇ ‡Ì„ÎËÈÒÍÓÏ flÁ˚ÍÂ.
ˆÂÌÁ˲ ÔÓ‰ÔËÒ‡ÌÌÛ˛ (‰ÓÍÚÓÓÏ Ì‡ÛÍ) Ë Á‡‚ÂÂÌÌÛ˛ Ô˜‡Ú¸˛.
˝ÍÒÔÂÚÌÓ Á‡Íβ˜ÂÌË ‚ÓÁÏÓÊÌÓÒÚË ÓÔÛ·ÎËÍÓ‚‡ÌËfl, ÓÙÓÏÎÂÌÌÓ ‚ Ó„‡ÌËÁ‡ˆËË, ÓÚÍÛ‰‡
ËÒıÓ‰ËÚ ÛÍÓÔËÒ¸ (ÒÓÔÓ‚Ó‰ËÚÂθÌÓ ÔËÒ¸ÏÓ).
‡ÒÔË‡ÌÚ˚ Ô‰ÓÒÚ‡‚Îfl˛Ú ÒÔ‡‚ÍÛ ÔÓ‰Ú‚Âʉ‡˛˘Û˛ ÏÂÒÚÓ Û˜Â·˚.
èË ÛÒÎÓ‚ËË ‚˚ÔÓÎÌÂÌËfl ÙÓχθÌ˚ı Ú·ӂ‡ÌËÈ Í Ï‡ÚÂË‡Î‡Ï Ì‡ ÔÛ·ÎË͇ˆË˛, Ô‰ÓÒÚ‡‚ÎÂÌ̇fl ‡‚ÚÓÓÏ ÛÍÓÔËÒ¸ ÒÚ‡Ú¸Ë ˆÂÌÁËÛÂÚÒfl,
Òӄ·ÒÌÓ ÛÒÚ‡ÌÓ‚ÎÂÌÌÓ„Ó ÔÓfl‰Í‡ ˆÂÌÁËÓ‚‡ÌËfl ÛÍÓÔËÒÂÈ, ÔÓÒÚÛÔ‡˛˘Ëı ‚ ‰‡ÍˆË˛ ÊÛ̇·. ê¯ÂÌËÂ Ó ˆÂÎÂÒÓÓ·‡ÁÌÓÒÚË ÔÛ·ÎË͇ˆËË
ÔÓÒΠˆÂÌÁËÓ‚‡ÌËfl ÔËÌËχÂÚÒfl „·‚Ì˚Ï ‰‡ÍÚÓÓÏ (Á‡ÏÂÒÚËÚÂÎflÏË „·‚ÌÓ„Ó ‰‡ÍÚÓ‡),
‡ ÔË ÌÂÓ·ıÓ‰ËÏÓÒÚË — ‰ÍÓÎ΄ËÂÈ ‚ ˆÂÎÓÏ.
Ä‚ÚÓÛ Ì ÔËÌflÚÓÈ Í ÔÛ·ÎË͇ˆËË ÛÍÓÔËÒË ‰ÍÓÎ΄Ëfl ̇Ô‡‚ÎflÂÚ ÏÓÚË‚ËÓ‚‡ÌÌ˚È ÓÚ͇Á.
è·ڇ Ò ‡ÒÔË‡ÌÚÓ‚ Á‡ ÔÛ·ÎË͇ˆË˛ ÛÍÓÔËÒÂÈ
Ì ‚ÁËχÂÚÒfl.
Л. В. Козикова ©
1/--страниц
Пожаловаться на содержимое документа