close

Вход

Забыли?

вход по аккаунту

Лекция 3-4

код для вставкиСкачать
Методы идентификации
хромосом. Хромосомные
перестройки.
Лекция 3-4
Возможности идентификации
хромосом на протяжении клеточного
цикла
I.Solovei 2003
Структура хромосомы
клетка
ядро
хромосома
хроматиновые
петли нуклеомеры
нуклеосомы
ДНК
Классификация монохромно
окрашенных хромосом




Число хромосом.
Размер хромосом.
Наличие спутника.
Центромерный
индекс.
Классификация хромосом





Метацентрические
хромосомы – 37,550%;
Субметацентрические
– 25,0 – 37,4%;
Субакроцентрические
– 12,5 – 24,9%;
Акроцентрические –
0,1 – 12,4%;
Телоцентрические –
0%.
Метафазные пластинки митотических клеток
корневых меристем растений BC2
А) 2n=24
Б) 2n=25
В) 2n=26
Г) 2n=29
Монахос С.Г.
Гетерохроматин
1.
Факультативный – в период интерфазы либо
плотно упакован, либо представляет собой петли,
в зависимости от ткани или стадии развития
клетки
2.
Конститутивный – остается плотно упакованным
в течение всей интерфазы во всех тканях;
локализован около центромер, теломер и
ядрышко организующего района (NOR-области).
Краситель Гимза
Компоненты раствора
метиленовый синий
Эффект окрашивания
бледные, слабо заметные бэнды
азур А
азур В
эозин
отсутствие бэндов
метиленовый синий + эозин
наличие хорошо различимых бэндов
азур + эозин
метиленовый синий
красящий
комплекс
эозин
Дезоксирибонуклеиновая кислота
Образование прочного красящего вещества в зависимости от
конфигурации и разной степени уплотнения
С-бэндинг – история открытия
Pardue и Gall случайно открыли метод С-бэндинга в 1970 году при
проведении экспериментов по in situ гибридизации меченой
тритием сателлитной ДНК на хромосомах мыши:
1. денатурация хромосомной ДНК гидроокисью натрия;
2. ренатурация в буфере;
3. проявка гибридизации авторадиографией, при подкрашивании
хромосомы красителем Гимза.
С-бэндинг
1.
2.
3.
4.
5.
С-окрашенные участки не всегда совпадают с
областями увеличения количества ДНК.
Применяется, в основном, на однодольных
(Мятликовые и Лилейные).
Постоянен у одного вида растений с наличием
небольшого полиморфизма.
С помощью морфометрического анализа на
нескольких злаках доказана неслучайность
распределения бэндов.
Возможно создание таких условий, при которых
бэнды будет давать только одна хромосома из
всего генома (показано на хромосомах человека и
некоторых растений).
С-окрашенные хромосомы арабидопсиса
С-окрашенные хромосомы ячменя
Хромосомы пшеницы
Гомеология хромосом пшеницы
Стадия
Условия
Процесс
Проращивание
В чашках Петри в
термостате
(24°
C)
Прорастание семян
Предобработка и
фиксация корешков с
дальнейшей мацерацией
Фиксация в
уксусном
алкоголе 3:1,
мацерация в 45%
уксусной кислоте
или 0.5%
ацетокармине
Обработка удаляет
пуриновые основания
(аденин, гуанин), что
позволяет разрезать
сахарофосфатный остов
ДНК без его разрушения
для снятия
сверхспирализации,
частичное удаление
белков
Стадия
Условия
Процесс
Дегидратация
В 95% (100%)
этаноле
Дегидратация
Денатурация
В Ba(OH)2 (или
NaOH) от 5 до 15
минут при
температуре 5055° C
Благодаря
щелочной среде
происходит разрыв
водородных
связей между
основаниями и
распаду ДНК на две
одноцепочечные
нити
Стадия
Ренатурация ДНК
Условия
В солевом
растворе
цитрата
натрия SSC
(или в NaCl)
Время и
температура
зависят от
конкретной
методики
Процесс
Приводит к ренатурации ДНК,
изменяет состояние ДНП. Основа
С-окрашивания избирательная
устойчивость хроматина к
экстрагированию. Ренатурируют
только высокоповторяющиеся
участки, уникальная и средне
повторяющаяся ДНК не
ренатурирует
Стадия
Окрашивание
Условия
1. В буферном растворе Гимза
при периодическом контроле
под микроскопом.
2. Промывка
дистиллированной водой.
3. Высушивание на воздухе,
оставление в ксилоле на ночь.
4. Высушивание на воздухе.
5. Помещение препарата под
покровное стекло с Канадским
бальзамом и т.д.
Процесс
Избирательное
связывание
красителя с ДНП
Использование С-бэндинга в научных
исследованиях
и его практическое применение
1.
2.
Изучение полиморфизма распределения С-бэндов:
1.
проведение паспортизации сортов;
2.
оценка сорта на гетерогенность;
Установление прицентромерных, пара- и
перицентрических перестроек, дополнений и замещений:
1.
выявление линий и сортов с ценным чужеродным
генетическим материалом
3.
Позволяет устанавливать эволюцию генома у
амфиплоидов
4.
Несмотря на свои преимущества, метод в ряде случаев
обладает низкой разрешающей способностью
Номенклатура бэндов
Парижская конференция “Standartization in
Human Cytogenetics, Birth Defects”, 1971 год.
Каждый ГХ блок идиограммы мягкой пшеницы,
когда-либо выявленный, получил свой номер,
соответствующий положению на плече
Первоначальный модельный объект – мягкая
пшеница сорта Chinese Spring
G-бэндинг
1.
Больше бэндов, чем при С-окраске. Как и С-бэндинг
требует красителя Гимза, но предобработка
включает трипсин, мочевину или протеиназу.
2.
G-бэндинг на растительных хромосомах
практически невозможен, по- видимому, из-за
большего количества ДНК на единицу длины
хромосомы, хромомеры слишком плотно
упакованы по сравнению с хромосомами
млекопитающих.
3.
В последние годы появились методики Gокрашивания растительных объектов.
Сравнение метафазной и прометафазной гомологичных
хромосом: распределение бэндов соответствует положению
желобков на поверхности хромосомы (x 10,000; Harrison, C.J.,
Jack, E.M. Allen, T.D., and Harris, R., J. Cell Sci., 77, 143, 1985.
Courtesy of the Company of Biologists)
Q-бэндинг
1.
2.
3.
Хромосомы не проходят предварительную обработку
Обработку проводят акрихином или его производными
(акрихинипритом)
Исследование хромосом проводят с помощью
флуоресцентного микроскопа
R-бэндинг
1.
2.
Предварительная инкубация препаратов в фосфатном
буфере (рН=6.8) в условиях контролируемой температуры
(87 °С) в течение 10-12 мин.
Окрашивание обратно Q- и G-окрашиванию
Сравнение основных видов
дифференциального окрашивания
Название метода
Основа метода
Объекты
Q-бэндинг
Окрашивание ДНК АТ-специфичными
флуорохромами (акрихин,DAPI, Hoechst
33258 ) - жѐлтое свечение
Рептилии, птицы,
млекопитающие
G-бэндинг
Окрашивание Гимзой после инкубации в
тѐплом SSC или трипсине
Рыбы, амфибии,
рептилии, птицы,
млекопитающие
R-бэндинг
Окрашивание Гимзой после инкубации в
горячем буфере
Млекопитающие
C-бэндинг
Окрашивание Гимзой после обработки
щелочью - фиолетовые бэнды
Большинство
растений и
животных
Репликацион-ный
бэндинг
Слияние с BrdU в течение ранней или
поздней S-фазы после окрашивания
Гимзой
Растения
Сравнение методик основных способов
дифференциального окрашивания
Название метода
Принцип метода
C-бэндинг
Гимза окрашивает насыщенные сателлитами
прицентромерные районы, выявляет конститутивный
гетерохроматин
R-бэндинг
Выявляет области, насыщенные GC-парами,
противоположен по рисунку G-бэндингу
G-бэндинг
Тѐмные G-бэнды образуются в профазе или ранней
метафазе, благодаря участкам ДНК, способным
связывать краситель
Q-бэндинг
АТ-насыщенные участки ДНК флюоресцируют,
благодаря арихину; GC-области подавляют его
действие; большей частью в гетерохроматине; зависит
также, например, от способности флуорохрома
связываться с гистонами
Сравнение С- и G-бэндинга в животных и
растительных хромосомах
С-, G-, N-, нецентромерные (интерстициальные и теломерные)
бэнды в зависимости от интенсивности обработки выявляются как
у растений, так и у животных
Повышение жесткости обработки:
1.
G
R
T
C
2.
С-бэнды растений богаты АТ-парами, расположены близко друг к
другу и подобны бэндам, выявляемым при окраске по Фѐльгену
или Q-окраске, потому сравнимы с G-бэндами млекопитающих
3.
Степень одинаковости С- и G-бэндов хромосом животных и
растений до конца не выяcнена
Бэнды хромосом животных более отчетливы
4.
Другие методы
1. T-окраска –вариант R-окраски с преимущественным
окрашиванием теломер
2. NOR-бэндинг – окрашивание хромосом аммонийным
серебром, при этом окрашивается ядрышковый
организатор (вторичная перетяжка)
3. Hy-бэндинг– метод специально разработан для
растительных объектов. Включает обработку горячей
соляной кислотой (HCl) и окрашивание ацетокармином.
Распределение бэндов иное, чем у С-бэндинга
Длина хромосом и число сегментов (бэндов)
в метафазе – 400 (слева) и профазе – 1400 (справа)
Гибридизация in situ. GISH.
GISH of Allium cepa x (A. roylei x A.
fistulosum) hybrid
Принципы гибридизации in situ
Гибридизация in situ. FISH.
Simultaneous detection of three EST
clones on sunflower chromosomes
Хромосомные территории
Хромосомы
занимают
обособленные
территории
(ХТ) в
клеточном
ядре
I.Solovei 2003
Habermann et al
(2001) Chr Res, 9:
569 - 584
I.Solovei 2003
24-цветная 3D-FISH: нормальные
ядра фибробластов человека
Bolzer et al, 2004
Рано реплицирующиеся районы хроматина и те, что реплицируются в
середине фазы S, занимают в ядре постоянное положение в каждом
последующем клеточном цикле.
Первый
клеточный
цикл
Второй
клеточный
цикл
Четвертый
клеточный
цикл
Окрашенное ядро
Хроматин:
рано реплицирующийся = гены «домашнего хозяйства», транскрипционно активный,
в R-дисках
реплицирующийся в середине S = обеднен генами, транскрипционно неактивный, в
G-дисках
Рано реплицирующийся
хроматин
Lamin B
хроматин,
реплицирующийс
я в середине S,
прилегает к
ядерной оболочке
(мембрана +
ламина)
Компактизация
хроматина
ДНК
Нить хроматина?
~ 1,000
30 nm соленоид ~40 / 50
Нуклеосома
= октамер
гистонов
H2a, H2b, H3, H4
146 / 200 bp DNA
Компактизация
~10 раз
Метафазная хромосома /
интерфазный хроматин
~ 10,000
Строение метафазных хромосом
Центромер – это домен хромосомы
который определяет позицию кинетохора
микротрубочки веретена
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I IIIIIIIIIIIIIIIIIIIIIIIIII
IIIIIIIII I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I
Meтафазная хромосома
конститутивные
последовательности ДНК
и внутренние белки
кинетохора (хроматин)
Когезины
между
хроматидами
домен кинетохора
район
- центромер
центромера
перицентромерный гетерохроматин
временные (наружние) белки кинетохора – присоединение к нитям веретена
Последовательность ДНК в районе
центромера
Saccharomyces cerevisiae: единственный эукариот с cen-специфичной ДНК
CDE I
CDE II – одна нуклеосома CDE III – соединение с 1
микротрубочкой
ATCACATG
G
G
TGTATATGATTTCGCAAAAAAAA
AAA
T T
T
C TT
~ 125 пн, одна копия, три домена
Функциональный центромер
78 – 87 bp; 87 – 98%
AT
Сателлитная ДНК образует центромер человека
Перицентромерный район
(ретротранспозоны)
~2-5
Mb
-satellite DNA monomers (171 bp, ~ 63%
AT)
Для цитолога
Центромера - хромосомный участок, к которому
крепятся нити веретена клеточного деления.
Центромера иногда видна как "первичная" перетяжка на
хромосоме (Fleming 1880).
Для генетика центромера – это хромосомный
сайт, необходимый для наследования хромосом
По современной терминологии клеточной и
молекулярной биологии центромера – это сегмент ДНК
(центромерная ДНК), к которому крепится кинетохор (К).
Кинетохор - сложный белковый комплекс,
ассоциированный с Ц за счет ДНК-белковых
взаимодействий.
К нему крепятся микротрубочки веретена.
Структура обобщенного
центромера растений
домен хромосомы, определяющий сборку кинетохора
Перицентромерный
гетерохроматин
Кинетохорный
домен
Перицентромерный
гетерохроматин
CEN-DNA = видо-специфичные повторы сателлитной ДНК
Различные известные и неизвестные повторяющиеся последовательности
CR = центромерные ретротранспозоны различных семейств.
У злаков – производные древних T3/gypsy-подобных консервативных
элементов
Консервативные гистоны CenH3: взаимодействуют с ДНК  хроматин
Определение центромера
H4
CenH3
H2B
H
4
CenH3
Нуклеосома
Центромерная ДНК намотана на нуклеосомы, у
которых обычный гистон H3 заменен на гистон
CenH3, который взаимодействует с центромером
независимо от последовательности его ДНК.
Центромерный комплекс ДНК/CenH3 конститутивен:
маркирует центромерный район на протяжении всего
клеточного цикла у всех изученных эукариот.
H2A
В митозе/мейозе множество других временных
Модифицированные центромерных белков (~100) узнают эту «метку» и
полипептидные концы взаимодействуют, образуя действующий кинетохор.
CenH3
Как CenH3 гистон специфически узнает нуклеосомы
центромера – неизвестно.
Определение центромера у
кукурузы
гистон CenH3
CEN-DNA
CRM
CEN-DNA
CRM
Нормальные
центромерные
последовательности
+ CenH3
B хромосома
CEN-DNA и CRM зонды гибридизуются со многими сайтами
(кластерами) на B хромосоме, но гистона CenH3 в хроматине нет. кукурузы
Последовательность ДНК сама по себе не достаточна для обеспечения функции центроме
Типы центромер
1. Локализованная центромера
2. Неоцентромера
3. Нелокализованные центромеры
а. Полилокальные центромеры
б. Голоцентромеры (Холоцентромеры)
Большинство видов имеют одну локализованную
центромеру - МОНОЦЕНТРИЧЕСКИЕ ХРОМОСОМЫ
Центромер и клеточный цикл
S
G1
G2
Топоизомераза II
удаляет зацепления
ДНК в районе
центромера
интерфаза
митоза
анафаза
III
Когезины образуются
в фазе S и соединяют
сестринские
хроматиды до
метафазы
IIIIIIIIIIIIIIIIIIIIIIIIII
I профаза /
метафаза
Расхождение и сегрегация хромосом
Центромеры обеспечивают движение и упорядоченное
распределение хроматид между дочерними ядрами в MИТОЗЕ.
MИТОЗ. Центромеры обогащены когезинами, что
обеспечивает правильное выстраивание хромосом на
метафазной пластинке и прохождение «контрольного пункта»
на стадии метафазы. Сестринские хроматиды начинают
терять когезию в плечах начиная с профазы. Центромеры
разъединяются в последнюю очередь.
IIIIIIIIIIIIII IIIIIIIIIIII IIIIIIIIIIIIII IIIIIIIIIII
ХРОМОСОМНЫЕ ПЕРЕСТРОЙКИ
И МЕТОДЫ ИХ УЧЕТА

Хромосомной перестройкой, или
аберрацией называют изменение
структуры хромосомы под
влиянием излучений, химических
веществ или спонтанно.
Типы перестроек




хромосомные, когда обе сестринские
хроматиды участвуют в хромосомной
перестройке в идентичных местах;
хроматидные, когда в аберрацию
вовлечена только одна из сестринских
хроматид.
внутрихромосомные - происходящие в
пределах одной хромосомы,
межхромосомные аберрации связаны с
обменом участками между разными
хромосомами.
Внутрихромосомные перестройки



делеция (нехватка) – потеря участка хромосомы;
делеции могут быть хромосомные и хроматидные;
концевые (теряется теломера) и интерстициальные
(выпадает участок, находящийся между
центромерой и теломерой);
инверсия – поворот участка хромосомы на 180˚; в
результате инверсии меняется порядок
расположения генов, но с полным сохранением всех
генов; в зависимости от присутствия в перестройке
центромеры различают перицентрические
(переворачивается участок с центромерой) и
парацентрические (центромера в перестройке не
участвует);
дупликация – удвоение участка хромосомы
Делеции. Идентификация и
происхождение.
Межхромосомная перестройка

транслокация – перемещение
участка одной хромосомы в
негомологичную хромосому; они
могут быть и хроматидными
(обмен участками хроматид
негомологичных хромосом);
различают симметричные (обмен
ацентрическими участками) и
асимметрические (обмен
центромерными участками).
Транслокации
Структурные изменения в
хромосомах и хроматидах
Аберрации, индуцированные
мутагенами
1/--страниц
Пожаловаться на содержимое документа