close

Вход

Забыли?

вход по аккаунту

- biosafety.kz

код для вставкиСкачать
Қазақстан Республикасының білім және ғылым министрлігі
Ғылым Комитеті
Биологиялық қауіпсіздік проблемаларының ғылыми-зерттеу институты
Биологиялық қауіпсіздік проблемаларының ғылыми-зерттеу
институтының құрылған күніне арналған жас ғалымдардың
«БИОЛОГИЯЛЫҚ ҚАУІПСІЗДІКТІ ҚАМТАМАСЫЗ
ЕТУДЕ ҒЫЛЫМНЫҢ ИННОВАЦИЯЛЫҚ ДАМУЫ»
- атты екінші Халықаралық ғылыми конференцияның материалдар
жинағы
Гвардейск қалашығы
7 тамыз, 2014 ж.
1
Министерство образования и науки Республики Казахстан
Комитет науки
Научно-исследовательский институт проблем биологической безопасности
Сборник материалов второй Международной научной конференции
молодых ученых на тему:
« ИННОВАЦИОННОЕ РАЗВИТИЕ НАУКИ В
ОБЕСПЕЧЕНИИ БИОЛОГИЧЕСКОЙ БЕЗОПАСНОСТИ»,
посвященная дню образования Научно-исследовательского института
проблем биологической безопасности
п.г.т. Гвардейский
7 августа, 2014 г.
2
Ministry of Education and Science of the Republic of Kazakhstan
Science Committee
Research Institute for Biological Safety Problems
Proceeding of the second international conference of young scientists:
"INNOVATIVE DEVELOPMENT OF SCIENCE IN
PROVIDING OF BIOLOGICAL SAFETY",
dedicated to the day of formation of the Research Institute for Biological Safety
Problems
Gvardeiskiy
August 7, 2014
3
УДК
ББК
И
Цель конференции: дать возможность молодым ученым самостоятельно представить
результаты своей работы, получить опыт выступления перед аудиторией и публичного
обсуждения научных результатов. Развитие творческой активности молодых ученых и
специалистов, привлечение их к решению актуальных задач современной науки, обмен
опытом и установление контактов между коллегами.
Международная конференция молодых ученых традиционно проводится при участии
Совета молодых ученых и поддержке руководства РГП НИИПББ КН МОН РК.
РЕДАКЦИОННАЯ КОЛЛЕГИЯ:
Сансызбай А.Р.
Абдураимов Е.О.
Генеральный директор РГП НИИПББ КН МОН РК,
д.в.н., профессор, член-корреспондент НАН РК
зам. ген. директора РГП НИИПББ КН МОН РК по
науке, к.б.н., ассоциированный профессор
зам. ген. директора РГП НИИПББ КН МОН РК по
ИПБ, к.в.н., доцент
главный ученый секретарь РГП НИИПББ КН МОН РК, к.в.н.
Кожабергенов Н.С.
председатель Совета молодых ученых НИИПББ
Рсалиев А.С.
зав. лабораторией, к.с-х.н.
Табынов Кайсар К.
зав. лабораторией, к.в.н.
Табынов Кайрат К.
магистр, с.н.с.
Шыныбекова Г.О.
м.н.с.
Сандыбаев Н.Т.
Хайруллин Б.М.
Инновационное развитие науки в обеспечении биологической безопасности:
II-Международная научная конференция молодых ученых, посвященная дню образования
Научно-исследовательского института проблем биологической безопасности
(7августа 2014 г., п.г.т. Гвардейский).
ISBN
ISBN
© НИИ Проблем Биологической Безопасности, 2014
4
АЛҒЫСӨЗ
Заманауи қоғамның дамуы мемлекеттің қалыптасу және өсу деңгейін айқындаушы
ғылым мен техниканың толыққанды дамуынсыз мүмкін емес. Сондықтан да әсіресе
Қазақстан тәрізді дамушы елдер үшін ғылымды серпінді және мақсатты тұрғыда дамыту
өте маңызды. Қазақстан халқына арнаған өзінің Жолдауында еліміздің Президенті Н. Ә.
Назарбаев халықтың экономикалық игілігін одан ары нығайту үшін жаңа міндеттерді
анықтап берді. Негізгі бағыт – білім беру жүйесінің жаңа сапасы, әлемдік деңгейде
ғылыми зерттеулер жүргізу және ғылым мен инновациялық процесстердің өзара тығыз
байланысы. Оңды ілгерілеушіліктердің арқасында Қазақстан қазірдің өзінде тұрақты
әлеуметтік экономикалық даму саласы бойынша едәуір табыстарға қол жеткізді. Бұл
процесстің маңызды көріністері болып адамның да, жануарлар әлемінің де ізгі
жайлылығын қалыптастыру және сақтау табылады. Жұртшылық тұрмысы үшін жайлы
жағдай биологиялық қауіп-қатерден тиімді қорғаудың мемлекеттік саясаты жүргізілген
кезде ғана жасалынатын болады.
Қазіргі кезде Қазақстан Орталық Азия аумағында биологиялық қауіпсіздік
проблемаларын шешу бойынша көшбасшы болып табылады, сондай-ақ ұлттық және
халықаралық проблемаларды шешу үшін қажет ғылыми және материалдық-техникалық
әлеуетке ие. Мемлекеттің жайлылығы мен тұрақтылығын қамтамасыз етудегі шешуші
сәттердің бірі болып биологиялық қауіпсіздік саналады, ал қауіпсіздік сауалдары қойылған
міндеттерді шешудегі ғылыми-инновациялық қатынаспен тікелей байланысты.
Өз қызметінің тарихында биологиялық қауіпсіздік проблемаларының ғылыми
зерттеу институты көптеген үлкен табыстарға қол жеткізді, көп елдерге танылды.
Институттың негізгі міндетіне молекулярлық биология және вирустардың, бактериялар
мен саңырауқұлақтың гендік инженериясы, торшалық биотехнология, молекулярлық
вирусология саласында биологиялық қауіпсіздікті қамтамасыз ету, емдеу, алдын алу және
диагностикалық препараттарды жасау үшін жаңа ғылыми білім алуға бағытталған
түбегейлі зерттеулер жүргізу, денсаулық сақтау саласы мен ветеринария үшін емдік,
диагностикалық және алдын алу препараттары бойынша қолданбалы зерттеулерді жүргізу
жатады.
Теңдессіз зертханалық құрал-жабдықтармен жабдықталған заманауи ғылыми
зертханалары бар институт қазіргі уақытта биологиялық қауіпсіздік және қолданбалы
биотехнология саласындағы өзекті мәселелерді шешеді. Сынақтық базасы жабдықталған
өнімдердің сынамасын, оларды өндіріске одан ары енгізу үшін жұмыс жүргізуге мүмкіндік
береді.
Заманауи өндірістік желінің барлығының арқасында институт агроөнеркәсіптік
кешенді бірқатар аса қауіпті ауруларға қарсы маңызды биопрепараттармен қамтамасыз
етеді. Тәуелсіздік алғалы бергі жылдарда институт Қазақстан Республикасы үшін өзекті
бағыттарда 20-дан астам ғылыми-техникалық бағдарламаларды табысты орындады.
Бағдарламаларды жүзеге асыру нәтижесінде Қазақстанда 1-ші рет А/Н5N1 жоғары
патогенді құс тұмауына қарсы инактивтендірілген вакцинасы жасалды, өндіріске ендірілді
және сатылуда, ол өз кезегінде Қазақстан Республикасындағы құс тұмауы бойынша
эпизоотологиялық және эпидемиологияқ жағдайдың тұрақтылығын қамтамасыз етуге
мүмкіндік беріп отыр. Бұдан бөлек, Қазақстанда бірінші рет Қазақстан Республикасының
денсаулық сақтау саласы үшін бағытталған, А/Н5N1 жоғары патогенді тұмауға қарсы
«KazFluvac» және А/Н1N1 пандемиялық шошқа тұмауына қарсы «ReFluvac» отандық
вакцианалары жасалды және өндіріске енгізілді. Осы зерттеулердің арқасында Қазақстан
Республикасы құс тұмауына қарсы өз вакцинасы бар 13 мемлекеттің және шошқа
тұмауына қарсы вакцинасы бар 5 мемлекеттің қатарына кіреді. Сонымен қатар, БҚПҒЗИның соңғы жетістіктерінің бірі болып туберкулезге қарсы келешегі бар вакцина жасау
табылады. Зертханалық зерттеулер мен еріктілерде вакцинаны клиникалық сынау олардың
5
алдын алу және туберкулез терапиясы үшін де жоғары протективті және иммуногендік
қасиеттерін көрсетті. Жуық арадағы уақытта Қазақстанда және Ресей Федерациясында
еріктілердің кеңейтілген қауымының қатысуымен клиникалық сынақтардың II-фазасын
өткізу жоспарлануда.
Өзінің Қазақстан халқына Жолдауында еліміздің Президенті Н.Ә. Назарбаев
дарынды жастар үшін жағдай жасаудың қажеттілігіне ерекше назар аударуда. Біздің
институтта жастарға айрықша көңіл бөлініп келеді. Бұл ұрпақтар сабақтастығын,
біліктілігі жоғары мамандарды дайындауды, дарынды жастарды тәрбиелеуге жағдай
жасауды қамтамасыз етуге қажет. БҚПҒЗИ-да 35-ке дейінгі жас мөлшеріндегі 62 мүшесі
бар жас ғалымдар кеңесі жұмыс істейді. БҚПҒЗИ-ның жас ғалымдары халықаралық
конференцияларға белсене қатысып келеді және түрлі республикалық байқаулардың
жеңімпаздары болып танылды. Ғылымның болашағы ғылыми зерттеулер мен
инновациялық және стандартты емес тұжырымдамаларға ұмтылыстарды жыл сайын өсіп
келе жатқан жас зерттеушілер мен ғалымдармен тығыз байланысты. Жас ұрпақтардың
болашағы ғылымды дамытудың келешегі мол жоспарларын жүзеге асырумен байланысты,
сондықтан да олар осы процесстің айқындаушы буыны болуға тиісті. Жас ғалымдардың
келешегі мол еңбектері одан ары дамытуға және коммерцияландырылуға ие болуға
міндетті.
Дарынды жастар жүзеге асыратын инновациялар есебінен қазақстандық
экономиканың одан ары өсімі мен дамуына кепілдік беруге болады. Осыған орай, бұл
конференцияның мақсаты болып БҚПҒЗИ-ның жас ғалымдарының шығармашылық
белсенділігін дамыту, оларды заманауи ғылымның өзекті мәселелерін шешуге тарту,
ғылыми-зерттеу қызметіндегі мүдде-қызығушылықтарын ынталандыру, жастардың
шығармашылық әлеуетін анықтау табылады. Біздің институт өзінің жас зияткерлерін және
шығармашылығы дарынды жастарын шынайы мақтан тұтады, оларға үлкен сенім артады,
жастардың ғылымы және тәжірибелік қызметіндегі қол жеткізілген табыстардың келешегі
кемелдене береді деп үміт артады.
Конференцияға қатысушылардың бәріне де жемісті жұмыс тілеймін.
ҚР БҒМ ҒК БҚПҒЗИ-ның
Бас директоры, профессор
А.Р. Сансызбай
6
ПРЕДИСЛОВИЕ
Развитие современного общества невозможно без полномасштабного развития науки
и техники, определяющего уровень становления и развития государства. Поэтому очень
важно динамичное и целенаправленное развитие науки, особенно для развивающихся
стран, к которым относится и Казахстан.
В своем Послании народу Казахстана Президент страны Н.А. Назарбаев определил
новые задачи для дальнейшего укрепления экономического благосостояния народа.
Основные ориентиры – это новое качество подготовки и системы обучения, проведение
научных исследований на мировом уровне и тесная взаимосвязь науки и инновационных
процессов.
Благодаря позитивным сдвигам Казахстан уже достиг заметных успехов в области
устойчивого социально-экономического развития. Важными элементами этого процесса
является формирование и поддержание благополучия, как человека, так и животного мира.
Благоприятные условия для жизни населения, могут быть созданы только при проведении
государственной политики эффективной защиты от биологических опасностей.
В настоящее время Казахстан является лидером в решении проблем биологической
безопасности на территории Центральной Азии и обладает необходимым научным и
материально-техническим потенциалом для решения национальных и международных
проблем.
Одним из ключевых моментов в обеспечении благополучия и стабильности
государства является - биологическая безопасность, а вопросы безопасности напрямую
связаны с научно-инновационным подходом в решении поставленных задач.
Научно-исследовательский институт проблем биологической безопасности за
историю своей деятельности достиг больших успехов, стал известен во многих странах.
Основными задачами института является проведение фундаментальных исследований в
области молекулярной биологии и генной инженерии вирусов, бактерий и грибов,
клеточной биотехнологии, молекулярной вирусологии, направленных на получение новых
научных знаний для обеспечения биологической безопасности, разработки лечебнопрофилактических и диагностических препаратов; осуществление прикладных
исследований по разработке лечебных, диагностических и профилактических препаратов
для здравоохранения и ветеринарии.
Институт, имея современные научные лаборатории, оснащенные уникальным
лабораторным оборудованием, в настоящее время решает актуальные задачи в области
биологической безопасности и прикладной биотехнологии. Экспериментальная база
позволяет проводить апробацию разработок для их дальнейшего внедрения. Благодаря
наличию современной производственной линии Институт обеспечивает потребности
агропромышленного комплекса актуальными биопрепаратами против ряда особо опасных
заболеваний. За годы независимости институтом успешно выполнено более 20 научнотехнических программ по актуальным для Республики Казахстан направлениям.
В результате реализации программ впервые в Казахстане разработана, внедрена и
реализуется инактивированная вакцина против высокопатогенного гриппа птиц A/H5N1,
что позволило обеспечить стабильность эпизоотической и эпидемиологической ситуации
по птичьему гриппу в Республике Казахстан. Кроме того, впервые в Казахстане были
разработаны и внедрены отечественные вакцины "Kazfluvac" против высокопатогенного
гриппа A/H5N1 и "Refluvac" против пандемического "свиного" гриппа A/H1N1,
предназначенные для здравоохранения Республики Казахстан. Благодаря этим
исследованиям Республика Казахстан входит в число 13 государств, располагающих
собственной вакциной против птичьего, и пятой страной, которая имеет свою вакцину
против свиного гриппа.
7
Кроме того одним из последних достижений НИИПББ является разработка новой
перспективной вакцины против туберкулеза. Лабораторные исследования и клинические
испытания вакцин на добровольцах показали их высокие протективные и иммуногенные
свойства, как для профилактики, так и для терапии туберкулеза. В ближайшее время
планируется проведение II-фазы клинических испытаний на расширенном контингенте
волонтеров в Казахстане и в Российской Федерации.
В своем Послании народу Казахстана Президент страны Н.А. Назарбаев особое
внимание уделяет привлечению и созданию условий для талантливой молодежи. В нашем
институте уделяется особое внимание молодежи. Это необходимо для обеспечения
преемственности поколений, подготовки высококвалифицированных кадров, создания
условий для воспитания талантливой молодежи. В НИИПББ функционирует Совет
молодых ученых, членами которого являются 62 сотрудника в возрасте до 35 лет.
Молодые ученые НИИПББ принимают активные участие в международных конференциях
и были победителями в различных республиканских конкурсах.
Будущее науки связано с молодыми исследователями и учеными, стремление
которых к научным исследованиям и разработке инновационных и нестандартных
концепций возрастают с каждым годом. Будущее молодого поколения связано с
реализацией перспективных планов развития науки и поэтому сейчас они должны стать
одним из определяющих звеньев этого процесса.
Перспективные разработки молодых ученых должны получать дальнейшее развитие
и коммерциализацию. Именно за счет инноваций, реализуемых талантливой молодежью,
можно гарантировать дальнейший рост и развитие казахстанской экономики.
В связи с этим целью настоящей конференции является развитие творческой
активности молодых ученых НИИПББ, привлечение их к решению актуальных задач
современной науки, стимулирование интереса к научно-исследовательской деятельности,
выявление творческого потенциала молодежи.
Наш институт искренне гордится молодыми интеллектуальными и творческими
талантами, возлагает на них огромные надежды, твердо верит, что достигнутые успехи
лишь начало долгого пути в научной и практической деятельности.
Желаю всем участникам конференции успешной и плодотворной работы.
Генеральный директор
РГП НИИПББ КН МОН РК, профессор
А.Р.Сансызбай
8
INTRODUCTION
Development of the modern society is impossible without full-scale development of science
and technology, which is define the level of development state. Therefore, dynamic and
purposeful development of science is very important, especially for the developing countries to
which Kazakhstan belongs also.
In the Address of the President of the Republic of Kazakhstan N.A. Nazarbayev to the
People of Kazakhstan defined new tasks for further strengthening of economic health of the
people. The main directions are a new quality of preparation and training systems, carrying out
the scientific research at the world level and close relationship of science and innovation
processes.
Owing to the positive changes Kazakhstan already achieved noticeable success in the field
of sustainable social and economic development. The important elements of this process are
formation and wellbeing maintenance both person and fauna. The favorable conditions for
population can be created only when carrying out a state policy of the effective protection against
biological hazards.
Nowadays, Kazakhstan is the leader in the solution of problems of biological safety on the
territory of the Central Asia and possesses necessary scientific and material and technical
potential for the solution of the national and international problems.
One of the key moments in ensuring wellbeing and stability of the state is biological safety,
and security is directly connected with the scientific and innovation approach in the solution of
assigned tasks.
Research institute for biological safety problems made great progress and became known in
many countries. The main tasks of the Institute is carrying out of fundamental researches in the
field of molecular biology and genetic engineering of viruses, bacteria and fungi, cellular
biotechnology, the molecular virology directed on obtaining of new scientific knowledge for
ensuring biological safety, development of curative and prophylactic and diagnostic preparations;
implementation of applied researches for development of medical, diagnostic and prophylactic
preparations for health care and veterinary science.
The Institute having the up-to-date scientific laboratories equipped with unique laboratory
equipment, nowadays the Institute solves urgent problems in the field of biological safety and
applied biotechnology. The experimental base allowing to carry out approbation of developments
for their further realization. Owing to existence of the modern production line the Institute
provides the needs of agro-industrial complex by the urgent biological products against especially
dangerous diseases. More than 20 scientific and technical programs for the actual directions of
the Republic of Kazakhstan are successfully executed at the Institute for years of independence.
As a result of programs implementation, for the first time in Kazakhstan, the inactivated
vaccine against high pathogenic avian influenza A/H5N1 virus has been developed, put to use
and realized that allowed to provide stability of an epizootic and epidemiological situation on
avian influenza in the Republic of Kazakhstan. Besides, for the first time in Kazakhstan domestic
"Kazfluvac" vaccine against high pathogenic avian influenza A/H5N1 virus and "Refluvac"
vaccine against pandemic "swine" influenza A/H1N1 virus for health care of the Republic of
Kazakhstan had been developed and realized. Owing to these researches the Republic of
Kazakhstan is among 13 states having own avian influenza vaccine and the fifth country which
has swine influenza vaccine.
Besides, one of the last achievements of RIBSP is development of new perspective vaccine
against tuberculosis. Laboratory researches and clinical tests of vaccines on volunteers showed
their high protective and immunogenic properties both for prophylaxis and for therapy of
9
tuberculosis. The carrying out of clinical tests II phase of on the expanded contingent of
volunteers in Kazakhstan and in the Russian Federation is planned soon.
The President of the Republic of Kazakhstan N.A. Nazarbayev in the Address to the People
of Kazakhstan attends to involvement and creation of conditions for talented youth. We attend to
youth at our Institute. It is necessary for ensuring continuity of generations, preparation of highly
qualified personnel, and creation of conditions for education of talented youth. Council of young
scientists which members are 62 employees aged till 35 years functions at the RIBSP. The young
scientists of RIBSP take active part in the international conferences and were winners in the
various republican competitions.
The future of science is connected with young researchers and the scientists, and aspiration
for the scientific researches and development of innovation and non-standard concepts increase
every year. The future of young generation is connected with realization of long-term plans of
development of science and therefore now they have to become one of the defining links of this
process.
Perspective development of young scientists has to gain further development and
commercialization. At the expense of the innovations realized by the talented youth, it is possible
to guarantee the further growth and development of the Kazakhstan economy.
In this connection, the purpose of this conference is development of creative activity of
young scientists of RIBSP, involvement them to the solution of the urgent problems of the
modern science, stimulation of interest to research activity, identification of creative potential of
youth.
Our institute sincerely is proud of the young intellectual and creative talents, repose them
huge hopes and firmly believes that the achieved success only the beginning of long way in
scientific and practical activities.
I wish to all participants of conference of successful and fruitful work.
RIBSP SC ME&S RK Director General,
professor
A.R. Sansyzbay
10
УДК 579.864.1:615.331
СОЗДАНИЕ КОНСОРЦИУМА НА ОСНОВЕ ШТАММОВ LACTOBACILLUS
Абитаева Г.К., Бекенова Н.Е., Нағызбекқызы Э., Ануарбекова С.С.
РГП «Республиканская коллекция микроорганизмов»
Резюме. В данной статье представлены результаты создания пробиотического
консорциума на основе активных штаммов L. fermentum ATCC-9338 B-RKM 0018, L.
rhamnosus 11 LB и L. brevis 4 LB. При получении консорциумов нами учитывались такие
параметры как антагонистическая и адгезивная активность.
Введение. Пробиотики на основе лактобактерий позволяют достигнуть
выразительного лечебно-профилактического эффекта в самом широком спектре
заболеваний [1].
Исследования, связанные с прямым влиянием пробиотиков на кишечный эпителий,
уже привели к важным результатам, полученным in vitro и in vivo, и серьезному
подтверждению гипотезы, что употребление пробиотиков может улучшить
функционирование кишечного барьера у здоровых людей, и таким образом усилить
устойчивость природного механизма защиты от инфекций [2].
Бактерии рода Lactobacillus играют значительную роль в желудочно-кишечном
тракте человека, поэтому наши исследования были направлены на создание консорциума
лактобактерий, который имеет активный пробиотический потенциал.
Материалы и методы. В качестве обьектов исследования служил консорциум
пробиотических штаммов из L. fermentum ATCC-9338 B-RKM 0018, L. rhamnosus 11 LB и
L. brevis 4 LB.
L. rhamnosus 11 LB и L. brevis 4 LB выделены из различных традиционных казахских
молочнокислых продуктов (айран и кумыс) и индентифицированы до вида на основании
анализа нуклеотидной последовательности 16S rRNA гена. L. fermentum ATCC-9338 BRKM 0018 был взят из музейного фонда Республиканской коллекции микроорганизмов.
Все штаммы обладают высоким биологическим эффектом и являются кандидатами в
пробиотики.
Оценка биосовместимости
Исследование биосовместимости молочнокислых бактерий проводили методом
совместного культивирования в модификации Глушановой Н.А. [3].
Антагонистическую активность лактобацилл определяли по отношению к тестштаммам, из музея Республиканской коллекции микроорганизмов: Escherichia coli 157,
Serratia marcescens 221F, Proteus vulgaris 177, Staphylococcus aureus 209P, Candida albicans
ATCC-885-653, Salmonella typhimurium TA 98, Str. pyogenes (клинический изолят), методом
отсроченного антагонизма [4].
Адгезивность штаммов изучали в системе in vitro на формалинизированных
эритроцитах человека 0 (1) (Rh+) по методике В. Брилиса [5].
Результаты и обсуждение. Эффективность пробиотических препаратов
определяется совокупностью биологических свойств штаммов, входящих в состав
препаратов. Повышение и расширение спектра биологической активности
лактосодержащих пробиотиков может быть достигнуто за счет разработки препаратов на
основе консорциума, включающих совместимые и взаимодополняющие штаммы.
Большинство исследователей считают, что пробиотические препараты, основанные на
консорциуме различных видов бактерий, обладают более высокими терапевтическими
свойствами.
11
Наряду с общепринятыми критериями отбора штаммов в состав поликомпонентных
пробиотиков, важным является совместимость по биологическим свойствам, т.е. они не
должны подавлять друг друга при совместном культивировании. Поэтому первоначальным
этапом конструирования консорциума было изучение межвидового антагонизма
лактобактерий.
Выявлено три типа взаимодействия: биосовместимость – 50,4 % случаев, угнетение
роста одного штамма другим - 48,3 %, угнетение роста обоих штаммов - 1,3 %. По
результатам биосовместимости лактобактерий было создано 10 вариантов консорциумов.
По оценке максимального показателя жизнеспособности консорциумов отобран для
исследования вариант, включающий в свой состав L. fermentum ATCC-9338 B-RKM 0018,
L. rhamnosus 11 LB и L.brevis 4LB. Ни один из них не подавляет рост другого претендента
в пробиотики.
Ранее были изучены биологические свойства всех культур [6]. Отобранные штаммы
лактобактерий обладают широким спектром антагонизма к микроорганизмам,
вызывающие развитие патологического процесса, высокой и средней степенью адгезии,
резистентны к ряду антибиотиков. Штаммы обладают антилизоцимной, лизоцимной,
антиоксидантной и протеолитической активностью. Устойчивы к действию желчи,
кислоты и солевому стрессу.
Таким образом, вышеуказанные культуры лактобактерий обладают высоким
пробиотическим потенциалом и поэтому на их основе возможно создание консорциума,
обладающего высоким пробиотическим эффектом.
При отборе пробиотических культур лактобактерий следует обращать внимание на
штаммы с высокой антагонистической активностью по отношению к представителям
патогенной и условно-патогенной микрофлоры, и не активных в отношении
представителей нормофлоры.
Интересным представлялось оценка спектра активности консорциума и каждого
штамма, входящего в его состав, результаты представлены в таблице 1.
Как видно из таблицы 1, L. rhamnosus 11 LB и L. fermentum, входящие в состав
консорциума, наряду с самим консорциумом, проявили антагонистическую активность
высокой степени по отношению к патогенной и условно-патогенной микрофлоре. Штамм
L. brevis 4 LB не обладает антагонизмом лишь к C. albiсans, однако консорциум усиливает
ингибирующее действие в отношении кандид.
Таблица 1 - Показатели антагонистической активности
C. albiсans
Ser.
marcescens
Pr. vulgaris
Salm.
typhimurium
Str. pyogenes
St. aureus
L. fermentum ATCC9338 B-RKM 0018
L. brevis 4LB
L. rhamnosus 11 LB
Консорциум
Зона ингибирования тест-штамма, мм
E. coli
Наименование
13
7
3
15
13
10
10
35
20
32
20
16
20
0
12
12
30
22
23
25
30
31
25
30
17
13
20
27
Наиболее важным критерием для пробиотиков является способность лактобактерий
удерживаться на поверхности кишечного эпителия [7]. Результаты исследований Zhang W
et al. показали, что чем выше способность к адгезии, тем выше проявляется антимикробная
12
активность лактобацилл против патогенов. Адгезивную активность авторы связывают
наличием у лактобацилл S - слоя белков [8]. При изучении адгезивной активности
консорциума нами выявлено, что по степень адгезии к эритроцитам консорциума
значительно выше, чем у составляющих его штаммов (Рисунок 1).
Рисунок 1 – Адгезивная активность лактобактерий: средний показатель адгезии
нулевой от 0 до 1,0, низкий – 1,01-2,0, средний – 2,01-4,01, высокий – свыше 4,0
Выводы. Таким образом, сочетание L. fermentum ATCC-9338 B-RKM 0018, L.
rhamnosus 11 LB и L. brevis 4 LB показали более высокую биологическую активность в
сравнении с составляющими его штаммами, что делает его перспективным в качестве
пробиотического консорциума.
Список литературы
1. Indu Pal Kaur et al. Probiotics: Delineation of Prophylactic and Therapeutic Benefits / J.
Med Food. – 2009. - 12 (2), Р. 219–235.
2. Bourlioux P., Koletzko B., Guarner F. et al. The intestine and its microflora are partners
for the protection of the host: report on the Danone Symposium "The Intelligent Intestine," held
in Paris, June 14, 2002 // American J. of Clinical Nutrition. – 2003. – V. 78, Issue 4. – P. 675683.
3. Глушанова Н.А. Экспериментальное обоснование новых подходов к коррекции
микробиоценоза кишечника: Автореф. дисс. … д. м. н. – Москва, 2005. – 24 с.
4. Лихачева А.Ю. Биологические свойства лактобацилл и тест-системы для их
идентификации: Автореф. … канд. мед. наук. - Н. Новгород, 1992. – 21 с.
5. Бисимбаева С.К., Иманбаева М.И., Калина Н.В. и др. Методы определения
патогенных свойств возбудителей гнойно-воспалительных заболеваний: методические
рекомендации / под ред. Сарбасова Ш.И. – Астана, 2000. – 19 с.
6. Туякова А.К., Нагызбеккызы Э., Абитаева Г.К. и др. Изучение пробиотических
свойств новых штаммов // Биотехнология. Теория и практика. –2013. - № 4. – С. 55-58.
7. Kinoshita H et al. Proposal of screening method for intestinal mucus adhesive lactobacilli
using the enzymatic activity of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) // Anim
Sci J. – 2013. - V. 84(2). – Р. 150-158.
8. Zhang W., Wang H., Liu J. et al. Adhesive ability means inhibition activities for
lactobacillus against pathogens and S-layer protein plays an important role in adhesion //
Anaerobe. – 2013. - V. 22, Р. 97-103.
Түйін. Мақалада пробиотикалық консорциумды құруда L. fermentum ATCC-9338 BRKM 0018, L. rhamnosus 11 LB және L. brevis 4 LB белсенді штаммдарының нәтижелері
13
көрсетілген. Консорциумды алу кезінде антогонистік және адгезивтік белсенділіктерінің
параметрлері есептелді.
Summary. This article presents the results of creating a probiotic consortium on the basis
of active strains L. fermentum ATCC-9338 B-RKM 0018, L. rhamnosus 11 LB and L. brevis 4
LB. Upon receipt of consortia we considered parameters such as antagonistic and adhesive
activity.
УДК 579.61:615.33
НОВЫЕ ПРОБИОТИЧЕСКИЕ ПРЕПАРАТЫ НАПРАВЛЕННОГО ДЕЙСТВИЯ
Абитаева Г.К., Туякова А.К., Уразова М.С.,к.б.н.
РГП «Республиканская коллекция микроорганизмов»
Резюме. Разработаны два пробиотических препарата направленного действия:
«Пародонтальные стрипы» и пробиотический комплекс в форме свечей. В ходе проведения
доклинических испытаний препаратов на животных моделях была доказана их высокая
терапевтическая эффективность. Данные разработки рекомендуются для дальнейшей
коммерциализации с целью внедрения во врачебную практику специалистов узкой
направленности.
Введение. Пробиотики в современной медицине применяются в качестве средства
для моделирования иммунитета, для усиления общей колонизационной резистентности
организма, снижения аллергических реакций, для предупреждения и профилактики
развития воспалительных заболеваний и рака кишечника и т.д. Уже обязательным во
врачебной практике является назначение пробиотических препаратов после или
одновременно с антибактериальной терапией. Быстрому росту рынка пробиотиков также
способствует забота человека о собственном здоровье и желание участвовать в
профилактике заболеваний, чтобы избежать крупных расходов на здравоохранение. На
данный момент мировой рынок пробиотиков оценивается экспертами в 30 млрд. $ [1]. На
казахстанском фармацевтическом рынке пробиотики представлены производителями из в
ряда европейских стран и США, что сказывается на цене и низкой эффективности.
Производство отечественного препарата могло бы положительно сказаться на его
конечной стоимости, тем самым, гарантировав его успех у потребителей. Поэтому
конструирование и производство недорогих отечественных биопрепаратов на основе
автохтонных штаммов с доказанной терапевтической эффективностью для Казахстана
чрезвычайно важно.
В РГП «Республиканская коллекция микроорганизмов» были разработаны два
пробиотических препарата для различных областей медицины с доказанной
терапевтической эффективностью на животных моделях. Пробиотический препарат
«Пародонтальные стрипы» перспективный для стоматологической практики в качестве
лечебного и профилактического средства при воспалительных заболеваниях пародонта и
пробиотический комплекс для применения в отечественной гинекологической практике
при лечении бактериального вагиноза.
Материалы и методы. Штаммы лактобацилл, используемые в качестве
терапевтической основы биопрепаратов отбирались согласно критериям, предъявляемым к
пробиотикам: учитывались высокие показатели антагонистической активности по
14
отношению к патогенным микроорганизмам, высокая адгезивная активность,
соответствующие показатели кислотообразующей активности, устойчивость к факторам
внутренней среды организма. Выделены они были из соответствующих целевому
назначению биотопов клинически здоровых людей.
В результате основу препарата «Пародонтальные стрипы» составил консорциум из 4
штаммов: Lactobacillus casei subsp. rhamnosus, Lactobacillus casei subsp. casei, Lactobacillus
helveticus, Lactobacillus fermentum. Матрикс данного препарата состоит из желатина,
поливилпирролидона и глицерина.
Препарат пробиотический комплекс представлен двумя шмаммами L. salivarius,
L.fermentum на желатиново-глицериновой основе в виде свечи.
Эффективность препарата «Пародонтальные стрипы» была подтверждена на модели
хронического пародонтита, воспроизведенной на крысах с помощью трехмесячной
малобелковой диеты. Экспериментальные животные были разделены на 5 групп: 1.
животные, получающие лечение стрипами без внесения пробиотического консорциума
(контрольная группа); 2. животные, получающие лечение стрипами с консорциумом в виде
осажденной бактериальной массы; 3. животные, получающие лечение стрипами с
консорциумом в лиофилизированной форме; 4. животные, получающие лечение
препаратом Метрогил-Дента (группа сравнения); 5. животные, не получающие лечение
(контрольная группа). Аппликация препарата производилась на слизистую оболочку
полости рта опытных животных путем дозирования ее по размеру, соответствующему
очагу поражения [2].
Для установления эффективности пробиотического комплекса in vivo была
поставлена модель бактериального вагиноза, индуцированного антибиотиками
ампициллин и метронидазол, на лабораторных беспородных крысах, также разделенных на
5 испытательных групп, включая 2 контрольные. После окончания курса введения
антибактериальных препаратов крысам опытной I группы интравагинально вводили в
течение 10 дней по 200 мкл пробиотического комплекса с концентрацией лактобактерий
7,6х109 КОЕ/мл. Крысы II группы – контрольной, с 7-го по 17-й день ежедневно получали
свечи плацебо (желатиново-глицериновую основу без лактобактерий). В качестве
препарата сравнения использовали вагинальные свечи «Ацилакт» (III группа), IV группа
животных – это нелеченные крысы с бактериальным вагинозом. Животные V группы
параллельно с антибиотиками с первых дней опыта интравагинально в течение 10 дней
получали испытуемые пробиотические свечи [3].
Определение микробиоты в двух экспериментах производилось путем высева
образцов на плотные питательные среды: ЖСА, Сабуро, Эндо, МРС-4, СПА.
Бактериальные культуры идентифицировались по культурально-морфологическим,
биохимическим свойствам с применением бактериологического анализатора BioMerieux
Vitek2 Compact. В конце эксперимента животных забивали в каждой группе для
последующего гистоморфологического изучения тканей.
Результаты исследований. В доклинических исследованиях при хроническом
пародонтите была подтверждена высокая терапевтическая активность препарата
«Пародонтальные стрипы». Так уже на 8-10-е сутки наступало значительное улучшение
картины заболевания и как следствие улучшение общего состояния животных. В группе,
получавшей пробиотический консорциум в составе препарата отмечалось полное
очищение пародонтальных карманов, слизистые десен порозовели, наблюдалось
отсутствие синюшности тканей, улучшение микроциркуляции. Морфологические
исследования показали противовоспалительное и ранозаживляющие действие
разработанного пробиотического препарата. Наилучшие микробиологические показатели
были зарегистрированы в группах, получающих в качестве лечения пародонтальные
стрипы, содержащие пробиотический консорциум в виде осажденной бакмассы. Так титр
дрожжей снизился с 3×105 до 4×102 КОЕ/мл, при этом изначально они наблюдались в
15
образцах всех животных (12), а по окончании эксперимента лишь у единичных
экземпляров (2). Также снизился титр стрептококков в образцах с 2×107 до 3×104 КОЕ/мл,
стафилококков с 3х107 до 1,8х103 КОЕ/мл, резкий скачок произошел в понижении
энтеробактерий с 4х108 до 2х104 КОЕ/мл. К концу эксперимента наблюдалось также
появление лактобацилл, их титр составил 4х102 КОЕ/мл, хотя до начала эксперимента они
не высевались.
Следует отметить, что при применении геля Метрогил-Дента в качестве препаратасравнения обращали внимание изменения в мягких тканях, признаки расстройства
кровообращения,
дистрофические
изменения
покровного эпителия,
очаговая
воспалительная полиморфно-клеточная инфильтрация, как субэпидермально, так и
межмышечной строме. При этом препарат Метрогил-Дента является для стоматологии
общепризнанным [2].
При проведении микробиологических исследований в эксперименте на модели
бактериального вагиноза
наилучшие показатели по восстановлению нормальной
микрофлоры были отмечены в V группе, где животные получали пробиотический
комплекс параллельно с антибиотиками и далее до окончания эксперимента. В отличие от
результатов I группы крыс, в V не было обнаружено лактозонегативных эшерихий и
протей, также прослеживалось явное доминирование лактобактерий (3,6 lg КОЕ /мл). В
контрольных группах на 17-й день эксперимента регистрировался дисбиоз влагалища.
Исследования морфологии тканей влагалища крыс показало, что семидневное применение
антибактериальных препаратов привело к дистрофическим и начинающимся
метапластическим изменениям покровного эпителия (рисунок 1 А).
А
Б
Рисунок 1 - Морфологическая картина БВ на 7-е сутки эксперимента (А) и на фоне
лечения опытным пробиотическим комплексом на 17-е сутки (Б)
Применение пробиотического комплекса к концу курса лечения привело к
выраженному улучшению морфологической картины слизистой оболочки влагалища
животных I группы, уменьшению воспалительной инфильтрации тканей (1 Б).
Аналогичные результаты наблюдались и в V группе. В группе сравнения, получавшей
Ацилакт, морфологическая характеристика тканей стенки влагалища характеризовалась
выраженными
расстройствами
кровообращения
и
сохранением
умеренных
воспалительных изменений [3].
Выводы.
Таким
образом,
проведенные
микробиологические
и
гистоморфологические исследования в ходе доклинических испытаний разработанных
биопрепаратов показали их высокую терапевтическую эффективность, выражающуюся как
в нормализации микрофлоры биотопов, так и в снижении воспалительных признаков и
дегенеративных изменений в тканях. Данные препараты рекомендуются для применения в
качестве профилактических и лечебных средств во врачебной практике специалистов узкой
направленности.
16
Список литературы
1. Sanchez B., Urdaci M., Margolles A. Extracellular proteins secreted by probiotic bacteria
as mediators of effects that promote mucosa-bacteria interactions. // J Microbiology. - 2010. P.3232-3242.
2. Отчет о научно-исследовательской работе по проекту «Разработка технологии
получения биопрепарата для профилактики и лечения пародонтита» шифр 04.04.01.Т7, в
рамках НТП О. 0493 за 2009-2011 гг.
3. Отчет о научно-исследовательской работе по проекту «Разработка научных и
методических основ создания пробиотического комплекса для профилактики и лечения
бактериального вагиноза», в рамках ПФИ Ф. 0479. за 2009-2011 гг.
Түйін. Қолданысқа бағытталған екі пробиотикалық препарат жасалынып шықты:
«Пародонтальді стриптер» және пробиотикалық жинақ. Жануарлар модельдеріне
клиникаға дейін жүргізілген сынақ қорытындысы бойынша олардың жоғары терапевтік
әсері дәлелденді. Алынған өндеулерді дәрігерлік тәжірибесіне енгізу мақсатында
қаржыландыру ұсынылады.
Abstract. Two probiotic preparation directional "Periodontal strips" and рrobiotic complex
were developed. During pre-clinical trials of drugs in animal models their high therapeutic
efficacy were proved. These developments are recommended for further commercialization in
order to introduce into medical practice of narrow specialists.
УДК 619:578.821: 578.284
СОХРАНЯЕМОСТЬ ЛИОФИЛИЗИРОВАННОЙ ВАКЦИНЫ ПРОТИВ ОСПЫ
ВЕРБЛЮДОВ ПРИ РАЗНЫХ ТЕМПЕРАТУРНО-ВРЕМЕННЫХ РЕЖИМАХ
ХРАНЕНИЯ
Абсатова Ж.С., Мамбеталиев М., к.в.н., Ажибаев А.Ж., Килибаев С.С., Битешова
Э.Т., Валиева А.Д., Есимбекова Н.Б., Кенжебаева М.К., Табынов К.К.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме.
В
данной
работе
представлены
результаты
сохраняемости
лиофилизированной вакцины против оспы верблюдов из аттенуированного штамма «КМ40» при разных температурно-временных режимах хранения.
Введение. Изучение вопроса сохраняемости вакцинных препаратов представляет
важную практическую задачу, так как это в значительной мере определяет условия
производства вакцин, режимы хранения их и сроки использования [1, 2]. Из факторов,
влияющих на стабильность вирусов, большое значение имеет правильно подобранные
защитные среды и температура хранения. Залогом надежной стабильности сухих
биопрепаратов является применение в технологии их изготовления эффективных
защитных сред-стабилизаторов, предотвращающих повреждения микроорганизмов в
процессе замораживания, обезвоживания и длительного хранения в высушенном
состоянии при различных температурах [3]. Большинство вирусов лучше сохраняются при
низких температурах, однако, изучение их сохраняемости при более высоких
температурах преследует цель определения степени возможной инактивации при условии
культивирования и проведения различных этапов работ в процессе приготовления
биопрепаратов [4].
17
В связи с этим, целью данной работы было изучение сохраняемости
лиофилизированной экспериментальной серий вакцины против оспы верблюдов (ОВ) из
аттенуированного штамма «КМ-40» при разных температурно-временных режимах
хранения.
Материалы и методы. В работе использованы лиофилизированные с различными
стабилизирующими средами экспериментальные микросерии вакцин из аттенуированного
штамма «КМ-40» вируса ОВ. В качестве стабилизирующих сред в составе вакцин нами
использованы защитные среды после смешивания со стерильной вируссодержащей
эмбриональной суспензией вируса в соотношении 1:1 в конечных концентрациях: 6,5 %
пептон (группа II); 6,5 % пептон + 5 % сахароза (группа III); 3 % пептон + 0,5 % желатин +
3 % сахароза (группа IV) и обезжиренное коровье молоко (группа V). В опыте в качестве
контроля использовали суспензию вируса без защитной среды (группа I). Лиофилизацию
вакцин проводили в ампулах (объем лиофилизата 1 см3) в течение 22-24 ч в лиофильной
установке (Labconco, США) в автоматическом режиме при температуре минус 45-50 °С с
уровнем вакуума в камере лиофильной сушки 103 х 25-45 мбар. Лиофилизированные
ампулы заложили на хранение при температурах (37,0 ± 0,5) °С в течение 1, 3, 5, 10, 15, 50,
70 и 100 сут; (22,0 ± 2,0) °С в течение 5, 10, 15, 50, 70 и 100 сут; (6,0 ± 2,0) °С и минус (40,0
± 1,0) °С в течение 70, 100 сут.
Сохраняемость экспериментальных 3 микросерии вакцин против ОВ определяли
путем их титрования в первично-трипсинизированной культуре клеток почки ягнят (ПЯ)
выращенной в пробирках. Результаты титрования учитывали по проявлению
цитопатического действия (ЦПД) вируса. Титр вируса рассчитывали по методу Рида и
Менча [5].
Данные были анализированы с использованием программного обеспечения Prism
v.5.01 (GraphPad Software, Inc, Сан-Диего, Калифорния), и величины выражены как
средняя стандартная ошибка среднего значения. Статистическая значимость была
установлена на уровне значения Р<0,05.
Результаты исследований. Сохраняемость экспериментальной вакцины против
вируса ОВ с разными защитными средами в различных температурно-временных режимах
определяли путем титрования в культуре клеток ПЯ (рисунок 1).
а)
б)
18
в)
г)
а) сохраняемость вируса с разными защитными средами при (37,0 ± 0,5) °С в течение 1, 3,
5, 10, 15, 50, 70, 100 сут; б) сохраняемость вируса с разными защитными средами при
(22,0 ± 2,0) °С в течение 1, 3, 5, 10, 15, 50, 70, 100 сут; в) сохраняемость вируса с разными
защитными средами при (6,0 ± 2,0) °С в течение 70 и 100 сут; г) сохраняемость вируса с
разными защитными средами при минус (40,0 ± 1,0) °С в течение 70 и 100 сут.
Группа I - контроль (суспензию вируса без защитной среды); Группа II - 6,5 % пептон;
Группа III - 6,5 % пептон + 5 % сахароза; Группа IV - 3 % пептон + 0,5 % желатин + 3 %
сахароза; Группа V - обезжиренное коровье молоко в цельном виде.
Рисунок 1 - Сохраняемость аттенуированного штамма вируса ОВ с разными
защитными средами в различных температурно-временных режимах
На основании данных приведенных в рисунке 1, можно сделать вывод о том, что
сохраняемость экспериментальной вакцины против вируса ОВ напрямую зависит от
температурно-временных режимов хранения и вида защитной среды. При сравнительном
анализе контрольной группы (I) с испытуемыми (II, III, IV, V) при температуре (37,0 ± 0,5)
°С на 1 и 3 сут хранения существенных отличий по титру биологической активности не
отмечено (P>0,05). На 5, 10, 15, 50, 70, 100 сут хранения у II, III и V групп биологическая
активность вируса была существенно выше по сравнению с контрольной группой
(P<0,001), тогда как в IV группе на 70 и 100 сут хранения титр вируса был на одном уровне
с контрольной группой. Наилучшей сохраняемостью вируса обладает II группа (защитная
среда пептон в конечной концентрации 6,5 %), т.к. биологическая активность вируса на 10,
15, 50, 70 и 100 сут хранения была выше по сравнению с III и V группами (P<0,01)
(рисунок 1а). При анализе сохраняемости вируса ОВ при температуре (22,0 ± 2,0) °С также
установлено, что наилучшими защитными свойствами обладает группа II в связи с тем, что
уровень биологической активности по сравнению с контрольной группой был
существенно выше на 5, 10, 15, 50, 70, 100 сут хранения вируса (P<0,001). Тогда как у
групп III, V и IV существенное отличие титров биологической активности от контрольной
группы (P<0,001) отмечалось лишь с 15 сут для групп III, V и 50 сут для группы IV
(рисунок 1б). Анализ сохраняемости вируса ОВ при температурах (6,0 ± 2,0) °С и минус
(40,0 ± 1,0) °С на 70 и 100 сут хранения показал, что существенных отличий в испытуемых
группах II, III, IV, V между собой, а также по сравнению с контрольной группой не
отмечено (P>0,05) (рисунок 1в, рисунок 1г).
Выводы. Учитывая, полученные результаты и их подробный анализ нами для
дальнейшего использования в составе экспериментальной вакцины против ОВ выбрана
защитная среда пептон в конечной концентрации 6,5 % обладающая наибольшими
протективными свойствами при высушивании и хранении вакцины против вируса ОВ.
19
Список литературы
1. Токарик Э.Ф., Ковальская Л.А., Скотникова Т.А. и др. Методические подходы к
конструированию защитных сред для живых вирусных вакцин // Научные основы
производства ветеринарных препаратов. – М., 1989. – С. 17-21.
2. Токарик Э.Ф., Ковальская Л.А., Константинов В.М. Методы статистического
анализа в исследованиях по стабилизации вирусных вакцин. Достижения и перспективы
развития криобиологии и криомедицины // Тезисы докл. Межд. конф. Харьков, 1988. – С.
56.
3. Coller L.H. The preservation of smallpox vaccine // Treds. Biochem. Sci. – 1978. – Vol.
3(2). – P. 27-29.
4. Мастеница М.А. К изучению потерь вируса в процессе производства оспенной
вакцины // Сб. вопр. приклад. вирусол. и микробиол. – Томск, 1974, Т. 24. – С. 262-265.
5. Reed I.J., Muench H.A. A simple method of estimating fifty per cent endpoints // Am. J.
Hyd. – 1938. №27. – P. 493-497.
Түйін. Жұмыста әлсіретілген «КМ-40» штамынан әзірленген кептірілген түйе
шешегіне қарсы вакцинасының әртүрлі температуралық және уақыттық сақтау
тәртіптемесінің нәтижелері көрсетілген.
Summary. This work presents the results of persistence of lyophilized camelpox vaccine
from attenuated strain of camels "KM-40" at different time-temperature storage modes
УДК: 619:616.921.5; 636.91
ТЕХНОЛОГИЧЕСКИЕ АСПЕКТЫ КУЛЬТИВИРОВАНИЯ ВИРУСОВ
ГРИППА А И В ДЛЯ РАЗРАБОТКИ ТРЕХВАЛЕНТНОЙ СПЛИТ-ВАКЦИНЫ
ПРОТИВ СЕЗОННОГО ГРИППА
Акжунусова И.К., Асанжанова Н.Н., Табынов К.К.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. В данной работе представлены результаты исследований по определению
оптимальных параметров культивирования рекомбинантных штаммов A/NYMC X-217
(H3N2) и B/NYMC BX-49 вируса гриппа в куриных эмбрионах. Определено, что
максимальное накопление вирусов отмечается при следующих условиях культивирования:
возраст куриных эмбрионов - 9-11 суток, заражающая доза вируса – 1000-10000 ЭИД50,
температура и продолжительность инкубации – (34 ± 0,5) ºС и 48 часов, соответственно.
Введение. До настоящего времени наиболее эффективным средством профилактики
гриппа является вакцинация.
Все противогриппозные вакцины готовятся из актуальных штаммов вирусов,
рекомендуемых ежегодно ВОЗ, в связи с этим состав штаммов вирусов
противогриппозных вакцин меняется ежегодно.
Расщепленные (сплит-вакцины) содержат в составе поверхностные антигены (H и
N), а также набор внутренних антигенов вирусов гриппа, благодаря чему сохраняется их
высокая иммуногенность, при этом высокая степень очистки обеспечивает низкую
20
реактогенность, а значит хорошую переносимость и небольшое количество нежелательных
реакций.
В данной работе представлены результаты исследований по определению
оптимальных параметров культивирования рекомбинантных штаммов A/NYMC X-217
(H3N2) и B/NYMC BX-49 для получения высокоактивного вируссодержащего материала
(ВСМ), необходимого для разработки технологии изготовления сезонной трехвалентной
инактивированной сплит-вакцины против сезонного гриппа. Следует отметить, что
параметры рекомбинантного штамма NIBRG - 121хр (Н1N1), входящего в состав
трехвалентной вакцины против сезонного гриппа, были отражены в наших ранних
исследованиях [1,2].
Материалы и методы. Отрабатывались следующие параметры культивирования:
оптимальные инфицирующие дозы вирусов (апробировались дозы в пределах от 1 до
100000 ЭИД50), возраст куриных эмбрионов (КЭ; 9, 10, 11, 12, 13 сут), температуры (от 32
до 38 ºС) и сроки инкубирования (в течение 24-96 ч). Уровень накопления вируса
оценивали путем титрования в КЭ, постановкой реакции гемагглютинации (РГА) и
одиночной радиальной иммунодиффузии (ОРИД). Статистическую обработку проводили с
использованием статистической программы GraphPad Prism 6 (GraphPad Software, Inc., La
Jolla, CA, USA).
Результаты
исследований.
Максимальные
значения
инфекционной
и
гемагглютинирующей активности вируса были получены при использовании дозы для
штамма A/NYMC X-217 (H3N2) в пределах от 1000 до 10000 ЭИД50 и В/NYMC BX-49 от
1000 до 100000 ЭИД50 при этом установлено зависимость уровня накопления вируса от
дозы заражения.
Максимальное накопление вируса происходит при температуре (34 ± 0,5) ºС (Р <
0,05), что согласуются с литературными данными [1,2, 3].
По данным, представленным в литературе [4], и результатам собственных
исследований на репродукцию вируса гриппа (ВГ), в определенной степени влияет возраст
КЭ. Репродукция двух штаммов A/NYMC X-217 (H3N2) и В/NYMC BX-49 вируса гриппа
вне зависимости от возраста КЭ находится на высоком уровне: инфекционная активность
от (7,20 ± 0,14) до (9,16 ± 0,12) lg ЭИД50/см3; гемагглютинирующая от 322 ± 86,42 до 1290
± 345,45; содержание ГА от (7,53 ± 0,9) до (11,43 ± 0,49) мкг/мл; достоверность
результатов (Р < 0,05). Показана очень слабая корреляция (r=0,2) между значениями
титров ВГ по РГА и ОРИД штамма A/NYMC X-217 (H3N2) и слабая отрицательная
корреляция (r=-0,5) между гемагглютинирующей активности и содержанием
гемагглютинина. Таким образом, по результатам проведенных исследований для
выращивания штаммов A/NYMC X-217 (H3N2) и В/NYMC BX-49 рекомендуются КЭ 911-сут возраста, что согласуется с литературными данными [5, 6, 7].
При инфицировании 10-сут КЭ штаммами A/NYMC X-217 (H3N2) и В/NYMC BX49 наивысшее накопление вирусов отмечается на 48-96 ч инкубирования. В целях
сокращения продолжительности технологического процесса в качестве оптимального
срока был выбран режим с 48 ч инкубации. На основе проведенного сравнительного
анализа полученных результатов с данными научной литературы можно сделать вывод,
что срок инкубирования 48 является оптимальной для вируса гриппа [5, 7].
Представленные результаты показывают, что при оптимизации параметров
культивирования рекомбинантных штаммов A/NYMC X-217 (H3N2) и В/NYMC BX-49
вируса гриппа в КЭ достигнуты высокие показатели активности, которые не имели между
собой значимой разницы. Наиболее значимым преимуществом нашей работы является
определение накопления гемагглютинина в ОРИД в качестве дополнительного критерия
оценки. ОРИД позволяет характеризовать качество инактивированной гриппозной
21
вакцины (ИГВ) по концентрации ГА (в мкг/мл) в вакцинном препарате. В то же время
ОРИД обладает большой точностью и воспроизводимостью, меньшей зависимостью
результатов от условий постановки эксперимента, что позволяет отхарактеризовать строго
количественно все компоненты поливалентных гриппозных вакцин. Последнее
обстоятельство чрезвычайно важно для практики производства и контроля ИГВ и их
дальнейшего совершенствования [8].
Заключение. На основании проведенных исследований установлены оптимальные
условия культивирования рекомбинантных штаммов A/NYMC X-217 (H3N2) и В/NYMC
BX-49 в КЭ, включающие возраст КЭ, заражающую дозу вирусов, температуру и
продолжительность
инкубации,
соблюдение
которых
позволяет
получать
вируссодержащую суспензию с инфекционной и гемагглютинирующей активностью не
менее 7,0 lg ЭИД50/см3 и 1:256, соответственно, и содержанием ГА не менее 7,0 мкг/мл.
Достигнутая активность вирусов достаточна для приготовления трехвалентной
инактивированной сплит-вакцины против сезонного гриппа, отвечающей требованиям
ВОЗ.
Благодарность. Авторы работы выражают благодарность сотрудникам НИИПББ, а
именно Рыскельдиновой Ш.Ж., Кожамкулову Е.М., Инкарбекову Д.А., Гоцкиной Т.М. и
Кыдырбаев Ж.К. за оказанную помощь в определении параметров культивирования
вирусов гриппа, а также Касенову М.М. и Сарсенбаевой Г.Ж. за помощь в определении
концентрации гемагглютинина в ОРИД.
Список литературы
1. Табынов К.К., Мамбеталиев М.А., Ажибаев А.Ж., Бурашев Е.Д., Азанбекова М.А.
Оптимизация условий культивирования рекомбинантного штамма NIBRG-121хр вируса
гриппа на куриных эмбрионах // Актуальные проблемы и перспективы биологической
безопасности. - Гвардейский,2012. - С. 152-158.
2. Табынов К.К., Мамбеталиев М.А., Булатов Е.А., Абсатова Ж.С., Копоченя А.А.
Параметры культивирования референс-вируса гриппа NIBRG-121 на развивающихся
куриных эмбрионах SPF // Тез. докл. междунар. конф.» Противогриппозные вакцины
нового поколения». - Санкт-Петербург, 2009.- С. 78-79.
3. Егоров Ю., Медведева Т.Е., Полежаев Ф.И., Александрова Г.И., Гендон Ю.З.
Особенности получения и характеристика холодоадаптированного варианта вируса гриппа
А/PR/8/34 //Acta virol. – 1984. - 28:19-25.
4. Кыдырбаев Ж.К., Табынов К.К., Мамадалиев С.М., Молдагулова Н.Б. Параметры
культивирования вируса птичьего гриппа штамма A/домашний гусь/Павлодар/1/05 (H5N1)
на куриных эмбрионах. Journal of Agricultural Science of Kazakhstan 2007.- № 10.- С. 49-51
5. Ершебулов З.Д., Абдураимов Е.О., Рыскельдинова Ш.Ж., Кыдырбаев Ж.К.,
Мамадалиев С.М., Кожамкулов Е.М., Табынов К.К., Асанжанова Н.Н., Жугинисов К.Д.,
Таранов Д.С. Определение оптимальных параметров культивирования рекомбинантного
штамма А /Аstana RG/5:3/2009 // Биотехнология. Теория и практика. - 2010.- № 4. - С. 75 –
79.
6. Tabynov K, Kydyrbayev Z, Sansyzbay A, Khairullin B, Ryskeldinova S, Assanzhanova
N, Kozhamkulov Y. and Inkarbekov D. Immunogenic and Protective Properties of the First
Kazakhstan Vaccine against Pandemic Influenza А (Н1N1) pdm09 in Ferrets // Virologica sinica.
- 2012. - № 27 (6):345-352.
7. Ewasyshyn M.E., Sabina L.R Allantoic fluid protease activity during influenza virus
infection // Acta virol. – 1986. - 30:109-118.
22
8. Кастрикина Л.Н., Бижанов Г.И., Лонская Н.И., В.Ф. Попов В.Ф. Изучение
стабильности инактивированной гриппозной вакцины в процессе хранения // Вопросы
вирусологии. – 1990. - № 1. – С. 68-70.
Түйін. Бұл жұмыста тұмау вирусының A/NYMC X-217 (H3N2) және B/NYMC BX-49
рекомбинантты
штамдарының
тауық
эмбриондарында
үйлесімді
баулудың
параметрлерінің зерттеулерінің нәтижелері көрсетілген. Тағайындалды, вирустың ең көп
жинағы: тауық эмбриондарының – 9-11 тәуліктік жасында, вирустық жұқтырушылық
дозасының мөлшері -1000-10000 ЭИД50/эмбрионға, температуралық жағдайда өсіру – (34 ±
0,5) ºС және өсіру ұзақтығы 48 сағат, сәйкесінше.
Abstract. This paper presents the results of studies to determine the optimal parameters of
the cultivation of influenza virus recombinant strains A/NYMC X-217 (H3N2) and B/NYMC
BX-49 in chicken embryos. It was determined that the maximum accumulation of viruses is
observed at the following culture conditions: age of chicken embryos – 9-11 days, the dose of
virus infecting - 1000-10000 EID50, the temperature and duration of incubation - (34 ± 0.5) º C
and 48 h, respectively.
УДК 619:576.8.09
ГЕНЕТИЧЕСКИЙ АНАЛИЗ ВИРУЛЕНТНОГО ГЕНА
СПОРУЛЯЦИИ СИГМА ФАКТОРА (SIGK) CLOSTRIDIUM PERFRINGENS,
ВЫДЕЛЕННЫЙ ОТ САЙГАКОВ
Акылбаева К.К., Шораева К.А., Тленчиева Т.М., Садикалиева С.О.,Строчков В.М.,
Султанкулова К.Т. к.б.н., Сандыбаев Н.Т. к.б.н., Сансызбай А.Р. д.в.н.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. В данной статье представлены результаты по молекулярно-генетическому
анализу вирулентного гена sigK бактерии Clostridium perfringens, выделенные от сайгаков
на территории Республики Казахстан.
При проведении генетического анализа нуклеотидных последовательностей гена sigK
бактерии Clostridium perfringens, выделенных в разные годы было выявлено, что изолят
выделенный в 2013 г. отличается от других казахстанских изолятов наличием нескольких
замен в нуклеотидной последовательности.
Полученные данные показали, что изоляты бактерии Clostridium perfringens,
выделенные в 2010, 2011 и 2012 гг. идентичны на 100 %, тогда как изолят выделенный в
2013 г. отличался, и степень сходства составило 97 %.
Введение. В современное время основное поголовье сайгаков, благодаря
принимаемым мерам по их охране, сохранилось только в Казахстане. Гибель животных за
счет техногенного и растительного отравления исключена в процессе токсикологического
исследования почвы, воды и геоботанического исследования растительного покрова [1].
В настоящее время основная роль в развитии смешанных септических и
респираторных инфекций сайгаков отводится бактериям, прежде всего Pasteurella
multocida и Сlostridium perfringens.
Clostridium perfringens является возбудителем пищевых токсикоинфекций человека и
животных, одним из возбудителей газовой гангрены. Синтезируют протеиназы,
23
лецитиназу, коллагеназу, гуалуронидазу и другие ферменты патогенности. Гены
энтеротоксинов Clostridium perfringens, которые отвечают за токсинообразования могут
находиться как на хромосоме, так и на плазмидах и являются транспозибельными
элементами [2].
До настоящего времени природа вирулентности бактерии Сlostridium perfringens
полностью не изучена. Данные о возможном характере распределения токсинов и генов в
геноме Сlostridium perfringens малочисленны. Имеются данные о том, что некоторые
штаммы Сlostridium perfringens при адаптации к другому виду хозяина повышают
вирулентность [3].
Известно, что в геноме Сlostridium perfringens имеются более 50 вирулентных генов,
в их число входит ген sigK – ген, отвечающий за споруляцию сигма фактора РНК [4].
Быстрому появлению пищевого отравления бактериями Сlostridium perfringens типа
А часто способствует процесс споруляции, в результате которого в большом объеме
синтезируется энтеротоксин. Этот процесс осущестляется с помощью четырех
альтернативных сигма-факторов: sigK, sigE, sigF и sigG. На сегодняший день были
показаны функции двух генов – sigK и sigE, необходимые для споруляции и производства
энтеротоксина. Гены, кодирующие споруляции сигма-фактора (sigK, sigE, sigF и sigG)
присутствуют не только в Сlostridium perfringens, но и во всех видах бактерии Сlostridium
perfringens [5].
Целью данной работы является проведение молекулярно-генетического анализа
вирулентного гена sigK бактерии Clostridium perfringens, выделенных от сайгаков на
территории Республики Казахстан.
Материалы и методы. Биоматериалы. В работе использовали изоляты бактерии
Clostridium perfringens, выделенные от сайгаков на территории Республики Казахстан в
2010, 2011, 2012 и 2013 гг.
Выделение бактериальной ДНК. Выделение ДНК проводили с использованием
коммерческого набора “PrepMan Ultra Sample Preparation Reagent” фирмы Applied
Biosystems, согласно протоколу производителя.
Постановка ПЦР. Амплификацию фрагментов ДНК генов бактерии Pasteurella
multocida проводили на термоциклере «GeneAmp PCR 9700», фирмы «Applied Biosystems»,
с использованием следующего праймера:
sigK-f
(CAATACTTATTAGAATTAGTTGGTAG)
и
sigK-r
(CTAGATACATATGATCTTGATATACC) [6]. Реакционной смеси была приготовлена
согласно протоколу набора «AccuPrime Taq DNA Polymerase High Fidelity»: 2,5 µl - 10X
ПЦР буфера, 1 µl каждого праймера (20 pmol/µl), 0,2µl - Taq DNA полимеразы, 4 µl - ДНК,
16,3 µl - H2O. Условия амплификации: 94ºC - 2 мин; 35 циклов 94ºC - 30 сек, 55ºC - 30 сек,
68 ºC - 1 мин, и 1 цикл 68ºC - 10 мин.
Анализ ПЦР продуктов. Детекцию ПЦР продуктов проводили на 2% агарозном геле в
1 х ТАЕ буфере с бромистым этидием.
Секвенирование
ДНК.
Секвенирование
ДНК
проводили
методом
дидеоксисеквенирования с использованием терминирующих дидеоксинуклеотидов (метод
Сенгера) на автоматическом 16-капиллярном секвенаторе Genetic Analyser 3130 xl, Applied
Biosystems. В качестве полимера для капилляров использовали РОР-7. Наработку
терминирующих продуктов ДНК проводили методом циклического секвенирования.
Сравнительный анализ нуклеотидных последовательностей генов проводили,
используя компьютерную программу BLAST.
Результаты исследований. Для достижения поставленной нами цели, первым
этапом была наработка гена sigK методом ПЦР. Результаты амплификации представлены
на рисунке 1.
24
М – Маркер, 1 kb, Invitrogen; о.к. – отрицательный контроль; 1, 2, 3, 4 – изоляты
бактерии Clostridium perfringens, выделенные от сайгаков в 2010, 2011, 2012 и 2013 гг.
Рисунок 1 – Электрофореграмма sigK гена бактерии Сlostridium perfringens,
выделенных от сайгаков в 2010-2013 гг.
В результате амплификации были наработаны продукты размером 643 п.о.
Для
проведения
генетического
анализа
была
определена
нуклеотидные
последовательности гена sigK бактерии Сlostridium perfringens методом секвенирования.
На рисунке представлены результаты сравнительного анализа гена sigK бактерии
Сlostridium perfringens, выделенных от сайгаков в 2010 году с изолятами, выделенными в
2011-2013гг.
Рисунок 2 – Сравнительный анализ гена sigK изолята бактерии Clostridium
perfringens, выделенный в 2010 г. с изолятами, выделенные в 2011, 2012 и 2013 гг. и с
данными Genbank
25
Полученные данные показали, что идентичность изолята бактерии Clostridium
perfringens, выделенного в 2010 г. с изолятами, выделенными в 2011 и 2012 гг. составляет
100 %, тогда как с изолятом выделенным в 2013 г. степень сходства составило 97 %.
Рисунок 3 – Сравнительный анализ по гену sigK изолята бактерии Clostridium
perfringens, выделенного в 2010 г. с изолятами выделенные в 2011, 2012, 2013 гг.
При проведении сравнительного анализа нуклеотидных последовательностей
казахстанских изолятов бактерии Clostridium perfringens, выделенные в разные годы было
выяснено, что изолят бактерии Clostridium perfringens, выделенный 2013 г. отличается от
других казахстанских изолятов наличием нескольких нуклеотидных замен в позициях 68,
148, 286, 309, 359, 368, 371, 388, 409, 421, 424, 457, 469, 475, 479, 487, 488, 493, 529,
соответственно.
Учитывая выявленные нуклеотидные отличия казахстанского изолята бактерии
Clostridium perfringens, выделенного 2013 г. от других казахстанских изолятов были
проведены сравнительные анализы аминокислотных последовательностей с данными
ГенБанк (рисунок 5).
26
Рисунок 4 – Сравнительный анализ гена sigK изолята бактерии Clostridium
perfringens, выделенного в 2013 г. с данными ГенБанк программой BLAST
Результаты
молекулярно-генетического
анализа
аминокислотных
последовательностей гена sigK бактерии Clostridium perfringens, выделенный в 2013 году
показало, что последовательности фрагмента данного гена генетически подобны на 99 %
фрагменту гена sigK штамма Сlostridium perfringens OY0904 (AB604085.1) и штамма
Сlostridium perfringens TGII003 (AB604083.1), а также на 97 % фрагментам гена sigK
штамма Сlostridium perfringens NCTC808 (AB477891.1) и штамма Сlostridium perfringens
BI-D2 (AB477863.1).
Аминокислотная последовательность казахстанского изолята выделенного 2013 г
отличается от аминокислотной последовательности других штаммов, была обнаружена
наличие аминокислотной замены – I498V (изолейцин→валин), характерной для штамма
Сlostridium perfringens OY0904 (AB604085.1) и наличие четырех аминокислотных замен K88R, D475E, I499V и S508P, характерные для штамма Сlostridium perfringens NCTC808
(AB477891.1).
Выводы. При проведении генетического анализа было выявлено, что идентичность
изолята бактерии Clostridium perfringens, выделенного в 2010 г. с изолятами, выделенными
в 2011 и 2012 гг. составляет 100 %, тогда как с изолятом выделенным в 2013 г. степень
сходства составило 97 %.
Молекулярно-генетический анализ аминокислотных последовательностей гена sigK
бактерии Clostridium perfringens, выделенный в 2013 году показал, что последовательности
фрагмента данного гена генетически подобны на 99 % фрагментам гена sigK штамма
27
Сlostridium perfringens OY0904 (AB604085.1) и штамма Сlostridium perfringens TGII003
(AB604083.1), а также на 97 % фрагмент гена sigK штамма Сlostridium perfringens
NCTC808 (AB477891.1) и штамма Сlostridium perfringens BI-D2 (AB477863.1).
Полученные результаты генетических исследований могут быть использованы в
производстве различных биопрепаратов нового поколения, рекомбинантных штаммов,
ДНК-вакцин и разработке мероприятий по улучшению эпизоотической обстановки и
снижению уровня биологической безопасности Республики Казахстан.
Список литературы
1. Абсатиров Г.Г., Таубаев У.Б., Кушалиев К.Ж., Какшиев М.Г., Нуртаева Ж.Т.,
Сарсенова Б.Б. Эколого-эпизоотологическое обоснование причин массовой гибели
сайгаков в западном Казахстане // Степи Северной Евразии: Материалы VI
Международного симпозиума. – 2013. – №5. – С. 68-72.
2. Charles L. Hatheway. Toxigenic Clostridia // Clinical Microbiology Reviews. -1990. – P.
66-98.
3. Sawires Y.S. and Songer J.G. Clostridium perfringens: Insight into virulence evolution
and population structure // Anaerobe. - 2006. – P. 23-43.
4. Lin B.C., Heller S. and Marco T. A molecular approach to the caracterization and
evolution of Clostridium perfringens type A field strains // American association of Swine
Veterinarians. – 2008. – P. 213-218.
5. Harry K.H., Zhou R., Kroos L., Melville S.B. Sporulation and Enterotoxin (CPE)
synthesis are controlled by the sporulation specific sigma factors sigE and sigK in Clostridium
perfringens // Journal of Bacteriology. – 2009. – P.2728-2742.
6. Chalmers G., Martin S.W., Prescott J.F., Boerlin P. Typing of Clostridium perfringens by
multiple-locus variable number of tandem repeats analysis // Veterinary Microbiology. – 2008. –
P. 126-135.
Түйін. Мақалада Қазақстан Республикасы аймағында киіктерден бөлініп алынған
Clostridium perfringens бактериясының sigK вирулентті генінің молекулалық-генетикалық
талдау жұмыстарының нәтижелері көрсетілген.
Әр жылдары бөлініп алынған Clostridium perfringens бактериясының sigK генінің
нуклеотидтік тізбегін генетикалық талдау жүргізу кезінде 2013 жылы бөлініп алынған
изолят қазақстандық өзге изоляттардың нуклеотидтік тізбектерінде бірнеше орын
ауыстырулар бар екені анықталды.
Алынған нәтижелер Clostridium perfringens бактериясының 2010, 2011 және 2012 жж.
бөлініп алынған изоляттар ұқсастығы 100 % құрады, ал 2013 ж. бөлініп алынған изолят
ерекшеленіп, тиісінше ұқсастық деңгейі 97 % тең болды.
Summary. This article presents the results of performed work on the molecular and genetic
analysis of a virulent gene sigk of bacteria Clostridium perfringens, isolated from the saiga in
Kazakhstan.
In carrying out the genetic analysis of nucleotide sequences of the gene sigK of bacteria
Clostridium perfringens, isolated in different years it was revealed that isolated isolate in 2013 is
different from other Kazakhstan isolates having multiple substitutions in the nucleotide sequence.
The obtained data showed that isolates of bacteria Clostridium perfringens, dedicated in
2010, 2011 and 2012 are identical for 100 %, whereas isolated isolate in 2013 was differ and
characterized by the degree of similarity 97%.
28
УДК 619:615.371:616.988.21
ИЗУЧЕНИЕ ИММУНОГЕННОСТИ ЭКСПЕРИМЕНТАЛЬНОЙ
ИНАКТИВИРОВАННОЙ ВАКЦИНЫ ПРОТИВ БЕШЕНСТВА ЖИВОТНЫХ
Алиева А.Б., Далбаев Н.К., Жилин Е.С, Баракбаев К.Б. к.в.н.
РГП «Научно-исследовательский институт проблем биологической
безопасности» КН МОН РК
Резюме. В работе представлены результаты изучения иммуногенных свойств
экспериментальной инактивированной вакцины против бешенства животных.
Установлено, что однократное внутримышечное введение вакцины кроликам индуцирует
выработку вируснейтрализующих антител, обеспечивающих невосприимчивость к
контрольному заражению вирулентным штаммом «CVS» вируса бешенства.
Введение. Бешенство относится к группе наиболее опасных антропозоонозных
инфекционных заболеваний, характеризующихся поражением центральной нервной
системы. По оценке Всемирной Организации Здравоохранения, бешенство входит в
пятерку инфекционных болезней, которые наносят наибольший социальный и
экономический ущерб. Инфекция из-за абсолютной летальности представляет
серьезнейшую проблему современной ветеринарии [1].
Многолетние попытки контролировать распространение бешенства среди диких
животных и бродячих животных путем снижения плотности популяции не дали
положительных результатов, в связи с чем наиболее перспективным направлением борьбы
с данной инфекцией является вакцинопрофилактика [2, 3]. Отсутствие в Казахстане
производства антирабических препаратов актуализирует вопрос разработки отечественных
средств профилактики инфекции. При производстве антирабических вакцин одним из
важных критериев качества изготавливаемого препарата является их иммуногенность.
В связи с вышеизложенным, в настоящей работе приведены результаты
исследований иммуногенности экспериментальной антирабической инактивированной
вакцины против бешенства животных.
Материалы и методы. Материалом для исследования служила экспериментальная
культуральная антирабическая инактивированная вакцина из штамма «VRC-RZ2»,
сорбированная на гидроокиси алюминия. В экспериментах использовались мыши белые,
беспородные, массой 10-14 г, кролики массой 2-2,5 кг.
Вакцинацию кроликов проводили внутримышечно и подкожно в область средней
трети шеи в объеме 1,0 см3. Мышам препарат вводили внутрибрюшинно в объеме 0,5 см3.
Клинические наблюдения за состоянием подопытных животных проводили на протяжении
всего срока исследований. Еженедельно отбирали пробы сывороток крови, которые
тестировали на наличие антител в непрямом варианте ИФА и реакции нейтрализации (РН).
Для оценки иммунологической протективности испытуемого препарата, через 21 сут
после вакцинации, проводили контрольное заражение животных штаммом «CVS»
интрацеребрально, в дозе 100-300 МЛД50. Расчет LD50 дозы вируса для контрольного
заражения проводили по методу Рида и Менча [4].
Результаты и обсуждение. В течение 14 сут после вакцинации животные каждой
группы оставались клиническими здоровыми. Результаты исследований сывороток крови
кроликов на наличие антител до иммунизации и после 7, 14, 21 сут представлены на
рисунках 1, 2.
29
Рисунок 1 – Результаты исследования сывороток крови кроликов в ИФА
Рисунок 2 – Результаты исследования сывороток крови кроликов в РН
Данные, представленные на рисунках 1, 2, свидетельствуют о том, что введение
экспериментальной антирабической вакцины кроликам индуцирует наработку
вируснейтрализующих и преципитирующих антител. Антитела выявляются в сыворотках
крови в обеих группах животных на 7 сут после вакцинации. К 21 сут титр антител в
группе получивших внутримышечную дозу вакцины, достигал в ИФА 1:4000, а величина
среднего геометрического титра антител в РН составила 1:56. В пробах сывороток крови,
отобранных в группе подкожно иммунизированных животных за весь срок наблюдения,
регистрировалось менее интенсивное накопление антител. Так, к 21 сут титр антител в
сыворотках крови, полученных от данной группы составил в ИФА 1:400 и 1:4 в РН.
Результаты
изучения
протективности
экспериментальной
культуральной
антирабической инактивированной вакцины представлены в таблице.
30
Таблица – Результаты протективности экспериментальной антирабической вакцины
Метод
иммунизации
Вид
животных
Объем
вакцины,
см3
Доза вируса
Кол –во
Протекштамма «CVS», животных, тивность,
МЛД50
выжило/в
%
опыте
кролики
1,0
300
10/10
100
в/м
п/к
кролики
1,0
300
4/10
40
в/б
мыши
0,5
100
20/20
100
Примечания: «в/м» - внутримышечный; «п/к» - подкожный; «в/б» - внутрибрюшинный
Из данных таблицы, следует, что при внутримышечном введении вакцины кроликам
и внутрибрюшинной иммунизации мышей отмечена 100 %-ная невосприимчивость к
заражению животных вирулентным штаммом «CVS» вируса бешенства. В тоже время,
подкожное введение вакцины кроликам предохраняло от заражения только 40 %
вакцинированных кроликов. Низкий уровень протективности при данном методе
вакцинации свидетельствует о недостаточной напряженности иммунного ответа, что
подтверждается
сравнительно
низкими
титрами
вируснейтрализующих
и
преципитирующих антител в сыворотках крови животных данной группы.
Согласно данным литературы, для создания напряженного иммунитета титр
вируснейтрализующих антител должен составлять 1:8-1:16 [5]. В проведенных нами
экспериментах получены соответствующие результаты, так при внутримышечной
вакцинации животных средний геометрический титр специфических антител в реации
нейтрализации в среднем составил 1:56, который предохранял всех животных
контрольного заражения.
Известно [6,7], что наиболее выраженный иммунитет наблюдается при иммунизации
животных внутримышечно и в меньшей степени иммуногенная потенция проявляется при
аппликации подкожно, с использованием адъювантов и соблюдением интервалов
иммунизации, что также соответствует результатам проведенных экспериментов.
Выводы
1. Однократная иммунизация экспериментальной инактивированной вакциной
против бешенства
кроликов индуцирует наработку вируснейтрализующих и
преципитирующих антител.
2. Внутримышечная иммунизация кроликов и внутрибрюшинная иммунизация
мышей предохраняет всех животных от контрольного заражения вирулентным штаммом
«CVS» вируса бешенства.
3. Подкожное введение вакцины кроликам защищает от контрольного заражения 40
% животных и свидетельствует о необходимости введения в состав вакцины
дополнительных адъювантов или проведения бустерной иммунизации для создания
напряженного иммунитета.
Список литературы
1. Шестоповалов А.М., Кисуринам И., Груздев К.Н. Бешенство и его
распространение в мире. // Журнал вопр. Вирус. – 2001, №2. С.7 – 12.
2. Winkler W. at al. Vaccination of foxes against rabies using ingested bats// Journal
Wildlife Diseases. 1975. – Vol. 11. – №3. – P. 382 – 388.
3. Perry B.D. The oral immunization of animals against rabies// The veterinary annual. –
1987. – Vol.29. – P.37 – 57.
31
4. Reed I.J., Muench H.A. A simple method of estimating fifty per cent endpoints // Am. J.
Hyd. – 1938. – 27. – P. 493 – 497.
5. Селянинов Ю.О., Цыбанов С.Ж., Недосеков В.В., Жестеров В.И., Горшкова Т.Ф.
Сравнение антигенных свойств инактивированных препаратов вируса бешенства. // Тезисы
конф. – г.Покров. – 1998, С.237 – 238.
6. Guidance for research on oral rabies vaccines and Field application of oral vaccination of
dogs against rabies, WHO Geneva. – 2007 (http://www.who.int/rabies)
7. Иванов B.C., Самуйленко А.Я., Титеричев В.И., Иванов И.В. Проявление
иммуногенной потенции антирабической вакцины из штамма Щелково-51 в зависимости
от места ее введения // Тезисы конф. – Щелково. – 2000. С. 33 – 36.
Түйін. Жұмыста жануарлар құтырығына қарсы тәжірибелік инактивтендірілген
вакцинаның иммуногендік қасиеттерін зерттеу нәтижелері көрсетілген. Вакцинаны
қояндарға бұлшық ет арасына бірреттік енгізу вируснейтралдаушы антидене түзілуіне
және құтырық вирусының вирулентті штаммы «CVS»-ке төзімділігі анықталды.
Summary. The paper presents the results of a study of the immunogenic properties of
experimental inactivated vaccine against rabies. It is found that the single intramuscular injection
of vaccine to rabbits induces a generation of virus-neutralizing antibodies, providing the
insusceptibility to control infection with virulent strain “CVS” of rabies virus.
УДК: 619:578.831.21:578.821.21.
ОЦЕНКА БЕЗВРЕДНОСТИ И РЕАКТОГЕННОСТИ АССОЦИИРОВАННОЙ
ВАКЦИНЫ ПРОТИВ ЧУМЫ МЕЛКИХ ЖВАЧНЫХ ЖИВОТНЫХ И ОСПЫ ОВЕЦ
Аманова Ж.Т., Таранов Д.С., Ершебулов З.Д., Булатов Е.А.,
Баракбаев К. Б., Сансызбай А.Р.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. В статье представлены результаты по изучению безвредности и
реактогенности экспериментальной ассоциированной вакцины против чумы мелких
жвачных животных и оспы овец, на лабораторных и естественно восприимчивых
животных. Результаты исследований показали, что подкожное введение ассоциированной
вакцины не вызывает реактогенности и нежелательных явлений в организме испытуемых
овец, кроликов и белых мышей.
Введение. Чума мелких жвачных животных (ЧМЖЖ) – РНК-содержащий вирус,
принадлежащий к роду Morbillivirus, семейства Paramyxoviridae, высоко контагиозная
вирусная
болезнь,
сопровождающиеся
конъюнктивитами,
геморрагическим
гастроэнтеритом, поражением лимфоидной системы и развитием пневмонии [1, 2].
Оспа овец (ОО) – ДНК-содержащий вирус, относящийся к семейству Poxviridae, роду
Capripoxvirus, острое контагиозное заболевание сопровождающиеся с папулезнопустулезными поражениями кожи и слизистых оболочек больных животных [3, 4].
В комплексе мер борьбы с ЧМЖЖ и ОО решающее значение имеет специфическая
профилактика. В связи с этим на протяжении многих лет против данных инфекций
применялись различные моновакцины, изготовленные на основе аттенуированных
32
штаммов [5, 6, 7]. Внедрение ветеринарную практику вакцинных препаратов,
изготовленных из аттенуированных штаммов возбудителей инфекционных болезней, ввела
за собой необходимость поисков возможности использования их в ассоциации с другими
вакцинами [8].
В то же время известно, что одним из важнейших вопросов упрощения и
оптимизации прививочного календаря, является создание поливалентных или
ассоциированных вакцин. При этом ассоциированные вакцины, составленные с учетом
возможности незначительного повреждающего действия при достаточно высокой
иммуногенности и оптимальности доз компонентов, входящих в этот препарат,
отличаются рядом преимуществ от моновакцин и находят все более широкое применение
ветеринарной практике [8, 9, 10].
В Казахстане, также как и в России для специфической профилактики ЧМЖЖ и ОО
разработана ассоциированная вакцина на основе существующих монопрепаратов против
данных инфекций.
В основном при разработке ассоциированных вакцин ветеринарных специалистов
интересует вопрос: не будет ли ассоциированная вакцина при применении обладать
излишней реактогенностью и оказывать вредное влияние на прививаемый организм.
Исходя из этого, целью настоящих исследований было определения безвредности и
реактогенности ассоциированной вакцины против ЧМЖЖ и ОО на лабораторных и
естественно восприимчивых животных.
Материалы и методы. Приготовление вакцины. На основе штамма «G-45MK»
вируса ЧМЖЖ и штамма «НИСХИ» вируса ОО приготовлены лабораторные серии сухой
культуральной ассоциированной вакцины.
Для получения вирусной биомассы ЧМЖЖ и оспы овец, проводили раздельное
культивирование вирусов с использованием культуру клеток ПЯ, выращенные в матрасах
стационарным методом. Культуру клеток инфицировали данными штаммами в дозах 0,01
и 0,1 ТЦД50/кл, соответственно и выдерживали при температуре 37 °С в течение 1 часа, для
контакта монослоя клеток с вирусом. По истечению контакта в матрасы с культурой
клеток вносили поддерживающую среду ПСП, с содержанием 2 % инактивированной
сыворотки КРС и 1 % глутамина в объеме 1/10 части матраса и культивировали в течение
6-9 сут. Ежедневно проводили визуальный контроль под световым микроскопом для
обнаружения характерных деструктивных изменений в монослое клеток. По достижению
цитопатического действия в монослое культуры клеток на 80-90 % матрасы замораживали
при минус 20 °С с последующим оттаиванием при комнатной температуре в течение 12-18
часов.
Полученные суспензии вирусов ЧМЖЖ и ОО объединяли 1:1 и добавляли защитную
среду, охлажденную до 4 ± 1 °С, в соотношении 1:1, с добавлением антибиотиков.
Содержимое сосуда тщательно перемешивали и разливали по 2,0 см3 в стерильные
ампулы. Затем ампулы помещали в металлические кассеты и проводили лиофилизацию в
сублимационной установке с последующим отпаиванием под вакуумом. До использования
ампулы с вакциной хранили при минус 20 ⁰C.
Определение безвредности и реактогенности вакцины
Для определения безвредности и реактогенности брали 10 ампул с вакциной. В
каждую ампулу вносили стерильный физиологический раствор в объеме, равном объему
до высушивания вакцины. После растворения содержимое всех ампул переносили в
стерильный стеклянный флакон и тщательно перемешивали. Полученную смесь
использовали для испытания без дополнительного разведения.
33
Ассоциированную вакцину испытывали на овцах, кроликах и белых мышах по 3
головы на опыт методом подкожного введения. При этом овцам вакцину вводили в объеме
5,0 см3 (125000 ТЦД50), кроликам по 1,0 см3 (25000 ТЦД50), а белым мышам 0,1 см3 (2500
ТЦД50). За испытанными животными вели ежедневное клиническое наблюдения,
осматривая место аппликации и общее состояние животных, а у овец и кроликов с
измерением температуры тела в течение 14 сут.
Результаты исследований. В результате исследования безвредности и
реактогенности вакцины на лабораторных животных, установлено, что испытуемая
ассоциированная вакцина против ЧМЖЖ и ОО безвредна и ареактогенна для белых
мышей при подкожном введении. На введение образцов ассоциированной вакцины у
кроликов не отмечалось повышения температуры тела (Рисунок 1) и не наблюдались
признаки отклонения от физиологической нормы в течение 14 сут (срок наблюдения),
кроме припухлостей до 1,5 см3 в местах аппликации образцов вакцины, которые
рассасывались в течение 4-6 сут.
40
Температура ºC
39,5
ОЖ № 1
39
ОЖ №2
ОЖ № 3
38,5
Контроль
38
Срок наблюдения
ОЖ – опытные животные
Рисунок 1−Температура тела кроликов, находившиеся в опыте по определению
безвредности и реактогенности ассоциированной вакцины
В результате испытаний ассоциированной вакцины ЧМЖЖ и ОО на естественно
восприимчивых животных (овцах) показали, что общее клиническое состояние
вакцинированных овец в течение срока наблюдение было в пределах нормы кроме
уплотнений в месте введения вакцины, которая постепенно исчезала в течение 3-5 сут. У
овец на протяжении всего срока наблюдения не отмечалось повышение температура тела
(рисунок 2).
34
Температура ºC
40
39,5
ОЖ № 1
39
ОЖ №2
ОЖ №3
38,5
Контроль
38
Срок наблюдения
ОЖ – опытные животные
Рисунок 2−Температура тела овец, находившиеся в опыте по определению
безвредности и реактогенности ассоциированной вакцины
Анализ полученных результатов свидетельствует, что при подкожном введении
ассоциированной вакцины животным, не выявлены признаки отклонения от
физиологической нормы, повышенная температурная реакция либо другие побочные
действия препарата на организм животных.
Следовательно, на основе анализа полученных результатов установлено, что
экспериментальная ассоциированная вакцина против ЧМЖЖ и ОО является безвредной и
ареактогенной для белых мышей, кроликов и овец.
Обсуждение результатов. В настоящее время доказано, что применение
ассоциированных вакцин, а также комплексной и ассоциированной иммунизации в
сравнении с многократными прививками различными монопрепаратами имеет
несомненные преимущества в плане значительного сокращения времени на создание
иммунитета одновременно к нескольким инфекциям, совершенствования громоздких схем
профилактических прививок и снижения аллергических реакций. Основными
преимуществами ассоциированных вакцин, комплексных и ассоциированных прививок
является то, что при этом резко сокращается число инъекций, а количество вводимых
антигенов не уменьшается [11, 12].
В связи с этим, в настоящее время перспективным направлением является
применение вакцинных препаратов с использованием ассоциированных вакцин.
Следует отметить, что в последние годы большое значение придается разработке
ассоциированных вакцин против ЧМЖЖ и ОО, так как данные заболеваний представляют
реальную опасность для животноводства многих стран, нанося ощутимый экономический
ущерб во время эпизоотий.
В свою очередь, вакцинные препараты наряду с высокой эффективностью, должны
обладать достаточной безвредностью и ареактогенностью. Так как, безвредность и
реактогенность вакцин, на сегодняшний день становится главнейшим условием их
применения.
Общеизвестно, что при определении безвредности и реактогенности вакцин, у
животных возможно появление отеков в местах аппликации и умеренная лихорадочная
реакция после применения вакцины, которые считаются приемлемыми последствиями
35
вакцинации. Но могут возникнуть и более серьезные осложнения, зависящие от вакцины
или от прививаемого организма. Вакцинируемое животное может обладать повышенной
чувствительностью к примеси какого-либо белка, загрязняющего вакцину или страдать
иммунологической недостаточностью. В то же время, возможно загрязнение вакцины
посторонними белками или токсинами и даже живыми вирусами и т.д, которые вполне
могут отрицательно влиять на прививаемый организм [13, 14].
Поэтому при определении безвредности и реактогенности профилактических
препаратов должны осуществляться комплексные научно-практические исследования,
позволяющие получить четкое представление о состоянии различных сторон
специфической и неспецифической реактивности организма и объективно оценить
профилактические возможности вакцин.
С этой целью провели исследования по определению ассоциированной вакцины
против ЧМЖЖ и ОО на безвредность и реактогенность.
Следует отметить, что аналогичные вакцины были разработаны в ряде НИИ России.
В частности Балышев В.М. и др. [12] разработали ассоциированную вакцину против
данных болезней из штаммов Б/5-96 вируса ОО и 45G37/35 вируса ЧМЖЖ. В
исследованиях безвредности и реактогенности в овцах вакцина обладала высокой
ареактогенностью и безвредностью для овец. Так же, Морозов Н.В. с соавт. [9] изучали
эффективность экспериментальной ассоциированной вакцины против ОО, ОК, и ЧМЖЖ
из штаммов «ВНИИЗЖ», «ВНИИЗЖ 2003», «ВНИИЗЖ» соответственно. Полученные
результаты свидетельствовали о возможности получение ассоциированной вакцины
против ОО, ОК, ЧМЖЖ культуральной сухой, которая может быть использована для
профилактической иммунизации овец. То есть, данная экспериментальная
ассоциированная вакцина обладала высокой иммуногенностью, безвредностью и
ареактогенностью для овец. В этом случае, полученные результаты исследований по
определению безвредности и реактогенности ассоциированной вакцины против ЧМЖЖ и
ОО сходятся с данными этих авторов. К тому же следует отметить, что полученный в
институте аттенуированный штамм «НИСХИ» вируса ОО и «G-45МК» вируса ЧМЖЖ,
которые являются одним из компонентов потенциальной ассоциированной вакцины, менее
реактогенны и безвредны по сравнению с другими штаммами данных вирусов. В наших
экспериментах не обнаружено ни одного случая повышения температуры тела и
отклонения от физиологической нормы. Следовательно, можно заключить, что
экспериментальная ассоциированная вакцина против ЧМЖЖ и ОО из штаммов «G-45МК
и «НИСХИ» соответсвенно, является менее реактогенной и безвредной для овец,
кроликов и белых мышей.
Выводы. По результатам проведенных исследований по изучению безвредности и
реактогенности экспериментальной ассоциированной вакцины против ЧМЖЖ и ОО на
лабораторных животных (кроликах и белых мышах) и естественно восприимчивых
животных (овцах) установлена, что ассоциированная вакцина против ЧМЖЖ и ОО
является ареактогенной и безвредной для овец, кроликов и белых мышей.
Список литературы
1. Gibbs, E.P., Taylor, W.P., Lawman, M.J.P., Bryant J. (1979). Classification of peste
des petits ruminants virus as the fourth member of the genus morbillivirus. // Intervirology II. pp.
268—274.
2. Murthy F.A., Fauquet C.M., Bishop D.H.L. et. al. (1995).Virus Taxonomy.
Classification and Nomenclature of Viruses.Sixth Report of the International Committee on
Taxonomy of Viruses. // Arch. Virol. -Suppl. 10.
36
3. Lefevre P.C. Sheep and goats pox // Ins. Elev. Med. Vet. pays trop. Prod. – 1982. P.171
4. Бочеренко В. А. Оспа овец и коз // - Харьков. – 2007. http://studentbank.ru
5.
Иванющенков В.Н., Кореба О.В., Кекух В.Г., Уфимцева Т.Н., Уфимцев К.П.,
Зайцев В.А., Курченко Ф.П. Биологические свойства вакцинного штамма НИСХИ вируса
оспы овец / Ветеринария, 1990, 8, с. 22-24.
6.
Диев В.И. Оспа овец и ее профилактика вакциной из штамма ВНИИЗЖ /
Современные аспекты патологии животных: докл. конф., посвящ. 40-лет. ВНИИЗЖ. Владимир, 1988, с.111-124.
7.
Балышев В.М. и др. Вирусвакцина против оспы овец сухая культуральная,
результаты разработки и производственных испытаний / Диагностика, профилактика и
меры борьбы с особо опасными, экзотическими и зооантропонозными болезнями
животных. Сб. ст.: Материалы Международной науч.-практ. конф., посвященной 75-летию
со дня рождения И.А.Бакулова / ГНУ ВНИИВВиМ. - Покров, 2000, с.131-133.
8. Идрисов Г. З. Иммуноморфологическая оценка новых моно- и ассоциированных
вакцин при различных способах введения их в организм сельскохозяйственных животных:
Дисс. на соиск. учён. степ. док. вет. наук. г. Владимир – 2008.
9. Мороз Н.В., Диев В.И., Капускин Е.В., Кукушкина М.С. Изучение антигенных и
иммуногенных свойств экспериментальной ассоциированной вакцины против оспы овец,
оспы коз и чумы мелких жвачных // Материалы международной научной конференции
«инфекционная патология животных», посвященной 50-летию фгу «ВНИИЗЖ» (21-24
октября 2008 г.). С. 266-271.
10. Кадымов Р.А., Сафаров Ю.Б. Ассоциированная и комплексная вакцинация
животных // - М., - 1974. - 271 с.
11. Фролов С.В. Разработка ассоциированной вакцины против инфекционного
бронхита кур и ньюкаслской болезни: Дисс. на соиск. учён.степ. канд. биол. наук. – г.
Владимир − 2000 г.
12. Разработка ассоциированной вакцины против оспы овец и чумы мелких жвачных
животных / В.М. Балышев, С.В. Парилов, Ю.Ф. Калантаенко, Т.Ф. Горшкова, А.Н. Жуков,
А.В. Гарькин, Л.И. Анисимова // Ветеринария.- 2010.- №9. - С. 21-24.
13. Рамон Г. Ассоциированные вакцины // 40 лет исследовательской работы. - М., 1962. - С. 18-21.
14. Кисленко В.Н., Колычев Н.М., Госманов Р.Г. Ветеринарная микробиология и
иммунология: учебник / Под редакцией проф. В.Н Кисленко.-4-е изд., перераб. и доп.-М.:
ГЭОТАР-Медиа, 2012. - 752 с.
15.
Разработка ассоциированной вакцины против оспы овец и чумы мелких
жвачных животных / В.М. Балышев, С.В. Парилов, Ю.Ф. Калантаенко, Т.Ф. Горшкова,
А.Н. Жуков, А.В. Гарькин, Л.И. Анисимова // Ветеринария.- 2010.- №9. -С.21-24.
Түйін. Мақалада ұсақ күйіс қайыратын малдар обасы (ҰКҚМО) мен қой күліне (ҚК)
қарсы қауымдастырылған тәжірибелік вакцинаның, зертханалық жануарлар (үй қояндары
мен ақ тышқандарда) мен вирустарға табиғи қабілетті жануарларда (қойларда) қауіпсіздігі
мен реактогенділігін анықтау барысында жүргізілген зерттеулердің нәтижелері
ұсынылған. Тері астына егу әдісін пайдалана отырып ҰКҚМО мен ҚК қарсы
қауымдастырылған вакцинасын ақ тышқандарға, үй қояндары мен қойларға егкенде,
вакцина аталған жануарлар үшін қауіпсіз және ареактогенді деп танылды.
Summary. The article presents the results on a study of harmlessness and reactogenicity of
experimental associated vaccine against peste des petits ruminants and sheep pox, on laboratory
37
and naturally susceptible animals. The results showed that subcutaneous injection of associated
vaccine did not cause the reactogenicity and adverse effects on the organism of tested sheep,
rabbits and white mice.
УДК 579.64:504.53.054+579.68:504.4.054+631.46
ОПТИМИЗАЦИЯ УСЛОВИЙ КУЛЬТИВИРОВАНИЯ АКТИВНЫХ
ШТАММОВ-НЕФТЕДЕСТРУКТОРОВ
Аюпова А.Ж., Сарсенова А.С. к.б.н., Молдагулова Н.Б. к.в.н.
РГП на ПХВ «Национальный центр биотехнологии» КН МОН РК
Резюме. В статье приведены результаты по оптимизации условий культивирования
активных штаммов-нефтедеструкторов в зависимости от температуры, значениии рН
среды и срока культивирования.
Введение. В ходе добычи и последующей переработки нефти происходит достаточно
серьезное загрязнение природной среды [1]. Наиболее перспективным методом очистки
почв от загрязнений нефтью и нефтепродуктами признан биологический метод, с
использованием
биопрепаратов
на
основе
природных
нефтеокисляющих
микроорганизмов. [2]. Одним из аспектов проблемы получения промышленных форм
биопрепаратов, отвечающих требованиям экономичности и эффективности, является
вопрос сохранения жизнеспособности и катаболической активности бактерий [3].
Организация
микробиологического процесса получения штаммов с высокой
катаболической активностью начинается с изучения физиологии исследуемого
микроорганизма: изучения характера питания микроорганизма, а также влияния внешних
факторов на состояние клеток и популяций. Вопросы эти выясняются путем оптимизации
исследуемого процесса. Основой для этого является культивирование микроорганизмов в
контролируемых и управляемых условиях.
Материалы и методы исследований. Объектами исследований являлись активные
штаммы нефтеокисляющих микроорганизмов из коллекции лаборатории экологической
биотехнологии.
Сырая нефть с месторождения Жанаталап, Атырауской области с плотностью 0,88
г/см3.
В работе использовали: сухой питательный агар (СПА); сухой питательный бульон
(СПБ); минеральная среда Ворошиловой-Диановой.
Отработку оптимальных условий культивирования проводили в зависимости от
значения рН, температурного диапазона и времени культивирования.
Для оценки углеводородокисляющей способности на воде культуральную жидкость
исследуемых штаммов вносили в количестве 0,1 мл в колбу со 100 мл морской воды с
добавлением 3% сырой нефти и культивировали на орбитальном шейкере в течение 14
суток.
Степень деструкции нефти в воде определяли методом ИК-спектрометрии на 14
сутки проведения эксперимента.
Результаты и обсуждение. Из рабочей коллекции микроорганизмов лаборатории
экологической биотехнологии отобраны 4 наиболее активных штамма нефтедеструктора –
Rhodococcus erythropolis В12, Rhodococcus sp B6, Rhodococcus sp B.22, Rhodococcus
38
erythreus В 31. Нефтеокисляющая активность отобранных штаммов микроорганизмов была
проверена путем их культивирования на морской воде с 3%-ным содержанием сырой
нефти.
Рисунок 1 - Деструкция нефти нефтеокисляющими штаммами микроорганизмов
Из результатов деструкции нефти (рисунок 1) видно, что наибольшей активностью
обладает штамм Rhodococcus erythropolis В12. Деструкция нефти при его культивировании
составила 92,7%. Штаммы Rhodococcus sp В22 и Rhodococcus sp В6 утилизировали 91,5 и
89% нефти соответственно. Наименьшую активность показал штамм Rhodococcus erythreus
В31, который использовал только 75,13% нефти. В контрольной пробе нефть также
подвергалась незначительным изменениям за счет выветривания легких фракций.
Оптимизацию условий культивирования исследуемых микроорганизмов проводили в
лабораторных условиях путем культивирования штаммов в колбах объемом 250 мл при
разных значениях температуры и рН среды.
Рост нефтеокисляющих микроорганизмов при разных значениях кислотности среды
определяли по изменению оптической плотности культуральной жидкости на 7 сутки
роста культур на питательной среде СПБ. Уровень рН среды устанавливали путем
добавления 1% раствора HCl или 3% KOH. Все изученные нефтеокисляющие
микроорганизмы показали слабый рост при рН среды 4 и 9, хорошо росли при диапазоне
рН среды 5,0-8,0. Наиболее оптимальным значением рН для культур является значение 78.
В следующей серии опытов нами испытан температурный диапазон при
культивировании штаммов-деструкторов. При этом культуры инкубировали при
температурах +240С, +280С, +320С и +360С (таблица 1).
Таблица 1 – Рост микроорганизмов в зависимости от температуры инкубирования
Наименование
штаммов
В6
В12
В22
В31
Оптическая плотность клеток на 7 сутки культивирования, ед. ОП 540
исходный
+240С
+280С
+320С
+360С
0,021±0,02 1,9±0,01 2,0±0,04
2,52±0,05
1,7±0,01
0,026±0,08 1,7±0,06 1,9±0,01
2,4±0,02
1,5±0,04
0,024±0,01 2,1±0,02 2,0±0,07
2,6±0,09
1,9±0,03
0,028±0,03 2,1±0,04 2,05±0,02 2,25±0,06
1,6±0,01
По табличным данным можно сделать вывод о том, что культуры хорошо
репродуцируются в диапазоне температур от +240С до +360С. Однако, максимальная
плотность культуры отмечается при температуре +320С.
39
После установления оптимальных условий культивирования определяли время
максимального накопления клеток. Для этого штаммы микроорганизмов культивировали
на cyхом питательном бульоне при температуре +320С при рН среды 7,5.
Таблица 2 - Время максимального накопления биомассы
Время,
часы
0
12
Титр клеток микроорганизмов, КОЕ/мл
В6
В12
В22
6
6
(1,15±0,21)×10 (2,61±0,25)×10
(1,83±0,39)×106
(3,42±0,21)×106 (5,61±0,25)×106
(4,83±0,39)×106
В31
(4,15±0,42)×106
(7,15±0,42)×106
24
(2,19±0,52)×107
(3,26±0,53)×107
(5,41±0,16)×107
(2,92±0,15)×107
36
(2,46±0,31)×109
(5,25±0,15)×109
(5,92±0,72)×109
(4,47±0,49)×109
48
(6,81±0,35)×109
(6,44±0,81)×109
(7,99±0,92)×109
(3,83±0,23)×109
60
(6,32±0,14)×109
(4,87±0,64)×109
(8,13±0,47)×109
(4,15±0,37)×109
72
(5,19±0,41)×108
(8,15±0,32)×109
(6,22±0,51)×109
(3,42±0,11)×109
По результатам исследований установлено, что время максимального накопления
клеток для штаммов В6 и В12 является 48 часов, а для культур В22 и В31 - 60 часов. На 72
час культивирования микроорганизмов наблюдается снижение титра клеток
микроорганизмов.
Выводы. Отобраны штаммы с наибольшей деструктивной активностью, способные
утилизировать нефть в пределах 75,13-92,7%. Штамм Rhodococcus erythropolis В12
обладает наиболее высоким показателем деструкции нефти и является перспективным
объектом при разработке экологически безопасных биопрепаратов используемых для
биоремедиации нефтезагрязненной воды. При изучении роста 4 штаммов
нефтеокисляющих
микроорганизмов
установлено,
что
все
изученные
углеводородокисляющие микроорганизмы проявили хороший рост при значениях рН
среды от 7-8, температуре 320С. При этом максимальное накопление клеток наблюдается
на 48-60 часы культивирования.
Список литературы
1 Пат. 2114071 Российская Федерация. Способ очистки почвы, природных и сточных
вод, загрязненных нефтью и нефтепродуктами, с использованием биопрепаратов /
Заявитель и патентообладатель Борзенков И.А. - № 97107716/13; заявл. 22.05.97; опубл.
27.06.98, Бюл. № 28 – С 3.
2 Андресон Р.К. Биотехнологические методы ликвидации загрязнений нефтью и
нефтепродуктами. - М.: ВНИИОЭНГ. – 1993. – С.24.
3 Петриков К.В., Власова Е.П., Ветрова А.А., Овчинникова А.А., Понаморева О.Н.,
Алферов В.А., Пунтус И.Ф., Филонов А.Е. Получение сухой формы биопрепарата для
очистки от нефтяных загрязнений и изучение его свойств при долговременном хранении //
Известия ТулГУ. Естественные науки. – 2010. – №1. - С.186-195.
Түйін. Мақалада белсенді мұнай тотықтырғыш штамдардың оптималды өсіру
жағдайларын, ортаның температурасынан, рН және өсу мерзімдеріне байланысты
келтірілді.
40
Summary. The results of active oil destroying bacterial strains growth condition
optimization in dependence of temperature, pH of area and cultivation period were described.
УДК 633.11.324/327:578.0
ИСПОЛЬЗОВАНИЕ МОЛЕКУЛЯРНО - ГЕНЕТИЧЕСКИХ МАРКЕРОВ В
ГЕНОТИПИРОВАНИИ СОРТОВ ОЗИМОЙ ПШЕНИЦЫ
Базылова Т.А., Уразалиев К.Р., Абекова А.М.
ТОО «КазНИИ земледелия и растениеводства
АО «КазАгроИнновация», e-mail: t.bazylova @mail.ru
Резюме. Использование молекулярных (ДНК) маркеров открывает перспективы для
изучения генетической природы количественных признаков путем маркировки локусов,
определяющих их развитие и на этой основе практического повышения эффективности
методов селекции.
Введение. В Программе Правительства РК на 2010–2014 годы одним из
приоритетных направлений по переходу к устойчивому развитию экономики, ее
модернизации и диверсификации являются развитие биотехнологии.
Использование молекулярных (ДНК) маркеров открывает перспективы для изучения
генетической природы количественных признаков путем маркировки локусов,
определяющих их развитие и на этой основе практического повышения эффективности
методов селекции. Это направление связано с развитием современного подхода МАS
(marker assisted selection).
Маркерная селекция - сильный инструмент, для ускорения селекции, а также сейчас
ее применяют в борьбе с экологическими проблемами (загрязнение, изменение климата, и
т.д.) и новые социальные требования для высококачественных и более безопасных
сельскохозяйственных продуктов.
Ускорение селекционного процесса благодаря применению биоинженерных
технологий и селекции на основе ДНК-маркеров позволит сократить создание сортов
растений на 3-5 лет, при обычном сроке 10-12 лет, ускорить сортосмену, снизить затраты
на создание сорта на 15-20%.
Материалы и методы. Сорта озимой пшеницы отдела зерновых культур (Алмалы,
Стекловидная 24, Жетысу, Аруана, Наз, Карасай, Арап, Майра, Сапалы, Фараби, Рассад,
Нуреке, Юбилейная 60)
Геномную ДНК выделяли из зерна с использованием СТАВ - методом. Качество
выделенной ДНК определяли электрофорезом в 2 % агарозном геле в присутствии
бромистого этидия [1]. Полученную ДНК растворяли в 10мм трис- HCl-буфера, pH 8.0,
1мM
EДТА. ПЦР-анализ проводили в амплификаторе «Eppendorf Mastercycler»
(Германия).
Параметры амплификации были следующие: предварительная денатурация при 94 oс
в течение 10 минут, затем 30 циклов: 95oс - 40с, 60oс - 40с, 72oс – 40с и начальный этап
элонгации цепи 72oс- 10мин [2,3].
Идентификацию генов Lr осуществляли с использованием метода полимеразной
цепной реакции с праймерами, маркирующими гены Lr21, Lr32. Праймеры отбирали на
основании литературных данных. Гели окрашивали бромистым этидием и
41
фотографировали
(Франция).
с помощью
гельдокументирующей системы «Quantum ST -4 »
Результаты исследований. С помощью диагностических молекулярных маркеров,
сцепленных с известными генами устойчивости к бурой ржавчине Lr21 был проведен
скрининг образцов ДНК 9 сортов озимой пшеницы (Triticum aestivum L.).
ПЦР-анализ показал присутствие гена Lr 21 у 4 из 9 изученных сортов озимой
пшеницы: Карасай, Фараби, Рассад, Нуреке. Праймер Lr 21 находится на расстоянии
соответствующего ему фрагмента амплификации, который составляет 130 п.н.
Применение молекулярных маркеров позволяет решить проблему устойчивости к
бурой ржавчине в одном генотипе, опираясь не на фенотипическое проявление, а
непосредственно на генетическую основу [4].
Был проведен ПЦР-анализ на устойчивость к бурой листовой ржавчине Lr32 у
12 сортов озимой пшеницы (Triticum aestivum L.).
ПЦР-анализ показал присутствие искомого гена у 5 из 12 изученных сортов озимой
пшеницы: Наз, Арап, Майра, Фараби, Рассад. Праймер Lr 32 находятся на расстоянии
соответствующего ему фрагмента амплификации, который составляет 120 п.н. , [5].
Хлебопекарное качество гексаплоидных пшеницы является сложным признаком. В
своей работе мы использовали STS-маркеры ДНК в качестве, инструмента определения
различий сортов пшеницы по хлебопекарным качествам. Высокомолекулярный глютенин
кодируются комплексом локусов, Glu-1, на длинном плече группы-1 гомеологичной
хромосомы A, B и D геномов. Эти маркеры являются очень важными при отборе пшеницы
для качества хлебопечения.
1
2
3
4
5
6
7
8
9
10
11 12 13 14 15 16
1-Ladder; 2 – Стекловидная 24; 3 - Алмалы; 4 - Жетысу; 5 – Карасай; 6 - Наз; 7 - Арап; 8 Майра; 9 - Сапалы; 10 - Фараби; 11- Рассад; 12 - Нуреке; 13- Юбилейная 60; 14 Холостой, без ДНК; 15 - Стекловидная 24; 16 - Ladder
Рисунок 1 - Амплификация геномной ДНК озимой пшеницы с праймерами P1+Р2
Был проведен ПЦР 12 образцов озимой пшеницы c праймерами HMW (Р1 + Р2),
которые определяют хлебопекарные качества. Для наших селекционных материалов ТОО
«КазНИИЗиР» при амплификации с праймерами P1+Р2 ПЦР показал максимальное
количество полос (рисунок 1).
Это может свидетельствовать об относительном разнообразии генетических данных
селекционных материалов всех генотипов. Все изучаемые нами сорта являются 1Dx51Dx10 типами.
42
Выводы. Молекулярно-генетический анализ дает возможность выявить
специфические геномные маркеры, которые могут использоваться для селекции
генотипов. Целенаправленное использование специфических праймеров позволит
исследователям сократить затраты труда и средств, необходимые для анализа образцов. В
будущем селекция, основанная на молекулярных маркерах, может значительно увеличить
эффективность бридинга сельскохозяйственных культур.
Список литературы
1. Маниатис Т., Фрич Э., Сэмбрук Дж. Методы генетической инженерии.- М.: Мир. 1984.- 479 с.
2. Ahmad M. Molecular marker-assisted selection of HMW glutenin alleles related to
wheat bread quality by PCR-generated DNA markers // Theor Appl Genet. – 2000. – Vol. 101. P. 892-896.
3. Ma W., Zhang W., Gale K.R. Multiplex-PCR typing of high molecular weight glutenin
alleles in wheat // Euphytica.- 2003. - Vol. 134. - P. 51-60.
4. Беспалова Л.А., Васильев А.В. Применение молекулярных маркеров в селекции
пшеницы в Краснодарском НИИСХ им. П.П.Лукьяненко // Вавиловский журнал генетики
и селекции, 2012, т.16, №1/
5. McIntosh R.A., Wellings C.R., Park R.F. Wheat Rust (An Atlas of resistance genes).
CSIRO. Australia, 1995.
Түйін. Қолдану молекулалықтардың ( ДНК ) локустын таңбалаулары
таңбалағыштарды жолмен сандық белгілердің генетиқалық табиғат зерттеуіне арналған
болашақтарды ашып жатыр,олардың дамуы анықтаушылардың және мына негізде
селекция әдістерінің нәтижелілік практикалық жоғарылаулары .
Summary. The use of molecular (DNA) markers provides prospects for the study of the
genetic nature of quantitative trait loci by marking defining their locit, and the increase in
efficiency of breeding.
УДК: 619:616.98:578:636.32/.38.:636.39
ВЫЯВЛЕНИЕ ЛЕНТИВИРУСНЫХ ИНФЕКЦИЙ МЕЛКИХ ЖВАЧНЫХ
В ПОПУЛЯЦИЯХ МЕЛКОГО РОГАТОГО СКОТА
Барышникова Е.И., кандидат биологических наук
Колбасова О.Л., кандидат биологических наук
ГНУ ВНИИВВиМ Россельхозакадемии, г. Покров, Россия
Введение. Артрит-энцефалит коз и висна-маеди, объединенные в одну общую
группу (лентивирусы мелких жвачных), занимают значительное место в эпизоотическом
процессе среди всего разнообразия вирусных болезней мелких жвачных животных.
Симптомокомплекс поражения трех систем органов (центральной нервной системы,
суставов и легких) у коз и овец описан во многих странах мира [3, 4, 5]. Чаще АЭК
встречается в районах интенсивного козоводства – Европе, Австралии, США и др. В
естественных условиях болезнь поражает коз (в основном козлят в возрасте 1–5 месяцев) и
овец [2, 3].
Актуальность данной проблемы в нашей стране стала возрастать в связи с переходом
многих фермерских хозяйств на альтернативное животноводство (из-за неблагополучной
43
ситуации по африканской чуме свиней), к которому относится козоводство и овцеводство.
Кроме того, стало возрастать употребление в пищу диетических продуктов из козьего и
овечьего молока, в частности - мягкие сыры и другие кисло-молочные продукты.
Источником возбудителя служат инфицированные животные, как с клиническими
проявлениями болезни, так и на стадии инкубационного периода. По данным зарубежных
авторов основной путь передачи между животными – потребление инфицированного
молозива и молока козлятами и ягнятами, или прямой контакт с инфицированными
животными при их скученном содержании, а также транспортировка инфицированных
животных на раннее благополучные территории. Не исключен и вертикальный путь
передачи.
Диагноз на ЛМЖ базируется на основании эпизоотологических, клинических,
патоморфологических данных и результатов лабораторного исследования.
Лабораторная диагностика ЛМЖ включает в себя использование серологических,
вирусологических и молекулярно-биологических методов [2].
Основной целью данной работы являлось исследование проб молока, крови и
сыворотки крови от мелкого рогатого скота на наличие генома ЛМЖ при проведении
мониторинговых исследований за период с 2012 по 2014 гг.
Материалы и методы. В качестве материала для проведения данных исследований
были взяты пробы молока, крови и сыворотки крови от мелкого рогатого скота из частных
хозяйств различных регионов Российской Федерации и республики Беларусь,
поступивших с 2012 по 2014 гг. в ГНУ ВНИИВВиМ Россельхозакадемии.
Исследования по выявлению генома вируса АЭК осуществляли при помощи
«Набора препаратов для выявления генома лентивирусов мелких жвачных методом
полимеразной цепной реакции», разработанного в ГНУ ВНИИВВиМ Россельхозакадемии
[1]. Для анализа первичной последовательности амплифицируемых ПЦР-продуктов
использовали метод нуклеотидного секвенирования на приборе Applied Biosystem Genetic
Analyser 3130 XL (СШA) с набором компонентов BigDye Terminator kit 3.1 (Applied
Biosystem, СШA). Полученные последовательности сравнивали с опубликованными
последовательностями, представлеными в базе данных GenBank.
Для выявления антител к лентивирусам мелких жвачных использовали тест-системы
ID Screen Indirect ELISA for the detection of anti-MVV/CAEV antibodies in serum samples
фирмы ID.VET и тест-системы LSIVet Ruminant MAEDI-VISNA/CAEV-Serum
Immunoenzymatic test for specific detection of anti-gp 135 antibodies to CAEV and VISNAMAEDI in ovine/caprine serum фирмы LSI.
Результаты исследований. За период с 2012 по 2014 гг. в ГНУ ВНИИВВиМ
Россельхозакадемии исследовано методом ПЦР и ИФА 2713 проб молока, крови и
сывороток крови из частных хозяйств Астраханской, Брянской, Воронежской, Калужской,
Ленинградской, Московской, Нижегородской, Пензенской, Рязанской, Тверской,
Тульской, Тюменской, Ярославской, областей, Республике Башкортостан, Республики
Удмуртия Российской Федерации и республике Беларусь.
За период 2012 г. из 241 поступившей на исследование пробы выявлено 47
положительных проб, доставленных из Ленинградской, Ярославской, Московской,
Брянской областях и Республике Беларусь (рис. 1). В 2013 г. из 2356 поступивших для
лабораторного исследования образцов было обнаружено 793 положительных пробы.
Данные образцы были доставлены из Астраханской, Воронежской, Ленинградской,
Нижегородской, Пензенской, Рязанской, Тюменской, Ярославской, Московской областях,
Башкортостане, Удмуртии и республике Беларусь (рис. 2). В период с января по март 2014
г. из 116 поступивших для исследования образцов из Ленинградской, Рязанской, Тульской,
44
Тверской, Московской областях, республике Чувашии и Республике Беларусь выявлена 21
положительная проба (рис. 3).
При исследовании 160 образцов молока и молозива методом ПЦР в двух образцах
выявлен геном лентивирусов мелких жвачных, в образцах сыворотки крови от этих же
животных были выявлены антитела к данному возбудителю. Согласно рекомендации МЭБ
(Международное Эпизоотическое Бюро) результаты всех ПЦР-положительных проб были
дополнительно подтверждены методом нуклеотидного секвенирования. Установлено, что
полученные нуклеотидные последовательности идентичны участку генома лентивирусов
мелких жвачных, представленным в Genbank.
Рисунок 1 - Результаты лабораторных исследований по выявлению лентивирусов
мелких жвачных за 2012 г
Рисунок 2 - Результаты лабораторных исследований по выявлению лентивирусов
мелких жвачных за 2013 г.
45
Рисунок 3 - Результаты лабораторных исследований по выявлению лентивирусов
мелких жвачных за 2014 г.
Выводы. При исследовании 2713 проб молока, крови и сывороток крови из
различных субъектов Российской Федерации в 859 образце выявлены антитела к
лентивирусам мелких жвачных, в двух образцах выявлен геном лентивируса мелких
жвачных, что подтверждено нуклеотидным секвенированием с последующим анализом
филогенетического древа.
С целью своевременного обнаружения вирусной инфекции и предотвращения
распространения лентивирусов мелких жвачных, а так же быстрого принятия ветеринарносанитарных мер по ликвидации данного заболевания необходимо своевременно проводить
лабораторно-диагностические исследования серологическими
и молекулярнобиологическими методами.
Список использованных источников литературы
1. Методические положения по выявлению провирусной ДНК лентивирусов мелких
жвачных методом полимеразной цепной реакции / Барышникова Е.И., Малоголовкин А.С.,
Колбасова О.Л., Цыбанов С.Ж. / РАСХН; ГНУ ВНИИВВиМ. – Покров, 2011.-13с.
2. Direct Evidence for Natural Transmission of Small-Ruminant Lentiviruses of Subtype
A4 from Goats to Sheep and Vice Versa / C. Shah, J.B. Huder, J. Buni, M. Schunmann, J.
Mahlherr, H. Lutz, J. Schapbach // Journal of Virology. – 2004. – Vol. 78, N. 14. – P. 7518 –
7522.
3. Ngatia, T.A. Occurrence and pathology of caprine arthritis – encephalitis in young goats
in Kenya / T.A. Ngatia, M.J. Njenga, P.G. Mbuthia // Bull. Anim. Health. Prod. Africa – 2005. –
Vol. 53, N.1. – P. 77 – 83.
4. The caprine arthritis–encephalitis virus is a distinct virus within the lentivirus group / A.
Gazit, A. Yaniv, M. Dvir, K. Perk, S.G. Irving and J.E. Dahlberg // J.Virol. – 1983. – Vol. 124. –
P. 192 – 195.
46
5. Transmission of small ruminant lentiviruses / B.A. Blacklaws, E. Berriatua, S.
Torsteinsdottir, N.J. Watt, D. Andres, D. Klein, G.D. Harkiss // Vet. Microbiol. – 2004. – Vol.
101. – P.199 – 208.
Resume. Diagnosing of Lentivirus diseases in small ruminants is combined of
epidemiological data, clinical symptoms, pathomorphological changes and laboratory assays. The
last ones include serological, virological, and molecular biological tests.
Commercial ELISA kits and PCR kit developed in SSINRRIVV&M of RAAS were used
by authors in their research. Within the research 2713 samples of milk, blood, and serum from
various regions of Russian Federation were assayed. As a result, antibodies against Small
ruminant Lentiviruse were revealed in 859 samples, as well as 2 samples contained genome of
the Caprine arthritis encephalitis virus. PCR data have been confirmed by nucleotide sequencing
and phylogenetic tree analysis afterwards.
УДК 619:616.9:57.063.8
ОПРЕДЕЛЕНИЕ ПАТОГЕННОСТИ ШТАММА
«PASTEURELLA/SAIGAS/2011/ZKO/KZ» НА ЛАБОРАТОРНЫХ ЖИВОТНЫХ
Безрукова А.Н. м.в.н., Жилин Е.С., Кайсенов Д.Н., Зинина Н.Н. к.в.н.,
Строчков В.М., Еспембетов Б.А. к.в.н.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. Изучена степень патогенности штамма Pasteurella/Saigas/2011/ZKO/KZ на
мышах. Установлено, что минимальная заражающая доза вызывающая 100% гибель
животных составляет 25 микробных клеток. Учитывая высокую патогенность штамма,
предлагается использовать данную культуру в качестве контроля, при проверке
иммуногенности разрабатываемых противопастереллезных вакцин, с использованием в
качестве лабораторных моделей - мышей
Введение. Одной из основных причин массового падежа сайгаков, согласно
официальным данным МСХ РК, стала пастереллёзная инфекция [1-4]. Сотрудниками
НИИПББ выделены изоляты возбудителя болезни Pasteurella/Saigas/2011/ZKO/KZ,
Pasteurella/Saigas/2010/ZKO/KZ из патологического материала от павших животных.
Проведена идентификация и дифференциация Pasteurella/Saigas/2011/ZKO/KZ,
что
соответствует P.multocidа и подвиду multocidа серотипу В [5].
Известно, что заболеваемость и летальность при пастереллезе могут сильно
варьировать в зависимости от вирулентности возбудителя, иммунологического фона стада,
условий содержания и кормления, наличия сопутствующих инфекций и своевременности
проведения оздоровительных мероприятий [6].
Для определения степени патогенности изолятов пастерелл в литературе описывается
тест, заключающийся в подкожном введении мышам суточной культуры, в десятикратных
разведениях. Результаты данного теста характеризуют штамм по степени патогенности.
Наиболее патогенные штаммы пастерелл, при разведении до 10-100 микробных клеток, в
100% случаях вызывают гибель животных [7-9].
Задачей настоящих научных исследований явилась оценка степени патогенности
штамма Pasteurella/Saigas/2011/ZKO/KZ, для рассмотрения вопроса о возможности
47
применения данной культуры в качестве контроля, при проверке иммуногенности
противопастереллезных вакцин с использованием в качестве лабораторных моделей мышей.
Материалы и методы. Для изучения вирулентных свойств штамма
Pasteurella/Saigas/2011/ZKO/KZ использовалась культура Pasteurella multocida (Р.М.).
Восстановление
вирулентных
свойств
штамма
Pasteurella/Saigas/2011/ZKO/KZ
осуществляли на белых мышах, путем трехкратного пассирования, с использованием
суточной бульонной культуры, в объеме 0,5 см 3 при подкожном введении, в область
средней трети спины. Из органов павших животных проводили высевы на селективные
питательные среды Brain heart infusion agar (BHIA) (Titan media) и Brain heart infusion broth
(BHIB) (Titan media). Определение концентрации микробных клеток в суточной культуре
проводили с использованием оптического стандарта мутности (10 Ед) ГИСК им.
Тарасевича. Готовили ряд последовательных разведений пастерелл от 1×10 9 до 1 м.к. в 0,5
см3 физиологического раствора, для подкожного заражения мышей, живой массой 16-18 г.
Осуществляли ежедневное наблюдение за экспериментальными животными, регистрируя
клинические отклонения от нормального состояния мышей. Степень патогенности
изучаемого штамма соответствовала разведению культуры пастрелл, при котором
отмечалась 100 % гибель животных и выражалась в LD100.
Из органов павших мышей проводили высевы на среды BHIA, BHIB, а также
готовили мазки на предметном стекле. Фиксированные препараты окрашивали по
Романовскому-Гимзе и Граму для оценки морфометрических характеристик.
Специфическая идентификация культуры осуществлялась полимеразной цепной
реакцией (ПЦР) с применением коммерческого набора Bactotype (Германия) и
синтезированным в НИИПББ набором праймеров на капсидный ген (КMT). При
выделении ДНК из образцов использовали набор – QIAamp DNA Mini Kit, QIAGEN,
Hilden [10,11].
Для изучения сохранения патогенных свойств и проверки жизнеспособности
пастерелл суточная бульонная культура P.M. с использованием питательной среды
Nutrient Broth (NB) (Himedia) с 50% глицерином заложена на хранение (1, 3, 6, 12, 18 мес).
Статистическая обработка результатов исследований выполнялась с использованием
программы GraphPad Prism 5.0.
Результаты исследований и обсуждение результатов. Освежение бактериальных
закладок Р.М., проводили путем первоначального высева на BHIA и BHIВ, с дальнейшим
использованием их при трехкратном пассировании суточной бульонной культуры на
мышах. При этом с повышением пассажного уровня отмечали снижение сроков гибели
мышей от 24 ч до 16 ч после заражения и повышение смертности животных от 70 до 100
%. Результаты эксперементов представлены в таблице 1.
Таблица 1- Результаты опытов по восстановлению вирулентных свойств пастерелл
Пассажный
уровень
1
2
3
Количество мышей
в опыте
10
10
10
Срок наступления
гибели, ч
22-24
20-22
16-18
Смертность, %
70
90
100
У лабораторных животных в течение 12-18 ч отмечали угнетение
характеризующееся учащением дыхания, малоподвижностью и взъерошенностью
48
волосяного покрова. Через 16-24 ч после заражения экспериментальные мыши, имевшие
вышеуказанные признаки погибали.
В результате вскрытия мышей были установлены патологические изменения во
внутренних органах. Печень увеличена в объеме, с притупленными краями, коричневатого
цвета, дряблая. Сердечная сорочка заполнена мутным экссудатом. Сердечная мышца
дряблая. Легкие плотные с точечным кровоизлиянием. Селезенка увеличена, темнокрасного цвета, лимфатические узлы увеличены в объеме. При высевах из органов
(печень, легкие, селезенка, почки) и крови из сердца на питательные среды, через 12-16 ч
наблюдался рост культуры в виде слегка выпуклых, прозрачных колоний с голубоватым
оттенком, флуоресцирующих в проходящем свете.
При микроскопии выделенных культур и окрашенных по Граму наблюдались
граммотрицательные коккобактерии, расположенные одиночно, попарно, иногда в виде
коротких цепочек или беспорядочными скоплениями, а при окраске по Бурри и
Романовскому-Гимза обнаруживали огромное количество полиморфных биполярно
окрашенных палочек, что характерно для пастерелл.
После восстановления вирулентных свойств изучаемого штамма суточную культуру
далее использовали для оценки степени патогенности на беспородных белых мышах.
Результаты опытов представлены в рисунке 1.
Из данных рисунка 1, видно, что при введении животным 24 часовой культуры
пастрелл в концентрациях от 1×109 до 25 м.к. вызывает 100% гибель мышей. При дозах
15 и 20 м.к. смертность наблюдалась соответственно у 10-40% животных. Следовательно,
минимальная LD100 в трех независимых опытах составила 25 м.к. для мышей. При
микроскопии мазков-отпечатков и выросших культур из органов павших животных
зараженных штаммом Pasteurella/Saigas/2011/ZKO/KZ в дозе 25 м.к. выявлено наличие
грамотрицательных коккобактерий, подобных исходной культуре.
Рисунок 1 – Результаты оценки степени патогенности РМ на мышах
Специфическую идентификацию культуры осуществляли методом полимеразно цепной реакции. Результаты электрофореза ПЦР - продуктов в 2% полиакриламидном геле
ПААГ представлены на рисунке 2.
49
А
Б
Рисунок 2 – Результаты электрофореза ПЦР продуктов в 2 % ПААГ полученных с
помощью а - набор праймеров на капсидный ген (КMT), б - набор Bactotype, ДНК
испытуемой культуры пастерелл из органов мышей: 1 - сердце, 2 - селезенка, 3 - легкие, 4 печень, ПК – положительный контроль, М – маркер
Из выше представленного рисунка 2 следует, что вне зависимости от используемых
наборов ПЦР, образовывались ПЦР - продукты, профили которых в электрофорезе
соответствовали профилям образцов положительных контролей.
В последующих опытах изучалась жизнеспособность и вирулентные свойства
культуры Р.М. после хранения (1, 3, 6, 12, 18 мес).
Результаты проверки жизнеспособности закладок представлены на рисунке 3.
Рисунок 3 – Результаты оценки количества жизнеспособных клеток в закладках
микробной культуры РМ после хранения
Из данных рисунка 3 видно, что при хранении закладок Р.М. отмечается снижение
жизнеспособных клеток. Количество жизнеспособных микробных клеток в испытуемых
образцах по истечению 18 мес составило 1,5×108 м.к.
50
Восстановление вирулентных свойтв микробной культуры проводилось аналогично
вышеописанной методике. Установлено, что вирулентность востановленных культур РМ
после 0-18 мес хранения, соответсвует LD100 полученному ранее и составляет 25 м.к.
Уровень патогенности пастерелл выявленный в ходе экспериментальных работ для
мышей составил 25 м.к, что свидетельствуют о высокой патогенности изучаемого штамма
и является важной характеристикой для последующего сопоставления с уровнем
патогенности аттенуированных штаммов пастерелл [12].
При постановке ПЦР с использованием теста Bactotype с набором праймеров КМТ
гена выявлен кодирующий участок гена КМТ в исследуемых культурах от павших мышей
зараженных штаммом Pasteurella/Saigas/2011/ZKO/KZ в дозе 25 м.к., что подтверждает его
видовую специфичность [13].
Отработанный режим по поддержанию, хранению, проверке штамма, пассированию,
способствует быстрому восстановлению исходных свойств музейной культуры
Pasteurella/Saigas/2011/ZKO/KZ.
Выводы. 100% показатель смертности лабораторных животных отмечен в течение
16-18 ч на третьем пассаже при введение суточной бульонной культуры, исследуемого
штамма Pasteurella/Saigas/2011/ZKO/KZ
1. По степени вирулентности изучаемый штамм отнесен к высокопатогенным, так как
минимальная LD100 для мышей составляет 25 м.к.
2. Штамм Pasteurella/Saigas/2011/ZKO/KZ сохраняет жизнеспособность в течение 18 мес
на питательной среде NB с 50% глицерином и востанавливливает патогенность после
трехкратного пассирования на лаботорных животных.
3. Учитывая полученные результаты, предлагается использовать указанный штамм в
качестве
контроля,
при
проверке
иммуногенности
разрабатываемых
противопастереллезных вакцин с использованием в качестве лабораторных моделей –
мышей.
Список литературы
1. Грачев Ю.А., Бекенов А.Б. Массовая гибель сайгаков в Казахстане – погибло
около 12 000 особей // Saiga News– 2010. – Вып.11. – С. 2-3.
2. Lundervold M. Infectious diseases of saiga antelopes and domestic livestock in
Kazakhstan. // PhD Thesis, University of Warwick, UK.- 2001.
3. Минсельхоз Казахстана называет причиной гибели сайгаков в мае текущего года
пастереллез, http://kt.kz.
4. Слудский А.А., Бекенов А.Б., Жевнеров В.В., Капитонов В.И. и др. Род Сайга // В
кн.: Млекопитающие Казахстана. Парнокопытные (полурогие). – 1983. – Алма-Ата. – Т.4. Ч.3. – С. 55-92.
5. Орынбаев М. Б., Рыстаева Р. А., Керимбаев А. А. и др. Случаи массовой гибели
уральской популяции сайгаков в Казахстане// Ж. Актуальные вопросы ветеринарной
биологии, №1(17), Ст-П., С.20-26.
6. García N., Fernández-Garayzábal J. F., Goyache J.,Domínguez L., Vela A. I.
Associations between biovar and virulence factor genes in Pasteurella multocida isolates from
pigs in Spain // Veterinary Record (2011) 169, 362.
7. Dillehay D.L., Paul K.S., DiGicamo R.F., Chengappa M.M. Pathogenicity of Pasteurella
multocida A:3 in flemissh Giantand new Zeland White rabbits // Lab. Anim. - 1991. - Vol. 25. №4. -P. 337-341.
8. Сидоров М.А., Скородумов Д.И., Федотов В.Б.; Под ред. М.А. Сидорова
Определитель зоопатогенных микроорганизмов: справочник. - М.: Колос, 1995. - 201 204с.
51
9. Voigts A., Ngaisiue G., Henton M.M., Hubschle O.J.B. Haemor rhagicsepticaemia due
to P.multocida tupe В 2 in Namibia // Trop - anim - health - prod. - 1997. Vol. 29 ( 4 ). -P. 247 248.
10. Brito J.B., Piffer I. A., Wentz I., Brito M.A. Capsular types and toxin production by
shains of P.multocida isolated from pigs in Sontherer Brazil // Rev. Microbiol. -1993. - v.24. №
2. -p.94 - 97.
11. Ackermann M.R., Debey M.C., Register K.B., Larson D.J. &Kinyon J.M. Tonsil and
turbinate colonization by toxigenic and nontoxigenic strains of Pasteurella multocida in
conventionally raised swine. // J.Vet. Diagn. Invest. – 1994. – 6. – Р. 375–377.
12. Boyce, J.D., Adler, B., 2000, The capsule is a virulence determinant in the pathogenesis of
Pasteurella multocida M1404 (B:2), Infection and Immunity, vol 68 issue 6, American Society
for Microbiolgy, Washington USA, - P. 3463-3468.
13. Нефедченко А.В., Глотова Т. И., Глотов А. Г. Способ выявления патогенных штаммов
и изолятов бактерии pasteurella multocida (патент РФ № 2477321)
Түйін. PASTEURELLA/SAIGAS/2011/ZKO/KZ штаммы патогенділігіннің деңгейі
тышқандарда зерттелді. Жануарлардың 100% ажалын шақыратын шектік зақымдаушы
доза 25 микробтық торшаны қурайтыны анықталды. Штаммның жоғары патогенділігін
ескере отырып, аталынған культураны зертханалық үлгі ретінде тышқандарды пайдалану
арқылы пастереллезге қарасі жасалып жатқан вакцинаның иммуногенділігін тексеру
жезінде пайдалану усынылады.
Summary. The rate of pathogenicity of Pasteurella/Saigas/2011/ZKO/KZ strain on mice is
studied. It has been demonstrated that the minimal infected dose which causing 100 % animal
death was 25 of microbial cells. In consideration of high pathogenicity strain, it is offered to use
this culture as control for immunogenicity control of the developed pasteurellosis vaccine with
using mice as laboratory model.
УДК 579.864.1
ИЗУЧЕНИЕ ЗАКВАСОЧНЫХ СВОЙСТВ ШТАММОВ БАКТЕРИЙ РОДА
LACTOBACILLUS, ПЕРСПЕКТИВНЫХ В КАЧЕСТВЕ СТАРТЕРНЫХ КУЛЬТУР
ДЛЯ ПРОИЗВОДСТВА
КИСЛОМОЛОЧНЫХ ПРОДУКТОВ ФУНКЦИОНАЛЬНОГО ПИТАНИЯ
Бекенова Н.Е., Егинчибаева А.Д., Ануарбекова С.С.
РГП « Республиканская коллекция микроорганизмов», г. Астана
Резюме. Нами была проведена оценка кислотообразования 35 культур молочнокислых
бактерий. Изучена их ферментативная активность, а также органолептические и
текстуральные свойства продуктов ферментации. В результате отобраны 5 наиболее
активных штаммов лактобацилл.
Введение. Среди продуктов питания кисломолочные продукты – наиболее ценные,
благодаря своей высокой пищевой и биологической ценности, а также диетическим,
лечебным и вкусовым свойствам [1].
В качестве заквасок для приготовления кисломолочных продуктов функционального
назначения
используется
различные
композиции
молочнокислых бактерий,
ацидофильные штаммы, бифидобактерии, являющиеся важнейшими компонентами
микрофлоры желудочно-кишечного тракта [2, 3].
52
Для поддержания заквасок в наиболее активном состоянии необходимо постоянно
производить замену заквасочных штаммов, что связано с изменением биологических
свойств заквасочных микроорганизмов при их длительном культивировании и хранении [4].
Этим обусловлена необходимость выделения чистых культур молочнокислых
бактерий с целью получения производственно-ценных штаммов заквасочных
микроорганизмов.
При подборе культур для ферментированных продуктов необходимо учитывать
наряду с протеолитической и липолитической активностью, устойчивостью к антибиотикам
и бактериофагу, ценными физиологическими свойствами, указывающих на их
приживаемость в кишечнике, активность кислотообразования, способность к образованию
веществ, ответственных за ферментирование аромата готового продукта [5].
Материалы и методы. Объектами исследований служили 35 культур лактобацилл,
выделенные из кисломолочных продуктов и от клинически здоровых людей.
Для сквашивания использовали сухое обезжиренное молоко 87 г/л, стерилизованное
при 0,5 атм 20 мин [6].
Энергию кислотообразования культур определяли по методу Тернера. Оценку
проводили по количеству титруемой молочной кислоты, накопленной бактериями при
посеве на обезжиренное молоко за 17 часов. Результаты выражали в градусах Тернера по
формуле [7].
Результаты исследований. В ходе исследований были определены важнейшие
заквасочные свойства исследуемых штаммов бактерий рода Lactobacillus: кислотность,
образование сгустка, рН, органолептические показатели: вкус, запах.
В результате исследования количества титруемой молочной кислоты, накопленной
бактериями при посеве на обезжиренное молоко за 17 часов, выраженных в градусах
Тернера, установлено, что 5 культур лактобацилл обладают хорошими показателями
(таблица 1).
Таблица 1 - Показатели заквасочных свойств активных культур
Наименование
культуры
L.
paracasei
tolerans 1 LB
L. rhamnosus 11
LB
L. cellobiosus 31
LB
L. casei subsp.
tolerans 32 LB
L. salivarius 33 LB
Густота и текстура
продукта, полученного
путем сквашивания
молока
Сквашивание хорошее, за
10
ч,
консистенция
довольно
густая,
однородная.
Сквашивание хорошее, за
4 ч, густая однородная
консистенция.
Сквашивание отличное, за
10 ч, густая однородная
консистенция.
Сквашивание хорошее, за
9
ч,
консистенция
плотная, однородная.
Цвет, вкусовые
качества продукта
Цвет
молочный,
вкус
приятный,
кисловатый, запах
кисломолочный.
Цвет
молочный,
запах нейтральный,
вкус кисловатый.
Цвет
молочный,
вкус
и
запах
приятный.
Цвет
молочный,
запах
приятный
молочный,
вкус
кисловатый.
Сквашивание хорошее, за Цвет
молочный,
11 ч, не сильно густая запах
приятный
однородная консистенция. молочный,
вкус
кисловатый.
53
рН
Кислотообразо
вание, по
Тернеру
5,0
80 °Т
6,5
80 °Т
6,0
70 °Т
6,0
75 °Т
5,5
65 °Т
Штамм L. casei 1 LB ферментировал молоко за 10 часов, с энергией
кислотообразования 80 °Т, и образованием однородного сгустка средней вязкости.
Штамм L. rhamnosus 11 LB сквашивал молоко за 4 часа, с образованием плотных,
однородных, вязких сгустков, энергия кислотообразования составляет 80 °Т.
Штамм L. cellobiosus 31 LB ферментировал молоко за 10 часов, с образованием
плотных, однородных сгустков и энергией кислотообразования – 75 °Т.
Штамм L. casei subsp. tolerans 32 LB ферментировал молоко за 9 часов с образованием
хороших плотных сгустков и энергией кислотообразования – 75 °Т.
Штамм
L. salivarius 33 LB ферментировал
молоко за 11 часов, энергией
о
кислотообразования 65 Т, образовывал сгусток однородный, средней вязкости.
Итак, данные штаммы являются перспективными в качестве заквасок. Также
положительным является то, что они обладают пробиотическим спектром, а именно
лизоцимной, антилизоцимной, протеолитической активностью и адгезией. Устойчивы к
ряду антибиотиков и секретам желудочно-кишечного тракта. Проявляют антагонизм к E.
coli, P. vulgaris, Ser. marcescens, S. aureus, S. pyogenes, Salm. tуphimurium, а L. rhamnosus 11
LB к C. аlbicans.
Выводы. Полученные результаты характеризовали отобранные нами культуры
молочнокислых бактерий как удовлетворяющие предъявляемым требованиям к
современным стартерным культурам, применяемым при производстве функциональных
продуктов питания. Заквасочные культуры должны обеспечить достижение нужной
кислотности в молоке за короткий промежуток времени, который должен быть
практически одинаковым от партии к партии, обеспечивая тем самым высокую скорость
сквашивания. Отобранные нами культуры микроорганизмов обладают высокой скоростью
сквашивания и при этом образуют продукты с мягким и тонким вкусом, однородной
консистенцией. В связи с этим, отобранные в ходе данного исследования культуры будут
использованы в качестве стартеров для пробиотических комплексов.
Список литературы
1. Крусь Г.Н., Храмцов А.Г., Волокитина З.В., Карпычев С.В. Технология молока и
молочных продуктов. - М.:Колос, 2006. - 455 с.
2. Красникова Л.В., Кострова И.Е. Роль микрофлоры закваски в повышении качества
продуктов // Молочная промышленность. -1989.-С.1-37.
3. Храмцов А.Г., Евдокимов И.А., Костин В.В., Рябцев С.А. Концепция
биотехнологии молочных продуктов нового поколения // Сыроделие и маслоделие. – 2001. № 4. – С.11-12.
4. Усенко Д.В. Опыт применения кисломолочного пробиотического продукта //
Вопросы детской диетологии. – 2004. – Т.2, №5. - С. 58-60.
5. Нетрусов А.И. Практикум по микробиологии. – М.:ACADEMA, 2005. – С.608 .
6. Скривер А., Стенби Е., Фолкенберг Д.М., Банг Йенсен Н. Инструменты для
разработки заквасок // Молочная промышленность. - 2004. - № 10. - С . 27-28.
7. Банникова Л.А., Королева Н.С., Семинихина В.Ф. Микробиологические основы
молочного производства. - М.:Агропромиздат, 1987. - 400 с.
Түйін. Біздің жұмысымызда 35 сүтқышқылды бактериялардың культураларына
қышқылтүзу бағалауы жүргізілді. Олардың ферментативтік белсенділігі, органолептикалық
және өнімнің ферментациялық текстуральді сипаттамасы көрсетілді. Нәтижесінде 5
белсенді лактобацилл штаммдары таңдалып алынды.
54
Summary. We assessed 35 of acid lactic acid bacteria cultures. Studied their enzymatic
activity, as well as textural and organoleptic properties of the products of fermentation. As a result,
selected the 5 most active strains of lactobacilli.
УДК 615.371;074;076
МЕТОДЫ ТЕХНОЛОГИЧЕСКОГО И БИОЛОГИЧЕСКОГО КОНТРОЛЯ
КАЧЕСТВА РЕКОМБИНАНТНЫХ ВАКЦИН ПРОТИВ ТУБЕРКУЛЕЗА В
НАУЧНО-ИССЛЕДОВАТЕЛЬСКОМ ИНСТИТУТЕ ПРОБЛЕМ БИОЛОГИЧЕСКОЙ
БЕЗОПАСНОСТИ
Богданов Н.В., Касенов М.М. к.в.н., Волгин Е.Н., Нурпейсова А.С., Исагулов Т.Е.,
Сарсенбаева Г.Ж., Хайруллин Б.М. к.в.н.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. В работе представлены результаты исследований по внедрению
технологического и биологического контроля качества рекомбинантных вакцин для
туберкулеза в Научно-исследовательском институте проблем биологической безопасности.
Введение. Согласно данным Всемирной организации здравоохранения (ВОЗ) по
состоянию за 2013 год Казахстан находится на 33 месте из 212 стран мира по количеству
больных туберкулезом. При этом среди стран Центральной Азии в Казахстане отмечается
самый низкий успех лечения. Так, 16 % от всего объема лечения безуспешны [1].
В Казахстане зарегистрировано 350 тысяч больных туберкулезом, и, вероятно, еще
больше не известно противотуберкулезной службе, так как «социально ущербные» группы
населения (лица без определенного места жительства, нелегальные мигранты, алкоголики,
наркоманы и прочие) практически недоступны своевременному выявлению туберкулеза
[2].
В официальных заявлениях Министерства здравоохранения РК говорится, что за
последние несколько лет тенденция заболеваемости уменьшилась на несколько десятков
процентов. Ежегодно в стране туберкулезом заражаются более 20 тысяч человек. В
наибольшей степени туберкулез диагностируется среди лиц трудоспособного возраста от
18 до 54 лет, причем более половины составляют больные моложе 34 лет [2].
Более 80 лет для иммунизации против туберкулеза во многих странах, в том числе и в
Республике Казахстан, применяют живую аттенуированную вакцину БЦЖ. Однако
современные вакцинные штаммы БЦЖ – производные штамма Mycobacterium bovis
Pasteur, полученного еще в 1921 г., не защищают взрослых (ранее вакцинированных БЦЖ
или латентно инфицированных) от развития туберкулеза легких, вызванного
лекарственно-устойчивыми гипервирулентными штаммами возбудителя определенных
генотипов, например, таких как доминирующий в РК генотип Beijing. Кроме того, у
привитых детей регистрируется рост числа осложнений после вакцинации в виде костных
поражений, развивающихся вследствие диссеминации БЦЖ. Серьезную опасность
представляет генерализация БЦЖ-инфекции при иммунодефицитных состояниях. Не
исключено, что контакт иммунизированных БЦЖ вакциной лиц с циркулирующими в
окружающей среде M.tuberculosis может усиливать или качественно изменять иммунитет,
созданный с помощью вакцины из штамма M.bovis (БЦЖ) [3].
В связи с потребностью более эффективного и безопасного препарата для
профилактики и терапии туберкулеза в НИИПББ были разработаны противотуберкулезные
55
вакцины для здравоохранения Республики Казахстан с использованием векторной системы
на основе рекомбинантного аттенуированного гриппозного вируса, экспрессирующего
микобактериальные антигены. Однако для подтверждения безопасности нового препарата
необходимо было провести всесторонний контроль качества [4].
Биологический контроль является важнейшей и определяющей частью при выпуске
биопрепаратов.
Системы
определения
качества
биопрепаратов
постоянно
совершенствуются с целью недопущения выпуска продукции, несоответствующей
требованиям нормативной документации.
Вакцины отличаются от других иммунобиологических препаратов сложностью
состава и технологии изготовления, разнообразием механизмов действия на организм и
необходимостью особого контроля их безопасности.
Для обеспечения безопасности вакцин должны быть изучены и охарактизованы
свойства вакцинного штамма, клеточного субстрата, свойства полуфабриката и конечного
продукта. Кроме того, предусматривается обязательный входной контроль исходного
сырья. Существуют жесткие требования к безопасности стабилизаторов, консервантов,
адъювантов, растворителей и других реагентов [5].
Принятая в ряде стран система биологического контроля и проверки безопасности
вакцин включает:
- контроль вакцин на производстве, который предусматривает обязательный
поэтапный контроль материала на безопасность на разных стадиях технологического
процесса;
- испытание новых вакцин разработчиком и государственным органом контроля,
включающим проведение экспертизы нормативной документации, лабораторный контроль
экспериментальных, экспериментально-производственных и первых производственных
серий вакцины, а также клинические испытания вакцины на безопасность;
- государственную сертификацию серий вакцины, проверку соответствия серий
вакцины требованиям нормативной документации;
- контроль санэпиднадзора за соответствием качества вакцин на местах их
применения, включающий соблюдение правил хранения, транспортировки и реализации
препаратов.
- инспектирование предприятия для проверки соблюдения требований GLP и GMP,
гарантирующих безопасность выпускаемых препаратов [6];
Таким образом, для получения безопасного продукта биотехнологической
промышленности необходимо внедрение современных методов контроля качества с
существующими международными нормами и требованиями.
Материалы и методы. Для внедрения методов технологического и биологического
контроля качества векторной вакцины против туберкулеза в НИИПББ были изучены
нормативные документы, регулирующие производство противотуберкулезных вакцин в
различных странах, такие как Европейская фармакопея 5.0, Государственная фармакопея
РК, Рекомендации (ВОЗ) [7, 8, 9, 10, 11].
Результаты исследований. По результатам проведенных исследований отработаны
методы контроля качества и безопасности отечественной вакцины против туберкулеза для
здравоохранения на основании общепринятых и соответствующих международным
стандартам методов контроля, используемых в биологической промышленности при
производстве и контроле вакцин для медицинской практики. Так же была составлена и
утверждена схема контрольных точек и методов контроля на все стадии производства
культуральной векторной вакцины против туберкулеза, которые представлены в таблице 1.
56
Таблица 1 - Проект схемы контрольных точек производства векторной вакцины
против туберкулеза в НИИПББ
№
КТ
Контрольные
точки,
наименование
стадии
Наименование
объекта контроля
Параметры контроля
Метод контроля
Сухой остаток
Взвешивание осадка
после выпаривания
Аммиак
Сравнивание с
эталоном раствора
аммоний иона
Хлориды
Сульфаты
Кальций
Вода очищенная
Контроль
КТбуферных
1 растворов и их
компонентов
Буферные
Растворы
(SPGN)
КТ2
Контроль
вакцинного
штамма
Контроль
качества
КТкультур клеток
3
и питательной
среды
Тяжелые металлы
Окраска раствора с
использованием
тиоацетамидного
реактива или натрия
сульфида
Стерильность
Посев на бактериологические среды
рН
Потенциометриический метод
Пирогенность
Температурная
реакция на кроликах
рН
Потенциометрический
метод
Стерильность
Посев на
бактериологические
среды
Стерильность
Посев на
бактериологические
среды
Безопасность
На лабораторных
животных
Жизнеспособность
клеток
Методом
окрашивания
цитоморфология
Микроскопирование
Стерильность
Посев на
бактериологические
среды
Вакцинный штамм
Культура клеток
57
Сравнивание
опалесценции при
добавлении азотной
кислоты и раствора
нитрата серебра
№
КТ
Контрольные
точки,
наименование
стадии
Наименование
объекта контроля
Параметры контроля
Метод контроля
Обнаружение
микоплазмы
Электронная
микроскопия
рН
Потенциометрический
метод
Прозрачность
Визуально
Стерильность,
Посев на
бактериологические
среды
Внешний вид
Визуально
Антигенная
характеристика
РТГА
Характеристика
модифицированного
NS гена
ПЦР
Генотипическая
характеристика
Секвенирование
модифицированного
NS гена
Обнаружение
микоплазмы
Электронная
микроскопия
Стерильность
Посев на
бактериологические
среды
Контроль качества
питательной среды
(OptiPro)
КТ4
КТ
-5
Контроль
маточного
материала
Контроль
посевного
материала
Маточный материал
Специфическая
активность
Внешний вид
Антигенная
характеристика
Посевной материал
Стерильность
Специфическая
активность
Стерильность
КТ
-6
Контроль на
стадии
получения
вирусной
биомассы
Полученная
вирусная биомасса
Вирусный материал
осветленный
Гемагглютинирующа
я активность
Специфическая
активность
Общий белок
Антигенная
характеристика
58
Титрация на культуре
клеток
Визуально
РТГА
Метод прямого
посева
Титрация на
культуре клеток
Метод прямого
посева
РГА
Титрация на
культуре клеток
Метод Лоури
РТГА
№
КТ
Контрольные
точки,
наименование
стадии
Наименование
объекта контроля
Параметры контроля
Метод контроля
Характеристика
модифицированного
NS гена
ПЦР
Генотипическая
характеристика
Сконцентрированны
й диафильтрат
КТ
-7
Контроль
полуфабрикат
а
Сконцентрированны
й диафильтрат после
хроматографической
очистки
Обнаружение
микоплазмы
Общий белок
Специфическая
активность
Гемагглютинирующа
я активность
Общий белок
Специфическая
активность
Гемагглютинирующа
я активность
Общий белок
Специфическая
активность
Гемагглютинирующа
я активность
Внешний вид
рН
КТ
-8
Контроль
качества и
безопасности
готового
продукта
Антигенная
характеристика
гемагглютинина
Характеристика
модифицированного
NS гена
Генотипическая
характеристика
Готовый продукт
Стерильность
Общий белок
Специфическая
активность
Гемагглютинирующа
я активность
Безопасность
59
Секвенирование
модифицированного
NS гена
Электронная
микроскопия
Метод Лоури
Титрация на
культуре клеток
РГА
Метод Лоури
Титрация на
культуре клеток
РГА
Метод Лоури
Титрация на
культуре клеток
РГА
Визуально
Потенциометрически
й метод
РТГА
ПЦР
Секвенирование
модифицированного
NS гена
Метод прямого
посева
Метод Лоури
Титрация на
культуре клеток
РГА
на лабораторных
животных
Согласно представленной схеме контрольных точек производства векторной вакцины
против туберкулеза:
- Проведен контроль буферных растворов и их компонентов, пирогенности воды,
используемой в лабораториях и контроль стерильности и безопасности рекомбинантных
векторных вакцинных штаммов FLUNS1/Esat6_Ag85A и FLUNS1/Esat6, используемых
для приготовления векторных вакцин TB/FLU-04L для профилактики и TB/FLU-01L для
терапии туберкулеза.
Проведен
контроль
качества
маточных
материалов
из
штаммов
FLUNS1/Esat6_Ag85A и FLUNS1/Esat6,
- Проведен контроль на стадии посевного материала FLUNS1/Esat6_Ag85A и
FLUNS1/Esat6
- Приготовлены по 3 экспериментальные серии векторной вакцины TB/FLU-04L для
профилактики туберкулеза и TB/FLU-01L для терапии. На всех этапах приготовления
вакцин TB/FLU-04L и TB/FLU-01L проводился технологический контроль качества,
включающий проверку инфекционной активности, гемагглютинирующей, рН,
стерильности и тд. согласно схеме контрольных точек производства векторной вакцины
против туберкулеза.
Выводы. В результате проведенных работ в НИИПББ внедрены способы и методы
полного технологического и биологического контроля качества новой рекомбинантной
вакцины для профилактики и терапии туберкулеза. Схема контроля охватывает все стадии
производства препарата, что позволяет получить в итоге качественные и безопасные
векторные вакцины против туберкулеза.Данные исследования вносят большой вклад в
обеспечение благополучия в Республике Казахстан по такому актуальному заболеванию, как
туберкулез.
Список литературы
1. http://www.who.int/tb/country/data/visualizations/en/
2. TB Alert // www.tbalert.org
3. В. А. Аксенова, К. Г. Пучков, Н. В. Николаева РНИИФ Минздрава РФ Проблемы
массовой противотуберкулезной иммунизации в современных условиях //Российский
медицинский журнал, 1997, 5, с. 31–36
4. Государственная программа развития здравоохранения Республики Казахстан
«Саламатты Қазақстан» на 2011 – 2015 годы // http://ru.government.kz/resources/docs/doc19
5. Медуницын Н.В. Вакцинология. – М.: Триада-Х, 2004.-448 с.
6. Всемирная Организация Здравоохранения (ВОЗ), Департамент вакцин и
биологических препаратов Руководство ВОЗ по требованиям GMP – надлежащей практике
организации производства, Женева, 2001 г.
7. Методические рекомендации по разработке лабораторией контроля качества
руководства по системам обеспечения качества WHO/ VSQ/98.04.
8. European Pharmacopoeia 5.0 p 671.
9. Государственная фармакопея РК I издание, 2008.
10. Государственная фармакопея РК II издание, 2009
11. Good Manufacturing Practice: Guidelines on the validation of manufacturing processes.
Annex 6. WHO Expert Committee on Specification for Pharmaceutical Preparations // Thirtyfourth report. - 1996.
Түйін. Аталмыш жұмыста «Биологиялық қауіпсіздік проблемаларының ғылымизерттеу институты» базасында туберкулезге қарсы рекомбинантты вакцинаны жасау
барысында жүргізілітен технологиялық және биологиялық тексеру әдістерән енгізу
нәтижелері көрсетілген.
60
Summary. This paper presents the results of research on the development of technological
and biological quality control of recombinant vaccines for tuberculosis on the basis of a research
institute for biological safety problems.
УДК 639.331.37:597.553.2 (470.2)
ТЕСТ-СИСТЕМА ДЛЯ ДИФФЕРЕНЦИАЛЬНОЙ ДИАГНОСТИКИ
ЙЕРСИНИОЗА ЛОСОСЕВЫХ РЫБ
Богданова П.Д., аспирант, Дрошнев А.Е., к.б.н., Завьялова Е.А.,к.б.н., Гулюкин М.И.,
д.в.н.
ГНУ Всероссийский научно-исследовательский институт экспериментальной
ветеринарии им. Я.Р. Коваленко
(ВИЭВ Россельхозакадемии), г. Москва, Россия
Резюме. Одной из проблем современной аквакультуры в России является йерсиниоз
лососевых рыб, заболевание, наносящее существенный урон рыбоводческим хозяйствам за
счет высокого уровня гибели рыб и порчи товарного вида. Для дополнения существующих
методов бактериологического анализа разработана тест-система на основе ПЦР с
электрофоретической детекцией для идентификации йерсиний вида Y.ruckeri, выделенных
из биоматериала от рыб. Широкое использование метода ПЦР-диагностики при
проведении бактериологического анализа в ихтиопатологии позволит существенно
сократить длительность исследования и более полно обследовать поголовье для получения
достоверной информации о состоянии здоровья рыб.
Введение. Рыбоводство как основное направление современной аквакультуры России
важнейшая отрасль сельского хозяйства. Рыбы при интенсивном выращивании постоянно
контактируют с огромным количеством микроорганизмов, как непатогенных, так и
патогенных, представляющих опасность в развитии эпизоотий [1]. Одна из таких - Yersinia
ruckeri, бактерия семейства Enterobacteriaceae, которая вызывает кишечную болезнь
йерсиниоз- Enteric Red Month (ERM), известную также под названием «красный рот»,
хроническую системную инфекцию [2] радужной форели выращиваемой в пресной воде.
Первоначально болезнь ограничивалась северо-западным районом Северной
Америки и югом Канады, где была открыта и изучена Рукером и Россом [3,4]. Однако,
впоследствии, возбудитель заболевания так же был выделен в ряде европейских стран –
Италии [5], Англии [6,7], на юго-востоке Франции [8], в Германии и Норвегии, на ближнем
востоке, в Азии и даже на других континентах, в Австралии [9], Южной Америке. В этих
регионах, активно занимающихся форелеводством, йерсиниоз считается опасной
инфекцией. Болезнь наносит существенный урон рыбоводческим хозяйствам, приводит к
высокому уровню гибели рыбы и к порче её товарного вида.
В первую очередь заболеванию подвержены разные виды лососевых и сиговых рыб,
так же известны случаи выявления возбудителя у других пресноводных гидробионтов, что
служит вектором передачи бактерий в окружающей среде культивируемой рыбе. Y.ruckeri
передается горизонтально, через воду и экскременты зараженной рыбы [2]. У заболевших
особей отмечают геморрагии различных тканей и органов, особенно около рта, в
мускулатуре, жабрах, брюшной стенке, полостном жире, а также в переднем и заднем
отделах кишечника [10]. Наиболее остро болезнь проявляется у мальков, у более крупных
рыб протекает хронически.
61
На территории Российской Федерации йерсиниоз выявляется с 2010 года, количество
случаев с каждым годом увеличивается, однако в список карантинных это заболевание не
включено, что в виду массовой, но часто бесконтрольной перевозки рыбопосадочного
материала способствует его распространению[11].
Следовательно, с развитием контактов между странами, ростом и увеличением
интенсивности рыбоводческой промышленности внутри регионов данное заболевание
стало повсеместно распространено в мире. Поэтому возникает
необходимость
своевременной диагностики, а также точной идентификация возбудителя.
Сейчас диагностика йерсиниоза в лаборатории основана на выявлении бактерий в
посевах на питательных средах с последующим изучением их культуральнобиохимических свойств. Этот метод долгий, требующий финансовых затрат, а результат
анализа часто зависит от таких факторов, как опыт и компетенция специалиста,
проводящего работу, качества используемой питательной среды и т.п. Поэтому,
использование современных методов будет, несомненно, актуально и востребовано при
диагностике.
Цель. Целью исследования является разработка тест-системы для дифференциальной
диагностики возбудителя йерсиниоза на основе метода ПЦР, с последующей его
стандартизацией, что позволит максимально сократить возможность ошибки.
Цель достигается конструированием специфичных олигонуклеотидных праймеров
для идентификации ДНК Yersinia ruckeri и применением мультилокусной полимеразной
цепной реакции.
Материалы и методы. Для разработки тест-системы, оценки чувствительности и
специфичности использовали 12 штаммов Y.ruckeri из коллекции лаборатории
ихтиопатологии ВИЭВ, видовая принадлежность которых была ранее определена
культурально-биохимическими и серологическими методами, а также других
представителей рода Yersinia - Y.enterocolitica, Y.aldovae, Y.frederiksenii, Y.kristensenii;
микроорганизмы других семейств – Pseudomonadaceae (P.fluorescence), Vibrionaceae (V.
anguillarum);род Aeromonas (A.hydrophila, A.salmonicida) и гетерологичные организмы –
Homo sapiens.
Для подбора праймеров использовали программы Primer Select (Laser Jene 7.0) и
Oligo 7.0 (США) на основе последовательностей, представленных в международной базе
данных «GeneBank» (www.ncbi.nlm.nih.gov) проанализированных с помощью пакета
программ DNAStar Lasergene (США) и Mega6.0 (США). Праймеры проверяли на
отсутствие гомологии с последовательностями других бактерий и геномом человека
программой Blast с помощью web-ресурса Национального центра биотехнологической
информации (NCBI). Синтетические олигонуклеотидные праймеры синтезировали в ООО
«Синтол» (Москва, Россия). Выделение ДНК осуществляли коммерческим набором «Рибопреп» (Интерлабсервис, Москва, Россия). Полимеразную цепную реакцию проводили
используя коммерческую стандартизированную реакционную смесь с Taq-полимеразой
(«Синтол», Москва) на программируемом термоциклере «Терцик» («ДНК-технология»,
Москва). Детекцию продуктов амплификации осуществляли с помощью гельдокументирующей системой
BioDocAnalyze (Biometra an Analitik Jena Company,
Германия).
Результаты и обсуждение. В качестве мишеней для праймеров были выбраны три
гена glnA, gurB, recA. После анализа генов были подобраны участки характерные только
для Y.ruckeri: для гена glnA праймеры YrgA-1 и YrgA-2, фланкирующие участок размером
154 пары оснований (п.о.); для гена gurB праймеры YrgВ-1 и YrgВ-2, фланкирующие
участок 225п.о.; для гена recA - YrrA-1 и YrrA-2, фланкирующие участок 294п.о. При
использовании стандартной ПЦР смеси «red-mix» с добавлением dNTP, MgCl2 и по 10pmol
62
праймеров оптимальная программа амплификации: 1) 94°C - 5 мин – 1 цикл; 2) 94°C - 45
с., 51°C - 45 с., и 72°C - 60 с. - 35 циклов; 3) 72°C - 5 мин – 1 цикл.
Оценка специфичности сконструированных праймеров подтвердила гомологичность
с нуклеотидной последовательностью генов recA, glnA и gurB и отсутствие значимой
гомологии с нуклеотидными последовательностями бактерий семейства Enterobacteriaceae
и других видов. При анализе выбранных фрагментов установлено отсутствие
самокомлементарных участков внутри праймеров и комплементарности друг к другу, во
избежание возникновения вторичных структур и «димеров» праймеров, которые могут
блокировать реакцию или привести к неспецифической амплификации. В ходе
экспериментов установлено, что специфические фрагменты определенного размера
амплифицировались только в образцах Y.ruckeri. Специфичность в рамках исследуемой
панели образцов составила 100%. Ложноположительных результатов при использовании
одновременно, но независимо (в разных пробирках) всех трех пар праймеров получено не
было.
Различие в размерах амплифицируемых участков 154 п.о., 225 п.о. и 294 п.о.
соответственно, позволило проводить исследование в одной пробирке, что снижает
материальные затраты и увеличивает «емкость» термоциклера при исследовании большого
количества проб. Таким образом была разработана тест-система на основе ПЦР с
электрофоретической детекцией в 2% геле для идентификации йерсиний вида Y.ruckeri,
выделенных из биоматериала от рыб, которая рекомендована для дополнения
микробиологического анализа и позволяет существенно сократить длительность
исследования.
В последнее время, для лабораторной диагностики болезней человека и животных все
чаще применяется молекулярно-генетический метод ПЦР, однако в ихтиопатологии это
недостаточно распространенная техника. Возможно, это объясняется недостатком научнообоснованной информации или иными причинами, но в доступной мировой литературе
нами обнаружено только четыре статьи, где авторы использовали ПЦР для работы с
Yersinia ruckeri, при этом не с диагностическими целями, а для секвенирования и изучения
филогенетических взаимоотношений йерсиний разных видов.
По сравнению с традиционными методами, применение готовой тест-системы на
основе ПЦР, включающей все необходимые компоненты, имеет определенные
преимущества: обладает высокой чувствительностью, коротким сроком выполнения,
возможностью ранней диагностики и не требует глубоких знаний от оператора
выполняющего рутинное исследование. Это позволит шире внедрять метод в
ветеринарную практику и более полно обследовать поголовье рыб в аквакультуре с целью
мониторинга заболевания или, в случае необходимости, установления причин гибели.
Список литературы
1. Обухова Е. С. Экологические особенности псевдомонад в составе аутофлоры
радужной форели в условиях Карелии: автореф. дисс. … канд. биологических наук. –
Петрозаводск, 2013.-3 с.
2. Sirvas-Cornej, S., Sánchez-Robinet, С., Peña-Domínguez, С. Rapid diagnosis and
identification by PCR of Yersinia ruckeri isolated of Oncorhynchus mykiss from Canta, Lima,
Peru // Rev. peru. biol. 2011;18 (3) рр. 349-353
3. Ross, A. J., Rucker, R. R., Ewing, W. H. Description of a bacterium associated with
redmouth disease of rainbow trout (Salmo gairdneri) //Can. J. Microbiol. 1966; 12: 763-770
4. Rucker, R. R. Redmouth disease of rainbow trout (Salmo gairdneri) // Bull. Off. Int. des
Epiz. 1966; 65: 825-830
5. Busch, R. A. Enteric redmouth disease (Hagerman strain) // Mar. Fish. Rev. 1978; 40
(3): 42-51
63
6. Roberts, M. S. A report of an epizootic in hatchery-reared rainbow trout, Salmo
gairdnen' hchardson, at an English trout farm, caused by Yersinia ruckeri // J. Fish Dis. 1983; 6:
551-552
7. Frerichs, G. N., Stewart, J. A., Collins, R. О. Atypical infection of rainbow trout, Salmo
gairdneri Richardson, with Yersinia ruckeri // J. Fish Dis. 1985; 8: 383-387
8. Lesel, R., Lesel, M., Gavini F., Vuillaume, A. Outbreak of enteric redmouth disease in
rainbow trout, Salmo gairdneri Richardson, in France // Journal of Fish Diseases. 1983; 6: 385387
9. Rubsamen, S., Weis, J. Nachweis von Enteric Redmouth bei Regenbogenforelen, Salmo
gairdneri Richardson, in Sudbuden // Tierarztl. Umsch. 1983; Jg 40 (№12): 995-998
10.
Bullock, G. L., Cipriano R. C. Enteric Redmouth Disease of Salmonids // Fish
Disease Leaflet 82. United States Department of the Interior Fish and Wildlife 1990; Service: 1-4
11.
Использование метода ПЦР для дифференциальной диагностики йерсиниоза
лососевых рыб / Е.А. Завьялова, П.Д. Богданова, Д.М. Щепетов и др. // Молекулярная
диагностика-2014:
VIII
Всероссийская
научно-практическая
конференция
с
международным участием. - Москва, 2014.-Т.3.-с. 476
Summary. The yersiniosis is one of the problems of aquaculture in Russia, being a disease
causing a considerable damage to the fish farms due to the high level of fish kill and spoiling the
marketable quality of fish. The test system based on PCR with electrophoretic detection for
finding of Y.ruckeri type yersinias, extracted from the fish biomaterial was developed in addition
to the existing methods of bacteriological tests. The widespread use of PCR diagnostics method
for bacteriological test in ichtyopathology will contribute to substantial reduction of the test
duration and examine more comprehensively the population to get the reliable information on the
health of the fishes.
УДК 619:616.98:578.842.1:577.2
СОЗДАНИЕ КЛОНОТЕКИ, КОДИРУЮЩЕЙ ИММУНОЛОГИЧЕСКИ
ЗНАЧИМЫЕ БЕЛКИ ПОЛЕВОГО ИЗОЛЯТА ВИРУСА АФРИКАНСКОЙ ЧУМЫ
СВИНЕЙ
Варенцова А.А., аспирант, ФГБУ «ВНИИЗЖ»;
Шевченко И.В., аспирант, ФГБУ «ВНИИЗЖ»;
Зиняков Н.Г., кандидат биологических наук, ФГБУ «ВНИИЗЖ»;
Резюме. Статья посвящена анализу вируса африканской чумы свиней (АЧС) и
изучению генов иммунологически значимых белков B646L (p72), CP204L (p30), KP177R
(p22), O61R (p12), EP402R (CD2v), CP530R (pp62), CP2475L (pp220) и E183L (p54).
Описано создание клонотеки генов с использованием прокариотического вектора pJET1.2.
Введение. Африканская чума свиней (АЧС) – болезнь, вызываемая вирусом из
семейства Asfarviridae. Инфекция широко распространена во многих странах Африки
южнее Сахары. Из этого региона возбудителя болезни неоднократно заносили в другие
страны, в том числе в Грузию, Россию, Армению, Иран, Республику Беларусь и Украину
[1]. Наносимый болезнью экономический ущерб складывается из прямых потерь по
ликвидации болезни и ограничений в торговле, накладываемых на страны, в которых
регистрируют АЧС [2].
64
На сегодняшний день вакцины против АЧС не существует, поэтому борьба с АЧС
сводится к быстрой и достоверной идентификации болезни, убою и уничтожению
инфицированных животных, применению строгих карантинно-ограничительных мер [2].
Возможным выходом для проведения специфической профилактики болезни, и создания
безопасных диагностических наборов могли бы быть искусственные, рекомбинатные
системы для получения иммунологически активных вирусных протеинов.
Материалы и методы. Для выделения ДНК вируса АЧС использовали пробы 10%
суспензии селезенки свиней, павших от АЧС, изолята Krasnodar 06/12. Общий пул ДНК
экстрагировали фенольно-детергентным методом.
Для получения и накопления ПЦР-продукта использовали: матричную ДНК с
концентрацией 100 мкг/мл по 1 мкл на реакцию, Taq- и Pfu- ДНК-полимеразы,
реакционный
буфер
с
(NH4)2SO4
и
2,5мМ
MgCl2,
смесь
10
мМ
дезоксинуклеозидтрифосфатов
(Fermentas),
праймеры,
фланкирующие
последовательности генов (по 10пМ каждого). Общий объем реакционной смеси составлял
20 мкл.
Использованные в работе праймеры приведены в таблице 1.
Таблица 1-Нуклеотидные последовательности праймеров, использованных для
амплификации генов вируса АЧС.
Назва- Название гена ние
праймера
O61R
Fp12/24
Rp12/25
CP2475
L
B646L
Fp220/2
6
Rp220/2
7
Fp72/27
Rp72/27
CP204L
Fp30/28
Rp30/28
E183L
Fp54/28
Rp54/28
KP177R
Fp22/27
Rp22/29
CP530R
pp62F
Последовательность 5’ - > 3’
Длина Сайты Источник
п.о.
рестрик
-таз
GCGGATCCTTGAATAAGCGTTAA
C
GCGGATCCGACATCATTATGGAT
GA
TATGGTACCAATCATATAAGAAT
AAC
CGGCGGCCGCGACCAGGACTGCT
TCTC
TATCAGGATCCTTCGCATAAACCG
CCA
GGAAGCCCACAGATCTAACCCAT
TGTG
AGAGGTTGAAGATCCATGGTTAC
CCATT
CTAATAAATCTGGATCCTGCTGCT
GCAG
TTCTTGAGGATCCTTGGAAAGTTG
GTCC
CTTATAATATACTGCAGTATGTTG
AGTC
CAGAAAGGATCCAATATTATGTA
GACC
CGATGCACAATATTATAAGCTTTA
AACCG
ATAAGAATTCGATGCCCTCTAACA
24
BamHI
25
BamHI
26
KpnI
27
NotI
27
BamHI
27
BglII
28
NcoI
28
BamHI
28
BamHI
28
PstI
27
BamHI
29
HindIII
J.G.
Neilan et
al., 2004
29
EcoRI
Казакова
65
Angulo
A. et al.,
1992
Andres
G. et al.,
2002
Neilan
J.G. 2004
J.G.
Neilan et
al., 2004
J.G.
Neilan et
al., 2004
TGAAA
AGGAAGTCGACAGGTAAAACACA
CCACAG
CD2vF2 ATAAAACGGATCCTGATAAAATG
ATAATAC
CD2vR2 TAGGAATTCTTAAATAATTCTATC
TACGTG
pp62R
EP402R
29
SalI
30
BamHI
30
EcoRI
А.С,
19.01.20
12
Температуру отжига праймеров подбирали постановкой реакции с градиентом
температур от 42 до 62°С с шагом 1ºС на амплификаторе «Терцик» (ДНК-технологии,
Россия).
Секвенирование полученных плазмид осуществляли с помощью генетического
анализатора 3130 Genetic Analyzer (Applied Biosystems, США).
Web-ресурсы: для анализа нуклеотидных последовательностей генома штаммов и
изолятов вируса АЧС использовали ресурсы международных баз данных NCBI, EMBL;
сравнительный анализ гомологии нуклеотидных последовательностей генов проводили с
помощью программ BioEdit 6.0.7.
Клонирование ПЦР-продуктов проводили согласно руководству T. Maniatis в
прокариотическом векторе pJET1.2 с использованием клеток Е. coli штамма DH5б [7].
Результаты и обсуждение. Геном вируса АЧС размером около 190 тыс.п.н.
содержит 151-167 открытых рамок считывания (ОРС). Структура генома полевых изолятов
АЧС различается по длине ОРС и количеству генов в мультигенных семействах.
Для создания репрезентативной клонотеки генов вируса АЧС, были выбраны гены,
кодирующие белки p72, p30, p22, p12, CD2v, pp62, pp220 и p54, которые участвуют в
процессе формирования вириона, или являются белками прикрепления и проникновения.
Работы по изучению протеинов вируса АЧС показали, что поверхностные белки р30, p54,
p22, CD2v, и p12 играют важную роль в процессах вирус-клеточного взаимодействия, а
синтез белков рр220, рр62 и р72 активно воздействует на морфогенез вируса [3, 4].
Использованные праймеры, содержали в себе сайты рестрикции для дальнейшего
клонирования в экспрессирующих плазмидах. Оптимизированные условия амплификации
позволили получить полноразмерные копии генов, пригодные для клонирования в
прокариотическом векторе pJET1.2, и трансфецировать полученные конструкции в клетки
Е. coli. В среднем, для проведения одной реакции лигирования ПЦР-продуктов размером
более 1000 п.о. использовали от 50 до 100 нг ДНК вектора, для ПЦР-продуктов менее
1000 п.о. - от 20 до 50 нг ДНК вектора. Для трансформации использовали компетентные
клетки E. coli штамма DH5б в концентрации 106 в 50 мкл.
Прокариотический вектор pJET1.2 подходит для клонирования ПЦР-продуктов,
минуя стадию очистки ПЦР-продуктов от реакционной смеси. Использование данного
вектора позволяет провести клонирование с возможностью получения до 100%
положительных клонов, избавляя от необходимости проведения скрининга колоний.
Используя, данный прокариотический вектор, была сконструирована клонотека из 24
клонов для 8 генов вируса АЧС: рекомбинантная плазмида pJET1CD2vKrasnodar06/12
содержит встройку размером 1134 п.о., плазмида pJET1р12Krasnodar06/12 содержит
встройку размером 421 п.о., плазмида pJET1р22Krasnodar06/12 содержит встройку
размером 754 п.о., плазмида pJET1р30Krasnodar06/12 содержит встройку размером 1134
п.о., плазмида pJET1р54Krasnodar06/12 содержит встройку размером 717 п.о., плазмида
pJET1рр62Krasnodar06/12 содержит встройку размером 1645 п.о., плазмида
pJET1р72Krasnodar06/12 содержит
встройку размером 1981 п.о., плазмида
pJET1рр220Krasnodar06/12 содержит встройку размером 1042 п.о. Объем клонированных
66
генов вируса АЧС составляет 5,2% от полноразмерного генома изолята Krasnodar 06/12.
Плазмидные конструкции, входящие в состав представленной в данной работе клонотеке,
могут быть использованы для создания альтернативных источников генетического
материала, положительного контроля в ПЦР-диагностике, а также для получения
рекомбинантных вирусов и ДНК-вакцин. Выполнение подобных разработок должно
помочь преодолеть неудачи традиционных подходов к созданию вакцины против АЧС и
стимулировать развитие других направлений по созданию средств специфической
профилактики, таких как ДНК-вакцинация [5].
Выводы. В результате работы была получена клонотека из 24 клонов для 8 генов
вируса АЧС. Для клонирования были использованы нуклеотидные последовательности
генов, участвующих в процессе формирования вириона, или являющихся белками
прикрепления и проникновения (p72, p30, p22, p12, CD2v, pp62, pp220 и p54). Создание
репрезентативных клонотек ДНК последовательностей является эффективным подходом в
разработке современных диагностических средств и рекомбинантных вакцин.
Список литературы
1. Забережный A.Д., Алипер T.И., Гребенникова T.A. и др. Африканская чума свиней
в Российской Федерации // Вопросы вирусологии. 2012. Т. 57. №5. С. 4 – 10.
2. Макаров В.В., Сухарев О.И., Цветнова И.В. Эпизоотологическая характеристика
вируса африканской чумы свиней // Ветеринарная практика. 2013. Т. 1. № 60. С. 6 – 16.
3. Angulo A, Vinuela E, Alcami A (1993) Inhibition of African swine fever virus binding
and infectivity by purified recombinant virus attachment protein p12. J Virol 67:5463–5471.
4. Borca M.V., Kutish G.K., Afonso C.L., Irusta P., Carrillo C., Brun A., Sussman M, Rock
D.L. (1994b) An African swine fever virus gene with similarity to the T-lymphocyte surface
antigen CD2 mediates hemadsorption //Virology 199:463–468.
5. DNA Vaccination Partially Protects against African Swine Fever Virus Lethal Challenge
in the Absence of Antibodies/ J.M. Argilaguet, E. Prez-Martn, M. Nofrarнas, [et al.]. // PLoS One
[Электронный ресурс]. – 2012. – Vol.7(9): e40942. – Шифр Информрегистра:
doi:10.1371/journal.pone.0040942.
6. General morphology and capsid fine structure of african swine fever virus particles/ J.L.
Carrascosa, J.M. Carazo, A.L. Carrascosa [et al.]// Virology. – 1984. – Vol.132. – Р. 160-172.
7. Sambrook, J. Molecular Cloning: A Laboratory Manual/ J. Sambrook, E.F. Fritsch, T.
Maniatis. – New York: Cold Spring Harbor. – 1989. – 1nd [Электронный ресурс]. – Режим
доступа: http://www.genome.ou.edu/protocol_book/protocol_partII.html#II.F.
Summary. This article presents the African swine fever virus (ASFV) genome analysis
and the study of genes, encoding immunologically relevant proteins B646L (p72), CP204L (p30),
KP177R (p22), O61R (p12), EP402R (CD2v), CP530R (pp62), CP2475L (pp220) and E183L
(p54). Described the creation of ASFV gene library using prokaryotic vector pJET1.2.
67
УДК: 619:615.371.616.921.5
КРАТКИЙ ОБЗОР ПО ГРИППОЗНЫМ ВАКЦИНАМ,
ЗАРЕГИСТРИРОВАННЫМ НА ТЕРРИТОРИИ СТРАН ТАМОЖЕННОГО СОЮЗА
Гоцкина Т.М., Табынов К.К.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. В данной работе представлен краткий обзор по гриппозным вакцинам,
зарегистрированным на территории стран Таможенного союза, который включал в себе
анализ процедуры выбора штаммов для противогриппозных вакцин; описание и свойства
современных вакцин против сезонного и пандемического гриппа.
Введение. Грипп – острая вирусная инфекция с воздушно-капельным путем
передачи, характеризующаяся острым началом, лихорадкой, общей интоксикацией и
поражением респираторного тракта. Эпидемии гриппа происходят ежегодно, поражая до
15% населения земного шара, значимо увеличивая смертность в группах повышенного
риска, увеличивая затраты на медицинскую помощь и нанося серьезный экономический
ущерб. По частоте и количеству случаев грипп и ОРВИ занимают первое место, составляя
95% всех инфекционных заболеваний [1].
Возбудитель гриппа – вирус, относится к семейству Orthomyxoviridae. Известны три
типа вирусов гриппа человека: А, В и С. Наибольшее эпидемиологическое значение имеет
вирус гриппа типа А. Морфология и генетика вируса гриппа, химический состав,
структура вириона изучены достаточно хорошо и подробно описаны в литературе [2].
Кроме ежегодных эпидемий вирусы гриппа, такие как тип А могут вызывать
пандемии. Пандемии всегда являлись событиями мирового значения. Они возникали в
результате появления высококонтагиозного вируса гриппа, к которому большая часть
населения не имела иммунитета, и как следствие, практически глобальной
восприимчивости людей к инфекции. В прошлом столетии отмечено три пандемии гриппа:
«испанский грипп» в 1918 г., «азиатский грипп» в 1957 г. и «гонконгский грипп» в 1968 г.
Так называемая «Испанка» вызвала гибель от 40 до 50 миллионов человек во всем мире
[3]. Ни сроки, ни последствия следующей пандемии невозможно предсказать определенно.
На протяжении полувека вакцины постоянно совершенствовались, их эффективность
и чистота постоянно улучшались. В 1966 году стал применяться новый технологический
метод очистки (зональное центрифугирование), который позволил добиться лучшей
очистки вакцины от яичного белка и различных компонентов клеток (которые и были
причиной наиболее частых и серьезных реакций на вакцину). Такие высокоочищенные
вакцины были менее реактогенными по сравнению с самыми первыми вакцинами, но все
еще, особенно у детей, часто вызывали системные реакции (головную боль, повышение
температуры и недомогание). Повышенная концентрация интерферона в организме и
является причиной "побочных эффектов", которые рассматриваются как общие реакции на
введение вакцины. После возникшей в 1968-1969 г.г. пандемии гриппа А в мире
значительно активизировались исследования по созданию и изучению средств
профилактики гриппа. Разработка и совершенствование вакцин проходило по такой схеме:
максимальное освобождение от балластных веществ и концентрация основных
иммуностимулирующих вирусных белков.
По этим критериям инактивированную гриппозную вакцину разделяют на 3 типа:
цельновирионные (корпускулярные), расщепленные (сплит – вакцины), и субъединичные
[4].
Выбор штаммов для противогриппозной вакцины. Каждый год силами
Национальных центров по гриппу сети Всемирной организации здравоохранения
проводится выбор трёх штаммов вируса гриппа для проведения прививок против гриппа в
68
предстоящем эпидемическом году. Выбираемые штаммы представляют собой H1N1, H3N2
и B-типа штаммы, полагаемые как наиболее вероятные для человека в предстоящем
эпидемическом сезоне. Национальные центры по гриппу сети ВОЗ были учреждены в 1952
г. На сегодняшний день эта сеть включает более чем 120 национальных центра по
изучению гриппа более чем в 90 странах мира. Указанные национальные центры по
гриппу в своих странах отбирают пробы, осуществляют первичное выделение вируса
гриппа и дают им предварительную антигенную характеристику. Впервые выделенные
штаммы они отправляют в национальный центр всемирной организации здравоохранения
для проведения антигенного и генетического анализа на высоком уровне, результат
которого образует основу рекомендаций со стороны ВОЗ о составе вакцины для
профилактики гриппа в Южном и Северном Полушариях на каждый год. Выбор штаммов
со стороны Национальных центров по гриппу для процесса производства вакцины
основывается на наибольшей вероятности того, какие штаммы будут преобладать в
предстоящем году [5].
Клинические испытания являются неотъемлемым этапом для вновь разработанных
вакцин, на основании результатов испытаний решается вопрос о целесообразности
применения препарата в практике здравоохранения. В ходе клинических исследований
новый препарат изучается для получения данных о его эффективности и безопасности. На
основании этих данных уполномоченный орган здравоохранения принимает решение о
регистрации препарата или отказе в регистрации. Препарат, не прошедший клинических
исследований, не может быть зарегистрирован и выведен на рынок [6].
Каждый сезон вирусы в результате подверженности к генетическим мутациям
меняют свои антигенные свойства, в связи с чем, возникают новые штаммы, поэтому ранее
разработанные вакцины теряют свою эффективность в течение определенного периода
времени. На территории других стран, где доминируют другие штаммы вирусов, такие
вакцины могут быть малоэффективными.
Сегодня Глобальная сеть наблюдения за гриппом ВОЗ насчитывает 113
национальных центров изучения гриппа в 84 странах мира, а также четыре центра по
изучению гриппа ВОЗ, расположенных в Лондоне (Англия), Атланте (США), Мельбурне
(Австралия) и Токио (Япония). Пятый центр, расположенный в Мемфисе (США) ведет
особые исследования вирусов гриппа у животных. Национальные центры ведут работу по
сбору вирусов гриппа, циркулирующих в разных регионах мира. Затем образцы
направляются в четыре лаборатории для углубленного изучения. Помимо получения
общей, глобальной картины изменения активности вируса гриппа, эта работа позволяет
ВОЗ выпускать два раза в год рекомендации по составу противогриппозных вакцин,
которые с большей вероятностью смогут обеспечить защиту населения во время сезонных
эпидемий, как в южном, так и северном полушариях. Таким образом, глобальная сеть ВОЗ
вносит весомый вклад в понимание эпидемиологии гриппа и помогает производителям
вакцин получить препарат, содержащий наиболее подходящий вирус, а также поставляет
им высокоурожайный «посевной» материал для производства вакцин [7].
За последние 20 лет улучшилось качество гриппозных вакцин, увеличился их
ассортимент. Ниже проведены краткие сведения о гриппозных вакцинах, применяемых в
странах таможенного союза.
В настоящее время зарегистрированы и активно применяются следующие виды
противогриппозных вакцин:
1.Живые аттенуированные интраназальные вакцины;
2.Инактивированные вакцины подразделяются на три типа:
- цельновирионные вакцины;
- расщепленные (сплит) вакцины;
- субъединичные вакцины.
69
Живая вакцина (гриппозная аллантоисная интраназальная живая (ЖГВ) ФГУП “НПО
“Микроген” МЗ РФ (Россия) живая аттенуированная, интраназальная) изготавливается из
аттенуированных штаммов вируса гриппа, культивируемых в аллантоисной жидкости
куриных эмбрионов; они способны стимулировать местный ответ при интраназальном
введении. Вакцинация проводится взрослым и детям старше 3 лет.
Инактивированые вакцины:
а) Цельновирионные – содержат целые вирионы вируса гриппа (вакцина гриппозная
инактивированная
жидкая,
производитель
"Микроген",
Россия,
грипповак
инактивированная гриппозная вакцина – страна – производитель Россия, пандефлю
(Россия) гриппозная инактивированная субъединичная адсорбированная моновалентная
пандемическая вакцина, вакцины Республики Казахстан «Kazfluvac и Refluvac»
инактивированные адъювантные гриппозные жидкие вакцины).
в) Расщепленные или сплит – вакцины содержат расщепленные вирионы вируса
гриппа, содержащие как поверхностные, так и внутренние белковые молекулы и антигены,
за счет высокой степени очистки в них отсутствуют вирусные липиды и белки куриного
эмбриона (вакцина Гриппол, производитель "Микроген" Россия; вакцина Флюарикс,
производитель "ГлаксоСмитКляйн", Бельгия; вакцина Бегривак, производитель "Кайрон
Беринг", Германия; вакцина Ваксигрип, производитель "Санофи Пастер", Франция).
г) Субъединичные вакцины-содержат только поверхностные вирусные белки
(гемагглютинин и нейраминидазу) (вакцина Гриппол плюс, производитель "Петровакс
фарм", Россия; вакцина Инфлювак, производитель "Эббот Продактс ООО", бывшая
"Солвей фарма", Нидерланды; вакцина Агриппал, производитель "Новартис", бывшая
"Кайрон Ко", Италия, пандефлю (Россия) гриппозная инактивированная субъединичная
адсорбированная моновалентная пандемическая вакцина).
В случае пандемии для профилактики гриппа используется следующие вакцинные
препараты:
В 2003-2007 годах в России в ФГУП «НПО «Микроген» Минздравсоцразвития
России была разработана новая инактивированная расщепленная виросомальная
гриппозная вакцина Грифор. Препарат представляет собой высокоочищенную смесь
поверхностных антигенов в виде вирусов и внутренних антигенов в виде мицелл вируса
гриппа А (H1N1 и H3N2) и В. В результате проведенных I и II фаз клинических
исследований на контингенте лиц в возрасте от 18 до 60 лет показано, что вакцина Грифор
низкореактогенна, безопасна и обладает высокой иммуногенной активностью.
С 2005 г. в Российской Федерации проводилась разработка и исследования
«макетных» вакцин против пандемического гриппа. В рамках лабораторноэкспериментальных исследований изучены физико-химические и иммунобиологические
свойства и выбраны наиболее перспективные вакцинные кандидаты: живая
интраназальная «Ультрагривак» и инактивированная субъединичная «ОрниФлю» [8].
«Ультрагривак» – вакцина гриппозная живая, лиофилизат для приготовления
раствора для интраназального введения, является иммунологически эффективным
препаратом. Результаты клинического обследования добровольцев и проведенные
лабораторно-инструментальные исследования свидетельствовали об отсутствии
отклонений в самочувствии и в результатах анализов после иммунизации добровольцев
вакциной «Ультрагривак» в сравнении с фоновыми значениями [9].
В марте 2009 г. в РФ зарегистрированы и разрешены к применению две
пандемические гриппозные вакцины:
- инактивированная субъединичная адсорбированная «ОрниФлю»;
- живая «Ультрагривак».
С целью оценки безопасности и эффективности полученных вакцинных кандидатов
были проведены доклинические исследования на лабораторных животных. В результате
проведенных исследований показано, что вакцина «ОрниФлю» нетоксична в остром и
70
хроническом эксперименте, хорошо переносилась животными, не обладала выраженными
местными и местно-раздражающими действиями, не вызывали негативного влияния на
патоморфологические, гистологические и гематологические показатели. Вакцина
отличалась хорошей переносимостью, безопасностью и низкой реактогенностью [10].
Данные вакцины официально были разрешены использовать у людей в возрасте от 18
до 60 лет. С целью повышения безопасности, иммуногенности и эффективности
гриппозных вакцин с 2006 по 2008 г.
Вакцина Пандефлю (Россия). Пандефлю – вакцина гриппозная инактивированная
субъединичная адсорбированная моновалентная пандемическая вакцина. В настоящее
время по результатам клинического исследования разрешено применение вакцины
Пандефлю на взрослых в возрасте от 18 до 60 лет. Клинические исследования вакцины
Пандефлю на других возрастных категориях: детях от 3 до 17 лет и пожилых от 60 лет и
старше продолжаются. После получения доказательств безопасности и иммунологической
эффективности вакцины Пандефлю у детей и пожилых будут даны дополнительные
рекомендации по применению препарата для данной категории граждан. Вакцинный
штамм A/California/7/2009 (H1N1)v используемый в вакцине Пандефлю получен методом
классической реассортации на основе донора аттенуации PR/8 (H1N1), применяемого при
создании безопасных и иммунологически эффективных сезонных гриппозных вакцин,
рекомендован ВОЗ и Комиссией по гриппозным и диагностическим штаммам[11].
Вакцины Kazfluvac и Refluvac. Первые отечественные противовирусные вакцины
получены в Научно-исследовательском институте проблем биологической безопасности
Министерства образования и науки Республики Казахстан. Вакцины Kazfluvac и Refluvac
представляют собой инактивированные адъювантные гриппозные жидкие вакцины,
состоящие из цельных вирионов рекомбинантных штаммов вируса гриппа типов А(H1N1)
и А(H5N1), выращенных в куриных эмбрионах. В качестве адъюванта в состав вакцин
включен алюминия гидроксид. Его наличие значительно повышает эффективность вакцин
и позволяет максимально снизить дозу вводимого антигена, а значит, уменьшить
реактогенность вакцины.
Для приготовления вакцины Kazfluvac используют рекомбинантный штамм A/Astana
RG/6:2/2009 (H5N1) вируса гриппа, полученный в НИИПББ НЦБ КН МОН РК методом
обратной генетики из эпизоотического штамма A/chicken/Astana/6/05 (H5N1) и
высокорепродуктивного штамма донора A/PR/8/34 (H1N1). Допускается использование
других производственных штаммов, рекомендуемых и предоставляемых по линии ВОЗ для
изготовления инактивированных вакцин против гриппа А/ H5N1 [12]. Доклиническое
изучение безопасности, иммуногенной активности и протективного действия вакцины
Kazfluvac проводились на базах Национального центра экспертизы лекарственных средств,
изделий медицинского назначения и медицинской техники МЗ РК, НИИ гриппа СЗО
РАМН, Института токсикологии ФМБА, Государственного НИИ стандартизации и
контроля медицинских биологических препаратов имени Л.А. Тарасевича, СанктПетербургской государственной химико – фармацевтической академии [13]. Изучение
реактогенности, безопасности и иммуногенности вакцины Kazfluvac в дозах 7,5 мкг и 15
мкг HA при одно - и двукратной внутримышечной иммунизации добровольцев в возрасте
от 18 до 60 лет свидетельствует о хорошей переносимости, низкой реактогенности и
безопасности вакцины. Показана выраженная иммуногенная активность вакцины в обеих
дозах в отношении вируса гриппа А/H5N1 при одно- и двукратном введении. Полученные
результаты позволили рекомендовать проведение II фазы клинических исследований с
целью выбора оптимальной дозы препарата (7,5 или 15 мкг НА на человека) при
использовании однократной схемы введения вакцины добровольцам в возрасте от 18 до 60
лет [14].
71
Приготовления вакцины Refluvac используют рекомбинантный штамм NIBRG 121хр
вируса гриппа, полученный в NIBSC (Великобритания) методом обратной генетики из
эпидемического штамма А/California/7/2009 (H1N1) и высокопродуктивного штамма
донора А/PR/8/34 H1N1 предоставленный по линии ВОЗ в НИИПББ НЦБ КН МОН РК для
разработки
пандемической
вакцины.
Доклиническое
изучение
безопасности,
иммуногенной активности и протективного действия вакцины Kazfluvac проводились на
базах Национального центра экспертизы лекарственных средств, изделий медицинского
назначения и медицинской техники МЗ РК, НИИ гриппа СЗО РАМН, Института
токсикологии ФМБА, Государственного НИИ стандартизации и контроля медицинских
биологических препаратов имени Л.А. Тарасевича, Санкт-Петербургской государственной
химико-фармацевтической академии [15, 16].
Таким образом, изучение иммуногенной активности, реактогенности и безопасности
вакцины Refluvac в дозах 3,75 мкг и 7,5 мкг HA при однократной внутримышечной
иммунизации добровольцев свидетельствует о выраженной иммуногенной активности в
отношении вируса гриппа А/H1N1v, а также хорошей переносимости, низкой
реактогенности и безопасности вакцины. Полученные результаты позволи рекомендовать
вакцину Refluvac в дозе 3,75 мкг HA для государственной регистрации в качестве
профилактического средства защиты населения в возрасте от 18 до 60 лет от гриппа A
подтипа H1N1v [17].
Отличительной особенностью отечественных технологий в сравнении с
зарубежными аналогами является их технологичность и экономичность, так как они не
требуют применения дорогостоящего оборудования и максимально упрощенным методом
очистки и концентрирования. В качестве основы вакцины использованы рекомбинантные
штаммы, полученные на основе обратной генетики и актуальных для Казахстана штаммов
гриппа. На разработанные технологии имеются 5 патентов.
Вакцины против сезонного гриппа. Из вакцин от сезонного гриппа в настоящее время
в странах таможенного союза чаще всего применяются следующие препараты:
Вакцина Грипповак. Вакцина гриппозная инактивированная жидкая центрифужная
A(H1N1), A(H3N2) и В. Гриппозная тривалентная полимер-субъединичная жидкая
вакцина, представляющая собой поверхностные гликопротеины (гемагглютинин и
нейраминидаза), выделенные из очищенных вирусов гриппа типа А и В, в комплексе с
полиоксидонием. Одна иммунизирующая доза (0.5 мл) содержит 5 мкг гемагглютинина
штаммов вирусов гриппа типов A (H1N1), A (H3N2), 11 мкг вируса гриппа типа В и 500
мкг полиоксидония. Высокоочищенный, свободный от примесей невирионного
происхождения препарат. Антигенный состав вакцины изменяется каждый год в
соответствии с эпидемической ситуацией и рекомендациями ВОЗ. Доклинические
исследования показали, что вакцина не обладает эмбриотоксическим и тератогенным
действием [18].
Вакцина Гриппол® Нео. Одна из современных вакцин последнего поколения
семейства «Гриппол®» – представляет собой усовершенствованный аналог препаратов
Гриппол® и Гриппол® плюс, применяемых для массовой вакцинопрофилактики россиян в
рамках национального проекта «Здоровье». Гриппол® Нео сконструирован с применением
комбинации двух инновационных технологий: вакцина включает безопасный
водорастворимый адъювант Полиоксидоний® и антигены, выделенные из штаммов вируса
гриппа, выращенных на культуре клеток линии MDCK – Madine Darby Canine Kidney. Как
и вакцина Гриппол® плюс, Гриппол® Нео не содержит консерванта и производится на
современном фармацевтическом предприятии в соответствии с международными
требованиями GMP, в готовой к применению упаковке – шприц – дозе [19]. Важно
отметить, что Гриппол® Нео стала первой российской гриппозной вакциной, не
72
противопоказанной людям с аллергией на белок куриного яйца ввиду того, что куриные
эмбрионы полностью исключены из технологического процесса.
Доклиническая оценка вакцины Гриппол® Нео проводилась несколькими
аккредитованными организациями согласно утвержденным протоколам. В различных
моделях было показано, что в дозах, многократно превышающих человеческую, вакцина
не оказывает токсического, пирогенного, аллергизирующего действия как на взрослых, так
и на неполовозрелых и новорожденных животных, безопасна для иммунной системы как в
короткие, так и в отдаленные сроки после вакцинации. Результаты доклинических
исследований позволили рекомендовать ее к проведению клинических исследований[20].
Проведены государственные клинические испытания вакцины Гриппол® Нео с
уменьшенной антигенной нагрузкой, которые показали, что она обладает всеми
качествами вакцинного препарата нового поколения: безвредностью, высокой
иммуногенной активностью при введении.
Таким образом, семейство вакцин Гриппол® пополнилось новым полноправным
членом, а профилактическая медицина обрела новый инструмент для контроля такого
заболевания, как грипп. Гриппол® Нео стал первой в мире субъединичной адъювантной
вакциной с клеточной технологией получения антигенов. Исследования по расширению
показаний к применению вакцины продолжаются [18].
Вакцина Флюарикс (Германия). Инактивированная (не содержащая живого вируса)
очищенная расщепленная (сплит) вакцина против гриппа. Производится фирмой «Смит
Кляйн Бичем» (Германия). Препарат зарегистрирован в 33 странах мира, в которых
использовано более 20 млн. доз вакцины. Антигенный состав и штаммы вируса для
предстоящего эпидемического сезона гриппа определяет ВОЗ. Как и другие гриппозные
вакцины, препарат Флюарикс готовится с использованием куриных эмбрионов. Антигены,
содержащиеся в вакцине, получают расщеплением вирусных частиц, которые были
размножены в куриных эмбрионах, с помощью детергента [21].
Вакцина Ваксигрип (Франция). Ваксигрип – это современная вакцина против гриппа
с ежегодно обновляемым составом, защищающая от трех наиболее вероятных в грядущую
эпидемию разновидностей (штаммов) вируса гриппа. Ваксигрип относится к классу так
называемых сплит-вакцин. По сравнению с недорогими субъединичными (содержащими
лишь некоторые антигены вируса) вакцинами, сплит-вакцины против гриппа содержат
вдвое большее число антигенов, что позволяет формировать с их помощью более
полноценный иммунитет, эффективность которого на 10-15% выше. Сплит-вакцины в
России не производятся. Ваксигрип не содержит живых вирусов и поэтому заболеть
гриппом после вакцинации невозможно. Многоступенчатые контроль и очистка препарата,
а также отсутствие консерванта сводят к минимуму побочные реакции на прививку и
делают возможным ее проведение даже у детей с 6 месяцев, людей с хроническими
заболеваниями, у женщин в период грудного вскармливания и беременности [22].
Вакцина Бегривак. Гриппозная инактивированная трехвалентная расщепленная
(сплит) вакцина. Бегривак® – инактивированная трехвалентная расщепленная (сплит)
вакцина для профилактики гриппа. Производитель: Новартис Вакцинс энд Диагностикс
ГмбХ и Ко КГ (ранее - компания Кайрон Беринг ГмбХ и Ко Германия), группа компаний
Новартис. Бегривак® был лицензирован в 1972 г. в Германии, с 1999 г. применяется без
консервантов. Первая в мире вакцина для профилактики гриппа, не содержащая
консервантов и соединений ртути. Вакцина Бегривак представляет собой очищенные
антигены вирусов гриппа типа А и В, выращенные в аллантоисной жидкости куриного
эмбриона, инактивированные формальдегидом, расщеплённые эфиром [23].
Гриппозная инактивированная очищенная расщепленная вакцина Бегривак® для
профилактики гриппа, зарегистрирована Министерством здравоохранения Российской
Федерации. Антигенный состав вакцины Бегривак ежегодно обновляется согласно
рекомендациям ВОЗ. Вакцина Бегривак противопоказана лицам с повышенной
73
чувствительностью к куриному яичному белку, а также лицам в анамнезе которых
наблюдались тяжелые аллергические реакции на другие компоненты, входящие в состав
вакцины или на предшествующую прививку от гриппа данным препаратом. Прививка
должна быть отложена у пациентов с острым лихорадочным состоянием и у лиц с
подозрением на инфекционное заболевание при отсутствии точного диагноза.
Вакцина Агриппал S1. Агриппал® SI – трехвалентная инактивированная очищенная
субъединичная вакцина III поколения для профилактики гриппа. Производитель: Новартис
Вакцинс энд Диагностикс С.р.л. (ранее - Кайрон С.р.л., Италия), группа компаний
Новартис. Агриппал® S1 был лицензирован в 1986 в Италии, эффективность вакцины
подтверждена клиническими исследованиями и опытом применения в 40 странах мира.
Первая в мире субъединичная вакцина против гриппа, свободная от ртуть-содержащего
консерванта.
Препарат содержит по 15 мкг поверхностных антигенов – гемагглютинина и
нейраминидазы вирусов гриппа A и B. Антигенный состав ежегодно обновляется в
соответствии с рекомендациями ВОЗ.
Вакцина Агриппал S1 противопоказана лицам с повышенной чувствительностью к
куриному белку, а также лицам, в анамнезе которых наблюдались тяжёлые аллергические
реакции на компоненты вакцины.
Вакцина Агриппал S1 применяется для прививки от гриппа у детей и взрослых более
чем в 20 странах мира. При применении вакцины было отмечено незначительное число
местных реакций – болезненность и покраснение в месте инъекции [24].
Вакцины Гриппол® Плюс и Гриппол (НПО ПЕТРОВАКС ФАРМ, Россия). Вакцины
для профилактики гриппа. Представляют собой трехвалентную субъединичную (вакцину
третьего поколения) инактивированную гриппозную вакцину, состоящую из
поверхностных антигенов, культивированных на куриных эмбрионах здоровых кур,
вирусов гриппа типа А и В. Различают разные штаммы вирусов типа А. Антигены по
которым они различаются - это гемагглютинины и нейраминидаза (Н и N).
Антигенный состав гриппозной вакцины ежегодно обновляется согласно
рекомендациям Всемирной Организации Здравоохранения (ВОЗ). В этих рекомендациях
содержится информация о наиболее опасных штаммах вируса гриппа, появление которых
на территории Евразии наиболее ожидаемо.
Доклинические исследования показали, что вакцина гриппозная инактивированная
полимер-субъединичная не обладает эмбриотоксическим и тератогенным действием [25].
Вакцина Инфлювак (Нидерланды). Инфлювак® (Influvac®) – вакцина гриппозная,
субъединичная, инактивированная. Инфлювак – субъединичная трехвалентная
инактивированная вакцина 3-го поколения. Инфлювак содержит очищенные
поверхностные антигены вирусов гриппа типа А и В - гемагглютинин и нейраминидазу,
которые получены из определенных вакцинных штаммов вируса гриппа, выращенных на
куриных эмбрионах. Антигенный состав гриппозной вакцины Инфлювак ежегодно
обновляется в соответствии с рекомендациями Всемирной Организации Здравоохранения
(ВОЗ). Вакцина Инфлювак развивает специфический иммунитет к вирусам гриппа типа А
и В и обеспечивает защиту от гриппа. Очищенные антигены (гемагглютинин и
нейраминидаза), содержащиеся в вакцине Инфлювак, вызывают повышение титра антител,
необходимое для защитного эффекта, который наступает, как правило, через 14 дней после
инъекции. Продолжительность поствакцинального иммунитета сохраняется до 12 месяцев
[26].
Вакцина Инфлексал® V (BERNA BIOTECH, Ltd. Швейцария). Впервые вакцина
«Инфлексал V» была зарегистрирована в 1997 г. в Швейцарии, а в последующие годы еще
в 13 странах Европейского сообщества, 15 странах Латинской Америки, 5 странах Азии и
Ближнего Востока.
74
Представляет собой поливалентную виросомальную инактивированную вакцину
против гриппа, в состав которой входят поверхностные антигены вирусов гриппа типов A
и B, культивированные на куриных эмбрионах здоровых кур. Различают разные штаммы
вирусов типа А. Антигены по которым они различаются – это гемагглютинины и
нейраминидаза (Н и N).
Антигенный состав гриппозной вакцины ежегодно обновляется согласно
рекомендациям Всемирной Организации Здравоохранения (ВОЗ). В этих рекомендациях
содержится информация о наиболее опасных штаммах вируса гриппа, появление которых
на территории Евразии наиболее ожидаемо.
Если
есть
угроза
развития
пандемии
(эпидемия,
характеризующаяся
распространением инфекционного заболевания на территории всей страны, территорию
сопредельных государств, а иногда и многих стран мира), то такой штамм вируса гриппа
обязательно включается в состав вакцин либо на этот год, либо на следующий.
В результате проведенных клинических испытаний в условиях строго
контролируемого эпидопыта, установлено, что вакцина для профилактики гриппа
«Инфлексал V» обладает низкой реактогенностью и выраженной иммуногенной
активностью в отношении вирусов гриппа А и В [27].
Заключение. Все вышеуказанное наглядно демонстрирует сложность разработки
безопасной и в тоже время высокоэффективной вакцины против гриппа. По мнению
ведущих вакцинологов и иммунологов в нашей стране и за рубежом решить проблему
борьбы с гриппом можно только с помощью вакцин нового поколения,
сконструированных из высокоочищенных протективных антигенов вируса гриппа,
иммуногенные
потенции
которых
усилены
введением
водорастворимых
иммуноадъювантов.
В данное время на территории таможенного союза мало таких разработок по
изготовлению вакцин, которые могли бы помочь предупредить или снизить последствия
гриппозной инфекции. Для этого необходимо производить усовершенствованные
технологии вакцин, которые будут применяться в наших странах.
Список литературы
1. Грипп и другие респираторные вирусные инфекции / под ред. О.И. Киселева, И.Г.
Мариничева, А.А. Сомининой. - СПб, 2003
2. Белова Е.Г. Грипп – болезнь всех возрастов // Лечащий врач. – 2003.- №10 .- С. 7375
3. Фридман Э.А. и др. Эффективность гриппозных вакцин и пути ее совершенство–
вания //В сборник научных трудов НИИ гриппа Проблемы конструирования гриппозных
вакцин Л.,1988. –С. 59–62.
4. Т.А. Бектемиров, Г.А. Ельшина, М.А. Горбунов и др. Результаты изучения
эфффективности гриппозной инактивировванной субъединичной вакцины Инфлювак.
Муждународный журнал медицинской практики. 2000; 9: 47-51.
5. Кузнецов О.К.,Ерофеева М.К., Мигунов А.И. Вакцинопрофилактика гриппа,
разработка новых вакцин.// В кН.: Грипп и другие респираторные инфекции:
эпидемиология, профилактика, диагностика и терапия.- М.: Боргес, 2003.- С.158-175.
6. Сологуб Т.В., Ледванов М.Ю., Малый В.П., Стукова Н.Ю., Романцов М.Г.,
Бизенкова М.Н., Полякова Т.Д. ГРИПП. Клиническая Симптоматика // Успехи
современного естествознания. – 2009. – № 12 – С. 27-29.
7. Van Essen G. A., Palache A. M., Forleo E. et al. Vaccination against flu in 2000:
recommendations about application and application of vaccines in 50 developed and quickly
developing //Vaccine. - 2003. - V. 21. – Р. 1780-1785.
75
8. Миронов А.Н. «ОрниФлю» - гриппозная инактивированная субъединичная
вакцина для профилактики гриппа птиц. / Коровкин С.А., Мельников С.Я., Дылдина Н.В. //
Журнал «Аллергология и иммунология». - Том 10. - № 2. - 2009. - С. 298.
9. Катлинский A.B. Вакцина Ультрагривак - основное средство борьбы с возможной
пандемией птичьего гриппа /Семченко A.B., Коровкин С.А., Миронов А.Н., Мельников
С.Я. // Журнал «Эпидемиология и вакцинопрофилакгика». - №2 (45). - Март-апрель 2009. С. 50-56.
10. Гендон Ю., Маркушин С.,Акопова И. и др. Разработка культуральной живой
холодоадаптированной реассортантной гриппозной вакцины // Ворп. вирусол.-2003.- №2.С.12-17
11. Миронов А. Н., Романова А. А., Мешкова Р. Я., Фельдблюм Ирина Викторовна,
Купина Н. В., Бушменков Д. С., Цаан А. А.. Оценка реактогенности, безопасности и
иммуногенности инактивированной моновалентной вакцины у детей // Вопросы
современной педиатрии . — 2010 . — Том 9, N 4 . — С. 106-109 .
12. Kydyrbaev Zh.K., Mamadaliev S.M., Asanzhanova N.N., Tabynov K.K., Ryskel'dinova
Sh.Zh., Cherviakova O.V., Sandybaev N.T., Khaĭrullin B.M., Kiselev O.I. Technological
approaches to development of whole-virion inactivated vaccine from recombinant strain against
A/H5N1 influenza in the Republic of Kazakhstan // Zh Mikrobiol Epidemiol Immunobiol. –
2012. - №5. – Р. 54-9.
13.Nurpeysova A., Khairullin B., Kassenov M., Bogdanov N., Mamadalyiev S., Kydyrbaev
Zh., Abduraimov Y., Volgin E., Kondybayeva Zh., Issagulov T., Sarsenbayeva G., Kiselev O.,
Tsybalova L., Migunov A., Stukova M., Zaytseva M., Satybaldieva Zh., Shin S., Shnaukshta V.
Preclinical Testing of Kazfluvac, a Vaccine against Pandemic Influenza A/H5N1V//J. Pharm.
Biomed. Sci., 2011. 1(5) 108-112.
14. Sansyzbay A.R., Erofeeva M.K., Khairullin B.M., Sandybayev N.T., Kydyrbayev Z.K.,
Mamadaliyev S.M., Kassenov M.M., Sergeeva M.V., Romanova J.R., Krivitskaya V.Z., Kiselev
O.I., Stukova M.A. An inactivated, adjuvanted whole virion clade 2.2 H5N1
(A/Chicken/Astana/6/05) influenza vaccine is safe and immunogenic in a single dose in humans
// Clin Vaccine Immunol. – 2013. 20(8): 1314-9.
15. Nurpeysova A., Mamadalyiev S., Khairullin B., Kydyrbaev Zh., Kassenov M.,
Abduraimov Y., Volgin E., Bogdanov N., Issagulov T., Sarsenbayeva G., Kiselev O., Tsybalova
L., Migunov A., Stukova M., Zaytseva M., Satybaldieva Zh., Shin S., Shnaukshta V. Preclinical
Testing of Refluvac, A Vaccine Against Pandemic Influenza A/H1N1V//J. Appl. Environ. Biol.
Sci., 2011. 1(3) 48-53.
16. Tabynov K., Kydyrbayev Z., Sansyzbay A., Khairullin B., Ryskeldinova S.,
Assanzhanova N., Kozhamkulov Y., Inkarbekov D. Immunogenic and protective properties of the
first Kazakhstan vaccine against pandemic influenza A (H1N1) pdm09 in ferrets // Virol Sin. –
2012. 27(6): 345-52.
17. Tabynov K., Khairullin B., Kydyrbayev Zh., Sandybayev N., Stukova M., Erofeeva M.,
Shurygina A.P., Kiselev O., Mamadaliev S. and Sansyzbay A. Preliminary Assessment of Safety
and Immunogenicity of an Inactivated Whole-Virion Vaccine against Influenza А (H1N1) Pdm09
Containing Aluminum Hydroxide Adjuvant: A Randomized, Blinded Phase I Clinical Study // J
Vaccines Vaccin. - № 4(7). – P. 205.
18. Петров Р.В., Хаитов Р.М., Некрасов А.В., Иванова А.С., Пучкова Н.Г. Гриппозная
вакцина нового поколения - Гриппол. Сборник трудов 5-го Конгресса «Современные
проблемы аллергологии и иммунологии и иммунофармакологии», т.1, Москва, 12-14
ноября 2002.С.134-179.
19. Некрасов А. В., Пучкова Н. Г., Харит С. М., Черняева Т. В. и др. Вакцина
Гриппол® Нео:Результаты клинических исследований безопасности и реактогенности
(фаза II) // Эпидемиология и вакцинопрофилактика. 2009, № 5 (48): 54–60.
76
20. Некрасов А. В., Пучкова Н. Г., Харит С. М., Черняева Т. В. и др. Вакцина
Гриппол® Нео:Результаты клинических исследований безопасности и реактогенности
(фаза II) // Эпидемиология и вакцинопрофилактика. 2009, № 5 (48): 54–60.
21. Бурцева Е.И., Слепушкин А.Н., Белякова А.Л. и др. Выбор оптимальных схем в
тактике вакцинации против гриппа пожилых людей. ЖМЭИ 1998; 4: 40-44.
22. Коровина Н., Заплатников А., Захарова И. и др. Сравнительная эффективность
вакцины Ваксигрип и средств неспецифической профилактики гриппа. Terra Medica, 1999,
№2:20-21
23.
Кузнецов
O.K.,
Степанова
Л.А.,
Коротков
А.В.Особенности
вакцинопрофилактики гриппа // Эпидемиология и вакцинопрофилактика.2006. № 1. С. 3–8.
24. Карпова Л.С., Маринич И.Г., Столяров К.А. Дальнейшее совершенствование
эпидемиологического надзора за гриппом в России в системе Федерального центра по
гриппу и ОРВИ //Эпидемиология и вакцинопрофилактика.2008. № 6. С. 23–29.
25. Ельшина Г.А., Горбунов М.А., Бектимиров Т.А. и др. Оценка реактогенности,
безвредности и профилактической эффективности тривалентной профилактической
полимер-субъединичной вакцины "Гриппол", при введении детям школьного возраста.
Журн микробиол 2000; 2: 50-4.
26. Daubeney P., Taylor C. J., McGaw J. et al. Immunogenicity and shipping of a trivalent
antiinfluenzal subjedinichny vaccine (Inflyuvak) at children age from 6 months to 4 years. //
British Journal of Clinical Practice, 1997; 51: 87-90.
27. Гаращенко Т.И., Ильенко Л.И., Гаращенко М.В. Фитотерапия в сезонной
профилактике острых респираторных заболеваний у детей школьного возраста //Вопросы
современной педиатрии. — 2006. — Т. 5, N 6 — с. 52–55.
Түйін. Бұл жұмыста Кедендік бірліктің аумағында тіркелген тұмауға қарсы
вакциналардың, өздеріне штамдардың талғамдау анализының рәсімін алған; маусымдық
тұмауға қарсы және пандемияға қарсы қазіргі тұмау вакциналарына сипаттама ұсынылды.
Abstract.The short review on the infuenzal vaccines registered in the territory of the
countries of the Customs union is submitted in this work, which included the analysis of
procedure of a choice of strains for influenza vaccines; description and properties of modern
vaccines against seasonal and pandemic flu.
УДК 615.371+615.06: 312-053.8+312-055
ОЦЕНКА СВЯЗИ ДЕМОГРАФИЧЕСКИХ ФАКТОРОВ И КЛИНИЧЕСКИХ
ПРОЯВЛЕНИЙ С ЭФФЕКТИВНОСТЮ ПЕРВИЧНОЙ ВАКЦИНАЦИИ ЖИВОЙ
ОСПОВАКЦИНОЙ
Ермилова О.С., аспирант, Гинько З.И., врач-инфекционист высшей категории МСЧ 163
ФМБА, Белявская В.А., д.б.н., зав. сектором
ФБУН ГНЦ ВБ «Вектор», п. Кольцово, НСО.
Резюме. Течение первичной вакцинации против натуральной оспы отражает
индивидуальные особенности иммунитета. Целью настоящей работы является изучение
влияния демографических и клинических факторов на вакцинальный процесс. В
исследовании принимали участие 82 человека, впервые вакцинированных живой оспенной
вакциной. Оценка эффективности вакцинации проводилась по наличию пустулы.
Статистически значимых различий в разных возрастных и половых группах выявлено не
было. Вакцинальный процесс средней тяжести сопровождался достоверно большим
77
размером пустулы (p<0,01). У 72 человек (87,8%) вакцинация сопровождалась местными и
общими вакцинальными реакциями.
Введение. Натуральная оспа была ликвидирована в результате программы массового
оспопрививания в XX веке. С 1980г по решению ВОЗ всеобщая иммунизация населения
была прекращена [1]. Но угроза вспышек заболевания остается [2,3], и ряд стран создают
запасы противооспенных вакцин для предотвращения возможных атак биотерроризма и
разрабатывают более эффективные вакцины [4, 5]. Иммунизация может сопровождаться
серьезными осложнениями [6, 7]. Изучение противовирусных вакцин показало, что
индивидуальные различия в реактивности организма и эффективности вакцинации могут
быть обусловлены полиморфизмом генов, определяющих функционирование иммунной
системы [8].
Цель настоящей работы: изучение влияния половозрастных различий на
эффективность вакцинации, оцениваемой по размеру пустулы у первично
вакцинированных лиц, и их взаимосвязь с вакцинальными реакциями.
Материалы и методы исследований. Исследование проводили в соответствии с
протоколом исследований, утвержденным Этическим комитетом ФБУН ГНЦ ВБ
«Вектор». Вакцинацию (с 2000 по 2013гг) проводили в соответствии с методическими
указаниями двухэтапным способом
живой оспенной вакциной. Эффективность
вакцинации оценивали по размеру пустулы на 8-ые сутки после прививания.
Поствакцинальный период классифицировали по клиническим проявлениям общих и
местных реакций на степени тяжести (легкую, среднюю и тяжелую). Сравнение
параметрических данных проводили с использованием t-критерия Стюдента при помощи
пакета прикладных программ Statistika 9 (StatSoft).
Результаты исследований. В исследовании принимала участие когорта впервые
вакцинированных лиц в составе 82 человек, сотрудников «Вектора» и проверяющих
организаций. Средний возраст в когорте составил 27 лет (от 20 до 34 лет). Мужчин (63
чел.) в 3,3 раза больше чем женщин. Обследуемых разделили на 2 возрастные группы:
относительно молодые (20-25 лет) и взрослые (26-32 года). При сравнении групп по
возрасту и полу статистически значимых различий в размере образовавшейся пустулы
выявлено не было (p=0,38). Результаты представлены в таблице 1. У 2 человек из когорты
(2,4%) не наблюдалось кожной реакции после проведения прививки.
Таблица 1 - Демографические данные когорты и их влияние на эффективность
вакцинации
Группа
Всего вакцинировано (от 20 до 34 лет)
В возрасте от 20 до 25 лет (средний возраст
24,7лет)
В возрасте от 26 до 34 лет (средний возраст
24,7лет)
Мужчин (средний возраст 27,0 лет)
В возрасте от 20 до 25 лет (средний возраст
22,9лет)
В возрасте от 26 до 34 лет (средний возраст
30,1лет)
Женщины (средний возраст 28,8 лет)
78
Количество
(n)
82
29
Размер пустулы на 8
сутки (мм)
9,9±2,9
9,7±2,9
53
9,9±2,9
63
27
9,8±2,83
9,9±2,9
36
9,8±2,9
19
10,0±2,8
В возрасте от 20 до 25 лет (средний возраст 22,0
лет)
В возрасте от 26 до 34 лет (средний возраст
29,6лет)
2
8,0±2,8
17
10,3±2,8
Влияние степени тяжести поствакцинального периода на эффективность вакцинации
оценивали, сравнивая размеры пустулы в двух группах: со средней степенью тяжести (57
чел.) и с легкой степенью (23 чел.). В группе лиц с легкой степенью диаметр пустулы
составил 8,9 ± 1,0 мм, и был достоверно меньше (p<0,01), чем в группе лиц со средней
степенью тяжести (диаметр пустулы 10,4 ± 3,7 мм). Из 80 успешно вакцинированных лиц
(с наличием пустулы) у 72 человека отметили возникновение выраженных местных и
общих вакцинальных реакций (табл. 2).
Таблица 2 - Местные и общие вакцинальные реакции
Местные вакцинальные реакции
n (%)
Общие вакцинальные
реакции
Лихорадка (выше 39,0 С)
Озноб
n (%)
Зуд в месте вакцинации
Подмышечный лимфаденит
из них лимфаденит более 1,5 см
вd
Болезненность
в
левой
подмышечной области или левом
плече
Отек левого плеча
Выраженная местная
воспалительная реакция:
гиперемия свыше 10 см в
диаметре
инфильтрация больше 4,5 см
9 (11)
71 (86,6)
5 (6)
13 (15,9)
Недомогание, слабость
18 (22)
1 (1,2)
Головная боль
Першение в горле
3 (3,7)
1 (1,2)
7 (8,5)
5 (6)
Насморк
1 (1,2)
Боли в поясничной области
1 (1,2)
Миалгия
H. Zoster на коже туловища
2 (2,4)
1 (1,2)
Гнойный ободок вокруг корочки
9 (11)
Длительный период отпадения 6 (7,3)
корочки (более 30 дней)
9 (11)
9 (11)
Наиболее часто встречающимся осложнением является подмышечный лимфаденит (у
86,6% вакцинированных). У лиц с лимфаденитом размер пустулы достоверно больше, чем
у лиц без этого осложнения (p=0,03). Сравнительный анализ частоты встречаемости
вакцинальных осложнений местного и общего характера среди мужчин и женщин из
разных возрастных групп значимых различий не выявил.
Выводы. В результате проведенного исследования было показано, что среди 82
впервые вакцинированных лиц, у 97,6% вакцинация прошла успешно (наличие пустулы).
При этом у 87,8% из них наблюдались местные и общие вакцинальные реакции.
Состояние средней степени тяжести в поствакцинальном периоде наблюдалось в 69,5%
случаев. Между размером пустулы и тяжестью поствакцинальных реакций отмечалась
положительная корреляция. Половозрастные различия не оказывали влияние на
эффективность вакцинации, оцениваемой по размеру пустулы.
В дальнейшем планируется поиск полиморфных вариантов генов иммунитета,
вовлеченных в формирование баланса между эффективностью адаптивных иммунных и
неспецифических воспалительных реакций.
79
Список литературы
1. Научный обзор исследований вируса натуральной оспы, 1999–2010 гг. ВОЗ. 2011г.
2. Ладный И.Д. Ликвидация оспы и предупреждение ее возврата Издательство
«Медицина»: 1985, с.230.
3. Маренникова С.С. К 30-летнему юбилею ликвидации натуральной оспы в мире.
Журн. микробиол., эпидемиол и иммунобиол.; 2011; 3:121-124.
4. Von Krempelhuber A, Vollmar J, Pokorny R, Rapp P, et al. A randomized, doubleblind, dose-finding Phase II study to evaluate immunogenicity and safety of the third generation
smallpox vaccine candidate IMVAMUNE. Vaccine. 2010; 28(5):1209-16.
5. Nak-Hyun Kima, Yu Min Kanga, Gayeon Kima, Pyoeng Gyun Choea, et al. An openlabel, single arm, phase III clinical study to evaluate the efficacy and safety of CJ smallpox
vaccine in previously vaccinated healthy adults. Vaccine. 2013; 31: 5239– 5242.
6. Fulginiti V.A., Papier A., Lane J.M., Neff J.M. and Henderson D.A. Smallpox
Vaccination: A Review, Part I. Background, Vaccination Technique, Normal Downloaded from
Vaccination and Revaccination, and Expected Normal Reactions. Clinical Infectious Diseases
2003; 37: 241–50.
7. Marnie L. Elizaga, Sandhya Vasan, Mary A. Marovich, et al. Prospective Surveillance
for Cardiac Adverse Events in Healthy Adults Receiving Modified Vaccinia Ankara Vaccines: A
Systematic Review. PLOS ONE. 2013; 8:
8. Ovsyannikova I.G., Poland G.A.. Vaccinomics: Current Findings, Challenges and Novel
Approaches for Vaccine Development. The AAPS Journal. 2011; 13 (3): 438-445.
Abstract. Primary smallpox vaccination is associated with immune individual variations.
This work purpose was to determine demographic and clinical influence to vaccination. The data
of 82 primary vaccinated with live smallpox vaccine subjects of Russian population was
investigated. Vaccination success was defined as the presence of a pustule at day 8. Age and
gender did not present any differences. Size of the pustule was correlated with the moderate
reactions (p<0.01).72 subjects (87.8%) experienced one or more side effects.
УДК 575.22
ПЕРСПЕКТИВНЫЕ СИМБИОТИЧЕСКИЕ АЗОТФИКСИРУЮЩИЕ
МИКРООРГАНИЗМЫ
А.Е. Есенбаева, к.б.н. О.А.Тен, к.х.н. Д.С. Балпанов
Филиал РГП на ПХВ «Национальный центр биотехнологии», КН МОН РК в г.
Степногорск, E-mail: [email protected]
Резюме. В статье приводятся результаты выделения азотфиксирующих
микроорганизмов. Выявлено и экспериментально установлено, что бактерии штамма
Bradyrhizobium japonicum SR4, Sinorhizobium fredii SR1 образуют на корнях растений
клубеньки, обладающих хорошей азотфиксирующей активностью и положительно влияют
на полевую всхожесть сои, ее рост и урожайность. Выделенные активные
клубенькообразующие
азотфиксирующие
микроорганизмы
перспективны
для
дальнейшего использования в качестве биологических азотфиксирующих удобрений.
Введение. Азотфиксирующие симбиотические бактерии, широко известные как
Rhizobium sp., широко используются в производстве биологических удобрений для
бобовых растений, которые применяются для продовольственных, кормовых целей, в
качестве овощной культуры, многие служат сырьем для различных отраслей
80
промышленности. С развитием животноводческой отрасли зернобобовые культуры в
качестве источника кормового белка приобрели высокую значимость в кормлении
различных видов животных. Они используются в виде зернофуружа, для приготовления
комбикормов, белковых добавок, зерносенажа, сена, зеленого корма.
Фиксация атмосферного азота возможна только в клубеньках, образующихся на
корнях растений. Возникают они при инфицировании корневой системы бактериями из
рода Rhizobium. Заражение корневой системы происходит через молодые корневые
волоски. После внедрения бактерии прорастают внутри них до самого основания в виде
инфекционной нити. Выросшие нити проникают сквозь стенки эпидермиса в кору корня,
разветвляются и распределяются по клетками коры. При этом индуцируется деление
клеток хозяина и разрастание тканей. В месте локализации бактерий на корне растенияхозяина образуются клубеньки, в которых бактерии быстро размножаются и
располагаются по отдельности или группами в цитоплазме растительных клеток [1-3].
Препараты на основе клубеньковых бактерий широко используются во многих
странах под различными названиями (во Франции - N-germ, в Чехии и Словакии –
нитразон, а России – нитрагин, ризоторфин и т.д). Также искусственная инокуляция
бобовых культур клубеньковыми бактериями проводится в Болгарии, Польше, США,
Канаде, Франции и др.
Материалы и методы исследований. В полевых условиях из каштановых почв
Северного Казахстана отбирали растения определенного вида (донник, люцерну, клевер,
горох, сою) с хорошо развитой корневой системой и наличием активных клубеньков.
Выделение проводили из отобранных образцов (клубеньки). Клубеньки разрезали
стерильным ножом и шпателем растирали содержимое клубенька по поверхности
питательной среды. Этим же шпателем, без прокаливания, проводили рассев содержимого
клубенька еще на 4 чашки Петри на соответствующих средах последовательно.
Для проведения вегетационных опытов сначала подготовили грунт, смешав 80%
почвы с 20% торфяного грунта. Затем полученный грунт разложили по 5 кг в
вегетационные сосуды объемом 3 л и полили водопроводной водой. После этого
произвели закладку семян на проращивание: семена стерилизовали как указано выше и
проращивали в чашках Петри в физиологическом растворе (0,85% NaCl) при температуре
28°С в течении 3-х суток, а проростки замачивали в бактериальной суспензии
Bradyrhizobium japonicum SR4 или Sinorhizobium fredii SR1 с титром клеток не менее
6,0×108 КОЕ/мл в течение 15 мин и высаживали в почву.
Результаты и обсуждение. Для выделения симбиотических азотфиксирующих
микроорганизмов из клубеньков гороха и клевера использовали питательную среду на
гороховом отваре.
По сравнению полученных биохимических характеристик с литературными данными
выделенные моноизоляты были идентифицированы до вида: Rhizobium meliloti – 1 изолят,
Rhizobium leguminosarum bv. vicae – 2 изолята, Rhizobium ciceri-1 изолят, Bradyrhizobium
japonicum – 2 изолята, Sinorhizobium fredii – 1 изолят [4-8].
Видовую принадлежность изолятов подтвердили способностью микроорганизмов
инфицировать корни растений соответствующих видов и образовывать клубеньки в
лабораторных условиях [9].
Rhizobium meliloti дали рост на семенах донника и люцерны, суспензией Rhizobium
leguminosarum bv. vicae инокулировали – на семени гороха и клевера, Rhizobium ciceri – на
семени нута, Bradyrhizobium japonicum – на семенах сои, Sinorhizobium fredii – на семенах
сои и гороха. По результатам теста отобраны: Rhizobium meliloti – 1 изолят, Rhizobium
leguminosarum bv. vicae – 2 изолята, Rhizobium ciceri-1 изолят, Bradyrhizobium japonicum –
2 изолята, Sinorhizobium fredii – 1 изолят. Штаммы Rhizobium meliloti RL1, Rhizobium
leguminosarum bv. vicae RP1, Rhizobium leguminosarum bv. vicae R-2, Rhizobium ciceri RN1,
Bradyrhizobium japonicum SR2, Bradyrhizobium japonicum SR4, Sinorhizobium fredii SR1
депонированы под номером В-339, В-338, B-355, В-337, B-364, B-363 и B-362
81
соответственно в коллекции культур КазНИИ перерабатывающей и пищевой
промышленности.
Выявлено и экспериментально установлено, что бактерии штамма Bradyrhizobium
japonicum SR4, Sinorhizobium fredii SR1 образуют на корнях растений клубеньки,
обладающих хорошей азотфиксирующей активностью и положительно влияют на полевую
всхожесть сои, ее рост и урожайность. Способность бактерий Bradyrhizobium japonicum
SR4 и Sinorhizobium fredii SR1 образовывать на корнях растений клубеньки
подтверждается вегетационными опытами в лабораторных условиях [10].
В результате проведенного вегетационного опыта, растения выкапывали вместе с
корнями, корни отмывали, подсушивали и взвешивали отдельно надземную и подземную
части растений, подсчитывали количество клубеньков. Результаты описанных
вегетационных опытов с соей представлены в таблице.
Таблица 1 - Количество клубеньков сои и вес растений в вегетационном опыте с соей
Вариант опыта
Контроль без обработки
Обработка бактериями
Bradyrhizobium japonicum
SR4
Обработка бактериями
Sinorhizobium fredii SR1
Вес растений, г
2,8
4,31
Количество клубеньков
5
19,8
3,85
15,1
Из данных представленных в таблице 1, следует, что при обработке семян сои
бактериями штаммов Bradyrhizobium japonicum SR4 и Sinorhizobium fredii SR1 по
сравнению с контролем растения сои имеют большой вес и на корнях образуются
клубеньки, причем в штамм Bradyrhizobium japonicum SR4 оказался более активным, чем
Sinorhizobium fredii SR1.
Таким образом, в результате проделанной работы отработан метод выделения
азотфиксирующих микроорганизмов, идентификацию которых проводили до вида по
биохимическим и культурально-морфологическим признакам с подтверждением вида по
способности микроорганизмов инфицировать корни растений соответствующих видов и
образовывать клубеньки в лабораторных условиях. В результате проведения
вегетационных опытов в лабораторных условиях выявлено, что выращенные семена сои,
предварительно обработанные штаммами Bradyrhizobium japonicum SR4 и Sinorhizobium
fredii SR1 по сравнению с контролем имеют большой вес и на корнях образуются
клубеньки. Выделенные активные азотфиксирующие микроорганизмы Bradyrhizobium
japonicum SR4 и Sinorhizobium fredii SR1 перспективны для дальнейшего использования в
качестве биологических удобрений.
Список литературы
1. Косолапов В.М. Фицев А.И., Гаганов А.П., Мамаев М.В. Горох, люпин, вика,
бобы: оценка и использование в кормлении сельскохозяйственных животных. – Москва,
2009.
2. Карагуйшиева Д.К. Свободноживущие азотфиксаторы почв Казахстана / АлмаАта: Наука, 1972. - 199 с.
3. Мамилов Ш.З. Азотфиксирующие ассоциации с Rhodopseudomonas sp. в
затопляемых почвах под рисом. // Повышение плодородия почв рисовых полей. М.: Наука.
- 1977. -С. 116-121.
4. V.K. Deshwal, A. Chaubey. Isolation and Characterization of Rhizobium leguminosarum
from Root nodule of Pisum sativum L. // Journal of Academia and Industrial Research (JAIR). –
2014. – Vol. 2. – Р. 464-467.
5. F. Shahzad, M. Shafee, F. Abbas, S. Babar, M.M. Tariq, Z. Ahmad. Isolation and
82
biochemical characterization of Rhizobium meliloti from root nodules Alfalfa (Medico sativa) //
The Journal of Animal and Plant Sciences. – 2012. Vol. - 22(2). P. 522-524.
6. V.V. Deshmukh, S.S. Mane, R.M. Gade, R.W. Ingle, M.S. Joshi. Biochemical studies of
Bradyrhizobium japonicum isolates // American international Journal of Research in Formal,
Applied and Natural Sciences. – 2013. - Vol. - 4(1). P. 53-57.
7. S.M. Nour, M.P. Fernandez, Ph. Normand, J-C. Cleyet-Marel. Rhizobium ciceri sp.
Nov., Consisting of strains that nodulate Chickpeas (Cicer arithenium L.) // International Journal
of Systematic Bacteriology.- 1994.- Vol.- 44. No.- 3. P. 511-522.
8. M.J. Sadowsky, H.H. Keyser, B.B. Bohlool. Biochemical characterization of fast- and
slow-growing rhizobia that nodulate soybeans // International Journal of Systematic
Bacteriology.- 1983.- Vol.- 33. No.- 4. P. 716-722.
9. Определитель бактерий Берджи / Под ред. Дж. Хоулта. – 9-е изд., В 2 т. - М.: Мир,
1997 - 800 с.
10. Мишустин Е.Н., В.К. Шильникова. Клубеньковые бактерии и инокуляционный
процесс. – М.: Наука, 1973. – 288 с.
Түйін.
Мақалада
азот
тұрақтандыратын
микроағзалар
бөлуінің
нәтижелері келтірілген. Bradyrhizobium japonicum SR4, Sinorhizobium fredii SR1
штаммының бактериялары өсімдіктер тамырларында жақсы азот тұрақтандыратын
белсенділікке ие түйнекшелер пайда болдырады және сояның егістік өнгіштігіне, оның
өсуі мен шығымдылығына оң әсер ететіндігі анықталды және эксперимент ретінде
белгіленді. Бөлінген белсенді түйнекше пайда болғыш азот тұрақтандыратын
микроағзалар келешекте биологиялық азот тұрақтандыратын тыңайтқыштар ретінде
қолдануға үмітті.
Summary. In the article, there are the results of isolation of nitrogen-fixing
microorganisms. It was identified and experimentally established that the bacteria of the strain
Bradyrhizobium japonicum SR4, Sinorhizobium fredii SR1 form nodules on the roots of plants,
having a good nitrogen-fixing activity and positively affect the germination of soybean, its
growth and yield. Isolated active nodule-forming nitrogen-fixing microorganisms are perspective
for future use as biological nitrogen-fixing fertilizers.
УДК 575.22
BACILLUS SUBTILIS S-2 ДЛЯ СОЗДАНИЯ БИОПЕСТЕЦИДОВ
А.Е. Есенбаева, О.А.Тен, Д.С.Балпанов
Филиал РГП «Национальный центр биотехнологии Республики Казахстан», МОН РК
в г. Степногорск, е-mail: [email protected]
Резюме. Среди потенциальных штаммов, обладающих фунгицидной активностью,
особое место занимают бациллы, на основе которых созданы биопестициды, защищающие
полезные сельскохозяйственные растения от грибных болезней. Значительный ущерб
причиняют грибы рода Fusarium sp., Helmintosporium sp., Verticillium sp. вызывающие
фузариозные корневые гнили растений. В процессе работы отработан метод выделения
Bacillus subtilis S-2 из ризосферы растений, оптимизация питательных сред и условий
культивирования фунгицидных микроорганизмов. Выделенный штамм Bacillus subtilis S-2
может быть использован для создания фунгицидного препарата широкого спектра
действия, защищающего полезные сельскохозяйственные растения.
Ключевые слова: фунгицидная активность, фитопатогенные грибки Fusarium sp,
Helmintosporium sp, Verticillium sp, Bacillus subtilis S-2, метод агаровых блочков.
83
Введение. В последние годы в связи с бурным развитием биотехнологии и задачами
обеспечения экологических условий жизни и производства усиливается интерес к
спорообразующим бактериям. Главными объектами фундаментальных и прикладных
исследований на протяжении многих лет были бактерии Bacillus subtilis, штаммы которого
используются как продуценты ферментов и как пробиотики.
Устойчивость растений к заболеваниям, вызываемым почвенными фитопатогенами,
во многом определяется результатами взаимодействия между корневой системой растений
и разнообразными микроорганизмами. Совокупность корневой системы с почвой
представляет собой сложную экологическую нишу, заселенную полезными, вредными и
нейтральными для растений микроорганизмами.
Широкое распространение заболеваний зерновых культур, вызываемых
фитопатогенными грибами, наносит значительный экономический ущерб сельскому
хозяйству. Развитие грибных болезней приводит к снижению урожая, а также к
загрязнению зерна высокотоксичными веществами — микотоксинами, что значительно
ухудшает потребительские качества зерна, его полноценность и безопасность для
теплокровных. К наиболее опасным грибным болезням зерновых культур относятся
фузариозы, возбудителями которых являются грибы рода Fusarium — Fusarium
graminearum, Fusarium nivalae, Fusarium avenaceum, а также грибы рода Helmintosporium
sp., Verticillium sp. Потери урожая от фузариоза достигают 30%. Источники инфекции при
корневых гнилях — зараженные почва, семена, растительные остатки. В настоящее время
для борьбы с корневыми гнилями преимущественно используются химические
антимикотические препараты. При этом возникает ряд рисков, например, формирование
устойчивости целевых микроорганизмов, токсичное воздействие на культурные растения,
снижение активности микроорганизмов ризосферы.
Микроорганизмы, вносимые в почву в составе комплексных удобрений и удобрений
на основе монокультур, способствуют повышению биологической активности почвы;
оздоровлению почвы от фитопатогенов; активизации микробно-растительного
взаимодействия; получению высоких урожаев экологически чистой сельскохозяйственной
продукции;
восстановлению
микробиоценоза
почв,
нарушенного
вследствие
антропогенного воздействия [1]. Спорообразующие бактерии рода Bacillus наиболее
перспективны в качестве компонентов биоудобрений, поскольку сохраняют
жизнеспособность и устойчивость к повреждающим воздействиям. Среди представителей
Bacillus sp только малая часть видов является патогенами и токсикогенами (Bacillus
anthrachis, B.cereus и некоторые другие) [2,3,4].
Bacillus subtilis обладает антагонистической активностью, подавляя рост патогенных,
условно патогенных грибов и бактерий и является важным продуцентом некоторых
полисахаридов, протеаз, амилаз и аминокислот. Также является продуцентом
полипептидных антибиотиков. Ввиду наличия антагонистических свойств против
фитопатогенов используется в биозащите растений.
Перспективной, таким образом, является разработка биологического удобрения на
основе органических компонентов и почвенных микроорганизмов, в том числе
фитопатогенных бактерий.
Материалы и методы. Выделение фунгицидных микроорганизмов проводили из
ризосферы
растений.
Отобранные
образцы
суспендировали
в
стерильной
дистиллированной воде в соотношении 1:100 и встряхивали на инкубаторе-шейкере в
течение 2 часов. Половину каждого образца прогревали при 80°С в течение 30 минут для
удаления вегетативной микрофлоры.
На чашки Петри с питательной средой Чапека высевали тест-организмы–
фитопатогенные грибки Fusarium sp, Helmintosporium sp, Verticillium sp, каждый организм
на отдельную чашку. Чашки подсушивали при комнатной температуре 2 часа. Стерильной
микробиологической петлей раскладывали капли суспензии на поверхности питательной
среды (по 5-7 капель на 1 чашку). Чашки Петри с посевами инкубировали при комнатной
84
температуре в течение 10 суток. После окончания инкубирования отбирали группы
колоний, вокруг которых произошла задержка роста тест-организма. Подобные колонии
образовались только вокруг капель суспензии, отобранной из прогретых проб почвы. Из
отобранных образцов готовили суспензию и проводили высев разведений суспензии 10 -710-8 на питательную среду Чапека, предварительно засеянную тест-организмами. Для
дальнейшей работы выбирали колонии, вокруг которых формировались зоны задержки
роста тест-организмов.
Отобранные колонии пересевали на скошенную среду Чапека, культивировали в
термостате для образования биомассы в течение 3-5 суток. После образования биомассы
отобранные моноизоляты тестировали на фунгицидную активность. Выделение и
поддержание выделенных культур осуществляли на универсальных агаризованных средах.
Для приготовления питательных сред пользовались приведенными ниже прописями.
Состав среды Чапека (г/л): сахароза - 30 г, NaNO3 - 3 г, KH2PO4 - 1 г, MgSO4 *, 7H2О 0.5 г, KCl - 0.5 г, FeSO4×7H2O - 0.01 г, агар-агар 15 г.
Результаты и обсуждение. Выделение микроорганизмов, обладающих фунгицидной
активностью проводили из окультуренной каштановой почвы и слоя почвы прикорневой
зоны овощных культур (картофеля, огурца). Отобранные в полевых условиях образцы
помещали в стерильные пластиковые пакеты и в течении двух часов доставляли в
лабораторию. Накопительную культуру ставили по описанной выше методике.
После образования биомассы, отобранные моноизоляты тестировали на
фунгицидную активность методом агаровых блочков [4]. Результаты исследования
отобранных моноизолятов представлены в таблице 1.
Таблица 1 - Исследование фунгицидной активности выделенных моноизолятов
методом агаровых блочков
Микроорганизм
Тест-культура
Диаметр зоны задержки роста, мм
Helmintosporium sp.
17
S-1
Verticillium sp.
14
Fusarium sp.
Нет задержки роста
Helmintosporium sp.
38
S-2
Verticillium sp.
25
Fusarium sp.
14
Для идентификации отобрали моноизоляты, вокруг которых формировались зоны
задержки роста тест-организмов не менее 10 мм (таблица 1). Образуются прямые
палочковидные клетки с закругленными краями, расположенные одиночно, попарно или в
виде цепочки. Отобранные изоляты ферментируют глюкозу, арабинозу, ксилозу, мальтозу,
лактозу, маннит, сахарозу с образованием кислоты без газа. Гидролизуют крахмал,
желатину, не гидролизует мочевину и утилизируют цитрат. Реакция Фогеса-Проскауэра на
образование ацетоина положительная.
По результатам морфологических и культурально-биохимических свойств [5] было
установлено, что отобранные культуры S-1 и S-2 относятся к виду Bacillus subtilis.
Для дальнейшей работы выбран штамм Bacillus subtilis S-2, проявивший наибольшую
фунгицидную активность.
На поверхности плотных питательных сред Bacillus subtilis S-2 образует сухие
морщинистые плоские колонии с неровным краем, на поверхности скошенной
питательной среды - сухой морщинистый налет. Через 72 часа инкубирования культура
образует центрально расположенные крупные округлые споры.
Дополнительно исследовали методом агаровых блочков воздействие Bacillus subtilis
S-2 на рост полезных биологически активных почвенных микроорганизмов. Показано, что
микроорганизм не подавляет рост Azotobacter sp., Rhizobium sp, Bradyrhizobium japonicum.
85
В результате проделанной работы проведен отбор штаммов почвенных
микроорганизмов, обладающих фунгицидной активностью. Из ризосферы почвы
Северного Казахстана выделена культура Bacillus subtilis S-2, обладающая
антагонистической активностью в отношении фитопатогенных грибков Fusarium sp,
Helmintosporium sp, Verticillium sp. В дальнейшем данный метод выделения активных
культур Bacillus subtilis S-2 может быть использован для получения удобрения на основе
бактерий, обладающих фунгицидной активностью.
Список литературы
1. Боронин А.М. Ризосферные бактерии рода Pseudomonas, способствующие росту и
развитию растений// Биология. 1998, № 3, С. 25-31.
2. Швартау В.В., Гуляев Б.И., Карлова А.Б. Особенности реакции растений на
дефицит фосфора// Физиология и биохимия культурных растений. 2009, №3, С. 208-212.
3. Park J., Bolan N., Mallavarapu M. Enhancing the solubility of insoluble phosphorus
compounds by phosphate solubilizing bacteria// 19-th World Congres of Soil Science. –
Brisbane, 2010, Р. 65-68.
4. Yasmin H., Bano A. Isolation and characterization of phosphate solubilizing bacteria
from rhizosphere soil of weeds of khewra salt range and attock// Pakistan Journal of Botany. –
2011, № 3, Р. 1663-1668.
5. Bergey D.H., Robert S.Breed. Bergey's manual of determinative bacteriology. Baltimore,
Williams & Wilkins Co., 1957, P. 613-621.
Түйін. Фунгицидтті белсенділігі бар потенциалды штаммдар арасында ерекше орын
алатыны және олардың негізінде саңырауқұлақ ауруларынан пайдалы ауылшаруашылық
өсімдіктерін қорғайтын биопестицидтер шығарылды. Көп шығын келтіретіні өсімдік
тамырының фузариозды шіруіне әкеліп соқтыратын Fusarium sp., Helmintosporium sp.,
Verticillium sp. саңырауқұлақтар түрлері. Жұмыс барысында өсімдік ризосферасынан
Bacillus subtilis бөліп алу әдісі меңгерілді, құнарлы ортаны және фунгицидтті
микроағзаларды өсіру шарттары оңтайландырылды. Bacillus subtilis бөлінген штамм
пайдалы ауылшаруашылық өсімдіктерін қорғайтын кең спектрі бар фунгицидті препарат
жасауға болады.
Кілтті сөздер: фунгицидті белсенділік, фитопатогенді саңырауқұлақтар Fusarium sp,
Helmintosporium sp, Verticillium sp, Bacillus subtilis, агар блокшелер әдісі
Abstract: Among the potential strains possessing fungicidal activity, bacilli, on the basis of
which are developed biopesticides, protecting valuable agricultural plants from fungicidal
diseases, occupy a special place.The fungi of the genus Fusarium sp., Helmintosporium sp.,
Verticillium sp. cause significant damage, causing fusarium root rot of plants. In course of work,
the method of isolation of Bacillus subtilis from the rhizosphere of plants has been worked out;
optimization of nutrient media and conditions of cultivation of fungicidal microorganisms have
been performed. The isolated strain of Bacillus subtilis can be used to develop fungicidal
preparation, possessing wide spectrum of action, which can protect valuable agricultural plants.
Key words: fungicidal activity, phytopathogenic fungi Fusarium sp., Helmintosporium sp.,
Verticillium sp., Bacillus subtilis, the method of agarinic blocks.
86
УДК 616:022.1619;616.981.42
ОПРЕДЕЛЕНИЕ МИНИМАЛЬНОЙ ЗАРАЖАЮЩЕЙ ДОЗЫ
КОНТРОЛЬНОГО ШТАММА B. ABORTUS 544 ДЛЯ КРУПНОГО РОГАТОГО
СКОТА КОНЪЮНКТИВАЛЬНЫМ МЕТОДОМ
Еспембетов Б.А. к.в.н., Сырым Н.С. к.в.н., Зинина Н.Н. к.в.н., Табынов К.К. к.в.н.,
Рыскельдинова Ш.Ж., Нисанова Р.К., Сармыкова М.К., Безрукова А.Н., Конбаева Г.М.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. Штамм B. abortus 544 в дозе 500 млн. м.т. и конъюнктивальном способе
введения может применяться для контрольного заражения при оценке иммуногенности
противобруцеллезных векторных вакцин.
Введение. Известно, что при некоторых инфекционных заболеваниях
конъюнктивальные реакции являются показателями иммунологической перестройки
организма. На способности конъюнктивы: «реагировать на специфические раздражители»
основаны широко используемые в ветеринарной практике методы аллергической
диагностики при бруцеллезе.
Конъюнктива обильно снабжена нервами и сосудами и поэтому легко реагирует на
всякие раздражения эндо- и экзогенного характера. Благодаря анатомо-физиологическим
особенностям (построения из рыхлой соединительной ткани) и наличию большого
количества лимфатических путей конъюнктива обладает значительной всасывательной
способностью. Целесообразность введения вакцин через слизистые оболочки, кроме
удобства, обусловлена также своеобразием анатомо-физиологических особенностей
слизистых покровов и, прежде всего, их способностью всасывать различные вещества, в
том числе и антигены [1].
Кроме большой всасывающей способности слизистых оболочек важное значение в
развитии иммунитета играет и факт наличия здесь (в слизистой и подслизистой) развитой
сети лимфатических сосудов и рецепторов, что создает условия, для быстрой мобилизации
функций ретикуло-эндотелиальной системы (регионарных лимфатических узлов) и
передачи иммунизационного раздражения по организму.
К настоящему времени установлено, что успех иммунизации зависит не только от
общей реактивности организма, качества вакцинных препаратов, но и от методов их
применения, т. е. способов введения вакцин в организм. Доказана возможность создания
активного иммунитета при нанесении на неповрежденные слизистые оболочки некоторых
токсинов, анатоксинов и вакцин [2]. А также при иммунизации противобруцеллезной
вакциной определенную роль играет изучение заражающей дозы контрольного штамма.
Совершенно очевидно, что для получения воспроизводимых результатов эта доза в каждом
опыте должна быть строго определенной величины.
Целью наших исследований являлось определение минимальной заражающей дозы
контрольного штамма
В. abortus 544 конъюнктивальным методом для оценки
иммуногенности векторной противобруцеллезной вакцины в опыте на крупном рогатом
скоте.
Материалы и методы. В экспериментальных исследованиях, были использованы:
9 телок в возрасте от 1,5 до 2 лет, живой массой 100-150 кг.
В серологических и бактериологических исследованиях применяли различные
питательные среды, биохимические реактивы, красители.
Фенотипические свойства бруцелл В. abortus 544 изучали путем использования
культурально-морфологических, серологических, бактерио-логических и других методов
исследований по общепринятой схеме ФАО/ВОЗ [3,4,5].
87
Результаты исследований. Освежение эталонного контрольного штамма B. abortus
544 проводилось путем его пересева in vitro на питательной среде Brucella Agar Base с
добавками (агар-агар, глюкоза, глицерин, L-цистин, дрожжевой экстракт), а также in vivo
через организм морских свинок, массой 250-300 г. Далее для восстановления вирулентных
свойств B. abortus 544 провели пассирование через организм морских свинок до 7
пассажного уровня.
В результате проведенных исследований установлено, что контрольный штамм B.
abortus 544, подвергнутый биоконтролю сохранил свои исходные типовые свойства,
согласно паспортным характеристикам данного штамма.
После освежения и проведения полного биологического контроля и определения
минимальной заражающей дозы контрольного штамма B. abortus 544 на лабораторных
животных перешли к проведению основного эксперимента на крупном рогатом скоте. Для
данного опыта были взяты 9 телок, из которых созданы 3 группы в каждой по 3 головы.
Животным трех групп вводили шт. В. abortus 544 в разных дозах: 1 группа –60 млн. м.
т./см3, 2 группа –240 млн. м. т./ см3., 3 группа –500 млн. м. т./ см3 коньюнктивально в
объеме по 0,5 см3 в каждый глаз.
После заражения, за животными ежедневно велись наблюдения, с обязательным
проведением ректальной термометрии и взятием крови с интервалом 7,14,21,28 суток для
серологических исследований. Термометрия является
важным обязательным
диагностическим показателем, который позволяет проследить динамику состояния
животного в период заражения. Результаты термометрии и серологических исследований
представлены в таблице 1 и рисунке 1.
Рисунок 1 – Результаты термометрии телок зараженных B. abortus 544
Клиническое наблюдение за телками в течение опытного периода показало, что
температура тела в 1 и 2 группах животных значительныхколебаний не отмечалось: утром
37.8 оС, а вечером 38.3 оС. Оптимальной нормой для этого возраста животных
температура тела считается предел от 37,5 оС до 39,5 оС. По нашим данным разница
между вечерней и утренней термометрией составляло 0.5 градусов, что является нормой.
При клиническом наблюдении у телок 3-ей группы отмечено незначительное
угнетение общего состояния организма, слюнотечение, конъюнктивит, увеличение
предлопаточных лимфоузлов и повышение температуры тела от 40,0 до 41,5°С в течение 3
суток (рисунок 2).
88
Рисунок 2 – Состояние глаз у животных зараженных коньюнктивальным методом
Как видно из рисунка 2, на 7-9 сутки у животных 3-й группы, зараженных
бруцеллезом коньюнктивально происходило опухание и покраснение века зараженного
глаза и истечение гноя, что подтверждает тем самым вирулентность вышеуказанного
штамма.
До заражения и с момента заражения от животных через каждые 7 суток, взята кровь
для серологического исследования на бруцеллез в РБП, РА и РСК. Результаты
исследования сывороток крови взятых от опытных животных представлены в таблице 1.
Дни
исследований
Таблица 1 – Результаты серологических исследований при определении
минимальной заражающей дозы контрольного штамма Br.abortus 544 для КРС
Разве
дения
2
РБП
3
РСК
1:5
1:10
1:50
1:100
1:200
1:400
7-е сутки после
заражения
7.11.13.
1
Вид
иссл.
РА
14-е сутки после
заражения
РБП
РСК
РА
1:400
–
–
–
–
–
–
#
+++
+
+
–
+
–
+
–
+
–
–
–
–
–
#
++
#
#
#
#
21е
сут
ки
по
сл
е
за
ра
же
ни
я
РБП
РСК
1:5
1:10
1:50
1:100
1:200
Дозы заражения для телок шт. B. abortus 544
60 млн. м.т./ см3
240 млн. м.т./ см3
500 млн. м.т./ см3
Инв.
Инв.
Инв.
Инв.
Инв. Инв. Инв. Инв. Инв.
№
№
№
№
№
№
№
№
№
03135 05105 33239 14110 1351 17133 1455 2211 03285
0
5
5
4
5
6
7
8
9
10
11
12
–
–
–
–
+
–
+
+
+
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
+++
+++
++
–
–
–
–
–
–
+++
+++
+++
–
–
–
–
–
–
+++
+++
+++
–
–
–
–
–
–
++
++
++
–
–
–
–
–
–
#
+++
+++
–
–
–
–
–
–
#
#
#
–
–
–
–
–
–
+++
#
#
–
–
–
–
–
–
#
#
#
–
–
–
–
–
–
#
#
#
–
–
–
–
–
–
#
#
+++
1:5
89
РА
–
–
–
–
–
–
–
–
–
–
–
–
1:10
1:50
1:100
1:200
1:400
28 сутки после
заражения
28.11.13.
РБП
–
–
–
–
–
–
–
–
–
–
–
–
1:5
1:10
1:50
1:100
РА
1:200
1:400
Примечания:
1 "–" - отрицательный результат;
РСК
–
–
–
–
–
+
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
+
–
–
–
–
–
–
–
–
–
–
–
+
–
–
–
–
–
–
#
#
#
#
#
+++
#
#
+++
++
++
+
#
#
#
+++
+++
+++
#
#
+++
+++
++
+
#
#
#
+++
+++
#
#
#
+++
++
++
+
2 "+" - положительный результат в крестах
Данные из таблицы 1 показывают, что исследованные пробы сывороток крови телок
1-ой и 2-ой группы до заражения и в последующие сутки после заражения штаммом
B.abortus 544 в серологических тестах были отрицательными. Тогда как в РБП с
сыворотками крови от телок 3 группы через 7 сут наблюдали мелкозернистый агглютинат,
а начиная с 10 суток отмечали крупнозернистую агглютинацию с выраженным
просветлением. Начиная, с 14 суток после заражения у телок выявляли
комплементсвязывающие антитела в РСК, а реакция агглютинации 14 суток
была
положительной почти у всех экспериментальных животных 3 группы и при дальнейших
наблюдениях существенного различия в титрах не отмечено.
Проведенные серологические тесты, с позитивными результатами указывают на то,
что в организме подопытных животных 3-ей группы циркулирует возбудитель бруцеллеза.
После заражения через 30 суток проведено патологоанатомическое вскрытие телок и
отобраны для бактериологического исследования органы (печень, почки, селезенка),
лимфоузлы (заглоточный, средостенный, бронхиальный, брыжеечный, правые и левые
предлопаточные, паховые, портальный, параортальный, тазовый, надвыменной) и костный
мозг. Далее проведены высевы из вышеуказанных органов, лимфоузлов и костного мозга
на питательные среды. Результаты бактериологических исследований представлены в
таблице 2.
Таблица 2 – Результаты бактериологических исследований
Доза
зараже
ния
60
млн.
м.т.
см3
240
млн.
м.т.
см3
500
03135
05105
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
ИИ
(инде
кс
инфи
ц.)
‒
‒
33239
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
14110
13510
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
17133
‒
‒
‒
‒
‒
‒
‒
‒
‒
‒
14555
+
+
+
+
+
+
+
+
+
91,7±
Инв №
жив-х
Загл
оточ
Результаты бактериологических исследований
Лимфоузлы
Органы
Пред Пахов Тазо Пар Пе- Поч- Селелопат
ый
вый аорт чень
ки
зенка
90
Костный
мозг
млн.
м.т.
см3
22115
+
+
+
+
+
+
+
+
+
03285
+
+
+
+
+
+
+
+
+
3,1
93,3±
2,7
92,9±
4,1
Культуры бруцелл были выявлены на питательной среде, посевного материала из
всех исследуемых лимфоузлов и из органов животных 3 группы (500 млн. м.т./ см3).
Важно отметить, что выделенная исходная культура штамма B. abortus 544 после
заражения телок в дозе 500 млн.м.т. /см3 вызывала генерализованный процесс, средний
индекс инфицированности (ИИ) составлял - 92,7 ± 3,1 в организме животного подтверждая
тем самым вирулентность вышеуказанного штамма (таблица 3).
Таблица 3 – Высеваемость бруцелл из селезенки коров, зараженных контрольным
штаммом B. abortus 544
Дозы
заражения
60 млн. м.т
см3
240 млн. м.т
см3
500 млн. м.т
см3
Инв. №
животных
03135
05105
33239
14110
13510
17133
14555
22115
03285
ИВС
(индекс веса селезёнки)
0.64±0.38
0.66±0.34
0.16±0.23
0.22±0.31
1.21±0.25
1.160±0.19
3.13±0.57
3,36±0.31
3.28±0.51
Значение
(P)
<0.01
<0.001
<0.005
<0.001
<0.005
<0.001
<0.005
<0.001
<0.005
Данные таблицы 3 показывают, что у животных 3 группы был высоким индекс веса
селезёнки (ИВС), равный в среднем 3,25 ± 0,46, и средний индекс инфицированности (ИИ)
- 92,7 ± 3,1. Эти животные реагировали позитивно в серологических реакциях. Все эти
результаты свидетельствуют о генерализованной форме инфицирования бруцеллезом.
Выводы. По результатам проведённых экспериментальных исследований
минимальная заражающая доза штамма B. abortus 544 для крупного рогатого скота
конъюнктивальным способом составила 500 млн м.т./см3, вызывающих генерализованный
процесс бруцеллезной инфекции. Следовательно отработанная заражающая доза шт. B.
abortus 544 конъюнктивальным методом может использоваться для контрольного
заражения при оценки иммуногенности противобруцеллезных векторных вакцин.
Список литературы
1. Онищенко Г.Г. Актуальные проблемы профилактики инфекционных болезней на
современном этапе. Микробиология. 2010; С.13–22.
2. Жарова Л.В. Эффективность конъюнктивального метода иммунизации овец
против бруцеллеза вакциной из штамма 19: Дисс. канд. вет. наук. - Омск, 2002. - 106 с.
3. Панкова, Е.В. Фенотипический контроль стабильности при хранении музейных и
производственных штаммов возбудителей бруцеллёза/ Е.В. Панкова // Ветеринарный врач.
- Казань. - 2012. - С.23-24.
91
4. Techniques for the brucellosis laboratory. Institut national de la recherché agronomique
147, rue de I’Universite, 75007//IJRA Paris J. – 1988. – ISB № – 2 – 7380 – 0042-8. - Р.145.
5. Manual of diagnostic tests and vaccines for terrestrial animals (mammals, birds and bees)
Sixth Edation Volume 2, 2008.
6. Иванов Н.П. Бруцеллез животных и меры борьбы с ним. - Алматы, 2007.-518 с.
7. Иванов Н.П., Тургенбаев К.А. Инфекционные болезни животных. Общая
эпизоотология. Алматы: «Нур-Принт», Том 1. 2013.
8. Красиков А.П. Искусственная регуляция паразито-хозяинных отношений при
бруцеллезе животных - Омск, 2002. - 271 с.
Түйін. B. abortus 544 штаммы 500 млн. м.д. дозада және конъюнктивальдік енгізу
әдісімен бруцелезге қарсы векторлық вацинаның иммундігін сараптау үшін қолдануға
болады.
Summary. B. abortus strain 544 at a dose of 500 million mt and conjunctival injection
method can be used for controlling contamination in assessing immunogenicity antibrucellar
vector vaccines.
.
УДК 619:615.37.012
АТТЕНУИРОВАНЫЕ ШТАММЫ PASTEURELLA
БЕЗОПАСНОСТЬ И ИММУНОГЕННЫЕ СВОЙСТВА
MULTOCIDA,
ИХ
Жилин Е.С., Безрукова А.Н. м.в.н., Червякова О.В. к.б.н., Кайсенов Д.Н.,
Строчков В.М., Зинина Н.Н. к.в.н., Еспембетов Б.А. к.в.н.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. В работе представлены результаты получения аттенуированных мутантных
штаммов
Рasteurella
multocida,
являющихся
дериватами
штамма
Pasteurella/Saigas/2011/ZKO/KZ. Отмечено снижение патогенности стрептомицин
резистентного мутанта и ауксотрофного AroA мутанта при подкожном введении мышам.
Выявлена токсичность PМ/UV/AP/Str20000 мутанта и его способность вызывать
заболевание у сайгаков. Подкожное и пероральное введение Pasteurella multocida
saigas/AroA мутанта инициирует наработку антител в сыворотках крови коз и сайгаков, а
также является безопасным для данных видов животных.
Введение. Pasteurella multocida (РМ) признана одним из значимых ветеринарных
патогенов. В Азии РМ является причиной геморрагическая септицемии, заболевания
крупного рогатого скота, мелкого рогатого скота, буйволов и других видов животных с
высокой смертностью и экономическим значением [1]. Основным методом контроля
пастереллеза является вакцинация, с использованием адъювантных вакцин содержащих
бактерин РМ. Основным недостатком данных вакцин является краткосрочность
создаваемого ими иммунитета (4-6 мес) и необходимость ревакцинации для создания
эффективного иммунного ответа [2].
В последнее время все больше возрастает интерес к использованию в качестве
профилактических средств против пастереллеза сельскохозяйственных животных и птиц
живых вакцин, приготовленных из «рационально аттенуированных» штаммов бактерий.
Имеются сообщения о разработке аттенуированного штамма резистентного к высоким
92
концентрациям стрептомицина и успешного использование его в качестве вакцины для
птиц [3]. Но данный метод аттенуации имеет недостаток, связанный с высоким риском
возврата к вирулентной форме. В альтернативу в литературе приводиться метод
обусловленный введением определенных ауксотрофных мутаций в ген AroA вирулентных
штаммов РМ, функция которого существенна для роста бактерий in vivo, и следовательно,
для развития инфекционного процесса, что делает их авирулентным. На основе данного
метода создан ряд коммерческих препаратов для профилактики пастереллеза КРС,
буйволов и кур [4, 5].
Согласно официальным данным МСХ РК одной из основных причин массового
падежа сайгаков в 2010, 2011 гг. являлась пастереллёзная инфекция [2]. Сотрудниками
НИИПББ выделены изоляты возбудителя пастереллеза Pasteurella/Saigas/2011/ZKO/KZ,
Pasteurella/Saigas/2010/ZKO/KZ из патологического материала от павших сайгаков [6].
Учитывая значимость проблемы в рамках проекта «Разработка методов специфической
профилактики против наиболее значимых инфекционных заболеваний сайгаков»
проводятся экспериментальные исследования по разработке препаратов и метода
профилактики пастереллеза сайгаков.
Целью представляемой работы стало получение аттенуированых РМ, изучение их
патогенности и иммуногенных свойств.
Материалы и методы. В качестве родительского штамма использовалась культура
штамма Pasteurella/Saigas/2011/ZKO/KZ [6], которая культивировалась на среде HBIA в
чашках Петри при температуре 37 °С в течение 18-24 ч.
Получение мутантов резистентных к повышенным дозам стрептомицина проводили с
использованием модифицированного метода Степаншина Ю.Г. и др. [7], заключающегося
в двухступенчатом отборе спонтанных и индуцированных 2-аминопурином мутантов
возбудителя Pasteurella multocida, устойчивых к стрептомицину. В наших экспериментах
был проведен трехступенчатый отбор спонтанных, а также индуцированных УФ
излучением [8] и 2-аминопурином мутантов Pasteurella/Saigas/2011/ZKO/KZ. Введение
дополнительной индуцированной мутации был обоснован необходимостью стабилизации
признака аттенуации. Полученные мутанты культивировали на среде HBIA, содержащей
стрептомицин (20000 мкг/мл), в чашках Петри при температуре 37 °С в течение 24-36 ч.
Мутанты РМ с нарушением AroA гена получали по методу Homchampa P. [9].
Селекцию АroA проводили по на средах предложенных Watko [10]. Мутанты не должны
давать рост на среде М9 содержащих фенилаланин (20 мкг/мл) и тирозин (20 мкг/мл). При
добавлении в указанную среду триптофана (20 мкг/мл) мутанты должны давать рост.
Полученные мутанты культивировали на среде HBIA, содержащей канамицин (10 мкг/мл),
в чашках Петри при температуре 37 °С в течение 18-24 ч.
Видовую специфичность родительского штамма и полученных мутантов
подтверждали методом ПЦР с использованием праймеров на капсульный ген.
Патогенность мутантных РМ изучали в тесте на мышах, заключающемся в
подкожном введении 18-24 ч мутантов РМ в дозах от 1 до 1010 м.к. Определение
концентрации микробных клеток проводили с использованием оптического стандарта
мутности (10 Ед) ГИСК им. Тарасевича. Результаты теста оценивали по выживаемости
мышей после введения определенной дозы мутантных пастерелл. Степень патогенности
рассчитывали с использованием метода Рида и Менча и выражали в LD50.
Принципиальную возможность использования полученных мутантов РМ в качестве
вакцинного препарата определяли по титру антител в непрямом варианте ИФА после
оральной и подкожной вакцинации коз и сайгаков. Схема опыта представлена в таблице 1.
93
Таблица 1 - Схема эксперимента по изучению патогенности мутантов на козах и сайгаках
Наименование препарата
Вид животного
Метод введения
Доза заражения, м.к.
Pm/UV40/АР/Str20000
подкожно
5×109
Pasteurella multocida saigas/ AroA
коза, сайга
перорально
2,5×1010
Постановку ИФА проводили по методу Kawamoto E. и др [11]. Статистическая
обработка результатов исследований выполнялась с использованием программы GraphPad
Prism 5.0.
Результаты и обсуждение. В результате трехступенчатого отбора спонтанных, а
также индуцированных УФ излучением и 2-аминопурином мутантов был получен клон
PМ/UV/AP/Str20000. Данный мутант имел резистентность к стрептомицину в
культуральной среде в концентрации 20000 мкг/мл, а также частичную
стрептомицинозависимость.
Для оценки характера наследования и стабильности
приобретенных признаков 3 клона мутанта Pm/UV40/АР/Str20000/2, были пропассированы
на среде АСМВ без антибиотика (10 пассажей), с последующим рассевом 50 субклонов
каждого клона на АСМВ (20000 мкг/мл). При исследовании 150 колоний ни одна утратила
устойчивости к стрептомицину, что свидетельствовало об отсутствии разделения
исследуемых клонов по признаку стрептомицин резистентности и стабильности
наследования данной мутации после 10 последовательных пересевов без селективного
давления антибиотика.
Электропорация родительского штамма с плазмидной ДНК несущей
последовательность AroА гена с вставкой кассеты резистентности к канамицину,
двуступенчатый отбор колоний по канамицину и селективной среде с ароматическими
соединениями позволили получить мутант Pasteurella multocida saigas/ AroA. Полученный
мутант имел резистентность к канамицину в культуральной среде в концентрации 10
мкг/мл, при этом не рос на среде М9 содержащей фенилаланин и тирозин, но
восстанавливал свой рост на указанной среде при добавлении триптофана.
Видовая специфичность полученных мутантов была подтверждена методом ПЦР.
Элетрофореограмма с профилями ПЦР-продуктов мутантов, представлена на рисунке 1.
1,2 - PМ/UV/AP/Str20000, 3,4 - Pasteurella multocida saigas/ AroA, М – маркер, ПК –
положительный контроль (ДНК Pasteurella/Saigas/2011/ZKO/KZ)
Рисунок 1– Электрофорез ПЦР-продуктов в 2 % ПААГ мутантов
94
Данные рисунка 1 свидетельствуют, что полученные профили ПЦР продуктов
стрептомицин резистентных и AroA мутантов имели молекулярную массу 440 п.н., что
соответствовало профилю капсульного гена РМ.
Для оценки степени аттенуации мутантных штаммов пастерелл проведены
эксперименты по определению уровня патогенности в сравнении с родительским
вариантом Pasteurella/Saigas/2011/ZKO/KZ в подкожном тесте на мышах. Результаты
опытов представлены в таблице 2.
Таблица 2 – Уровень патогенности аттенуированых штаммов в сравнение с родительским
вариантом пастерелл для белых мышей
Наименование испытуемого мутанта
Метод
введения
подкожно
подкожно
подкожно
PМ/UV/AP/Str20000
Pasteurella multocida saigas/AroA
Pasteurella/Saigas/2011/ZKO/KZ
ЛД50, мк
9,5±0,7×108
5,5±0,7×108
3,0±0,5×10
Данные таблицы 2 показывают, что подкожное введение животным 24 ч культуры
родительского штамма в концентрациях от 1×109 до 30 м.к. вызывает гибель мышей.
ЛД50 для мутанта PМ/UV/AP/Str20000 составила 9,5±0,7×108, а для мутанта с нарушенной
функцией AroA гена - 5,5±0,7×108, что соответствовало о снижении уровня патогенности
на 7-8 порядков по сравнению с родительским штаммом РМ.
Полученные данные по степени патогенности мутантных клонов соответствовали
результатам оценки снижения патогенности для мутантных штаммов РМ, представленных
в литературе [8, 11].
Дальнейшие опыты были направлены на изучение патогенности мутантов для коз и
сайгаков при подкожном, а так же при пероральном способе введения. Введение
мутантных пастерелл с нарушенной функцией AroA гена сайгакам и козам не приводило к
каким-либо клиническим отклонениям от нормы весь срок наблюдения 50 сут. В
противоположность введение мутантов Pm/UV40/АР/Str20000 пероральным и подкожным
методом сопровождалось у коз и сайгаков повышением ректальной температуры на 0,5-2,0
°С в течение 4-5 сут. Кроме того у сайгаков отмечены системные нарушения,
проявляющиеся угнетенным состоянием, диареей, слизистыми истечениями из носа в
течение 5-7 сут. Данные симптомы свидетельствовали о заболевании сайгаков
пастереллезом и реверсии данного типа мутантов. В последующий срок клиническое
состояние животных нормализовалось.
В результате забоя животных на 50 сут после заражения Pm/UV40/АР/Str20000 и
высева органов (легкие, печень, селезенка, кровь из сердца) на среду HBIA с и без
стрептомицина обнаружен рост колоний имеющих признак резистентности к
стрептомицину, что свидетельствовало о колонизации данного типа мутантов в организме
животных.
Полученные результаты подтверждают данные литературы, свидетельствующие о
потенциальной опасности реверсии стрептомицин резистентных мутантов [13]. При этом в
наших экспериментах отмечено, что в наибольшей степени патогенность проявлялась на
сайгаках, то есть на том виде животных от которых был выделен родительский штамм
пастерелл. Повышение температуры, регистрируемое у коз, после введения
Pm/UV40/АР/Str20000 объясняется токсическим шоком,
возникающим вследствии
введения высоких концентраций бактериальных клеток. Указанная реакция на введение
препаратов приводится в сообщения авторов, проводящих аналогичные исследования [14].
Учитывая результаты эксперимента полученный мутант Pm/UV40/АР/Str20000 в
дальнейших работах не использовался.
95
Введение сайгакам и козам аналогичных доз AroA мутантов не приводило к какимлибо клиническим изменениям состояния животных. В работах [15, 16] проводивших
исследования AroA мутантов РМ на козах, также указывают на температурную реакцию,
возникающую при подкожном введении 108 м.к. и более. В наших экспериментах
указанной реакции не возникало, что свидетельствовало о высоком уровне аттенуации
данного вида мутантов.
Для изучения иммуного ответа у животных на введение мутантов Pasteurella
multocida saigas/AroA, сыворотки крови коз и сайгаков исследованы в непрямом варианте
ИФА. Результаты исследований представлены в рисунке 2.
Рисунок 2 – Исследование сывороток коз и сайги в ИФА
Из данных рисунка 2 следует, что антитела в сыворотках коз и сайгаков начали
выявляться на 14 сут после введение мутанта Pasteurella multocida saigas/AroA. Наиболее
высокий титр антител отмечен в сыворотках крови на 42-49 сут после вакцинации. Титр
орально вакцинированных животных превышал титр антител, выявлявшийся в сыворотки
крови коз и сайги иммунизированных подкожно. В тоже время максимальное накопление
антител отмечено в сыворотках крови сайги при обоих методах введения мутантных
пастерелл.
Полученные результаты, свидетельствуют о наличие иммуного ответа на введение
мутантов с нарушением AroA гена. При этом уровень антител и сроки наступления
иммунитета при подкожном введении мутантов козам, соответствует данным
приведенным в литературе [16, 17]. Защитный уровень антител полученный в
экспериментах соответвует титру антител указанному в литературе, предохраняющему
вакцинированных животных от контрольного заражения вирулентными штаммами РМ [13,
16].
Заключение
1. Получены аттениированные мутанты со снижением степени патогенности на 7-8
порядков по сравнению с родительским штаммом Pasteurella/Saigas/2011/ZKO/KZ.
2. Мутант Pm/UV40/АР/Str20000 при введении козам и сайгакам вызывал
токсический шок, клинически проявлявшийся угнетённым состоянием животных и
повышением температуры. Заболевание сайгаков после введения данного мутанта с
96
проявлением клинических признаков свидетельствовало о реверсии Pm/UV40/АР/Str20000
к патогенному типу.
3. Мутант Pasteurella multocida saigas/AroA при подкожном и пероральном введении
сайгакам и козам не вызывал клинических отклонений от нормального состояния
животных. Уровень накопления антител в сыворотках крови вакцинированных животных,
выявляемые в непрямом варианте ИФА, позволяют предложить AroA мутант в качестве
кандидата вакцинного штамма для изготовления вакцины против пастереллеза сайгаков.
Список литературы
1. Wijewardana, T. G.. Haemorrhagic septicaemia. Rev. Med. Microbiol. – 1992 3: P. 59–
63.
2. Verma, R., and T. N. Jaiswal. Haemorrhagic septicaemia vaccines. Vaccine. - 1998. 16: P. 1184–1192.
3. Catt D.M., Chengappa M.M., Kadel W.L. et al. Preliminary studies vith a live
streptomycin - dependent Pasteurella multocida and Pasteurella hemolitica vaccine for the
prevention of bovine pneumonic pasteurellosis // Can. J. Сотр. Med. – 1985. Oct.; 49 (4): 366 71.
4. Vaccine efficacy in cattle against hemorrhagic septicemia with live attenuated aroA
mutant of Pasteurella multocida B:2 strain Journal of Cell and Animal Biology. – 2007. Vol. 1
(4), P. 062-065.
5. Vaxsafe ®
PM Vaccine (living) (Heddleston serotype 1, aroA deleted)
[www.bioproperties.com.au]
6. Орынбаев М. Б., Рыстаева Р. А., Керимбаев А. А. и др. Случаи массовой гибели
уральской популяции сайгаков в Казахстане// Ж. Актуальные вопросы ветеринарной
биологии, №1(17), Ст-П., С.20-26.
7. Степаншин Ю.Г., Манзенюк И.Н., Светоч Э.А., Гусев В.В., Душук Р.В Получение
и оценка свойств аттенуированного штамма P.multocida SM - 1 // Ветеринария. - 1998. - №
9. -С. 16-19.
8. Леонов A.B., Гусев В.В. Получение аттенуированного штамма P.multocida
//Ветеринария - 2004.- № 10.- С.23 - 26
9. Homchampa P., Strugnell R. A., Adler. B. Molecular analysis of the aroA gene of
Pasteurella multocida and vaccine potential of a constructed aroA mutant. Molecular
Microbioliology. – 1992, - 6, Р. 3585-3593.
10. Watko, L. P. A chemically defined medium for growth of Pasteurella multocida. Can. J.
Microbiol. - 1966.- 12. – P. 933–937.
11. Kawamoto E., Sawada T., Sato T. et al. Comparison of indirect haemagglutination test,
gel-diffusion precipitin test, and enzyme-linked immunosorbent assay for detection of serum
antibodies to Pasteurella multocida in naturally and experimentally infected rabbits. Lab Anim. –
1994. – 28. P. 19-25.
12. Tabatabaei, M., Moazzeni Jula, G. R., Jabbari, A. R. et al. Pathogenicity and
immunogenicity of native and mutant strains of Pasteurella multocida, the causative agents of
haemorrhagic septicaemia Iranian Journal of Veterinary Research, University of Shiraz, - 2007.
Vol. 8. P. 40-44.
13. Hodgson J. C., Finucane A., Dagleish M. P. et al. Efficacy of vaccination of calves
against Hemorrhagic Septicemia with a live aroA derivative of Pasteurella multocida B:2 by two
different routes of administration Infection and immunity. - 2005, p. Vol. 73, No. 3. P. 1475–
1481
14. Zamri-Saad M., · Ernie Z. A.,· Sabri M. Y. et al. Protective effect following intranasal
exposure of goats to live Pasteurella multocida B:2 Trop Anim Health Prod. 2006. - 38. P. 541–
546
97
15. Purdy C. W., Straus D.C., Chirase N. Effects of aerosolized dust in goats on lung
clearance of Pasteurella and Mannheimia species. Current Microbiology 2003. Vol. 46, P. 174–
179.
16. Chaudhuri P., Singh V.P., Thamizharasan A. et al. Pasteurella multocida P52 aroA
mutant conferred protection to rabbits and mice against haemorrhagic septicaemia DHR
International Journal Of Biomedical and Life Sciences. 2012. Vol. 3(1), P. 127-136.
17. Dagleish M. P., Hodgson J. C., Ataei S. et al. Safety and Protective Efficacy of
Intramuscular Vaccination with a Live aroA Derivative of Pasteurella multocida B:2 against
Experimental Hemorrhagic Septicemia in Calves. Infection and immunity, Dec. 2007, p. Vol. 75,
No. 12. P. 5837–5844.
Түйін. Жұмыста Pasteurella/Saigas/2011/ZKO/KZ штамының дериваты болып
табылатын аттенуирленген Рasteurella multocida мутанттық штамын алудың нәтижелері
көрсетілген. Тышқандарға тері астына енгізуде стрептомицинге резистентті штам мен
ауксотрофты AroA мутантының ауру тудырушылығының төмендейтіндігі байқалды.
PМ/UV/AP/Str20000 мутантының уыттылығы және оның ақбөкендерге ауру туғызатын
қабілеті анықталды. Pasteurella multocida saigas/AroA мутантын тері асты және пероральды
енгізу ешкілер мен ақбөкендердің қан сарысуында антидене түзілуін туындатады және
жануарлардың көрсетілген түрлері үшін қауіпсіз болып табылады.
Summary. The results of obtaining of attenuated mutant strain Рasteurella multocida
which is derivative of Pasteurella/Saigas/2011/ZKO/KZ strain are presented in this work.
Reduction of streptomycin pathogenicity of resistant mutant and auxotrophic AroA mutant at
subcutaneous introduction for mice was registered. Toxicity of PМ/UV/AP/Str20000 mutant and
its ability to cause disease of saigas were detected. The subcutaneous and oral introduction of
Pasteurella multocida saigas/AroA mutant is initiated of production for antibodies in blood serum
of goats and saigas and safe for these animal species.
УДК: 619:616.98:578:636.52/.58:616-076
ПРИМЕНЕНИЕ ТЕХНОЛОГИИ 454 LIFE SCIENCES
В РАБОТАХ ПО ИЗУЧЕНИЮ ВОЗБУДИТЕЛЕЙ ВИРУСНЫХ БОЛЕЗНЕЙ
ПТИЦ
Зиняков Н.Г., кандидат биологических наук, ФГБУ «ВНИИЗЖ»;
Овчинникова Е.В., кандидат биологических наук, ФГБУ «ВНИИЗЖ»;
Лазарева С.П., ведущий биолог, ФГБУ «ВНИИЗЖ»;
Дрыгин В.В., доктор биологических наук, ФГБУ «ВНИИЗЖ»
Резюме. Были секвенированы три вируса птиц (ИБК, аденовирус С,
аденоассоциированный вирус). Размер генома вируса ИБК, аденовируса С и
аденоассоциированного вируса был 27577, 45684 и 4682 нуклеотида, соответственно.
Полученные результаты показали наличие генетических рекомбинаций у полевого изолята
IBV27-11. Выявлены различные изменения (одиночные замены и структурные мутации) в
геномной последовательности аденовируса С. Была охарактеризована структура генома
аденоассоциированного вируса птиц. Показана возможность применения технологии 454
Life Sciences для исследования высоковариабельных и малоизученных инфекционных
агентов.
98
Введение. В настоящее время для решения широкого круга научноисследовательских задач проводится внедрение секвенирования второго поколения или
Next Generation Sequencing (NGS). За возможность получения большого объема данных,
генерируемых в ходе одного запуска, NGS называют также массивным параллельным
секвенированием. Области применения технологий NGS охватывают работы, связанные с
полногеномным секвенированием, таргетным секвенированием, анализом транскриптома
и метагеномными исследованиями [1, 2, 3]. Преимущество новых методов для работы с
вариабельными и малоизученными инфекционными агентами заключается в особенности
NGS-технологий, которые позволяют проводить работу без расчета праймеров за счет
случайной фрагментации исходной ДНК с последующим «size-selection» и
секвенированием полученной библиотеки. Технология 454 Life Sciences была одной из
первых задействованной в работах по изучению крупных геномов [4]. На данный момент
использование методов на ее основе позволяет получать массив данных, отличительной
особенностью которого является наибольшая длина единичных прочтений.
Целью данной работы было изучение возможности применения технологии 454 Life
Sciences для расшифровки генома возбудителей вирусных болезней птиц.
Материалы и методы. Выделение вируса инфекционного бронхита кур (ИБК)
проводили с использованием 9-суточных СПФ-эмбрионов кур путем заражения в
аллантоисную полость.
Аденовирус птиц культивировали с использованием перевиваемой культуры клеток
гепатоцеллюлярной карциномы петуха (LMH). Для культивирования использовали
поддерживающую среду (рН=7,8), состоящую из питательной среды DMEM (Sigma, США)
с добавлением фетальной сыворотки (Bioclot, Бразилия) в количестве 2% от общего
объёма среды и раствора L-глютамина (Sigma, США) в количестве сотой доли от объёма
среды.
Очистку вируса проводили с использованием ультрацентрифугирования в градиенте
сахарозы.
Для выделения РНК из очищенного материала применяли набор для выделения
нуклеиновых кислот RNeasy Mini Kit (Qiagen, Германия), в соответствии с инструкцией
производителя. Суммарную нуклеиновую кислоту вируса ИБК переводили в
двухцепочечную кДНК, используя набор cDNA Synthesis System (Roche, Германия),
согласно инструкции изготовителя.
Полногеномное
секвенирование
проводили
методом
пирофосфатного
секвенирования 454 Life Sciences на автоматическом секвенаторе GS Junior (Roche,
Германия), согласно протоколам изготовителя. Для сборки вирусного генома использовали
программное обеспечение GS De Novo Assembler (454 Life Science Corp.). Для выявления
рекомбинаций использовали программу Recombination Detection Program (RDP), версия
3.44.
Результаты исследований. Возбудителем ИБК является вирус сем. Coronaviridae,
рода Coronavirus. Особенностью данного возбудителя является генетическое разнообразие
и высокая скорость изменчивости. Уровень нуклеотидных отличий между изолятами
разных генетических групп составляет более 20%, кроме того встречаются вариантые
изоляты вируса ИБК, отличающиеся от всех известных штаммов и не относящиеся ни к
одному известному генотипу. Изменения в геноме вируса ИБК происходят в результате
накопления точечных мутаций, инсерций, делеций и рекомбинаций. Рекомбинация
происходит при инфицировании одной клетки разными штаммами вируса. При этом
дочерний вирус может иметь фрагменты генома родительских вирусов разных генотипов,
включая вакцинные штаммы [5].
99
Для полногеномного секвенирования был выбран изолят IBV27-11 вируса ИБК, т.к в
результате анализа нуклеотидной последовательности фрагмента гена S1 данного изолята
была выявлена рекомбинация двух вирусов, принадлежащих к разным генотипам
(Массачусетс и 793В). Для сборки полного генома было использовано 4542 единичных
прочтения, из которых была собрана последовательность размером 27577 п.н. Анализ
полученной нуклеотидной последовательности с помощью программы RDP позволил
выявить мозаичную структуру генома с пятью рекомбинационными событиями. Попытки
собрать геном по алгоритму картирования на известную референтную последовательность
с использованием программы GS Reference Mapper (454 Life Science Corp.) оказались
безуспешны, при этом число собранных контигов варьировало от 5 до 14 в зависимости от
использованной референтной последовательности. Полученный результат демонстрирует
необходимость использования алгоритмов сборки de novo для объектов, у которых
ожидаемы внутри- или межгеномнные рекомбинации и учитывать это при планировании
эксперимента.
Аденовирус птиц широко распространенный инфекционный агент, относящийся к
семейству Adenoviridae, роду Aviadenovirus. Наиболее известными болезнями птиц,
вызываемыми аденовирусами и имеющими характерные патологоанатомические
признаки, являются гепатит («IBH»-inclusion body hepatitis) и синдром гидроперикардита
(«HHS»-hepatitis-hydropericardium syndrome) [6, 7]. Стоит отметить, что, не смотря на то,
что аденовирусы являются распространенными инфекционными агентами, на настоящий
момент у аденовирусов птиц изучены и охарактеризованы лишь отдельные протеины. В
данной работе был использован изолят «Краснодар 2009», выбор был обусловлен
результатами предварительных работ. В результате анализа
нуклеотидных
последовательностей генов фибер-1 и фибер-2 было показано отличие выделенного
изолята от известных штаммов. Для сборки полногеномной последовательности было
использовано 10510 прочтений. В результате был получен один контиг длиной 45684 п.н.
По результатам анализа полного генома изолята «Краснодар 2009» был выявлен ряд
отличий от референтного штамма KR95. Отличия на генетическом уровне обусловлены
как точечными заменами 1,4% отличия, так и структурными мутациями 1,2%. Из точечных
замен 30% являются значимыми (0,36% от общего уровня отличий). Количество
аминокислотных замен, выявленных у изолята «Краснодар 2009» в сравнении со штаммом
KR95, по всем предполагаемым открытым рамкам считывания (ОРС) в результате
точечных замен составило 168. Среди структурных мутаций (17 событий относительно
штамма KR95) были выявлены как незначительные по размеру делеции и вставки, так и
крупные структурные мутации длиной до 147 п.н. Также были выявлены две вставкидупликации. Генетические мутации типа инверсии и рекомбинации выявлены не были.
Структурные мутации были отмечены как в кодирующей, так и в некодирующей части
генома.
Незначительные по размеру структурные мутации (инсерции и делеции),
затрагивающие предполагаемые рамки, были выявлены, как среди гипотетических, ранее
предложенных рамок считывания, так и среди изученных протеинов (гены белков фибер-1,
фибер-2, пентон, ДНК-полимераза).
Также стоит отметить, что среди собранных контигов был выявлен контиг размером
4682 п.н., который по результатам анализа был идентифицирован как
аденоассоциированный вирус. В результате сравнительного анализа генома были
выявлены характерные гены аденоассоциированных вирусов (ОРС неструктурного
протеина «rep protein» и структурных белков «cap protein»). Размер ОРС «rep protein»
составил 1992 п.н. Процент сходства нуклеотидной последовательности ОРС «rep protein»
составил 92%, 95%, 94% со штаммами VR-865, DA-1, YZ-1, соответственно. Размер ОРС
«cap protein» составил 2232 п.н. Процент сходства нуклеотидной последовательности ОРС
100
«cap protein» составил 87%, 95%, 95% со штаммами VR-865, DA-1, YZ-1 соответственно.
Собранный геном изолята ZN-1 был депонирован в GenBank под номером KF937794.
Выводы. Полученные результаты демонстрируют возможность использования
технологии 454 Life Sciences для исследования высоковариабельных в генетическом
плане инфекционных агентов, при этом возможно выявления в пробе малоизученных
объектов, проводить изучение вирусов, значительно отличающихся от референтных
штаммов и имеющих межгеномные рекомбинации. Таким образом, ветеринарная наука в
данный момент получила в свое распоряжение новый высокотехнологичный инструмент,
что открывает возможности в изучении генетических свойств вновь появляющихся и
малоизученных микроорганизмов, а также возбудителей особоопасных болезней
животных.
Список литературы
1. Metagenomic analysis of the viromes of three North American bat species: viral diversity
among different bat species that share a common habitat E.F. Donaldson, A.N. Haskew, J.E.
Gates, J. Huynh, C.J. Moore, M.B. Frieman / J. Virol., 2010 Vol.84, P.13004–13018.
2. Virome analysis for identification of novel mammalian viruses in bat species from
Chinese provinces / Wu, X. Ren, L. Yang, Y. Hu, J. Yang, G. He, J. Zhang, J. Dong, L. Sun, J.
Du, L. Liu, Y. Xue, J. Wang, F. Yang, S. Zhang, Q. Jin // J. Virol., 2012, Vol.86 P.10999–11012.
3. Identification of a novel astro-virus in domestic sheep in Hungary / Reuter, G.,
Pankovics, P., Delwart, E., Boros, A., // Arch. Virol. 2012. Vol. 157, P.323–327.
4. Chromosome Conformation Capture Carbon Copy (5C): A massively parallel solution
for mapping interactions between genomic elements / Josée Dostie, Todd A. Richmond, Ramy A.
Arnaout, et al. // Genome Res. 2006 Vol.16. P.1299-1309.
5. Cavanagh, D. (2007). Coronavirus avian infectious bronchitis virus. Veterinary Research,
38, 281-297.
6. Adair B.M., Fitzgerald S.D. Group 1 adenovirus infections // Diseases of Poultry / 12th
ed. Saif, Y.M., Fadly, A.M., Glisson, J.R., [et al.]. - Ames, Iowa, USA. - 2008. - P.252–266.
7. Classification of fowl adenoviruses by use of phylogenetic analysis and high-resolution
melting-curve analysis of the hexon L1 gene region / A. Marek, A. Günes, E. Schulz, M. Hess //
Journal of Virological Methods. – 2010. - Vol. 170. - P.147–154.
Summary. Three avian viruses (infectious bronchitis virus, Fowl adenovirus C, adenoassociated virus) were sequenced. The size genome IBV, adenovirus C and adeno-associated
virus was 27577, 45684, 4682 nucleotides long, respectively. The results indicated that the field
isolate IBV27-11 had genetic recombinations. Different types of changes (single changes and
structural mutations) in genome sequence adenovirus C were revealed. Genomic structure avian
adeno-associated virus was characterized. The possibility use technology 454 Life Sciences for
study high variable and little-known viruses was demonstrated.
101
УДК 616-085:576.858:633.88
ДОКЛИНИЧЕСКОЕ ИЗУЧЕНИЕ БЕЗОПАСНОСТИ
ПРОТИВОГРИППОЗНОГО ЛЕКАРСТВЕННОГО ПРЕПАРАТА НА ОСНОВЕ
ЭФИРНОГО МАСЛА NEPETA UCRANICA
1
Исагулов Т.Е., 1Нурпейсова А.С., 1Касенов М.М., 1Волгин Е.Н., 1Богданов Н.В.,
1
Сарсенбаева Г.Ж.., 2Акунова С.О., 1Хайруллин Б.М.
1
Научно исследовательский институт проблем биологической безопасности, пгт.
Гвардейский, Казахстан
2
Кыргызский Государственный Университет им. И. Арабаева, г. Бишкек, Кыргызстан
Резюме. В данной работе представлены результаты исследования по определению
острой токсичности противогриппозного лекарственного препарата на организм
лабораторных животных, изучено влияние препарата на биохимические и
гематологические показатели крови белых мышей и морских свинок.
Ключевые слова: грипп, противовирусный препарат, доклинические исследования
Введение. Грипп — инфекционная болезнь, протекающая с явлениями общей
интоксикации и поражением слизистой оболочки дыхательных путей. При заражении
вирус внедряется в эпителий наружного слоя слизистой оболочки дыхательных путей,
вызывая их разрушение и слущивание. Путь передачи инфекции — воздушно-капельный.
Восприимчивость к вирусу очень высокая. Инкубационный период — обычно 1—2 дня.
Чаще болезнь возникает внезапно. Грипп может протекать в легкой и тяжелой, даже
смертельной форме; часто он дает осложнения — воспаление легких, поражение сердца,
мозга и т.д.
Есть различные способы борьбы с вирусными болезнями, в том числе с гриппом, такие
как вакцинация и лечение лекарствами.
Анализируя молекулярно-биологические исследования вирусов и процессы их
взаимодействия с клетками, определены основы направления поиска противовирусных
химиотерапевтических
препаратов
[1,2].
В
последнее
время
изготовление
противовирусных препаратов постепенно переходит от синтеза химических соединений к
использованию фармакологически активных веществ растений, что обусловлено меньшей
их токсичностью, а также большим разнообразием химической структуры (витамины,
углеводы, липиды, алкалоиды, флавоноиды, сердечные гликозиды, эфирные масла,
сапонины и т.д.) [2,3]. Среди фармакологически активных растительных соединений
интерес к сесквитерпеновым лактонам, флавоноидам, кумаринам и эфирным маслам
начинает усиливаться во всём мире.
Лекарственные препараты растительного происхождения обладают преимуществом
перед синтетическими, которое заключается в малой токсичности, большей частью
мягкостью действия, редким индуцированием аллергических реакций и возможностью
проведения повторных и длительных курсов лечения и профилактики. Поэтому изучение
растений, широко применяемых в народной и традиционной медицине, и разработка на их
основе высокоэффективных лекарственных средств является одной из актуальных задач
медицинской и фармацевтической науки [4,5].
Основным источником для поиска новых лекарственных растений является арсенал
средств народной медицины. С этой точки зрения особый интерес представляют растения
семейства Lamiaceae, широко используемые в нетрадиционной медицине. Лечебным
эффектом обладает эфирное масло, содержащееся в растениях данного семейства [5,6], а
именно эфирное масло Котовника украинского, на основе которого и был получен
исследуемый противогриппозный лекарственный препарат.
102
Раннее были проведены работы по изучению безопасности, защитного действия и
лечебно-профилактической
эффективности,
где
и
было
установлено,
что
противогриппозный лекарственный препарат, в концентрации 40 мг/кг эфирного масла в
дозе 25 мкл для мышей и 100 мкл для морских свинок безопасен, обладает как
профилактическим так и лечебными свойствами против штамма A/ California /7/2009/H1N1
pdm09 вируса гриппа на 60-80 %.
Для дальнейшего изучения безопасности, были проведены доклинические испытания
исследуемого лекарственного препарата на лабораторных животных, а именно изучение
острой токсичности, что является одним из основных и обязательных этапов при
разработке и внедрении в медицинскую практику иммунобиологических препаратов [7,8].
Материалы и методы. В работе использовано 3 экспериментальные серий
противогриппозного лекарственного препарата против гриппа H1N1. Исследуемый
препарат приготовлен из эфирного масла, выделенного из растения Котовника
украинского (Nepeta ucranica) произрастающего на территории Республики Казахстан,
который представляет собой жидкую форму в виде капель и по предназначению в
организм вводится интраназально.
Испытание проводили на двух видах лабораторных животных обоего пола: белые
мыши с живой массой 25-30 г и морские свинки с живой массой 350-400 г. В
исследованиях использованы клинически здоровые животные, содержащиеся в
соответствии с действующими правилами.
Лабораторные животные распределялись по группам случайным образом методом
рандомизации на 2 группы (опытная и контрольная). В качестве критериев приемлемости
рандомизации считали отсутствие внешних признаков заболеваний и гомогенность групп
по весу тела (± 20%). Для испытания каждой экспериментальной серии препарата, группа
животных состояла из 8 особей в опыте на мышах и 6 особей в опыте на морских свинках,
включая контрольные группы. Каждому животному был присвоен индивидуальный номер
(в соответствии с номером группы и порядковым номером).
Испытание острой токсичности противогриппозного лекарственного препарата на
системы и органы лабораторных животных определяли введением опытным группам 0,1
мл то есть 4 дозы для мышей (1 стандартная доза в объеме 25 мкл, вводилась 4 раза в
течение 4 часов с интервалом между введением – 1 час) и 0,2 мл лекарственного препарата
морским свинкам, то есть 4 дозы (по 50 мкл), интраназально в концентрации 40 мг/кг
эфирного масла. Для контрольных групп в качестве негативного контроля использовали
раствор натрия хлорида.
Токсическое действие противогриппозного препарата оценивали по клиническим
признакам интоксикации, показателям общего состояния, изменения поведения, наличия
судорог, оценки координации движения, интенсивности и характера двигательной
активности, ежедневной регистрации массы тела, потребление воды и пищи.
Для определения влияния препарата на организм, изучали гематологические,
морфологические и биохимические показатели крови животных [8,9,10,11,12], кровь у
мышей получали пункцией хвостовой вены, а у морских свинок из сердца.
Статистическую обработку экспериментальных данных, определяли согласно среднему
значению выборки и ее среднеквадратичной ошибки. Достоверность различий между
показателями (р0,05) определяли с применением критерия Стьюдента.
Результаты и обсуждение. На протяжении всего периода клинического наблюдения
общее состояние и поведение животных всех экспериментальных групп соответствовало
обычному характеру животных, общее состояние опытных и контрольных групп
(потребление воды, корма и внешний вид) было удовлетворительным, признаков болезни и
103
случаев гибели не отмечено, при этом достоверные отличия между опытной и
контрольной группой отсутствовали.
Интенсивность и характер двигательной активности, координация движений, тонус
скелетных мышц сохранялись на фоновом уровне. Поведенческие реакции не отклонялись
от нормы опытных групп от группы контроля, состояние волосяного и кожного покрова,
окраска слизистых были без патологических изменений.
В таблице 1 и 2 приведены результаты динамики массы тел через 24 часа, 7 и 14 суток
после введения противогриппозного препарата опытным группами и контрольным.
Таблица – 1 Среднее значение изменения массы тела белых мышей (самок и самцов)
при определении острой токсичности противогриппозного препарата
Время
наблюдения
фон
2-й день
7-й день
14-й день
Контроль
M
27+2,0
27+2,0
27+2,0
27+2,0
F
25±0,5
25±0,5
26±0,5
26±0,5
Группы
Противовирусный препарат
1 серия
2 серия
3 серия
M
F
M
F
M
F
28+0,9 26±1,0 30+0,5 28+1,0 26+2,0 28±0,5
28+0,5 27±0,0 29+0,5 29+0,5 26+2,0 28±0,7
28+0,4 26±1,0 29+0,5 28+0,9 25+2,0 28±0,5
28+0,7 26±1,0 29+0,5 28+0,7 25+2,0 28±0,9
Таблица – 2 Среднее значение изменения массы тела морских свинок (самок и
самцов) при определении острой токсичности противогриппозного препарата
Время
наблюдения
фон
2-й день
7-й день
14-й день
Контроль
M
350+
2,0
350+
2,0
351+
2,0
351+
2,0
F
350±
0,5
350±
0,5
350±
0,5
350±
0,5
Группы
Противовирусный препарат
1 серия
2 серия
3 серия
M
F
M
F
M
F
352+
353±
350+
354+
355+
360±
0,9
1,0
0,5
1,0
2,0
0,5
353+
353±
351+
355+
355+
360±
0,5
0,0
0,5
0,5
2,0
0,7
353+
353±
351+
354+
355+
361±
0,4
1,0
0,5
0,7
2,0
0,5
353+
354±
351+
354+
356+
361±
0,7
1,0
0,8
0,9
2,0
0,9
Представленные в таблицах 1 и 2 данные показывают, что массы тела белых мышей и
морских свинок в трех группах не имели значительных различий (р0,05).
В нормальных физиологических условиях неизменно поддерживается постоянство
морфологического и химического состава, а также и физико – химических свойств крови.
Изменения состава крови, которые во многих случаях являются вторичными,
обусловленными нарушениями физиологической деятельности различных систем или
органов при воздействии различных лекарственных и иммунобиологических препаратов,
могут отразиться на нормальном функционировании организма. Учитывая, что кровь в той
или иной степени отражает, как в зеркале, многое из того, что происходит в организме, для
изучения безопасности экспериментальных серий противогриппозного препарата
использовали лабораторно - инструментальные методы по показателям общего анализа
крови (гемоглобин, гематокрит, эритроциты, нейтрофилы, базофилы, эозинофилы,
лимфоциты, моноциты). Результаты гематологических исследований периферической
104
крови при изучении острой токсичности противогриппозного лекарственного препарата
представлены в таблицах 3 и 4.
Таблица - 3 Влияние противовирусного препарата на морфологический состав
периферической крови белых мышей
Исследуе
мые
показател
и крови
Исследуемые группы, № серии исследуемого препарата и пол лабораторных
животных
Контроль
№1 серия
№2 серия
№3 серия
М
F
М
F
М
F
М
F
Гемоглоб
ин, г/дл
38,77±4
,06
41,57±1
,23
40,33±7
,31
35,00±1
,27
39,57±5
,90
35,00±6
,66
37,67±4
,17
40,00±0
,68
Гематокр
ит, %
0,35±
0,03
0,34±
0,04
0,32±
0,05
0,32±
0,03
0,37±
0,03
0,38±
0,02
0,37±
0,02
0,39±
0,02
Эритроци
ты, х107 л
3,5±
0,2
3,4±
0,3
3,3±
0,4
3,3±
0,3
4,1±
0,1
3,1±
0,5
3,7±
0,2
4,1±
0,2
Эозинофи
лы, %
Моноцит
ы, %
1,2±
0,3
5,7±
0,3
1,5±
0,3
6,7±
1,2
1,3±
0,2
6,3±
0,5
1,2±
0,0
7,7±
1,2
1,3±
0,4
6,3±
0,2
1,4±
0,1
5,7±
1,2
1,2±
0,0
6,0±
0,6
1,3±
0,2
5,3±
1,2
Лимфоци
ты, %
43,3±
0,8
45,0±
4,0
49,0±
2,3
47,3±
3,3
44,3±
4,3
45,7±
1,3
42,3±
1,6
42,7±
3,7
Таблица - 4 Влияние противовирусного препарата на морфологический состав
периферической крови морских свинок
Исследуе
мые
показател
и крови
Исследуемые группы, № серии исследуемого препарата и пол лабораторных
животных
Контроль
№1 серия
№2 серия
№3 серия
М
F
М
F
М
F
М
F
Гемоглоб
ин, г/мл
11,72±4
,06
13,51±1
,23
12,85±3
,09
14,61±1
,23
12,70±3
,02
12,81±1
,98
13,81±3
,85
12,61±1
,55
Гематокр
ит, %
0,35±
0,03
0,34±
0,04
0,34±
0,02
0,33±
0,02
0,35±
0,04
0,34±
0,04
0,31±
0,04
0,30±
0,02
Эритроци
ты, х106 л
5,5±
0,2
6,4±
0,3
5,7±
0,1
5,9±
0,4
5,8±
0,1
6,0±
0,1
6,0±
0,1
6,1±
0,2
Эозинофи
лы, %
3,2±
0,3
3,5±
0,3
3,0±
0,1
3,6±
0,2
3,6±
0,4
4,0±
0,1
3,5±
0,4
3,8±
0,3
Моноцит
ы, %
8,7±
0,3
9,7±
1,2
8,9±
0,2
9,5±
1,2
9,0±
0,1
8,9±
1,5
8,8±
0,2
9,2±
1,1
Лимфоци
ты, %
51,3±
0,8
55,0±
4,0
50,1±
0,8
58,0±
3,0
52,3±
0,2
57,0±
2,0
52,3±
0,5
58,0±
4,0
Данные представленные в таблицах 3 и 4 свидетельствуют об отсутствии достоверных
различий между уровнями гемоглобина, эритроцита, гематокрита и лейкоцитарной
105
формуле в контрольных и опытных группах лабораторных мышей после введения
экспериментальных серии противогриппозного препарата (р0,05). Отсутствовали также
достоверные различия между самками и самцами.
При изучении морфологического состава крови лабораторных мышей и морских
свинок, после введения дозы препарата отмечено незначительное снижение гемоглобина и
тромбоцитов по сравнению с контрольной группой.
Результаты, представленные в таблице 3 и 4 , свидетельствуют, что обнаружено
незначительное снижение эозинофилов, которое свидетельствует в пользу отсутствия
аллергизирующего действия данного препарата на лабораторных мышей.
Таким образом, применение противогриппозного препарата у мышей и морских
свинок не вызвало достоверных изменений в морфологическом составе периферической
крови, уровне гемоглобина и гематокрита по сравнению с контрольной группой.
Выявленные изменения могут быть интерпретированы с точки зрения активизации
иммунного ответа.
Результаты биохимических исследований крови при изучении острой токсичности
препарата.
Для адекватной оценки изменения физиологического состояния макроорганизма на
фоне воздействия противогриппозного лекарственного препарата провели определение в
сыворотке крови лабораторных мышей и морских свинок комплекса наиболее
информативных показателей активности ключевых ферментов метаболизма, а также
показателей белкового, углеводного и липидного обмена – общего белка, мочевины,
креатинина, холестерина, глюкозы, билирубина общего и связанного, активности
аспартамаминотрансферазы (АСТ) и аланинаминотрансферазы (АЛТ), таблица 5 и 6.
Таблица 5 – Влияние лекарственного препарата на основные биохимические
показатели периферической крови белых мышей
Исследуемые группы, № серии исследуемого препарата и пол лабораторных
Исследуе
животных
мые
показате
Контроль
№1 серия
№2 серия
№3 серия
ли крови
М
F
М
F
М
F
М
F
Общий
52,1±
51,7±
42,1±
48,0±
57,2±
58,9±
28,4±
40,1±
белок,
1,2
1,1
2,1
1,4
4,7
4,4
1,4
5,7
г/л
Мочевин
а,
5,6±1,1 5,0±0,7 3,8±1,3 3,6±0,8 7,7±2,2 4,2±1,4 4,0±1,0 3,8±0,1
ммоль/л
Креатин
48,5±
56,1±
56,1±
48,4±
44,3±
39,9±
56,3±
52,3±
ин,
2,3
3,7
4,0
4,1
5,5
5,1
5,2
3,5
мкмоль/л
Глюкоза,
8,2±2,2 6,5±1,7 8,0±2,3 5,0±1,9 5,3±1,3 5,5±1,4 5,4±2,1 5,0±1,7
моль/л
Холестер
ин
0,7±0,2 1,2±0,3 1,2±0,3 1,0±0,4 1,1±0,5 1,4±0,3 1,1±0,6 1,0±0,8
общий,
ммоль/л
Билируб
ин
0,010±0, 0,012±0, 0,014±0, 0,008±0, 0,009±0, 0,008±0, 0,001±0, 0,004±0,
общий,
004
002
003
001
001
002
000
001
ммоль/л
106
Билируб
ин
0,006±0, 0,003±0, 0,003±0, 0,004±0, 0,002±0, 0,003±0, 0,001±0, 0,003±0,
связанны
001
000
000
000
000
000
000
000
й,
ммоль/л
АСТ,
1,92±
1,65±
1,34±
1,25±
1,47±
1,45±
1,29±
1,56±
ммоль/
0,05
0,05
0,03
0,06
0,41
0,32
0,33
0,13
л-с
АЛТ,
0,31±
0,12±
0,08±
0,07±
0,14±
0,05±
0,09±
0,04±
ммоль/
0,03
0,03
0,02
0,01
0,01
0,01
0,02
0,01
л-с
Таблица 6 – Влияние лекарственного препарата на основные биохимические показатели
периферической крови морских свинок
Исследуем
ые
показател
и крови
Общий
белок, г/л
Исследуемые группы, № серии исследуемого препарата и пол лабораторных
животных
Контроль
№1 серия
№2 серия
№3 серия
М
F
М
F
М
F
М
F
52,1±
51,7±
50,3±
52±
50,2±
53,2±
54,2±
51,2±
1,2
1,1
1,0
1,0
1,5
1,5
1,5
1,2
Мочевина,
ммоль/л
5,6±
1,1
5,0±
0,7
5,5±
1,0
5,3±
0,1
5,7±
1,0
5,7±
0,3
5,8±
1,0
5,2±
0,2
Креатинин
ммоль/л
48,5±
2,3
56,1±
3,7
47,1±
2,2
54,2±
3,2
48,1±
2,6
58,2±
3,1
49,1±
2,1
58,2±
3,1
Глюкоза,
моль/л
Холестери
н общий,
ммоль/л
Билируби
н общий,
ммоль/л
Билируби
н
связанный
, ммоль/л
8,2±
2,2
6,5±
1,7
8,0±
2,0
7,8±
0,8
8,2±
2,0
7,0±
1,1
8,1±
2,1
6,9±
1,2
0,7±
0,2
1,2±
0,3
0,9±
0,1
1,0±
0,1
0,8±
0,1
1,2±
0,2
0,8±
0,1
1,1±
0,1
0,019±
0,009
0,062±
0,018
0,020±0,
007
0,051±
0,014
0,023±0,
009
0,058±
0,012
0,020±
0,008
0,061±
0,014
0,005±
0,000
0,004±
0,000
0,008±0,
005
0,006±
0,002
0,008±0,
002
0,005±
0,002
0,007±
0,002
0,005±
0,001
АСТ,
ммоль /л-с
1,92±
0,05
1,65±
0,05
1,94±
0,04
1,69±
0,07
1,92±
0,03
1,67±
0,08
1,98±
0,06
1,64±
0,08
АЛТ,
ммоль/л-с
0,31±
0,03
0,12±
0,03
0,32±
0,01
0,14±
0,06
0,33±
0,02
0,16±
0,04
0,32±
0,01
0,14±
0,06
Биохимическое исследование крови подопытных животных не показывало увеличение
содержания общего белка, как у мышей так и у морских свинок независимо от введенных
дозы противовирусного препарата. При этом тенденция к гиперпротеинемии имела
устойчивый характер, т.к. наблюдалась при исследовании всех трех серий лекарственного
107
препарата. Следует также отметить, что наиболее выраженные изменения наблюдались у
самок. Анализ литературных данных [10] свидетельствует, что полученные данные могут
быть результатами профилактического процесса.
Соответственно, практически не повышался уровень мочевины и креатинина. Уровни
глюкозы, холестерина, общего и связанного билирубина, трансаминаз у животных
опытной группы не отличались от результатов контрольной группы (р0,05).
Таким образом введение противогриппозного лекарственного препарата не вызывает
существенных изменений основных биохимических показателей крови лабораторных
мышей и морских свинок.
В результате наблюдения за общим состоянием и поведением животных всех
экспериментальных установлено отсутствие отклонений от нормы, это является
доказательством хорошей переносимости препарата на лабораторных животных.
Отсутствие снижения веса в течение наблюдения всего опыта свидетельствует об
отсутствии специфического воздействия исследованного препарата на аппетит и
потребление воды. Прирост массы тела как в контрольной, так и в опытных группах
животных показывает отсутствие различий в усвояемости пищи.
Заключение. В ходе проведенных исследований, полученные положительные
показатели доклинических испытаний безопасности противогриппозного лекарственного
препарата, свидетельствуют об отсутствии токсического действия, а так же негативного
влияния на общее состояние и массу тела лабораторных животных. Полученные нами
результаты позволяют отнести лекарственный препарат к V классу токсичности, то есть к
классу практически нетоксичных лекарственных веществ.
Список литературы
1. Шнейдер М.А. Методические вопросы научной разработки противовирусных
средств. Минск. 1977. С.44-46.
2. Муравьева Д.А. Фармакогнозия. М.: Медицина. 1991. 560 с.
3. Вульф Е.В. Эфиромасличные растения и их культура // Тр. по прикладной ботанике,
генетике и селекции. 1927. Т. 17, вып. 4. С. 283-341.
4. Горяев М.И. Эфирные масла флоры СССР. Алма-Ата: Изд. АН КазССР, 1952. 380 с.
5. Буйко Р.А. Гращенков А.Е., Маковкина А.О., Соколов В.С. Библиография по
эфирномасличным растениям и эфирным маслам (указатели отечественной литературы за
1747 – 1965 гг.). Л.: Наука, 1968. 275 с.
6. Смолянова А.М., Ксендза А.Т. Эфирномасличные культуры / М.: Колос, 1976. 331 с.
7. «Правила доклинической оценки безопасности фармакологических средств (GLP)»,
(РД 64-126-91. М., 1992);
8. Кукес В.Г., Булаев В.М., Колхир В.К., и др. Методические указания по
доклиническому изучению новых препаратов, разрабатываемых из природного сырья. В
сб. Руководство по экспериментальному (доклиническому) изучению новых
фармацевтических веществ М. , Минздрав РФ 2000. С. 346 – 348.
9. Сидорова К.А., Калашникова М.В., Пашаян С.А. Клиническая гематология
животных (учебное пособие) // Международный журнал прикладных и фундаментальных
исследований. – 2014. – № 3 – С. 131-131.
10. Любина А.Я., Ильичева Л.П., Катасонова С.А., Петросова С.А., Клинические
лабораторные исследования «Медицина» 1984. С.63 – 69.
11. Карпищенко А.И. Медицинские лабораторные технологии (справочник в 2-х
томах) /Под ред. А.И. Карпищенко. − СПб.:Интер-медика, 1999. − Т. 2. 350 с.
12. МсCleskey J.E. Fluorometric method for the determination of urea in blood / J. E.
McCleskey // Anal. Chem. — 1964. — Vol. 36. — P. 1646–1648.
13. Козинца Г.И. Атлас клеток крови и костного мозга «Триада - Х» 1998.
108
Түйін. Бұл жұмыста зертханалық жануарлардың ағзасына тұмауға қарсы
препараттың қатты уыттылығын анықтау бойынша жүргізілген зерттеулердің нәтижелері
көрсетілген, сонымен қатар, аталмыш препараттың ақ тышқандар мен теңіз шошқасы
қандарының гемотологиялық және биохимиялық көрсеткіштеріне әсері зерттелген
болатын.
Summary. This paper presents the results of a study to determine the acute toxicity of antiinfluenza drug on laboratory animals, to study the effect of the drug on biochemical and
hematological parameters of blood of white mice and guinea pigs
УДК 576.315/316/316.7: 576.535
ОЦЕНКА ВЛИЯНИЯ ФАРМАЗИНА НА ЭЛИМИНАЦИЮ МИКОПЛАЗМ В
КУЛЬТУРАХ КЛЕТОК
Исмагамбетова Д.Ж., Наханов А.К., Жаппарова Г.А.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. В данной работе рассмотрены проблемы деконтаминации клеточных
культур от микоплазм. Проанализировано действие антибиотика Фармазин на клеточные
линии BHK-21, BHK-21 К-17, CRFK и ПЩ. Показано, что данный препарат элиминирует
микоплазмы в клеточных линиях преимущественно на 5 пассажном уровне.
Введение. Микоплазменные контаминации являются очень серьезной проблемой для
всех клеточных биологов, и, по некоторым данным, более 15% всех клеточных линий
заражено микоплазмами. Микоплазмы обладают высокой инфицирующей способностью, и
при появлении в лаборатории новых клеток обычно происходит перекрестная
контаминация. Поэтому часто требуется постоянный контроль проверки микоплазменной
контаминации [1].
Из-за высокой контагиозности и серьезного воздействия на функции клетки-хозяина
такие организации, как Американская коллекция клеточных культур (АТСС), Европейская
коллекция клеточных культур (ECACC) и др., рекомендуют немедленно уничтожать
зараженные клетки, как только микоплазмы будут обнаружены [2].
Микоплазменная контаминация не исчезает сама собой, а распространяется на другие
культуры. Микоплазменная инфекция в латентной форме не сопровождается видимыми
изменениями клеток и без специального анализа может оставаться незаметной [3].
Известно,
что присутствие в клетках микоплазмы приводит к снижению
чувствительности к репродукции в них вирусов, а это важно не только для проведения
научных исследований, но и для получения антигенов, используе-мых для приготовления
любых медико-биологических препаратов [4].
Впервые микоплазмы были выделены из зараженной клеточной культуры в 1956 г.
[5]. Несмотря на то, что с момента обнаружения микоплазм в клеточных культурах
прошло 58 лет, проблема деконтаминации продолжает оставаться весьма актуальной.
Постоянно появляются сообщения о деконтаминации линий клеток с помощью новых
антибиотиков [6].
На протяжении всего периода функционирования нашей лаборатории постоянным
разделом работы является индикация микоплазм в клеточных линиях, а также их
109
деконтаминация различными препаратами. В настоящей работе были исследованы
клеточные линии, заложенные в банк культур клеток в период 1998-2005 гг.
Материалы и методы.
Для проведения исследований были использованы
клеточные линии BHK-21 (С-13) (почки новорожденных сирийских хомячков), BHK-21 К17 (почки новорожденных сирийских хомячков, клон-17), CRFK (перевиваемая сублиния
клеток почки кошки), ПЩ (линия почек щенка) хранящиеся в банке культур клеток
НИИПББ.
Культивировали клеточные линии, согласно паспортным данным, при 37ºС на
покровных стеклах. Использовали питательные среды ПСП и DМЕМ с 10% сыворотки
крови крупного рогатого скота без антибиотика. После 3 - 4 пассажей готовили
цитологические препараты и окрашивали флюоресцентным красителем DAPI. Для этого
покровные стекла с культурой дважды промывали буфером, фиксировали раствором
Карнуа в течение 1 мин. После фиксации добавляли DAPI на 15 мин и промывали
фиксатором трижды по 5 минут. Монтировали на предметные стекла и проводили
индикацию микоплазм в клеточных культурах с помощью люминесцентного микроскопа
(микроскоп Axio Scope A1, Zeiss). Микроскопически микоплазмы обычно выглядят в виде
отдельных гранул, точечных включений, расположенных вдоль границ цитоплазмы и в
межклеточном пространстве.
До деконтаминации был проведен тест токсичности антибиотика на клетки. Для
этого клеточную суспензию культивировали с добавлением Фармазина в концентрации 10,
20, 40, 60, 80, 100 мкг/мл в 6-луночных плашках. Клетки микроскопировали ежедневно,
отмечая признаки токсичности, такие как шелушение, появление вакуолей, снижение
монослоя и округление клеток (токсичная концентрация). Когда был определен
токсический уровень антибиотика, клетки культивировали 5 пассажей, используя
антибиотик в концентрации в 1-2 раза ниже, чем токсичная концентрация. Затем клетки
культивировали в среде без антибиотиков 3 - 5 пассажей, чтобы определить, когда уровень
загрязнения был ликвидирован. После чего готовили препараты, окрашивали DAPI и
микроскопировали.
Результаты исследований. До обработки антибиотиком во всех клеточных линиях
была обнаружена контаминация микоплазмами (рисунок 1а). При этом микроскопически в
культуре отмечались: многочисленные частицы разрушенных клеток и снижение ростовых
свойств культур клеток. В результате чего были проведены работы по очистке клеточной
линии с использованием Фармазина, препарата с активнодействующим веществом
тилозин.
Для обработки контаминированных клеток необходимо было определить токсичную
дозу указанного препарата. В результате исследований было установлено, что наиболее
оптимальной концентрацией Фармазина является 10 мкг/мл. Более высокие концентрации
обладали выраженным токсическим эффектом.
При проверке действия Фармазина в указанной концентрации наблюдалось
следующее:
- на первом пассаже в ростовой среде наблюдались многочисленные частицы
разрушенных клеток, снижение ростовых свойств культур клеток, имелись точечные
включения и гранулы.
- на втором пассаже результаты микроскопии показали почти то же самое, что и в
первом пассаже: также встречались точечные включения, но уже не так много, как в
первом случае, и снижение роста клеток.
- на третьем пассаже разрушенных клеток было уже меньше, однако на препаратах
выявлялись гранулы и точечные включения.
110
- на
четвертом
пассаже
гранулы
отсутствовали,
рост
клеток
был
удовлетворительный.
на пятом пассаже клетки характеризовались ростовыми свойствами в соответсвии с
паспортными данными. На микроскопических препаратах отсутствовали посторонние
включения (рисунок 1б).
а - до обработки фармазином 200;
б – после обработки фармазином 200
(10мкг/мл) (ув.объектив ×40, окуляр ×10)
Рисунок 1 – Культура клеток CRFK
Для контроля обработки клетки культивировали 3 - 5 пассажа без анти-биотика. При
этом во всех клеточных культурах ростовая среда была чистая, пролиферативные свойства
соответствовали паспортным данным, цитоплазма клеток гомогенная без включений.
Особенностями обработки было то, что в культуре клеток CRFK, мы заметили,
заметное улучшение состояния клеток после обработки Фармазином, уже после первого
пассажа. Тогда как в других культурах клеток (ПЩ, BHK-21 (С-13), BHK-21 К-17)
Фармазин подействовал не сразу, только после четвертого пассажа смогли получить
хорошие препараты, а наилучший эффект данный препарат показал на пятом пассаже.
Выводы. Таким образом, в нашем случае, 25% из 4-х изученных линий на первом
пассаже подверглись деконтаминации, а оставшиеся клеточные линии были полностью
деконтаминированы после пятого пассажа. Из проведенных нами исследований видно, что
антимикоплазменный препарат Фармазин может деконтаминировать культуры клеток от
микоплазм преимущественно на 5 пассажном уровне.
Список литературы
1. www.bioscreen.ru/files/upload/91/Resource%20Notes1-1.doc
2. Jakway J., Shevach E. 1984. Mycoplasma contamination in Hazard of screening
hybridoma supernatants for inhibition of 3H-thymidine incorporation // J Immunol. Meth. Vol.
67. P. 337-345.
3. Drexler H.G., Uphoff C.C. 2000. Contamination of cell culture, mycoplasma //
Encyclopedia of cell technology / Ed. R.S. Spier. New York; Toronto.Vol. 1. P.609-627.
4. Михайлова Г.Р., Подчерняева Р.Я., Данлыбаева Г.А., Селиванова Т.К.,
Гребенникова Т.В., Гринкевич О.М. Индикация микоплазм и деконтаминация их в
клеточных линиях для проведения вирусологических исследований. Материалы IX съезда
Всероссийского научно-практического общества эпидемиологов, микробиологов и
паразитологов. Москва, 2007: 238.
5. Robinson L.В., Wichelhausen R. H., Roizman В. 1956. Contamination of cell cultures
by pleuropneumoniae-like organisms / Science. Vol. 124. P. 1147-1148.
111
6. Методы культивирования клеток: Сборник научных трудов. – Л.: Наука, 1988.
313с.
Түйін.
Берілген
жұмыста
жасушалық
дақылдарды
микоплазмалардан
деконтаминациялау туралы мәселелер қарастырылған. BHK-21, BHK-21 К-17, CRFK и ПЩ
клеткалық линияларына антибиотик Фармазиннің әсері сарапталды. Бұл препарат
клеткалық линиялардағы микоплазмаларды көбіне 5-ші пассаждық деңгейде
элиминациялай алатындығы көрсетілген.
Summary. In this work problems of a decontamination of cell cultures from micoplasmas
are considered. Operating of antibiotic of Farmasyn is analysed on the cell lines of BHK - 21,
BHK - 21 К- 17, CRFK and BP. It is shown that this preparation of eliminating of micoplasm in
cell lines mainly at 5 arcade level.
УДК 619:616.98:579.843.95:639.3
ПОЛУЧЕНИЕ КОНЪЮГАТА В СОСТАВЕ ТЕСТ-СИСТЕМЫ ДЛЯ
ВЫЯВЛЕНИЯ ВИРУСА ВОЗБУДИТЕЛЯ ИНФЕКЦИОННОГО НЕКРОЗА
ПОДЖЕЛУДОЧНОЙ ЖЕЛЕЗЫ ЛОСОСЕВЫХ РЫБ (IPNV)
ИММУНОФЕРМЕНТНЫМ МЕТОДОМ
Карпова М.А. м.н.с, аспирант, Завьялова Е.А.к.б.н., Дрошнев А.Е.к.б.н.,
Гулюкин М.И.д.в.н.
ГНУ Всероссийский научно-исследовательский институт экспериментальной
ветеринарии
им.Я.Р.Коваленко (ВИЭВ Россельхозакадемии), г. Москва, Россия
Резюме. Инфекционный некроз поджелудочной железы лососёвых вызывает до 90%
гибели молоди лососевых рыб, что несет существенный урон рыбоводческим хозяйствам.
В результате проведенных исследований нами был разработан конъюгат для тестсистемы на основе твердофазного «сэндвич» варианта ИФА для определения антигена
IPNV в инфицированных культурах клеток и в гомогенатах тканей рыб.
Обеспечение такими наборами ветеринарных лабораторий позволит проводить
массовые обследования рыб для установления диагноза, а также изучения
распространения IPNV в рыбоводческих хозяйствах.
Введение. Инфекционный некроз поджелудочной железы лососевых (IPN)—это
опасное, распространенное по всему миру, очень заразное, вирусное заболевание
лососевых и других видов рыб, которое приводит к летальному исходу до 80% в
зависимости от сочетания таких факторов как штамм, его количество, хозяин и
окружающая среда, переболевшие рыбы на протяжении всей жизни являются
вирусоносителями. Болезнь передается как вертикально, так и горизонтально, через воду.
Вирусоносительство выявлено у 40 видов гидробионтов в том числе у пресноводных рыб,
а также у 70 видов морских беспозвоночных животных. [1].
Следовательно, своевременная и быстрая диагностика IPN является актуальной
проблемой промышленного рыбоводства. Современные аналитические методы в
диагностике различных заболеваний позволяют повысить эффективность профилактики и
лечения. Одним из перспективных методов определения вирусных антигенов и антител к
ним является иммуноферментный анализ (ИФА), в котором используется комбинация
высокоспецифичной иммунологической реакции с чувствительным каталитическим
112
действием ферментного маркера. Преимущества ИФА заключаются в высокой
специфичности, скорости и простоте постановки реакции, сравнительная невысокая
стоимость и универсальность применяемого оборудования, возможности автоматизации
процедуры анализа.
Основной этап в создании тест-системы методом иммуноферментного анализа
является конъюгирование биомолекулы, мечение антитела или антигена ферментной
меткой, которые используются для обнаружения иммунных комплексов. Наиболее широко
используемым ферментом в иммуноанализе служит пероксидаза хрена.
Конъюгирование фермента с иммунохимически активными белками производится
различными методами: химическая сшивка, ковалентное связывание молекулы фермента с
антителом или антигеном и образование соединений через нековалентные связи,
например, когда связь между ферментом и антителом или антигеном осуществляется
иммунологически, через взаимодействие антиген-антитело.
Наиболее широкое распространение получили ковалентные способы приготовления
конъюгатов. Выбор реакции связывания определяется типом доступных функциональных
групп в данных белковых молекулах.
Целью данного исследования является подбор условий и компонентов для создания
конъюгата.
Материалы и методы. Антитела. Вирусоспецифические антитела против IPNV
штамм N07-1, полученные в нашей лаборатории по разработанной ранее схеме из
сывороток гипериммунизированных кроликов. [2].
Антиген. В работе использовали очищенный и концентрированный антиген IPNV
штамм N07-1, выращенный на культуре клеток EPC и OMG.
IgG из иммунных сывороток выделяли риванольным методом с высаливанием
раствором сернокислого аммония с последующей гельфильтрации и ионообменной
хроматографией на ДЭАЭ-целлюлозе. Измерение концентрации белка проводили по
методу Лоури. [3,4].
Результаты и обсуждение. Подготовка антител к конъюгированию заключалась в
диализе IgG против 0,2М Na-карбонатного буфера рН9,5 30мин при температуре 560С.
Конъюгирование фермента с иммуноглобулинами проводили ковалентным способом, для
введения фермента в молекулы антител использовали периодат натрия по
модифицированной методике M.B. Wilson и P.K. Nakane. [5]. В качестве ферментативной
метки использовалась пероксидаза хрена (ПХ).
Предварительно пероксидазу хрена очищали через молселект G25. 2мг очищенной
пероксидазы хрена растворяли в 0,4мл бидистиллированной воды. Далее к раствору ПХ
добавляли 0,1мл 0,1М периодат натрия. Окисление происходило при мягком
шуттелировании при комнатной температуре в течение 30мин в темноте. Признаком
образования активной формы пероксидазы служило изменение окраски раствора фермента
с желто-коричневой на зеленоватую. При длительном хранении на свету активированная
форма быстро переходит в неактивную, при этом зеленая окраска снова переходит в
коричневую. Потом активированный фермент диализировали против 0,001М ацетатного
буфера рН4,4 с трехкратной заменой в течение 24 часов при температуре 40С.
Для поиска оптимального соотношения иммуноглубулинов к пероксидазе хрена
конъюгирование проводилось в трех вариантах IgG к ПХ 1:1, 1:2 и 2:1 в щелочной среде.
Инкубировали в течение 2 часов при комнатной температуре при слабом шуттелировании
в темноте. Оптимальным соотношением ПХ к IgG составило 1:2.
В одну часть растворов после охлаждения до 40С добавляли боргидрит натрия для
восстановления непрореагировавших альдегидных групп. Ведение боргидрида натрия
113
резко снижало чувствительность реакции, тем самым выявило не целесообразность его
применения.
Следующим этапом было высаливание из растворов конъюгата добавлением
насыщенного раствора сульфата аммония. Далее центрифугировали. Полученный осадок
ресуспензировали в 1мл 0,02М фосфатно-солевом буфере и диализировали против этого
же буфера с трехкратной заменой в течение 24 часов при температуре 4 0С. Потом
проводилась гельфильтрация с последующим высаливанием насыщенным раствором
сульфата аммония. Заключающим этапом был диализ против фосфатно-солевого буфера
рН7,2-7,4.
К полученному конъюгату добавляли равный объем глицерина и хранили при минус
20±0,50С. Активность приготовленного конъюгата определяли шахматным титрованием.
Рабочее разведение конъюгата составило 1:20000.
Разработанная нами тест-система обладает рядом преимуществ перед чешским
диагностическим набором TestLine. [6].
Во-первых, время постановки реакции сокращено, так как в качестве
антигендетектирующие антитела используются те же, что и для сорбции планшета. В
наборе сравнения используются дополнительные антивидовые антитела (свиные). По
данной схеме время анализа увеличено на 15ч.
Во-вторых, в наборе IPNV-ИФА-ВИЭВ в качестве антигендетектирующих антител
используются антитела кролика к вирусу IPN, что приводит к повышению точности
реакции в то время в наборе TestLine IPNV Ag ELISA используются свиные антитела к
иммуноглобулинам кролика.
Предложенная нами схема постановки реакции позволяет проводить анализ при
комнатной температуре. При этом в коммерческом наборе сравнения необходимо
задействовать термостатирование.
Оптимизированы объемы вносимых компонентов, что снижает ошибку оператора.
Использование малого количества компонентов при производстве диагностикума
позволяет снизить себестоимость тем самым масштабировать изготовление.
Список литературы
1. Завьялова Е.А. Цитоморфологическая характеристика культур клеток рыб и их
чувствительность к некоторым вирусам: Дисс.канд.биол.наук:03.00.23/ Е.А.Завьялова.Москва, 2006.-131с.
2. Завьялова Е.А., Дрошнев А.Е., Карпова М.А., Гулюкин М.И. Разработка тестсистемы для выявления вируса возбудителя инфекционного некроза поджелудочной
железы лососевых рыб (IPN) иммуноферментным методом / Мат. Междунар. научнопракт. конф. «Научные основы производства и обеспечения качества биологических
препаратов для АПК», Щелково, 2012.
3. Практикум по биохимии / Под ред. С.Е.Северина, Г.А.Соловьевой – М.: Изд-во
МГУ, 1989. – 508с.
4. Р.Досон, Д.Эллиот, У.Эллиот, К.Джонс Справочник биохимика –М.: Изд-во
«Мир», 1991. – 545с
5. Wilson M.B., Nakane P.K. Recent development in the periodate method of conjugating
horseradish peroxides (HRPO) to antibodies. Biomedical press; 1978: 215-244.
6. IPNV Ag ELISA [Электронный ресурс] // TestLine Clinical Diagnostics [Офиц. сайт].
URL: http://www.testlinecd.com/ipnv-ag-elisa (дата обращения: 15.02.2012).
7. OIE
Aquatic
code
2006
Available
in
URL:
http://www.oie.int/eng/normes/fcode/en_chapitre_1.2.3.htm
114
8. Van der Marel P., Snyder D.B, Lutticken D. Antigenic characterization of IBDV field
isolates by their reactivity with a panel of monoclonal antibodies // Dtsch.tierarztl. Wschr. 1990. Bd. 97. - S. 81-83.
Summary. Infectious pancreas necrosis of salmonidae fishes is the cause of death of up to
90% of young salmonidae fish, thereby causing a considerable damage to the fish farms. As a
result of conducted research, we developed a conjugate for the test system on the basis of solid
phase “sandwich” IFA option for identification of IPNV antigen in infected cell cultures and
homogenates of fish tissue.
Provision of such sets to the veterinary laboratories will allow mass tests of the fish to make
a diagnosis, and study the IPNV distribution in the fish farms.
УДК 619:578.821: 578.72
ТЕСТИРОВАНИЕ РЕВЕРСИБЕЛЬНОСТИ АТТЕНУИРОВАННОГО
ШТАММА «КМ-40» ВИРУСА ОСПЫ ВЕРБЛЮДОВ, ПРИМЕНЯЕМОГО ДЛЯ
РАЗРАБОТКИ ЖИВОЙ ВАКЦИНЫ
Килибаев С.С., Мамбеталиев М., к.в.н., Ажибаев А.Ж., Абсатова Ж.С., Битешова
Э.Т., Валиева А.Д., Есимбекова Н.Б., Кенжебаева М.К., Табынов К.К.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. В работе представлены результаты тестирования реверсибельности
аттенуированного штамма «КМ-40» вируса оспы верблюдов, применяемого для
разработки живой вакцины.
Введение. В настоящее время в ряде стран основным средством предупреждения и
борьбы с оспой верблюдов (ОВ) является специфическая профилактика [1-3]. В
купировании очага эпизоотии и контроля за ситуацией по ОВ используются как живые, так
и инактивированные вакцины [4, 5]. Известно, что по многим параметрам живые
вакцинные препараты
превосходят убитые вакцины [6]. На современном этапе
актуальным является вопрос, именно, применения природно-ослабленных или
аттенуированных штаммов вируса для приготовления средств специфической
профилактики.
Реверсибельность аттенуированных штаммов, используемых для изготовления
живых вакцин, применяемых в ветеринарии, тестируют на естественно восприимчивых
животных. Аттенуированные штаммы, не восстановившие свои исходные вирулентные
свойства в течение нескольких последовательных пассажей на наиболее восприимчивых к
естественной инфекции виде животных, считаются пригодными для изготовления живых
вакцин [7].
В связи с вышеизложенным целью наших исследований было изучение возможности
реверсии аттенуированного штамма «КМ-40» используемого для разработки живой
вакцины против ОВ.
Материалы и методы. Реверсибельность аттенуированного штамма «КМ-40»
вируса оспы верблюдов определяли на верблюдах годовалого возраста, путем проведения
трех последовательных пассажей. Для этого Ι группе верблюдов методом скарификации, а
также внутрикожно ввели суспензию штамма в дозе 10 5,0 ЭИД50 в объеме 1 см3. Через 7
115
сут провели второй
последовательный пассаж, путем инфицирования ΙΙ группы
верблюдов кровью, от Ι группы. Затем по такой же методике провели 3 пассаж. За
испытуемыми животными вели 28 сут клиническое наблюдение с ежедневным измерением
температуры тела с целью выявления характерных клинических признаков заболевания
оспой верблюдов.
На 3 и 6 сут после инфицирования у верблюдов отобраны пробы цельной крови (с
гепарином) для оценки уровня виремии путем титрования в культуре клеток почки ягненка
(ПЯ). На 7, 14, 21, 28 сут после заражения у испытуемых групп верблюдов отобраны
пробы сывороток крови для исследования их на наличие вируснейтрализирующих антител
(ВНА) в реакции нейтрализации (РН).
На 28 сут после 3 последовательного пассажа аттенуированным штаммом «КМ-40»
проведено контрольное заражение верблюдов III группы эпизоотическим штаммом М-96
вируса ОВ в дозе 105,0 ТЦД50/0,2 см3 методом скарификации.
Результаты. За период наблюдения за инфицированными верблюдами в течение 28
сут повышения температуры тела, проявление каких-либо клинических признаков болезни
у испытуемых групп животных отмечено не было. В пробах цельной крови отобранных на
3 и 6 сут после проведения последовательных пассажей у всех групп животных вирус не
обнаружен, что свидетельствует об отсутствии виремии. На 14, 21, 28 сут после
инфицирования у верблюдов I группы были обнаружены ВНА в титрах от 2,0 до 5,0 log2 на
первом пассажном уровне и от 1,0 до 3,0 log2 на втором. У верблюдов III группы ВНА не
обнаружены, что косвенно свидетельствует о том, что аттенуированный штамм «КМ-40»
вируса ОВ не передается от верблюда к верблюду на третьем пассажном уровне.
С целью подтверждения полного отсутствия ВНА у испытуемых верблюдов 3
пассажного уровня проведено их контрольное заражение эпизоотическим штаммом М-96
вируса ОВ. У животных на 7 сут после заражения на месте скарификации образовались
папулы, которые на 8 сут созрели до стадии пустул, содержимое которых выделялась
наружу. С 8 по 11 сут отмечено повышение температуры тела от 39,2 до 39,5 °С. На 10-11
сут полностью отсутствовал аппетит и отмечена генерализация оспенного процесса на
местах введения суспензии вируса, на губах, в промежности передних и задних ног, в
области паха и по всей голове. С 12 сут отмечено снижение температуры тела до уровня
физиологической нормы верблюдов. Начиная, с 14 сут из пустул начали образовываться
оспенные корочки и к 28 сут сроку, после контрольного заражения наступало полное
выздоровление животных.
Выводы. Таким образом, из полученных результатов следует, что вирус ОВ из
штамма «КМ-40» в результате трехкратного пассирования на верблюдах не восстановил
свои вирулентные свойства, что дает основание применять его в качестве вакцинного
штамма для изготовления живых аттенуированных вакцин против ОВ.
Список литературы
1. EL-Harrak M., Isolation of camelpox virus, development of an inactivated vaccine and
prophylactic application in Morocco // Int. meeting on camel production and future perspectives.
–1998, Al Ain, UAE: 736.
2. Wernery U., Meyer H., Pfeffer M. Camelpox in United Arab Emirates and its prevention
// Camel Prac. and Res. – 1997. – V. 4 (2). – P. 135-139.
3. Higgins A.J., Silvey R.E., Abdelghafir A.E. et al. The epidemiology and control of an
outbreak of camelpox in Bahrain // Proc. 1st int. Camel Conf. Eds.: W.R. Allen, A.J. Higgins, I.G.
Mayhew, D.H. Snow and J.F. Wade: R. and W. Publications, Newmarket, UK: 10-104.
4. Hafez S.M., Al-Sukayran A., dela-Kruz D. et al. Development of a life cell culture
camelpox vaccine // Vaccine. – 1992. – V.10 (8). – P. 533-537.
116
5. Kaaden O.R., Wernery U., Klopries M. Camel fibroblast cell line DUBCA and its use for
diagnosis and prophylaxis of camel diseases // Proc. of the Intl. Conf. of Livestock Production in
Hot Climates, Muscat, Oman: A49.
6. Wernery U. and Zachariah R. Experimental camelpox infection in vaccinated and
unvaccinated dromedaries // J. Vet. Med. B. – 1999. – V.46. – P. 131-135.
7. Абдураимов Е.О. Разработка технологии изготовления вирусвакцины против оспы
коз // Дисс. на соиск. учен. степ. канд. ветер. наук. Алматы. 2001. 103 с.
Түйін. Жұмыста тірі вакцинаны әзірлеуге қолданылатын әлсіретілген түйе шешегі
вирусы «КМ-40» штамының реверсибелділігін тексеру нәтижелері көрсетілген.
Summary. This work presents the results of testing reversion of attenuated strain "KM-40"
of camelpox virus used for the development of live vaccine.
УДК 576.621;856.3
НОВЫЙ КАНДИДАТ ВАКЦИНЫ ПРОТИВ В. ABORTUS НА ОСНОВЕ
ГРИППОЗНОГО ВЕКТОРА: ОЦЕНКА БЕЗОПАСНОСТИ НА КРУПНОМ
РОГАТОМ СКОТЕ
Кожамкулов Е.М., Рыскельдинова Ш.Ж., Табынов К.К., к.в.н.
РГП Научно-исследовательский институт проблем биологической безопасности КН
МОН РК
Резюме. В настоящей работе приведены результаты изучения безопасности, нового
вакцинного кандидата векторной вакцины против B.аbortus.
Иммунизация КРС
проводилась конъюнктивальным способом с использованием перекрестной прайм и
бустерной вакцинации. В результате комплексных исследований, включающих
клиническое обследование с термометрией, гематологический и биохимический анализ
крови, было установлено, что все образцы вакцин из вирусных конструкций, в том числе
сочетающие адъюванты, по сравнению с коммерческой бактериальной вакциной B. abortus
S19 полностью безопасны для КРС.
Введение. Бруцеллез – зооантропонозная инфекция, представляет собой мировую
проблему для здравоохранения, животноводства и экономики. Несмотря на столетнюю
историю открытия возбудителей этой инфекции и, соответственно, столь же длительную
историю объединения усилий ученых разных стран, направленных на разработку и
совершенствование средств и методов борьбы с ним, бруцеллез все еще остается одной из
существенных проблем медицинской и ветеринарных наук [1].
Как известно стратегическим методом борьбы с инфекционными болезнями является
иммунопрофилактика [2]. Профилактика этого опасного заболевания среди
крупнорогатого скота (КРС) в настоящее время проводиться с использованием живых
аттенуированных вакцин из штаммов B. abortus S19. Указанные вакцины обладают
высокой иммуногенностью, но при этом небезопасны для животных, что связано с их
способностью вызывать аборты у стельных коров, более того использование их осложняет
дифференциацию вакцинированных животных от инфицированных [3]. Сложившаяся
ситуация стала причиной ограничения вакцинации против бруцеллеза во многих
неблагополучных по данному заболеванию странах, что в свою очередь побудило к поиску
117
новых кандидатов противобруцеллезной вакцины, которые наряду с иммуногенностью
были бы безопасны для животных. С этой целью различными исследовательскими
группами были приготовлены субъединичные (рекомбинантные протеины) [4-8], ДНКвакцины [9-12] и живые векторные вакцины на основе Escherichia coli [13], Salmonela
enterica [14] и Semliki Forest virus (SFV) [15].
В НИИПББ для специфической профилактики бруцеллеза КРС, представляющего
огромную проблему для развития животноводства в Казахстане, предложена новая
стратегия, основанная на использовании живой векторной вакцины, где в качестве нового
векторов впервые используются рекомбинантные вирусы гриппа А субтипов Н5N1 и
H1N1, экспрессирующие бруцеллезный рибосомальный белок L7/L12 и поверхностный
мембранный белок Omp16. Данные исследования были посвящены изучению
безопасности полученных новых гриппозных вирусных векторов, а также их сочетаний с
различными адъювантами, на КРС в сравнении с живой аттенуированной вакциной B.
abortus S19.
Материалы и методы. Приготовление образцов вакцины. Образцы вакцины
готовили из вирусных конструкций Flu-NS1-124-L7/L12-H5N1, Flu-NS1-124-Omp16-H5N1,
Flu-NS1-124-L7/L12-H1N1 и Flu-NS1-124-Omp16-H1N1, накопленных в 10-суточных
эмбрионах при температуре 34 °С в течение 48 часов. Наработанные аллантоисные
суспензии вирусных конструкций с одинаковой антигенной структурой (Н5N1 или H1N1)
объединяли в один пул в соотношении 1:1 для получения бивалентной вакцинной
формуляции. Далее полученные смеси вирусных конструкций (L7/L12+Omp16)
объединяли с такими адъювантами как Montanide Gel01 (L7/L12+Omp16+MontanideGel01;
Seppic, France) в соотношении 80:20 по объему (согласно рекомендации производителя) и
(L7/L12+Omp16+хитозан, Sigma-Aldrich, Germany) в конечной концентрации 0.05% и
перемешивали на магнитной мешалке в течение 5-7 мин. Готовые образцы вакцин до
использования хранили при температуре 2-8°С. В исследованиях использованы 25 голов
КРС (нетели), казахской белоголовой породы, в возрасте 1-1,5 года. Все животные были
серонегативны к B. abortus, что было подтверждено путем исследования сывороток крови
в реакции агглютинации, роз-бенгал пробе и реакции связывания комплемента (Микроген
Россия). Нетели были распределены на 5 групп (5 животных/группа): три опытные,
вакцинированные
L7/L12+Omp16,
L7/L12+Omp16+MontanideGel01
и
L7/L12+Omp16+хитозан, одна контрольная негативная группа (ФБР) и одна контрольная
позитивная группа (B. abortus S19). Группы животных на протяжении всего опыта
содержались в разных комнатах и имели свободный доступ к воде и корму.
Иммунизация КРС. КРС опытных групп с использованием конъюнктивального (К.)
метода введения были двукратно с интервалом в 28 суток привиты образцами из вирусных
конструкций субтипов Н5N1 (прайм вакцинация) и H1N1 (бустерная вакцинация),
экспрессирующих бруцеллезные белки L7/L12 и Omp16. Детальная схема иммунизации
животных показана в таблице 1. КРС из группы позитивного контроля иммунизировали
однократно П.К. в область шеи (правая сторона) коммерческой вакциной из штамма B.
abortus S19 (Щелковский биокомбинат, Россия) в дозе 80 x 109 КОЕ/животное (согласно
инструкции производителя). КРС из группы негативного контроля в качестве инокулята
вводили ФБР.
118
Таблица 1 - Схема иммунизации КРС (нетели) смесью вирусных конструкций
Вакцина
Способ
Количество
введения* животных
Доза
прайм
вакцинации
(Н5N1),
log10
ЭИД50/животное
8,74+8,74
Доза бустерной
вакцинации
(Н1N1),
log10
ЭИД50/животное
8,5+8,25
смесь
Flu-NS1-124К.
5
L7/L12 + Flu-NS1-124Omp16
смесь
Flu-NS1-124К.
5
8,64+8,64
8,4+8,15
L7/L12 + Flu-NS1-124Omp16 + Montanide
Gel01
смесь
Flu-NS1-124К.
5
8,43+8,43
8,2+7,95
L7/L12 + Flu-NS1-124Omp16 + хитозан
B. abortus S19
П.К.
5
80 x 109 КОЕ
ФБР
П.К.
5
*Объем вакцины для нетелей при К. способе введения составлял 1 мл (по 0,5 мл в
каждый глаз), при П.К. способе введения 1 мл
Оценка безопасности вакцин. Безопасность образцов вакцин из вирусных
конструкций определяли в сравнении с группой негативного (ФБР) и позитивного (B.
abortus S19) контроля. Для этого за вакцинированными КРС в течение 56 суток после
первоначальной вакцинации (ПВ) вели ежедневное клиническое наблюдение с
термометрией. Кроме того, у животных из яремной вены на 0, 7, 14, 28, 35, 42 и 56 сутки
после ПВ отбирались образцы крови (цельная кровь и сыворотка крови с использованием
пробирок Becton Dickinson Vacutainer, USA) для проведения гематологических и
биохимических исследований
Гематологические и биохимические исследования крови КРС. Для гематологического
анализа образцы цельной крови исследовали на автоматических анализаторах крови T-540
Coulter Counter. При этом определялись следующие параметры: концентрация
гемоглобина, гематокрит, количество эритроцитов, лейкоцитов, тромбоцитов,
палочкоядерных и сегоментоядерных нейтрофилов, эозинофилов, лимфоцитов и
моноцитов.
Биохимические исследования образцов сыворотки крови проводились на
автоматическом анализаторе VITALAB Selectra 2 (Merck, Germany) с использованием
коммерческих наборов компании DiaSys Diagnostic Systems GmbH (Germany). Анализ
образцов проводился по следующим параметрам: билирубин общий, билирубин прямой,
креатинин, холестерин, общий белок, мочевина, глюкоза, аспартатаминотрансфераза и
аланинаминотрансфераза.
Результаты исследований. 1 Изучение безопасности образцов вакцин на КРС.
1.1 Клиническое наблюдение с термометрией. Проведенные исследования показали,
что иммунизация животных вирусными конструкциями, в том числе сочетающими
адъюванты, не оказывает никакого негативного влияния на общее клинического состояние
(поведение, аппетит и т.д.) животных на протяжении срока наблюдения. Температура тела
животных в опытных группах в течение срока наблюдения была в пределах нормы
(рисунок 1). На месте К. введения препаратов каких-либо изменений (истечения,
конъюнктивит) не наблюдалось.
119
Рисунок 1 – Температура тела нетелей после иммунизации различными образцами
вакцин. В опытных группах животных, иммунизированных вирусными конструкциями (в
том числе, содержащими адъюванты), на 30 сутки проведена бустерная вакцинация.
У животных позитивной контрольной группы, вакцинированных B. abortus S19, на
протяжении срока клинического наблюдения также не отмечались признаки какого-либо
заболевания, поведение животных и аппетит были как у животных из группы негативного
контроля (ФБР). Однако у животных вакцинированных B. abortus S19 группы на 1-3 сутки
после вакцинации отмечалось повышение температуры тела до 40.9°С (рисунок 1). Более
того, на месте П.К. введения вакцины отмечалось образование инфильтратов диаметром до
7 см, которые полностью рассасывались лишь к 14 суткам после вакцинации.
1.2 Гематологические и биохимические исследования. Анализ гематологических и
биохимических данных показал, что во всех группах животных исследуемые параметры в
течение всего срока наблюдения соответствовали физиологической норме [16, 17], и,
несмотря на динамические изменения, не выходили за их пределы (рис. 2 и 3).
Исключением является группа животных, привитых коммерческой вакциной B. abortus
S19. В указанной группе на 7 сутки после вакцинации была отмечена палочкоядерная
нейтрофилия, что согласно данным Громыко [18] связано с легким инфекционным
процессом (в нашем случае с вакцинацией). В целом, по всем другим исследованным
гематологическим и биохимическим параметрам между опытными и контрольными
(негативная и позитивная) группами достоверной разницы (Р>0,05) выявлено не было.
120
Рисунок 2 –Динамика гемотологических показателей у вакцинированных нетелей. В
опытных группах животных, иммунизированных вирусными конструкциями (в том числе,
содержащими адъюванты), на 30 сутки проведена бустерная вакцинация.
121
Рисунок 3 – Динамика биохимических показателей крови у вакцинированных
нетелей различными образцами вакцин. (в том числе, содержащими адъюванты).
Обсуждение. Настоящая работа является продолжением серии исследований,
направленных на получение безопасной и эффективной векторной вакцины против B.
abortus. Как уже отмечалось, чтобы решить проблему специфической профилактики B.
abortus мы впервые предложили векторную вакцину на основе рекомбинантных вирусов
гриппа, экспрессирующих рибосомальный белок L7/L12 и Omp16. Наши предыдущие
исследования показали, что эта вакцина у крупного рогатого скота индуцирует сильный
антиген - специфичный Т-клеточный иммунный ответ, а главное высокую протективность,
сравнимую, а в сочетание с адъювантом Montanide Gel01 значительно превосходящую
коммерческую вакцину B. abortus S19 [19].
Так как от результатов этих исследований зависела судьба всей дальнейшей
разработки, мы решили прибегнуть к подходу, способному повысить эффективность
вакцины. Для этого, к уже эффективно примененным на лабораторных животных
подходам, а это использование бивалентной вакцинной формуляции в режиме прайм и
бустерной иммунизации с конъюнктивальным способом введения, мы добавили
стратегию, предполагающую включение в состав вакцины адъюванта. Ввиду
конъюнктивального способа введения вакцины наш выбор пал на такие коммерческие
адъюванты как Montanide Gel01 и chitosan, которые согласно рекомендации производителя
122
и по некоторым публикациям [20-23] могут быть включены в состав вакцин с
мукозальным способом применения.
В наших предыдущих исследованиях было показано, что с уменьшением размера
NS1 гена повышается степень аттенуации вирусов гриппа А [24], однако также известно,
что в зависимости свойств чужеродной вставки в N-терминальной области NS1 гена
аттенуация вирусов гриппа не всегда достигается [25]. Поэтому в этих исследованиях мы
сочли необходимым изучить безопасность или степень аттенуации сконструированных
рекомбинантных вирусов гриппа А на КРС. Следует отметить, что в данных
исследованиях наряду с традиционными методами, применяемыми при оценке
безопасности ветеринарных вакцин, мы использовали более чувствительные методы
гематологического и биохимического анализа крови, которые позволяют первыми
раскрывать неясно выраженные клинические симптомы какого-либо заболевания в
организме.
Заключение. Таким образом, в результате комплексных исследований, включающих
клиническое обследование с термометрией, гематологический и биохимический анализ
крови, было показано, что все образцы вакцин из вирусных конструкций, в том числе
сочетающие адъюванты, по сравнению с коммерческой бактериальной вакциной B. abortus
S19 полностью безопасны для КРС в режиме прайм и бустерной иммунизации.
Благодарность. Авторы работы выражают благодарность сотрудникам НИИПББ, а
именно Еспембетову Б.А., Асанжановой Н.Н., Зининой Н.Н., Инкарбекову Д.А.,
Акжунисовой И.К. и Гоцкиной Т.М. за оказанную помощь при оценке безопасности
векторной вакцины против B. abortus на КРС.
Список литературы
1. Беляков В.Д., Дегтярев А.А., Иванников Ю.Г. Качество и эффективность
противоэпидемических мероприятий. - Л.: Медицина. -1981. – С. 304.
2. Гулюкин М.И., Альбертян М.П., Искандаров М.И., Федоров А.И. Конструирование
слабоагглютиногенных вакцин против бруцеллеза // Междунар. рабоч. Совещание:
Бруцеллез - пограничная инфекция животных и человека, требующая общих усилий
разных стран. – Серпухов. -2008. - С. 15-16.
3. Schurig G.G., Sriranganathan N., Corbel M.J. Brucellosis vaccines: past, present and
future // Vet Microbiol. – 2002. – Vol. 90. – P. 479–496.
4. Al-Mariri A., Tibor A., Mertens P., et al. Protection of BALB/c mice against Brucella
abortus 544 challenge by vaccination with bacterioferritin or P39 recombinant proteins with
CpGoligodeoxynucleotides as adjuvant // Infect Immun. – 2001. – Vol. 69. – P. 4816-4822.
5. Tabatabai L.B., Pugh G.W. Jr. Modulation of immune responses in Balb/c mice
vaccinated with Brucellaabortus Cu-Zn superoxide dismutase synthetic peptide vaccine //
Vaccine. – 1994. – Vol. 12. – P. 919-924.
6. Oliveira S.C., Splitter G.A. Immunization of mice with recombinant L7/L12 ribosomal
protein confers protection against Brucella abortus infection // Vaccine. – 1996. – Vol. 14. – P.
959-962.
7. Oliveira S.C., Zhu Y., Splitter G. Sequences of the rplJL operon containing the L10 and
L7/L12 genes from Brucella abortus // Gene. – 1994. – Vol. 140. – P. 137-138.
8. Oliveira S.C., Zhu Y., Splitter G.A. Recombinant L7/L12 ribosomal protein and gammairradiated Brucella abortus induce a T-helper 1 subset response from murine CD4+ T cells //
Immunology. – 1994. – Vol. 83. – P. 659-664.
9. Leclercq S., Harms J.S., Oliveira S.C. Enhanced efficacy of DNA vaccines against an
intracellular bacterial pathogen by genetic adjuvants // Curr Pharm Biotechnol. – 2003. – Vol. 4.
– P. 99-107.
123
10. Kurar E., Splitter G.A. Nucleic acid vaccination of Brucella abortus ribosomal L7/L12
gene elicits immune response // Vaccine. – 1997. – Vol. 15. – P. 1851-1857.
11. Onate A.A., Cespedes S., Cabrera A., et al. A DNA vaccine encoding Cu, Zn
superoxide dismutase of Brucella abortus induces protective immunity in BALB/c mice // Infect
Immun. – 2003. – Vol. 71. – P. 4857-4861.
12. Mayfield J.E., Bricker B.J., Godfrey H., et al. The cloning, expression, and nucleotide
sequence of a gene coding for an immunogenic Brucella abortus protein // Gene. – 1988. – Vol.
63. – P. 1-9.
13. Harms J.S., Durward M.A., Magnani D.M., et al. Evaluation of recombinant invasive,
non-pathogenic Eschericia coli as a vaccine vector against the intracellular pathogen, Brucella // J
Immune Based The Vaccines. – 2009. – Vol. 7. – P. 1.
14. Zhao Z., Li M., Luo D., et al. Protection of mice from Brucella infection by
immunization with attenuated Salmonella enteric serovar typhimurium expressing A L7/L12 and
BLS fusion antigen of Brucella // Vaccine. – 2009. – Vol. 27. – P. 5214-5219.
15. Cabrera A., Saez D., Cespedes S., et al. Vaccination with recombinant Semliki Forest
virus particles expressing translation initiation factor 3 of Brucella abortus induces protective
immunity in BALB/c mice // Immunobiology. – 2009. – Vol. 214, № 6. – P. 467-474.
16. Veterinary Medicine: A Textbook of the Diseases of Cattle, Horses, Sheep, Pigs, and
Goats. 10th edn., Saunders Elsevier, Philadelphia. 2007.http://www.love-training.net/order
17. Hussain SA, Uppal SK, Randhawa C, Sood NK, Mahajan SK. 2013. Clinical
characteristics, hematology, and biochemical analytes of primary omasal impaction in bovines.
Turk. J. Vet. Anim. Sci. 37: 329-336
18. Громыко ЕВ. 2005. Оценка состояния организма коров методами биохимии.
Экологический вестник Северного Казказа. 2: 80-94.
19. Tabynov K , Kydyrbayev Zh, Ryskeldinova Sh, Yespembetov B, Zinina N,
Assanzhanova N, Kozhamkulov Y, Inkarbekov D, Gotskina T, Sansyzbay A. 2014. Novel
influenza virus vectors expressing Brucella L7/L12 or Omp16 proteins in cattle induce a strong
T-cell immune response, as well as high protectiveness against B. abortus infection. Vaccine.
32(18): 2034-41.
20. Deville S, Arous JB, Bertrand F, Borisov V, Dupuis L. 2012. Efficacy of intranasal and
spray delivery of adjuvanted live vaccine against infectious bronchitis virus in experimentally
infected poultry. Procedia in Vaccinology. 6: 85 – 92.
21. Read RC, Naylor SC, Potter CW, Bond J, Jabbal-Gill I, Fisher A, Illum L, Jennings R.
2005. Effective nasal influenza vaccine delivery using chitosan. Vaccine. 23(35): 4367–74.
22. Mills KH, Cosgrove C, McNeela EA, Sexton A, Giemza R, Jabbal-Gill I, Church A,
Lin W, Illum L, Podda A, Rappuoli R, Pizza M, Griffin GE, Lewis DJ. 2003. Protective levels of
diphtheria-neutralizing antibody induced in healthy volunteers by unilateral priming-boosting
intranasal immunization associated with restricted ipsilateral mucosal secretory immunoglobulin
a. Infect Immun. 71(2): 726–32.
23. McNeela EA, Jabbal-Gill I, Illum L, Pizza M, Rappuoli R, Podda A, Lewis DJ, Mills
KH. 2004. Intranasal immunization with genetically detoxified diphtheria toxin induces T cell
responses in humans: enhancement of Th2 responses and toxin-neutralizing antibodies by
formulation with chitosan. Vaccine. 22(8): 909–14.
24. D. H. Yu, X. D. Hu, and H. Cai, “A combined DNA vaccine encoding BCSP31, SOD,
and L7/L12 confers high protection against Brucella abortus 2308 by inducing specific CTL
responses,” DNA and Cell Biology, vol. 26, no. 6, pp. 435–443, 2007. View at Publisher · View
at Google Scholar · View at Scopus
25. Иванов.А.В., Солмыков.К.М., и.др. Бруцеллез животных и перспективы его
специфической профилактики. Биологические и сельскохозяиственные науки.-2012. –С.
359-362.
124
Түйін. Бұл ғылыми мақалада жаңа вакциналы кандидатты B. аbortus-қа қарсы
векторлық вакцинаның қауіпсіздігін зерттеу нәтижелері көрсетілген. Қиылысты және
бустерлі вакциналау арқылы конъюнктивалды әдіспен ірі қара малдарды иммунизациялау
жүргізілді. Комплексті зерттеу нәтижесінде клиникалық тексерумен термометриялауды
қосқанда, қанның гематологиялық және биохимиялық қортындысы, вирустық жинтықтан
тұратын вакцинаның түрлері, оның ішінде тіркесті адъювантары, комерциялық бактериялы
B. abortus S19 вакцинамен салыстырғанда ірі қара малдарға толық қауіпсіз деп анықталды.
Summary. This paper presents the results of safety studies, the new vaccine candidate
vaccine vector B. Abortus. Immunization of cattle held conjunctival method using cross-prime
and booster vaccination. As a result of comprehensive research, including clinical examination
with thermometry, hematological and biochemical blood tests, it was found that all samples of the
vaccine virus structures, including combining adjuvants, compared with commercial bacterial
vaccine B. abortus S19 are completely safe for cattle.
УДК 619:578.825.1:578.2:578.5
ОЧИСТКА И КОНЦЕНТРИРОВАНИЕ ВИРУСА ИНФЕКЦИОННОГО
ЛАРИНГОТРАХЕИТА ПТИЦ
Козлов А.А., аспирант
Андрейчук Д.Б., старший научный сотрудник, кандидат биологических наук
Андриясова А.Н., ведущий биолог
Мудрак Н.С., главный научный сотрудник, доктор биологических наук
Федеральное государственное бюджетное учреждение «Всероссийский
научно-исследовательский институт защиты здоровья животных»
(ФГБУ «ВНИИЗЖ»), Россия, г. Владимир
Резюме. Представлены данные по оптимизации метода очистки и концентрирования
вируса инфекционного ларинготрахеита птиц для получения концентрированных
вирусных препаратов с высокой степенью очистки, пригодных для определения полной
нуклеотидной
последовательности
генома
данного
вируса
с
помощью
пиросеквенирования.
Ключевые слова: вирус инфекционного ларинготрахеита птиц, градиент плотности
сахарозы, центрифугирование, пиросеквенирование.
Введение. Вирус инфекционного ларинготрахеита птиц (ИЛТ) вызывает у кур
респираторное заболевание, характеризующееся поражением слизистых оболочек верхних
дыхательных путей и конъюнктивы. В промышленном птицеводстве болезнь наносит
значительный экономический ущерб. Возбудитель – ДНК-содержащий вирус семейства
Herpesviridae и подсемейства Alphaherpesvirinae, таксономически идентифицируется как
Gallid herpesvirus 1. Полная вирусная частица диаметром 195 – 250 нм состоит из
нуклеокапсида и окружающей его оболочки. Геном вируса представлен линейной ДНК
длиной около 155 тысяч п. н. [1].
В мировой практике изучения молекулярно биологических свойств вируса ИЛТ птиц
достаточно актуальным являются определение и анализ первичной структуры полного
генома вируса методом пиросеквенирования, однако для этого необходимо проведение
соответствующей пробоподготовки вирусных препаратов с применением методов очистки
и концентрирования вируса. Учитывая структурные особенности вириона вируса ИЛТ,
125
обуславливающие его лабильность, для очистки и концентрирования предпочтительнее
использовать метод ультрацентрифугирования в градиенте плотности сахарозы или
фиколла [2]. Согласно данным литературы в ходе пробоподготовки для полногеномного
пиросеквенирования в
качестве
вируссодержащего
материала
использовался
лиофилизированный препарат [3]. Однако технологически не всегда целесообразно
использование лиофилизированных вирусных препаратов, как например при работе с
вновь выделенными изолятами вируса. Кроме того, представленные в литературе методы
очистки и концентрирования вируса ИЛТ птиц достаточно трудоёмки и многостадийны [4,
5].
Целью нашей работы являлась оптимизация метода очистки и концентрирования
вируса ИЛТ птиц для получения концентрированных вирусных препаратов с высокой
степенью очистки, пригодных для определения полной нуклеотидной последовательности
генома данного вируса с помощью пиросеквенирования.
Материалы и методы. Вирус. Штамм «О» вируса ИЛТ птиц из коллекции ФГБУ
"ВНИИЗЖ".
Получение вируссодержащего материала. Для наработки вируса ИЛТ птиц
использовали 10 – 12 суточные СПФ-эмбрионы кур. Заражение проводили на
хорионаллантоисную оболочку (ХАО) через искусственную воздушную камеру. На 6-7
сутки после инокуляции отбирали поражённую ХАО. Отобранный материал
диспергировали и подвергали однократной заморозке (при -700С) и оттаиванию.
Определение титра инфекционности. Титр инфекционности вируса определяли
путём заражения 10-12 суточных СПФ-эмбрионов кур, десятикратными разведениями
вируссодержащей суспензии. Расчёт титра вируса проводили по методу Кербера.
Предварительное
центрифугирование.
Низкоскоростное
центрифугирование
проводили в течение 1 часа при 3000 об/мин на центрифуге Thermo Jouan KR25i с
использованием ротора AKL-500.
Подготовка градиента плотности сахарозы. Градиент был приготовлен используя
20%, 30% и 50% растворы сахарозы в равных объёмах. Полученную вируссодержащую
суспензию наслаивали в соотношении 1:1 объёма суспензии к объёму градиента
соответственно.
Высокоскоростное центрифугирование в градиенте плотности сахарозы.
Центрифугирование проводили с помощью ультрацентрифуги Thermo SERVALL WX Ultra
Series в течение 5 часов при 25000 об/мин с использованием бакетного ротора Surespin 630.
На границе 30% и 50% растворов сахарозы отбирали опалесцирующую фракцию.
Очистка вирусного материала от сахарозы. Отобранную фракцию разбавляли в два
раза фосфатно-буферным раствором (ФБР) при расчёте на объём используемых пробирок.
Центрифугирование проводили в течение 1 часа при 24000 об/мин (Thermo SERVALL WX
Ultra Series, ротор Surespin 630). Надосадочную жидкость удаляли, а осадок
ресуспендировали в ФБР.
Определение концентрации белка в вирусном препарате. Концентрацию белка в
препарате определяли по методу Бредфорда.
Электрофорез в полиакриламидном геле. Для оценки степени чистоты и
гомогенности
концентрированного
препарата
использовали
электрофорез
в
полиакриламидном геле с применением прибора EC120 Mini Vertical Gel System (Thermo
EC, США) согласно инструкции производителя.
Полимеразная цепная реакция в режиме реального времени. ПЦР-РВ проводили
согласно методу Callison S.A. и соавторов [6].
126
Результаты исследований. При заражении 10 – 12 дневных СПФ-эмбрионов кур
штаммом «О» вируса ИЛТ птиц, на 5-6 сутки после инокуляции на ХАО наблюдали
формирование непрозрачных бляшек, являющихся следствием некроза.
По данным титрования, в полученном материале титр инфекционности вируса ИЛТ
штамма «О» составил 5,75 lg ЭИД50/0,2мл.
В ходе ультрацентрифугирования содержащиеся в 90 мл осветлённой суспензии
частицы клеточного дебриса, имеющие плавучую плотность ниже, чем у вируса ИЛТ птиц,
задерживались на границе между вируссодержащей суспензией и 20% раствором сахарозы
и на границе 20% и 30% растворов сахарозы. Частицы клеточного дебриса с плавучей
плотностью выше, чем у вируса ИЛТ птиц, осаждались на дно центрифужной пробирки.
Фракция, содержащая очищенный вирус ИЛТ птиц, концентрировалась на границе между
30% и 50% растворами сахарозы, так как плавучая плотность вируса ниже плотности 50%
раствора сахарозы (плотность 1,229 г/мл). В итоге полученный концентрированный и
очищенный вирусный препарат имел объём, равный 1 мл, кратность концентрирования
препарата составила 90 раз.
Концентрация белка в материале, полученном после очистки и концентрирования,
рассчитанная по методу Бредфорда, составила 0,9 мг/мл. Молекулярная масса белков,
выявленных после электрофореза, соответствовала данным, полученным другими
авторами [5].
Титр инфекционности вируса в очищенном и концентрированном препарате составил
7,5 lg ЭИД50/0,2 мл. При сопоставлении данных по титрам вируса, было получено
значение, равное 1,75 lg ЭИД50/0,2 мл, показывающее разницу в концентрации вируса
между исходным и полученным препаратом приблизительно в 50 раз.
Оптическая плотность выделенной ДНК вируса из очищенного и
сконцентрированного материала составила 58 мкг/мл.
Методом ПЦР-РВ был проведён анализ образцов осветлённой вируссодержащей
суспензии размолотой ХАО и полученного концентрата, в результате которого
определили, что ДНК вируса была сконцентрирована приблизительно в 76 – 80 раз. Так
как объём осветлённой вируссодержащей суспензии был сконцентрирован в 90 раз,
разница в приведённых значениях может отражать потери вирусного материала,
возникшие в ходе очистки через градиент плотности сахарозы, которые составили 12 –
16% от количества в исходной осветлённой суспензии. Было установлено, что
использование полиэтиленгликоля (ПЭГ) на стадии предварительной очистки вируса [5]
приводит к увеличению потери вирусного материала, что может оказать негативное
влияние на качество нуклеотидных последовательностей, полученных методом
пиросеквенирования.
Использование полученного очищенного и концентрированного препарата позволило
получить нуклеотидные последовательности ДНК вируса высокого качества. Методом
пиросеквенирования была определена нуклеотидная последовательность полного генома
ДНК вируса ИЛТ птиц штамма «О» длиной 153 646 п.н.
Выводы. В ходе работы был оптимизирован метод очистки и концентрирования
вируса ИЛТ птиц. Полученные вирусные препараты пригодны для определения полной
нуклеотидной последовательности генома вируса ИЛТ птиц с помощью
пиросеквенирования.
Список литературы
1. Болезни домашних и сельскохозяйственных птиц: пер. с англ. / под. ред. Б.У.
Кэлнека [и др.]. – М.: АКВАРИУМБУК, 2003. – С. 608 – 622.
2. Гринин А.С., Титов И.Н. Очистка, концентрирование и фракционирование
вирусов животных. – М.: Колос, 1971. – С. 5-85.
127
3. First complete genome sequence of infectious laryngotracheitis virus / Lee S.W.,
Markham P.F., Markham J.F. [et al.] // BMC Genomics. – 2011. – Vol. 12. – P. 197.
4. Production of Monoclonal Antibodies against the Challenge Strain of Infectious
Laryngotracheitis Virus of Chickens and Their Use in an Indirect Immunofluorescent Diagnostic
Test / Abbas F., Andreasen J., Becker R. [et al.] // Pak Vet J. – 2010. – Vol. 30. – P. 163-166.
5. Saepulloh M. Molecular characterization of infectious laryngotracheitis virus (ILTV)
isolates from outbreak cases at Lipa City, Batangas Province, The Philippines // JITV. – 2004. Vol. 9. – P. 26-36.
6. Development and validation of a real-time Taqman PCR assay for the detection and
quantitation of infectious laryngotracheitis virus in poultry / Callison S.A., Riblet S.M., Oldoni I.
[et al] // Journal of Virological Methods. – 2007. – Vol. 139. – P. 31 – 38.
Summary. Information on optimization of avian infectious laryngotracheitis virus
purification and concentration procedures to prepare high-concentrated and high-purified
biologics suitable for pyrosequencing the entire viral genome is presented.
Key words: infectious laryngotracheitis virus, sucrose density gradient centrifugation ,
pyrosequencing.
УДК 579.222:547.992.3
ПОДБОР АССОЦИАЦИЙ ДРОЖЖЕВЫХ КУЛЬТУР ДЛЯ ЭФФЕКТИВНОГО
ИСПОЛЬЗОВАНИЯ ПОСЛЕСПИРТОВОЙ БАРДЫ
Костеневич А.А., Тригубович А.М., Черноок Т.В., к.б.н. Пучкова Т.А.,
к.б.н. Иконникова Н.В.
Институт микробиологии НАН Беларуси
Резюме. Отобраны активно растущие на послеспиртовой барде ассоциации
дрожжевых культур: C. tropicalis БИМ У–217 и S. fibuligera БИМ У–176; S. fibuligera БИМ
У-176 и T. cutaneum БИМ У–210; S. fibuligera БИМ У–176, T. cutaneum БИМ У–210 и C.
tropicalis БИМ У–217. Показано отсутствие между исследованными штаммами
антагонистических взаимоотношений, что свидетельствует о возможности их совместного
культивирования на жидких питательных средах. Культивирование ассоциации трех
штаммов дрожжей в непрерывном режиме с постоянной подачей подпиток зерновым
суслом позволяло получать высокую концентрацию дрожжевой биомассы (до 28,0–
30,0 г/л) с содержанием сырого протеина до 39–42% и обеспечивало эффективную
утилизацию питательных веществ барды (до 90%).
Введение. При производстве спирта на основе зернового сырья в качестве
многотоннажного отхода остается жидкая послеспиртовая барда, содержащая большое
количество растворенных органических веществ. Сброс значительных объемов барды в
стоки может вызывать загрязнение окружающей среды, поэтому проблема её переработки
для предприятий имеет важное экологическое значение [1].
Одним из путей рационального использования послеспиртовой барды является
культивирование на ней кормовых дрожжей. Это обеспечивает не только утилизацию
растворенных органических соединений барды, но и получение необходимого
сельскохозяйственным животным высокобелкового кормового продукта. Однако,
вследствие низкой концентрации и не полного усвоения дрожжами содержащихся в
послеспиртовой барде веществ, наблюдается недостаточный прирост дрожжевой
биомассы, в то время как удельные затраты энергии на производство сухих кормовых
128
дрожжей достаточно высокие. Поэтому задача усовершенствования технологий
существующих производств кормовых дрожжей является актуальной [2,3].
Одним из путей повышения производительности процесса является поиск штаммов
дрожжей, способных активно усваивать компоненты послеспиртовой барды. Поскольку
различные виды дрожжей отличаются по способности сбраживать и ассимилировать
сахара, использование их ассоциации позволит утилизировать более широкий спектр
компонентов сложных сред [4].
Цель работы – подобрать активно растущие на послеспиртовой барде штаммы
дрожжей и исследовать возможность их совместного культивирования для более полной
утилизации отходов спиртового производства и получения дрожжевой биомассы с
высоким содержанием белка.
Материалы и методы. В работе использовали штаммы дрожжей, относящихся к
родам: Candida, Debaryomyces, Rhodosporidium, Saccharomycopsis, Trichosporon,
Rhodotorula, Cryptococcus, Kluyveromyces, Saccharomyces, которые хранятся в Белорусской
коллекции непатогенных микроорганизмов Института микробиологии НАН Беларуси.
Культуры дрожжей поддерживали на скошенном агаре с зерновым суслом (6Б).
Дрожжи культивировали в колбах Эрленмейера на круговой качалке (160-180
об/мин) при температуре 26–28 °С в течение 24 часов.
Для получения биомассы дрожжей использовали два варианта питательных сред, рН
– 4,5–5,5:
1) послеспиртовую зерновую барду с добавлением солей (г/л): (NH4)2SO4 – 4,0;
MgSO4 – 0,3; KCl – 0,3; (редуцирующих веществ (РВ) после стерилизации 9,5-11,5
мг/мл);
2) среду 1 с добавлением 5 % зернового сусла (редуцирующих веществ (РВ) после
стерилизации 16,0–25,0 мг/мл).
После культивирования дрожжей на жидких питательных средах их биомассу
отделяли от культуральной жидкости центрифугированием при 5000 об/мин и
использовали для последующих анализов.
Для определения содержания сухой биомассы образцы сырого мицелия высушивали
при температуре 105° С до постоянного веса.
Содержание сырого протеина в биомассе определяли по Кьельдалю, истинный белок
– по Барнштейну [5].
Редуцирующие сахара (РВ) определяли с динитросалициловой кислотой по Miller [6].
Результаты исследований. Исследован рост 21 штамма дрожжей, относящихся к
родам Candida, Debaryomyces, Rhodosporidium, Saccharomycopsis, Trichosporon,
Rhodotorula, Cryptococcus, Kluyveromyces и Saccharomyces, на двух вариантах питательных
сред. Показано, что наиболее активно утилизировали питательные вещества
послеспиртовой барды (более 65% РВ) штаммы БИМ У–176, У–216, У–218 вида
Saccharomycopsis fibuligera, а также Kluyveromyces lactis БИМ У–201 и Candida tropicalis
БИМ У–217 (56,7–81,4). При этом они накапливали достаточно высокую биомассу – 12,5–
15,3 г/л. Штамм Trichosporon cutaneum БИМ У-210 менее активно утилизировал
редуцирующие сахара (36,8–45,6%) послеспиртовой барды, но отличался наиболее
активным ростом (14,0–20,0 г/л).
Наиболее высокий уровень содержания сырого протеина отмечен в биомассе
дрожжей родов Candida и Saccharomyces, а истинного белка – родов Candida,
Saccharomyces и Kluyveromyces. Содержание сырого протеина у исследуемых штаммов
достигало 29–43%, истинного белка – 19–31%. Содержание истинного белка у всех
исследованных штаммов увеличивалось (от 4 до 40%) при добавлении в среду зернового
сусла.
129
Проведена оценка совместимости отобранных штаммов БИМ У–176, У–216, У–218
дрожжей S. fibuligera, штаммов БИМ У-217 и U15 C. tropicalis, K. lactis БИМ У–201, T.
cutaneum БИМ У-210 и Saccharomyces cerevisea 717. Экспериментальную оценку взаимной
совместимости отобранных культур (попарно) проводили в условиях глубинного
культивирования, а также при их высеве на твердые питательные среды.
Установлено, что совместная инкубация отобранных культур дрожжей не
приводила к их взаимному ингибированию при росте на сусло-агаре, что свидетельствует
об отсутствии у них антагонистических взаимоотношений и о возможности их
совместного культивирования на жидких питательных средах.
Большинство испытанных комбинаций штаммов обеспечивало быстрое накопление
дрожжевой биомассы (15,0–20,0 г/л за 24 часа культивирования) и эффективную
утилизацию РВ барды (от 50 до 76%). В ходе экспериментов было установлено, что при
культивировании дрожжей на двух вариантах питательных сред, второй вариант
обеспечивал прирост их биомассы незначительно – от 4 до 14%, в то время как содержание
белка в клетках повышалось на 12–45%, а РВ среды снижались на 14–57%. Таким образом,
добавление в среду 5 % сусла способствовало повышению в биомассе уровня белка и
более эффективной утилизации РВ барды.
Наиболее высокий уровень накопления биомассы дрожжей отмечен при
совместном культивировании C. tropicalis БИМ У-217 и S. fibuligera БИМ У-176, биомасса
которых достигала 20,2 г/л, а содержание истинного белка в биомассе – 23,8%, при этом
содержании остаточных РВ в барде снижалось до 0,5%. Высокий уровень накопления
дрожжевой биомассы (19,3 г/л) достигался также при совместном культивировании S.
fibuligera БИМ У-176 и K. lactis БИМ У–201, однако, при этом не обеспечивалась
достаточная (до 90,0%) степень утилизации РВ в барде и составляла 62-68%.
Совместное культивирование пар дрожжей: C. tropicalis БИМ У–217 и K. lactis БИМ
У–201; S. fibuligera БИМ У–176 и T. cutaneum БИМ У–210 также обеспечивало высокий
выход биомассы дрожжей (18,7 и 18,4 г/л, соответственно), при этом использование
второй ассоциации дрожжей позволяло снизить содержание РВ в барде до 0,3%.
При проведении процесса совместного культивирования трех штаммов дрожжей S.
fibuligera БИМ У-176, T. cutaneum БИМ У-210 и C. tropicalis БИМ У-217 показано, что
между ними не наблюдались антагонистические взаимодействия. Культивирование этой
ассоциации в непрерывном режиме при постоянной подаче подпиток зерновым суслом
позволяла получать не только высокую концентрацию дрожжевой биомассы (до 28,0–30,0
г/л), содержащей до 39–42% сырого протеина, но и обеспечивала высокую степень
утилизации редуцирующих сахаров послеспиртовой барды (до 90%).
Выводы. Таким образом, отобраны наиболее активно растущие на послеспиртовой
барде штаммы дрожжей, обеспечивающие высокий уровень накопления дрожжевой
биомассы, эффективную утилизацию питательных веществ барды и высокий уровень
содержания белка. Установлено, что наиболее продуктивными ассоциациями дрожжей,
обеспечивающими высокую эффективность утилизации РВ барды и образование
дрожжевой биомассы, являлись сочетания культур: C. tropicalis БИМ У-217 и S. fibuligera
БИМ У-176; S. fibuligera БИМ У-176 и T. cutaneum БИМ У-210, а также ассоциация трех
штаммов дрожжей: S. fibuligera БИМ У-176, T. cutaneum БИМ У-210 и C. tropicalis БИМ У217.
Список литературы
1. Андросов, А.Л. Промышленные технологии переработки послеспиртовой барды /
А.Л. Андросов, И.А. Елизаров, А.А. Третьяков // Вестник ТГТУ. – 2010. – Т. 16, № 4. – С.
954–963.
130
2. Антипов, С.Т. Проблемы комплексной переработки послеспиртовой зерновой
барды/ С.Т. Антипов, А.В. Журавлев // Производство спирта и ликеро-водочных изделий. –
2005. – № 2. – С. 36–37.
3. Романовская, Т.В. Ассоциация дрожжевых культур как основа эффективной
биотрансформации зернового сырья в кормовую белковую добавку / Т.В. Романовская и
др. // Перспективы и проблемы развития биотехнологии в рамках единого экономического
пространства стран Содружества: материалы междунар. науч.- практ. конф. 25-28 мая 2005
г., Минск-Нарочь / Сост. и общ. ред. А.Н. Евтушенкова. – Мн.: РИВШ, 2005. – С. 213-214.
4. Сушкова, В.И. Безотходная конверсия растительного сырья в биологически
активные вещества / В.И. Сушкова, Г.И. Воробьёва. – Киров, 2007. – 204 с.
5. Петербургский, А.В. Практикум по агрохимии / А.В. Петербургский // М.: С.-х
лит. журналов и плакатов. – 1963. – С. 50.
6. Miller, G.L. Dinitrosalicylic acid for determination of reducing sugars / Miller, G.L. //
Anal. chem. – 1959. – Vol. 31. – P. 426-428.
Summary. The associations of yeast cultures actively growing on distillery spent grains were
selected: C. tropicalis BIM Y–217 + S. fibuligera BIM Y–176, S. fibuligera BIM Y–176 + T.
cutaneum BIM Y–210 and S. fibuligera BIM Y–176 + T. cutaneum BIM Y–210 + C. tropicalis BIM
Y-217. Lack of antagonistic relations between the studied strains indicates possibility of their mixed
fermentation on liquid nutrient media. Continuous co-cultivation of 3 yeast strains association with
constant feeding of grain wort resulted in high concentrations of yeast biomass (up to 28–30 g/l) with
39–42 crude protein content and efficient utilization of substrate nutrients (up to 90%).
УДК 619:578.831.2:57.083.138
ЧУМА ПЛОТОЯДНЫХ УГРОЖАЕТ РЕДКИМ ЖИВОТНЫМ
Кошеметов Ж.К. к.б.н., Кыдырбаев Ж.К. к.в.н., доцент, Султанкулова К.Т. к.б.н.,
Нурабаев С.Ш., Матвеева В.М. к.б.н., Богданова М.И., Сугирбаева Г.Д., Оразымбетова
Н.К., Бурашев Е.Д.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. В данной статье приведены результаты вирусологических исследований
биоматериалов павших от чума плотоядных гепарда и снежного барса в Алматинском
зоологическом парке. Применение методов РДП, ИФА, ПЦР, выделения возбудителя в
культуре клеток и проведение гистологических исследований биоматериалов позволило
постановку диагноза заболевания.
Введение. Чума плотоядных - острая вирусная болезнь животных семейства псовых
и куньих, характеризующаяся лихорадкой, катаральным воспалением слизистых оболочек,
пневмонией, расстройством функции нервной системы и желудочно-кишечного тракта.
Возбудитель болезни-РНК-содержащий вирус рода Morbillivirus семейства
Paramyxoviridae [1].
Чума плотоядных, распространенная во всем мире болезнь, занимает второе место
среди инфекционных заболеваний по смертности среди домашних собак, и является
серьезной угрозой для диких животных. Считается, что чума плотоядных поражает псовых
и куньих, а домашние кошки чумой плотоядных не болеют [2 ].
131
В последние годы ученые все чаще утверждают [3], что вирус поражает все новые и
новые виды диких животных. В середине 1990-х годов от этой инфекции погибла треть
популяции львов в Серенгети. Вирус стал причиной нескольких смертельных вспышек
заболевания байкальской нерпы, поставил на грань исчезновения популяцию островных
лис на о. Санта Каталина, и остается постоянной угрозой для исчезающих черноногих
хорьков в США [4-8]. Кроме того в 2000 году от чумы пострадали каспийские тюлени [9] и
по данным, собранным американскими специалистами по охране природы вместе с
дальневосточными ветеринарами Российской Федерации [10] с 2009 года 1 % популяции
кошачьих, как тигры пали от чумы плотоядных. Они отмечают, что главным источником
чумы плотоядных являются не вакцинированные собаки, как домашние, так и дикие. Когда
крупной добычи не хватает, тигры питаются барсуками и енотовидными собаками, могут
нападать на домашних собак. А самое печальное то, что все случаи были зафиксированы в
разных регионах Дальнего Востока Российской Федерации, то есть под угрозой
находиться вся популяция. Таким образом, чума плотоядных представляет реальную
угрозу для выживания амурского тигра.
Летальность заболевших животных составляет 30-60 %, тем самым наносит большой
экономический ущерб пушному звероводству и собаководству.
В последние 5 лет от неизвестных инфекционных заболеваний в Алматинском
зоологическом парке погибли около 10 голов экзотических для Казахстана животных,
такие как львы, снежный барс и гепард.
В связи с этим целью наших исследований являлась постановка диагноза павших в
январе 2014 года в Алматинском зоологическом парке снежного барса и гепарда.
Материалы и методы. Патологические материалы: печень, мозг, селезенка, легкие,
почка, кишечник гепарда и мозг снежного барса;
- диагностические наборы для реакций диффузионной преципитации (РДП) и
иммуноферментного анализа (ИФА) при чуме плотоядных и бешенстве, РДП при
инфекционном гепатите плотоядных (ИГП), парвовирусном энтерите плотоядных (ПЭП);
- ПЩ (перевиваемая линия культуры клеток почки щенка);
- MDCK (перевиваемая линия культуры клеток почки собаки);
- CRFK (перевиваемая линия культуры клеток почки кошки);
- Vero (перевиваемая линия культуры клеток почки зеленной мартышки);
- питательная среда МЕМ и Игла-МЕМ;
- набор Qiagen «One - Step RT – PCR kit»;
- набор для выявления кДНК вируса чумы плотоядных;
- набор для проведения электрофореза;
- Mastercycler, Eppendorf.
Постановка тест-систем
РДП и ИФА при чуме плотоядных и бешенстве, а также РДП при ИГП, ПЭП ставили
согласно их наставлений.
Вирусовыделение. Заражение культур клеток патологическими материалами (в виде
20 % суспензий) проводили по общепринятой методике. Смену среды проводили через 2
суток. Зараженные пробирки с культурой клеток ежедневно просматривали под световым
микроскопом на наличие ЦПД.
Выделение РНК вируса чумы плотоядных. Выделение РНК проводили с
использованием набора Qiagen «One - Step RT–PCR kit» в соответствии с наставлением по
применению данного набора.
Постановка полимеразной цепной реакции (ПЦР) анализа проводили при
следующих параметрах:
Реакционная смесь:
5х buffer – 25 мкл;
132
dNTP – 1 мкл;
Primer f – 1 мкл;
Primer r – 1 мкл;
РНК – 2 мкл;
Н2О – 14 мкл;
Enzymemix – 1 мкл.
Температурный режим:
55 ºС-30 мин
95 ºС– 15 мин
94 ºС– 30 секунд
50 ºС– 30 секунд
72 ºС– 1 мин
72 ºС– 10 мин
4 ºС- ∞
35 цикл
Результаты исследований. Биоматериалы, отобранные от павших гепарда (мозг,
кишечник, печень, легкие, селезенка, почки) и снежного барса (мозг) были исследованы на
наличие антигенов возбудителей чумы плотоядных, ИГП, ПЭП и бешенства с
применением РДП, ИФА и ПЦР на вирус чумы плотоядных, а также проведено
вирусовыделение в монослое культур клеток Vero, MDCK, CRFK и ПЩ. Результаты РДП и
ИФА представлены в таблице.
Таблица - Выявление антигенов вирусов чумы плотоядных, бешенства, ИГП и ПЭП
из патологических материалов гепарда и снежного барса в РДП и ИФА
№
п/п
1
2
3
4
5
6
7
Вид
животного
гепард
снежный
барс
Наименование
исследуемых
проб в виде 20%
суспензий
печень
мозг
селезенка
легкие
почки
кишечники
мозг
Результаты исследований на
чуму
бешенство
ИГП
плотоядных
РДП
ИФА
РДП ИФА РДП
+
1:160
+
1:20
1:80
+
1:160
+
1:320
Контроли
+
ПЭП
РДП
-
АгС вируса чумы
+
н/и
н/и
н/и
н/и
плотоядных
9
АгС вируса бешенства
н/и
н/и
+
+
н/и
н/и
10 АгС вируса ИГП
н/и
н/и
н/и
н/и
+
н/и
11 АгС вируса ПЭП
н/и
н/и
н/и
н/и
н/и
+
12 АгН
Примечания: 1. «АгС» - антиген специфический; 2. «АгН» - антиген нормальный;
3. «-» – отрицательный результат; 4. «+» – положительный результат
5. «н/и» - не исследован.
8
133
Из результатов таблицы видно, что в исследованных пробах антиген вируса чумы
плотоядных в РДП и ИФА выявлен только в печени, селезенке, почках и в кишечнике
гепарда, а также получены отрицательные результаты на бешенство, инфекционный
гепатит и парвовирусный энтерит плотоядных.
При этом антиген вируса чумы
плотоядных в ИФА обнаружен в печени и почках с активностью 1:160, легких - 1:80,
селезенке - 1:20 и в кишечнике - 1:320.
Из использованных культур клеток, только в монослое культуры клеток CRFK,
зараженной 20 % суспензией кишечника павшего гепарда на втором пассажном уровне
было выявлено цитопатическое изменение, характерное для вируса чумы плотоядных
(рисунок 1). Полученные результаты подтверждены обнаружением антигена вируса чумы
плотоядных в 100- кратной концентрированной суспензии в РДП и ИФА, а также РНК
вируса чумы плотоядных в ПЦР (Рисунок 2). При пассировании 20 % суспензии
патматериалов гепарда и снежного барса в монослоях культуры клеток Vero, MDCK и ПЩ
в течение пяти последовательных пассажей каких либо цитопатических изменений
отмечено не было.
А – Монослой культуры клеток CRFK.
Б – пораженный монослой культуры клеток CRFK .
Рисунок 1– Проявление ЦПД вируса чумы плотоядных в монослое культуры клеток
CRFK (второй пассажный уровень).
В рисунке (Б) видно, что ЦПД вируса плотоядных характеризовались округлением и
зернистости клеток.
В результате проведенного исследования на Р-ген был наработан спецический
продукт в пробах 5 и 6 с размером 429 пар оснований, что указывает на наличие вируса
чумы плотоядных в исследуемых пробах.
429 п.о. ( 1 kb маркер)
М – маркер; 1 - позитив контроль; 2 - негатив контроль; 3 –20 % суспензия печени; 4 –
20 % суспензия селезенки; 5 – 20 % суспензия кишечника; 6 - культуральная проба CRFK второго
пассажного уровня, зараженной 20 % суспензиями кишечника.
Рисунок 2 – Электрофореграмма ПЦР продуктов вируса чумы плотоядных в биоматериалах
павшего гепарда.
134
Проведены гистологические исследования легких и печени павшего гепарда (рисунок
3).
А – легкие, ув. 10х; Б – легкие, ув. 10х; В – печень, увел. 20х; Г – печень, увел. 20х.
Рисунок 3 - Микрофотография участков органов гепарда. Окраска гематоксилином и
эозином.
В ходе гистологического исследования отмечено острая катаральная пневмония
легких. Межальвеолярные перегородки расширены, в просвете альвеол серозный экссудат
(А и Б), разрушение балочной структуры печени, местами уменьшение количества
гепатоцитов, увеличение объема оставшихся печеночных клеток и признаки разрастания
соединительной ткани (В и Г).
Таким образом, в ходе проведённой экспертизы впервые на территории Республики
Казахстан была установлена циркуляция вируса чумы плотоядных среди диких кошачьих
животных.
Выводы
1. Причиной гибели гепарда в Алматинском зоологическом парке является чума плотоядных.
Антиген вируса чумы плотоядных в ИФА обнаружен в его печени и почках (1:160), легких
(1:80), селезенке (1:20) и в кишечнике (1:320);
2. Выделенный вирус чумы плотоядных из органов павшего гепарда культивируется в
культуре клеток CRFK проявлением характерное для данного вируса ЦПД и наличие
вируса подтверждается в ПЦР.
Список литературы
1. Сюрин В.Н., Белоусова Р.В., Фомина Н.В. Диагностика вирусных болезней
животных. – Москва: ВО Агропромиздат, 1991. - С. 228-237.
2. http://www.zooeco.com/0-cot0-18-2.html
3. Williams E.S., Barker I.K. Canine distemper. Infectious diseases of wild mammals, 3rd
ed. – Ames: Iowa State Press, IA.2001. - Р. 50-59.
4. Skai K., Yoshikawa T., Seki F., Fukushi S., Tahara M., Nagata N., Ami Y., Mizutani T.,
Kurane I., Yamaguchi R., Hasegawa H., Saijo M., Komase K., Morikawa S., Takeda M. Canine
distemper virus associated with a lethal outbreak in monkeys can readily adapt to use human
receptors. J. Virol. 2013. 87. - Р. 7170-7175.
5. Daoust P.Y., Mc Burney S.R., Godson D.L., vande Bildt M.W., Osterhaus A.D. Caninedistemper virus-associated encephalitis in free-living lynx (Lynx canadensis) and bobcats (Lynx
rufus) of eastern Canada. J. Wildl. 2009. Dis. 45. - Р. 611-624.
6. Origgi F.C., Plattet P., Sattler U., Robert N., Casaubon J.,Marot F., Pewsner M., Wu N.,
Giovannini S., Oevermann A., Stoffel M.H., Gaschen V., Segner H., Ryser-Degiorgis M.P.
135
Emergence of canine distemper virus strains with modified molecular signature and enhanced
neuronal tropism leading to high mortality in wild carnivores. Vet. Pathol. 2012.49. - Р.913-929.
7. Meli M.L., Simmler P., Cattori V., Martínez F., Vargas A., Palomares F., López-Bao
J.V., Simón M.A., López G., León-Vizcaino L., Hofmann-Lehmann R., Lutz H. Importance of
canine distemper virus (CDV) infection in free-ranging Iberian lynxes (Lynx pardinus). Vet.
Microbiol.2010. 146. - P. 132-137.
8. McCarthy A.J., Shaw M.A., Goodman S.J. Pathogen evolution and disease emergence in
carnivores. Proc. Biol. Sci. 2007. 274. - P. 3165-3174.
9. Орынбаев М.Б., Мамадалиев С.М., Хайруллин Б.М., Троицкий Е.Н., Кошеметов
Ж.К., Зайцев В.Л., Нурабаев С.Ш., Белоусов В.Ю., Керимбаев А.А., Мамбеталиев М.А.,
Булатов Е.А., Копоченя А.А. Чума плотоядных у каспийских тюленей. Вестник науки
Казахского агротехнического университета им. С.Сейфулина №2 (49). - 2008. - C.190 -193.
10. Николаев К. Чума плотоядных – новая угроза амурским тиграм. Общество
сохранения диких животных (WCS). Архив новостей. Август- 2013.
Түйін. Берілген мақалада Алматы зоология бағынан алынып келінген өлген
қабылан мен барыстан алынған биоматериалдарға жүргізілген вирусологиялық зерттеу
нәтижелері көрсетілген. ДПР, ИФТ, ПТР қолданумен, торша өсіндісінде қоздырғышты
бөлу және гистологиялық зерттеу нәтижесінде зоологиялық бағында қабыланның ауыру
және өлу себебі ет қоректілер обасы қоздырғышы екендігі анықталды.
Summary. This article presents the results of virological testing of biomaterials fallen
snow leopard and cheetah delivered from Almaty zoological park. Using RDP, ELISA, PCR,
pathogen isolation in cell culture and histological studies revealed that the cause of disease and
death in the zoological park cheetah is the causative agent of canine distemper.
REAL-TIME PCR ASSAY FOR SPECIFIC
DETECTION OF COWPOX VIRUS
Maksyutov R.A.1, Gavrilova E.V.1, Meyer H.2, Shchelkunov S.N.1
State Research Center of Virology and Biotechnology “VECTOR”, Novosibirsk Region, Russia
2
Bundeswehr Institute of Microbiology, D-80937 Muenchen, Germany
1
Abstract. The species cowpox virus (CPXV), genus Orthopoxvirus (OPV), consists of
isolates highly variable in their biological properties and their genotypes. We have developed
recently a procedure for the specific detection of CPXV DNA based on ORF D11L TaqMan PCR
assay; however, a rather limited panel of CPXV stains had been used. Following testing a large
panel of 47 CPXV DNAs using the CPXV-specific PCR assay showed that 3 strains
(Austria_1999, Norway_1994_MAN and EP-1) could not be amplified at all because of large
deletions in ORF D11L. In addition, sequencing demonstrated that deletion of 23 bp in five other
CPXV strains led to low-efficiency detection of these strains. To solve this problem we selected
new primer/probe combination in ORF D8L, also species-specific region in the CPXV genome,
and described here new real-time PCR method for genus-specific detection of orthopoxviruses
and simultaneous CPXV-specific differentiation with internal control. The specificity and
sensitivity of the developed method were assessed by analyzing DNA of 67 strains belonging to
136
orthopoxvirus species pathogenic for humans as well as from experimental specimens isolated
from CPXV-infected mice.
Key words: Orthopoxvirus; Cowpox virus; Real-time PCR; Detection.
Human cowpox is a zoonotic disease caused by cowpox virus (CPXV) with natural
reservoir in rodents [1]. Generally, limited to development of local lesions with possible
generalization of the process [2], in rare cases, human cowpox can be accompanied by severe
complications [3] and lethal outcome [4]. CPXV belongs to the genus Orthopoxvirus (OPV) of
the family Poxviridae on a par with other pathogenic for humans monkeypox (MPXV), variola
(VARV), and vaccinia (VACV) viruses. These OPVs are immunologically cross-reactive and
cross-protective, so that vaccination with VACV provides protection against an infection with
any other member of this genus [5].
In 1980 the World Health Organization recommended to stop further vaccination against
smallpox, taking into account the postvaccination complications caused by classical live VACV
and confirmation of the global eradication of smallpox. Thus, worldwide, almost all individuals
below 33 years of age have no immunity against smallpox and other human orthopoxvirus
infections, resulting in numerous reported outbreaks of the human diseases caused by the
zoonotic orthopoxviruses, including CPXV [6-8]. Whereas the impossibility of accurate diagnosis
based on clinical data it’s necessary to develop a rapid and reliable method for CPXV detection.
Previously we had developed a real-time TaqMan PCR assay for a sensitive and specific
detection of CPXV DNA [9]. This assay target in sequences of the ORF D11L was used as part
of a multiplex TaqMan PCR assay for a species-specific identification of VARV, MPXV, CPXV
and VACV [10]; analysis of 8 CPXV strains resulted in a specificity of 100 %. However genome
sequences of two CPXV strains, i.e. Austria_1999 (HQ407377.1) and Norway_1994_MAN
(HQ420899.1) have been published recently with extended deletions in ORF D11L [11]. Based
on in silico analysis these two strains cannot be detected by the CPXV-specific PCR.
To test this hypothesis, a large panel of 47 CPXV DNAs, including CPXV strain
Austria_1999 and Norway_1994_MAN, was analyzed according the assay described by
Gavrilova et al. [9]. As a positive control for the presence of orthopoxvirus DNA we used an
OPV-generic TaqMan PCR assay (Table 1).
39 out of 47 CPXV DNAs could be successfully amplified, in five specimen CPXVspecific DNA was detected with a much lower sensitivity (a shift by 10-13 ct-values versus the
identification of OPV DNA), and in three specimens CPXV-DNA could not be amplified at all:
CPXV strain Austria 1999, Norway_1994_MAN and EP-1.
Using additional primers we sequenced the entire ORF D11L as well as up- and
downstream sequences for 38 CPXV strains. The length of sequenced region was 2135 bp
relatively CPXV reference strain GRI-90. We confirmed that two CPXV strains, Austria_1999
and Norway_1994_MAN, have extended deletions in the ORF D11L accounting for 1380 and
599 bp relative to CPXV reference strain GRI-90, respectively. Unfortunately, we failed to obtain
any PCR-products for CPXV strain EP-1. Sequencing demonstrates a deletion of 23 bp for five
strains and a 2 bp deletion for three strains in the binding site of the CPXV_D11L_forward
primer. The deletion of 23 bp leads to a much lower sensitivity in 5 CPXV strains as compared to
the generic OPV PCR whereas the 2-bp deletion doesn’t have a negative impact on the detection
of CPXV DNA. A single nucleotide substitution in an area complementary to the fluorescent
probe, found in CPXV strain Rostock 07, did not has an impact on the identification.
For improving the specificity we selected a new oligonucleotide primer
CPXV_D11L_forward_v.2 (Table 1). Subsequent analysis of all 47 DNA samples under study
showed a specific detection of CPXV DNA, regardless of the presence or absence of the 23 bp
deletion. However, as expected, DNA of CPXV strains Austria_1999, Norway_1994_MAN and
EP-1 could not be detected with updated ORF D11L PCR assay. Therefore, the specificity was
93.6 %.
137
To solve this problem we selected primer/probe combination in ORF D8L (Table 1), also
species-specific region in the CPXV genome. Subsequent analysis showed a specific detection of
48 out of 49 CPXV DNAs, including two out of three “problem” strains: Austria_1999 and
Norway_1994_MAN. Inability to detect DNA of CPXV strain EP-1 can be explained by
extensive deletion at least exciting ORF D8L-D11L, which is not characteristic of the species.
And taking into account the opaque history of strain EP-1 isolated from the elephant in Germany
in 1971 with minimal characterization raises the question of possible discrepancy in classification
of this strain as CPXV. Thus, the specificity of the ORF D8L TaqMan PCR assay in our
experiments was 97.9 % (strain EP-1 belongs to CPXV) or 100.0 % (strain EP-1 doesn’t belong
to CPXV).
The specificity of the new procedure was also assessed by analyzing DNAs of other OPV
species pathogenic for humans, including 5 strains of VACV, 5 strains of MPXV and 10 strains
of VARV. All signals were negative. The sensitivity was assessed using recombinant plasmid
carrying a fragment of the CPXV ORF D8L (10 copies of the plasmid per reaction were
reproducibly detected) and genomic viral DNA purified from CPXV (20 copies of the genomic
CPXV DNAs per reaction were reproducibly detected).
Considering that patient specimens could also contain PCR inhibiting factors we have
constructed an internal control (IC) in the form of recombinant plasmid with insertion of a unique
sequence to evaluate this possibility. Based on IC we described here new real-time PCR method
for genus-specific detection of orthopoxviruses (based on conserved ORF F4L) and simultaneous
CPXV-specific differentiation (based on ORF D8L) with internal control (Table 1). OPV, CPXV
and IC hybridization probes contained various fluorescent dyes, which provided for recording the
amplification of the target DNA at a certain wavelength. The specificity and sensitivity of
multiplex real-time PCR assay wasn’t less than for CPXV ORF D8L TaqMan PCR assay
described above. Also, CPXV DNAs were successfully detected in experimental specimens
obtained after intranasal infection of mice with CPXV strain GRI-90 [9].
Presence of reliable genus-specific detection in our method is particularly necessary in view
of CPXV is not a single OPV species, but a composite of several (up to 5) species [11, 12]. In
that case there is always a probability of occurrence of a new strain of CPXV, which will be able
to escape from ORF D8L CPXV-specific detection, but genus-specific detection will not allow to
miss such sample with subsequent characterization, for example, by sequencing.
References
1. Crouch, A.C., Baxby, D., McCracken, C.M., Gaskell, R.M., Bennett, M., 1995.
Serological evidence for the reservoir hosts of cowpox virus in British wildlife. Epidemiol. Infect.
115, 185-191.
2. Blackford, S., Roberts, D.L., Thomas, P.D., 1993. Cowpox infection causing a
generalized eruption in a patient with atopic dermatitis. Br. J. Dermatol. 129, 628-9.
3. Baxby, D., Bennett, M., Getty, B., 1994. Human cowpox 1969-93: a review based on 54
cases. Br. J. Dermatol. 131, 598-607.
4. Vorou, R.M., Papavassiliou, V.G., Pierroutsakos, I.N. 2008. Cowpox virus infection: an
emerging health threat. Curr. Opin. Infect. Dis. 21, 153-156.
5. Shchelkunov, S.N., Marennikova, S.S., Moyer, R.W., 2005. Orthopoxviruses pathogenic
for humans. Springer, New York.
6. Campe, H., Zimmermann, P., Glos, K., Bayer, M., Bergmann, H., Deweck, C., Graf, P.,
Weber, B.K., Meyer, H., Buttner, M., Busch, U., Sing, A., 2009. Cowpox virus transmission from
pet rats to humans, Germany. Emerg. Infect. Dis. 1, 777-780.
7. Carletti, F., Bordi, L., Castilletti, C., Di Caro, A., Falasca, L., Gioia, C., 2009. Cat-tohuman orthopoxvirus transmission northeastern Italy. Emerg. Infect. Dis. 15, 499-500.
138
8. Ninove, L., Domart, Y., Vervel, C., Voinot, C., Salez, N., Raoult, D., Meyer, H., Capek,
I., Zandotti, C., Charrel, R.N., 2009. Cowpox virus transmission from pet rats to humans, France.
Emerg. Infect. Dis. 15, 781-4.
9. Gavrilova, E.V., Shcherbakov, D.N., Maksyutov, R.A., Shchelkunov, S.N., 2010.
Development of real-time PCR assay for detection of cowpox virus. J. Clin. Virol. 49, 37-40.
10. Shchelkunov, S.N., Shcherbakov, D.N., Maksyutov, R.A., Gavrilova, E.V., 2011.
Species-specific identification of variola, monkeypox, cowpox, and vaccinia viruses by multiplex
real-time PCR assay. J. Virol. Methods. 175, 163-169.
11. Carroll, D.S., Emerson, G.L., Li, Y., Sammons, S., Olson, V., Frace, M., Nakazawa,
Y., Czerny, C.P., Tryland, M., Kolodziejek, J., Nowotny, N., Olsen-Rasmussen, M., Khristova,
M., Govil, D., Karem, K., Damon, I.K., Meyer, H., 2011. Chasing Jenner's vaccine: revisiting
cowpox virus classification. PLoS One. 6(8):e23086.
12. Duraffour, S., Mertens, B., Meyer, H., van den Oord, J.J., Mitera, T., Matthys, P.,
Snoeck, R., Andrei, G., 2013. Emergence of cowpox: study of the virulence of clinical strains and
evaluation of antivirals. PLoS One. 2013;8(2):e55808.
Table 1- Oligonucleotide primers and hybridization probes used in real-time PCR
Virus
OPV
Viral
ORF
F4L
Oligonucleotide name*
OPV_probe
OPV_forward
OPV_reverse
CPXV
CPXV
IC
D8L
Oligonucleotide sequence
FAM-5’TTCCGAATGAATGTTTTCAATGGCC-3’BHQ1
5’GATAGTTTTTTTCATTACTATCTTTAACAT3’
5’-GGCTAGATGTTTCTACGGATTTC-3’
JOE-5’AAGTCATCTACTACATAGACCATGATCAA
CCAA-3’-BHQ1
5’-GGTAGGTTCATGTTGGAAAATATC-3’
CPXV_D8L_forward
5’CPXV_D8L_reverse
AAGATGTTATTAGTGGTATTAGAGAGAAA
T-3’
D11L CPXV_D11L_probe
JOE-5’CCACAATCAGGATCTGTAAAGCGAGC-3’BHQ1
CPXV_D11L_forward
5’-AAAACTCTCCACTTTCCATCTTCT-3’
CPXV_D11L_forward_v.2 5’-GATCTTCTTTCAATGGTAGGATTATA-3’
CPXV_D11L_reverse
5’-GCATTCAGATACGGATACTGATTC-3’
-
CPXV_D8L_probe
Cy5-5’-TTGCTTGTCGTGCTCGTATCGTCC3’-BHQ3
5’-ATGTTCAAGCTGTTAATATCAATCTCGIC_forward
3’
5’-TTTGCCACTGAACCATTCTATCAT-3’
IC_reverse
* oligonucleotides used in the final multiplex real-time PCR assay are boldfaced
IC_probe
139
УДК 619:616.98:578.831.3:636.5:616-073
ВЫЯВЛЕНИЕ АНТИГЕНА МЕТАПНЕВМОВИРУСА ПТИЦ В
ТВЕРДОФАЗНОМ НЕПРЯМОМ «СЭНДВИЧ»-ВАРИАНТЕ
ИММУНОФЕРМЕНТНОГО АНАЛИЗА С ИСПОЛЬЗОВАНИЕМ
МОНОКЛОНАЛЬНЫХ АНТИТЕЛ
Никонова З. Б., к.б.н., ФГБУ «Федеральный центр охраны здоровья животных»
(ФГБУ «ВНИИЗЖ»), г. Владимир, Россия.
Ярославцева П. С., аспирант, ФГБУ «ВНИИЗЖ».
Волкова М. А., к.б.н., ФГБУ «ВНИИЗЖ».
Мудрак Н. С., д.б.н., ФГБУ «ВНИИЗЖ».
Резюме. Предложен непрямой твердофазный «сэндвич»-вариант ИФА с
использованием моноклональных антител для определения содержания антигена МПВ
птиц в культуральных препаратах. Предел обнаружения метода составил 4,0±0,3 lg
ТЦД50/мл.
Введение. Метапневмовирусная инфекция (МПВИ) птиц – респираторное
заболевание кур и индеек всех возрастов [1]. Возбудителем заболевания является
метапневмовирус (МПВ) птиц рода Metapneumovirus, семейства Paramyxoviridae.
Выделяют 4 подтипа вируса: A, B, C и D. В результате молекулярно-биологических
исследований, проведенных в ФГБУ «ВНИИЗЖ», в птицеводческих хозяйствах России и
стран ближнего зарубежья были выявлен вирус подтипов А и В [2].
Культивирование полевого МПВ птиц в различных культурах клеток является
перспективным направлением исследований, поскольку в дальнейшем они могут быть
использованы в составе вакцинных препаратов и диагностических наборов. В связи с этим
возникла необходимость в методе оценки содержания специфического вирусного антигена
в культуре клеток на основе твердофазного непрямого «сэндвич»-варианта
иммуноферментного анализа (с-ИФА).
Материалы и методы. Штаммы микроорганизмов. Использовали вакцинные
штаммы МПВ птиц подтипа А (#8544) и подтипа В (PL21, VCO3/50), выделенные от птиц
хозяйств России, а также полевые изоляты вируса подтипа В aMPV/B/02/2007,
aMPV/B/07/2008, aMPV/B/10/2008, aMPV/B/05/2009, aMPV/B/14/2009, aMPV/B/12/2010,
aMPV/B/22/2010, изолят aMPV-A подтипа А и вакцинный штамм PV03-В подтипа В из
коллекции ФГБУ «ВНИИЗЖ».
Культуры клеток. Культивирование и определение титра инфекционной активности
МПВ птиц проводили с использованием культур клеток фибробластов эмбрионов кур
(ФЭК) и почки зеленой мартышки Vero.
Сыворотки и пероксидазные конъюгаты антител. При постановке ИФА
использовали гипериммунные сыворотки крови кур, содержащие антитела к МПВ птиц
подтипов А и В (Istituto Zooprofilattico Sperimentale delle Venezie, Италия), и антитела козы
к иммуноглобулинам курицы («Synbiotics», США), конъюгированные с пероксидазой
хрена.
Моноклональные антитела. Моноклональных антитела 8D1, 11F1, 12D2, 13E2 в
составе асцитической жидкости. Гибридомы-продуценты мкАТ были получены совместно
с сотрудниками Московского научно-исследовательского института медицинской
экологии в 2009 г. с использованием вакцинного штамма PV03-B МПВ птиц подтипа В.
Твердофазный непрямой с-ИФА. Моноклональные антитела в рабочем разведении на
карбонатно-бикарбонатном буфере 0,05 М (рН 9,5-9,6) сорбировали в лунках
полистироловых планшетов в течение 18 ч при температуре 4°С. После блокирования 1%
140
раствором бычьего сывороточного альбумина (БСА) вносили двукратные разведения
исследуемого материала, затем детекторные антитела (гипериммунные сыворотки крови
кур с антителами к МПВ птиц) и на заключительном этапе – меченные пероксидазой хрена
антивидовые антитела. Для разведения специфических компонентов реакции использовали
буфер производства фирмы «Synbiotics» (США). На каждом этапе инкубацию проводили в
течение 1 ч при температуре 37°С. В качестве хромогена использовали 3,3',5,5'тетраметилбензидин. Результат учитывали, регистрируя ОП при длине волны 450 нм.
Титром антител или антигена считали последнее разведение, ОП которого было больше
или равно удвоенному среднему значению ОП отрицательного контроля.
Статистическая обработка результатов. Для статистической обработки
результатов определяли среднее арифметическое при количестве опытов (n) и стандартное
отклонение () среднего арифметического.
Результаты и обсуждение. С целью повышения специфичности реакции при
разработке непрямого с-ИФА в качестве улавливающих антител использовали
моноклональные антитела (мкАТ) к МПВ птиц. Из четырех мкАТ (8D1, 11F1, 12D2, 13E2)
необходимо было выбрать антитела, обеспечивающие специфическое связывание с
наибольшим количеством различных штаммов и изолятов МПВ птиц. Для сенсибилизации
планшетов использовали асцитические жидкости, содержащие мкАТ в разведении 1:2000.
Двукратные разведения испытуемых антигенов и отрицательных проб (супернатанты
нормальных культур клеток) вносили, начиная с разведения 1:2. В качестве детекторных
антител использовали гипериммунные сыворотки крови кур, содержащие антитела к МПВ
птиц, в разведении 1:5000. Результаты представлены в табл. 1.
Таблица 1- Результаты подбора мкАТ для использования в качестве улавливающих
антител в непрямом с-ИФА с различными антигенами МПВ птиц
Штамм / изолят
МПВ птиц
aMPV-A
#8544
PV03-B
PL21
VCO3/50
aMPV/B/02/2007
aMPV/B/07/2008
aMPV/B/10/2008
aMPV/B/05/2009
aMPV/B/14/2009
aMPV/B/12/2010
aMPV/B/22/2010
Подтип
вируса
А
А
В
В
В
В
В
В
В
В
В
В
8D1
отриц.
2±0
427±121
213±60
2±0
27±8
213±60
7±2
427±121
53±15
5±2
1024±0
Титр антигена в с-ИФА с мкАТ
11F1
12D2
13E2
отриц.
отриц.
64±0
5±2
2±0
213±60
85±30
213±60
171±60
32±0
107±30
43±15
53±15
2±0
53±15
213±60
53±15
128±0
128±0
107±30
171±60
27±8
7±2
43±15
43±15
213±60
213±60
7±2
64±0
53±15
43±15
отриц.
107±30
128±0
853±241
1024±0
Примечание: титр антигена в с-ИФА представлен как величина, обратная разведению
исследуемого образца.
Результаты показали, что мкАТ 13E2 связывались со всеми исследованными
антигенами МПВ птиц подтипов А и В, поэтому они были выбраны в качестве
улавливающих антител в с-ИФА.
141
Экспериментально было установлено, что при исследовании антигенов МПВ птиц
подтипов А и В в непрямом с-ИФА в качестве детекторных антител необходимо
использовать поликлональные сыворотки к вирусу того же подтипа.
Методом раститровки реагентов по блок-схеме были установлены рабочие
концентрации для улавливающих мкАТ (1:4000), детекторных антител (1:5000) и
антивидового конъюгата (1:500).
Специфичность метода непрямого с-ИФА проверяли с использованием
гетерологичных антигенов (вирусы инфекционного бронхита кур, ньюкаслской болезни,
инфекционного ларинготрахеита, инфекционной бурсальной болезни, болезни Марека,
реовирус, аденовирусы птиц серотипов 1-12, Mycoplasma gallisepticum, Mycoplasma
sinovia). Их активность в реакции не превышала фоновый уровень (реакция с нормальной
культурой клеток).
Чувствительность непрямого с-ИФА определяли с использованием культуральных
образцов МПВ птиц с известными титрами инфекционной активности. Значения
аналитической чувствительности метода в отношении различных штаммов и изолятов
МПВ птиц составляли в среднем 4,0±0,3 lg ТЦД50/мл (табл. 2). Все представленные пробы
были предварительно исследованы в ОТ-ПЦР и показали положительный результат.
Таблица 2- Результаты определения аналитической чувствительности непрямого сИФА
Титр
Титр
Чувствительность
Штамм / изолят Подтип Культура инфекционной
антигена непрямого с-ИФА
МПВ птиц
вируса клеток*
активности
в с-ИФА
(lg ТЦД50/мл)
(lg ТЦД50/мл)
#8544
А Vero
7,00±0,25
213±60
4,67
PV03-B
В Vero
5,38±0,13
32±0
3,87
VCO3/50
В Vero
5,63±0,13
27±8
4,19
PL21
В Vero
6,13±0,13
107±30
4,10
aMPV/B/02/2007
В Vero
6,25±0,25
213±60
3,92
aMPV/B/07/2008
В ФЭК
6,00±0,25
128±0
3,89
aMPV/B/05/2009
В Vero
6,13±0,38
213±60
3,80
aMPV/B/14/2009
В ФЭК
5,75±0,25
27±8
4,32
aMPV/B/12/2010
В ФЭК
5,88±0,13
128±0
3,77
aMPV/B/22/2010
В ФЭК
6,25±0,25
341±121
3,72
Примечания: титр антигена в с-ИФА представлен как величина, обратная разведению
исследуемого образца;
* – культура клеток, в которой был получен соответствующий штамм или изолят
вируса и определен титр его инфекционной активности.
Каждый образец антигенсодержащего материала исследовали в непрямом с-ИФА в
трех повторностях (на трёх различных планшетах). Отклонения в титрах не превышали
величину одного 2-кратного разведения, что свидетельствует о воспроизводимости
результатов разработанного метода.
Разработанный метод непрямого с-ИФА использовали для оценки качества
вируссодержащего сырья на различных этапах изготовления диагностических тест-систем.
Результаты исследования антигенной активности МПВ птиц в непрямом с-ИФА до и после
концентрирования представлены в табл. 3.
142
Таблица 3- Определение активности различных антигенов МПВ птиц в непрямом сИФА до и после концентрирования
Титр антигенной активности
Подтип
вируса
до концентрирования
после концентрирования
#8544
А
96±32
512±0
PV03-B
В
171±60
853±241
aMPV/B/02/2007
В
341±121
3413±956
Примечание: за титр в с-ИФА принималась величина, обратная разведению.
Антиген
Выводы. В результате проведенной работы показана возможность использования
непрямого твердофазного с-ИФА для определения содержания антигена МПВ птиц в
культуральных препаратах.
Список литературы
1. Cook J.K.A. Avian rhinotracheitis // Rev. Sci. Techn. Off. Intern. Epiz. – 2000. – Vol.
19, № 2. – P. 602-613.
2. Выявление метапневмовирусов птиц в Российской Федерации с помощью
молекулярно-биологических методов /З.Б. Хлебовец, Л.О. Щербакова, Д.Ю. Козлов, Н.С.
Мудрак, А.В. Борисов, В.В. Дрыгин //Сб. тр. V Междунар. вет. конгр. по птицеводству. –
М., 2009. – С. 114-118.
Resume. Indirect sandwich-ELISA were developed for detection of antigen aMPV in
culture using monoclonal antibodies. Sensitivity of the method was 4,0±0,3 lg TCID50/мл.
УДК 632.4
ИЗУЧЕНИЕ И АНАЛИЗ РАЗВИТИЯ РАЗЛИЧНЫХ ВИДОВ ФУЗАРИУМА
ТРИТИКАЛЕ IN VITRO ПОД ВЛИЯНИЕМ РЕГУЛЯТОРОВ РОСТА РАСТЕНИЙ
Осокина Н.В. аспирант, Калашникова Е.А. д.б.н. профессор
РГАУ-МСХА им. К.А.Тимирязева, г. Москва, Россия
В настоящее время основной целью селекционных программ является повышение
урожайности сельскохозяйственных культур, создание новых сортов и гибридов,
обладающих улучшенными качествами продукта, комплексной устойчивостью к болезням,
вредителям и стрессовым факторам среды. Для решения этих задач часто прибегают к
использованию химических средств, опасных для здоровья человека. Но все эти
мероприятия являются необходимыми,
пока не будут найдены безопасные
альтернативные пути. Особую значимость урожайность сельскохозяйственных культур
имеет в связи с ростом населения, который влечёт за собой увеличение потребности в
продуктах питания. Следовательно, необходимо искать способы его интенсивного
производства.
Зерновые культуры вносят наибольший вклад в обеспечение населения земного шара
продуктами питания. Среди этих культур особое место отводится амфидиплоиду
тритикале, который совмещает ценные качества родительских форм, и, в первую очередь,
продуктивность пшеницы и экологическую устойчивость ржи. Увеличение площадей
сельскохозяйственных культур и преобладание в посевах, в основном, одних и тех же
сортов способствуют широкому распространению у растений болезней, в частности,
143
вызываемых грибами, что приводит к недобору урожая и снижению качества
продукции[1]. В связи с этим проблема устойчивости растений к заражению грибами
является
актуальной и приобретает экономический, медико-токсикологический и
экологический аспекты.
Однако, несмотря на это, до сих пор болезни зерновых, особенно тритикале, слабо
изучены. Зерновые культуры являются трудным объектом для генной инженерии. Это
обусловлено, прежде всего, отсутствием векторных систем для введения генов в геном
клеток злаков. Наиболее эффективная векторная система на основе плазмид Agrobacterium
tumefaciens малопригодна для злаков. Поэтому наиболее эффективной мерой борьбы с
патогенами с экологической, практической и экономической точек зрения помимо
создания генетически устойчивых к разным видам патогенов сортов тритикале является и
использование регуляторов роста. По литературным данным, регуляторы роста в
определённой концентрации влияют на устойчивость к патогенам. Ответом на патоген
является повышение фенольных соединений растения. На тритикале практически нет
работ связанных с регуляторами роста, в этом заключается новизна работы.
Одной из самых распространенных и вредоносных болезней зерновых культур и
тритикале, вызываемых грибами, фузариоз. Возбудителями фузариоза являются грибы
рода Fusarium. Его проявление самое разнообразное: гниение семян в почве при
прорастании, что влечет за собой изреживание посевов, гниение прикорневой части
стебля, заражение семян микотоксинами, пустоколосье, снижение технологических
качеств семян при хранении и элементов продуктивности растений[2].
В качестве объекта исследований были выбраны грибы рода Fusarium: F. culmorum,
F. avenaceum, F. sporotrichoides, Fusarium oxysporum, которые являются основными
возбудителями фузариоза колоса. Размножение чистой культуру патогенов провдили на
безгормональной агаризованной питательной среде Мурасига и Скуга. Выращивали грибы
в условиях световой комнаты при температуре 250С, 16- часовом фотопериоде, при
интенсивности света 3000 лк. Пересадку осуществляли при необходимости в
установленные сроки.
В ходе работе проводится скрининг различных регуляторов роста (в пяти разных
концентрациях) на развитие грибов рода Fusarium. Планируется изучение влияния
регуляторов роста на развитие грибов в присутствии зерновки, изолированного зародыша
и каллуса, биохимические исследования и наблюдения за поведением гриба в присутствии
регуляторов in vivo.
Действие регуляторов роста и развития растений, как и фитогормонов, довольно
разнообразно. Одни повышают всхожесть и энергию прорастания семян или ускоряют
пробуждение глазков и спящих почек на клубнях и луковицах, другие - стимулируют рост
корней и, соответственно, обеспечивают хорошее укоренение рассады и лучшую
приживаемость саженцев, а при применении, например, гиббереллинов - улучшается
опыление цветков и уменьшается опадение завязей[3]. Есть и другая группа регуляторов
роста, которая повышает иммунитет растений к действию абиотических и биотических
факторов окружающей среды. К таким регуляторам роста относятся вещества,
обладающие комплексным действием - бережно защищают растения от стрессов на всех
этапах развития, повышают устойчивость к одному или нескольким заболеваниям,
ускоряют созревание плодов и семян, увеличивают урожайность, улучшают внешний вид,
качество продукции, а также ее хранение и лежкость[4]. Включение такого приема в
технологию возделывания зерновых культур, и в частности, тритикале, позволит
сохранить экологическое равновесие за счет применения пестицидов в меньших
количествах и концентрациях.
В работе были исследованы различные регуляторы роста, отличающиеся по своему
спектру действия: Черказ 1, Черказ 2, Иммуноцитофит, арахидоновая кислота на основе
морских водорослей. Исследуемые препараты испытывали в концентрациях 150 мг/л, 75
144
мг/л, 30 мг/л, 15 мг/л. Растворы регуляторов роста подвергали холодной стерилизации,
путем пропускания их через бактериальный фильтр с диаметром пор 0,45 мкм.
Полученный стерильный раствор добавляли в заранее проавтоклавированную
питательную среду.
Исследования показали, что различные регуляторы роста, а также их концентрации
оказывают различное действие на скорость роста и развитие гриба в условиях in vitro.
Кроме того, экспериментально было показано, что исследуемые регуляторы роста
оказывают специфическое воздействие на определённый вид гриба. Например, препарат
Черказ 1 оказал очень слабое ингибирующее действие на все грибы только в одной
концентрации - 75 мг/л. (F. culmorum, F. avenaceum, F. sporotrichoides, Fusarium
oxysporum) В остальных испытываемых вариантах он себя никак не проявил. В то время
как препарат Черказ 2 оказал существенное ингибирующее влияние в концентрации 150
мг/л, в особенности подавлялся рост и развитие культуры гриба вда Culmorum. В данном
варианте отмечалось снижение скорости развития практически в 2 раза.
Иммуноцитофит значительно ингибирует рост и развитие всех исследуемых
образцов в концентрации 75 мг/л. Было отмечено снижение интенсивности развития у
грибов в 2-3 раза. По сравнению с данными, полученными при наблюдении за развитием
фузариоза в присутствии предыдущих препаратов, результат так же отличается в
несколько раз.
Скрининг влияния арахидоновой кислоты показал, что в аналогичной концентрации
значительно подавлен рост грибов F. culmorum, F. avenaceum, F. Sporotrichoides в
несколько раз. Однако, на Fusarium oxysporum оказывает положительное влияние в любой
концентрации. Гриб именно этого вида прекрасно растёт и развивается в присутствии
арахидоновой кислоты на основе морских водорослей.
Тем не менее, полученные данные говорят о том, что регуляторы роста растений
могут оказывать на развитие фузариума ингибирующее действие. Возможно, это позволит
хотя бы частично отказаться от применения вредоносных фунгицидов. Необходимо
продолжить исследования в данной области и эмперическим методом подобрать
оптимальную концентрацию препаратов, что позволит использовать регуляторы роста
сразу по нескольким направленностям функций.
Таким образом, на сегодняшний день изучение данной проблемы является
актуальным направлением исследований, которое имеет, несомненно, большую
практическую значимость, так как большие площади посевов зерновых культур страдают
именно от фузариоза. Применение химических фунгицидов с одной стороны приносит
пользу сельскому хозяйству, с другой стороны наносит вред экологической обстановке и
здоровью человека. Использование же регуляторов роста для борьбы с вредоносными
грибными заболеваниями поможет решить сразу несколько проблем: 1) снижение
фунгицидной и пестицидной нагрузки на растение и почву; 2) стимулирование роста и
развитие самого растения; 3) повышение урожайности культур. Поэтому исследования в
данной области необходимо продолжать и развивать, чтобы химические препараты
перестали быть неотъемлемой частью хорошего урожая зерновых культур.
Список литературы
1. Васильченко С.А. Исследование тритикале для переработки в хлебопекарную
муку. -М.: Наука,2005- 60с.
2. Степанова М.Б. Род Фузариум (Fusarium) // Мир растений: в 7 томах. — М.:
Просвещение, 1991. — 400 c.
3. Радцева Г.Е. Физиологические аспекты действия химических регуляторов роста
растений. – М.: Колос. – 1982.
4. Шаповал О.А., ВакуленкоВ.В., Прусакова Л.Д., Можарова И.Д. Регуляторы роста
растений в практике сельского хозяйства. - М.:2009. 130с.
145
Abstract. Today to combat fungal diseases agriculturally important crops are widely used
chemicals. They are harmful to human health. In certain concentrations, plant growth regulators
are capable of inhibiting the development of the fungus, an alternative solution. The paper
analyzes the influence of growth regulators on the development of Fusarium triticale.
УДК 633.16: 632.26: 632.938.1
УСТОЙЧИВОСТЬ СОРТОВ ЯЧМЕНЯ К ВОЗБУДИТЕЛЯМ ПЯТНИСТОСТЕЙ
ЛИСТЬЕВ В КАЗАХСТАНЕ
Рсалиев А.С., Амирханова Н.Т., Агабаева А.Ч., Омарова Г.Х.,
Асраубаева А.М., Байгутов М.Ж.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. В данной статье представлены результаты изучения районированных,
перспективных и коллекционных сортов ячменя по устойчивости к возбудителям
ринхоспориоза (Rhynchosporium secalis (Oud.) J.J. Davis), темно-бурой (Cochliobolus
sativus Drechs. ex Dastur) и сетчатой (Pyrenophora teres f. sp. teres Drechsler.) пятнистости.
Установлено, что большинство изученных отечественных сортов ячменя не обладает
групповой устойчивостью к возбудителям пятнистостей листьев. По результатам
фитопатологических исследований отобраны доноры комплексной устойчивости ячменя к
трем болезням: Азык, Акжол, Jazmin/Cardo//Tocte, Stipa/Chinia, Cerrazja/Congona,
Lino/Rmro//Jugl/3/Prtl и Jazmin/Cabuya/3/Chamico. Выявленные источники и доноры
устойчивости к возбудителям пятнистостей листьев рекомендуются для включения в
селекционные программы при выведении новых болезнеустойчивых сортов ячменя к
ринхоспориозу, темно-бурой и сетчатой пятнистости.
Введение. Ячмень (Hordeum vulgare L.) – универсальная культура по
распространению и по использованию в сельскохозяйственном производстве. Посевы
ячменя, по данным ФАО (Продовольственная и сельскохозяйственная организация ООН),
в мировом земледелии составляют около 80 млн. га, что определяет четвертое место
ячменя после пшеницы, риса и кукурузы. Мировое производство зерна ячменя составляет
более 160 млн. тонн в год [1, 2]. Значение ячменя в народном хозяйстве велико и
разнообразно. Зерно ячменя – отличный концентрированный корм, а солома и мякина
используются в качестве грубого корма или силоса. Велико значение этой культуры в
пивоваренной промышленности, где ячмень является основным сырьем [3, 4]. Широко
применяется ячмень в пищевой промышленности. Ячменные солодовые вытяжки находят
очень широкое техническое, пищевое, диетическое и лечебное применение [5].
Казахстан является основным производителем зерно кормового и пивоваренного
ячменя среди республик Средней Азии и Закавказья. За последние годы, в связи с
активным развитием животноводства и перерабатывающей промышленности, в Казахстане
резко повысился спрос на зерно ячменя. В этой связи в республике с каждым годом
увеличиваются посевные площади под этой культурой. Кроме того, на зерно ячменя
поступает большой спрос из зарубежных стран (Иран, Турция, ОАЭ и др.) [6]. По данным
Государственного реестра селекционных достижений Республики Казахстан, в настоящее
время допущены к использованию в различных регионах страны 54 сорта ячменя [7].
146
Важным резервом повышения урожая ячменя является борьба с болезнями, а также
создание и внедрение в производство сортов, устойчивых к инфекционным заболеваниям.
Так, как лимитирующими факторами получения высоких урожаев и высокого качества
зерна ячменя повсеместно являются вредоносные болезни. К настоящему времени на
ячмене зарегистрировано 34 болезни, которые вызываются более чем 50 видами патогенов
[8]. Анализ литературных данных и результатов собственных мониторинговых
исследований показывает, что в Казахстане основное значение среди наиболее опасных и
распространенных
болезней
ячменя
имеют пятнистости листьев,
вызываемые
гемибиотрофными грибами: ринхоспориоз (Rhynchosporium secalis (Oud.) J.J. Davis),
сетчатая (Pyrenophora teres f. sp. teres Drechsler.) и темно-бурая (Cochliobolus
sativus Drechs. ex Dastur) пятнистости [9-11]. Потери урожая ячменя от этих болезней в
период эпифитотий могут составлять от 20 до 40%. При этом вредоносность болезней
состоит не только в прямых потерях урожая из-за сниженного фотосинтеза растений, но и
в снижении качества зерна [12]. Ухудшение выполненности зерна, вследствие поражения
растений возбудителями пятнистостей листьев сопровождается ростом количества белка и,
соответственно, понижением его экстрактивности [13].
Несмотря на то что, для защиты растений от патогенов во многих странах
эффективно используют фунгициды, самым радикальным, экономически выгодным и
экологически безопасным способом борьбы с этими болезнями является создание
устойчивых сортов. Успех селекционной работы по созданию устойчивых к болезням
сортов базируется на знаниях патогенности и вредоносности каждого патогена, наличия
эффективных доноров и источников устойчивости. Эти вопросы оставались
малоизученными в Казахстане, следовательно, сведения о донорах групповой
устойчивости ячменя к перечисленным болезням в литературе отсутствуют.
В связи с этим нами на искусственном инфекционном фоне проведены лабораторная
оценка устойчивости к возбудителям пятнистостей листьев сортов ячменя различного
эколого-географического происхождения и определение наиболее устойчивых форм для
практической селекции.
Материалы и методы исследований. В исследовании использовали коллекционные
образцы, полученные из Международного центра улучшения кукурузы и пшеницы
(СИММИТ, Мексика), а также районированные и перспективные сорта ячменя в
Казахстане. В качестве инфекционного материала использованы пораженные вегетативные
органы ячменя, собранные в ходе мониторинга в различных регионах страны.
Для получения инокулюма пораженные образцы (отрезки листьев) промывали
дистиллированной водой, измельчали на части (2-3 см), помещали в сосуды и оставляли на
2-3 ч для выхода спор из пикнид. Затем массу встряхивали, перемешивали в течение 10-15
мин, фильтровали через марлю и определяли титр в камере Горяева. Далее опытных
растений в теплице опрыскивали конидиальной суспензией концентрацией 5000 спор/мкл
с добавлением 10 мл 0,0001%-ного раствора Твина 80. После инокуляции растения
накрывали полиэтиленовой пленкой на 14-16 час. Реакцию растений на заражение
учитывали на 6-8 сутки после инокуляции по соответствующей методике [14]. При этом 0
балл относится к иммунному типу, 1-2 балла – устойчивому, а 3-4 балла –
восприимчивому типу. Интенсивность поражения растений или степень развития
инфекции определена по модифицированной шкале Кобба (шкала R.F.Peterson,
A.B.Campbell, A.E.Hannah) [15].
Результаты исследований. Результаты лабораторных исследований показали, что
большинство изученных районированных и перспективных сортов ячменя не обладает
групповой устойчивостью к возбудителям пятнистостей листьев. В основном они
характеризуются как восприимчивые и высоко восприимчивые в период проростков.
147
Среди изученных болезней ячменя, ринхоспориоз или окаймленная пятнистость является
наиболее агрессивным заболеванием на ранних этапах онтогенеза растений. При
заражении с данным патогенам у многих сортов ячменя отмечены темно-коричневые
пятна до 1,0 мм, также наблюдалось хлороз до 2-3 мм, что характерно для восприимчивых
растений. При этом у них тип инфекции колебался в пределах 3-4 балла, с интенсивностью
поражения растений 10-50%. Среди изученных сортов ячменя только два сорта Азык и
Акжол показали высокую устойчивость к ринхоспориозу. Следует отметить, что
окаймленная пятнистость на ячмене распространена в основном южном и юго-восточном
регионах, где климатические условия благоприятны для возбудителя [10].
Таблица 1 – Проростковая устойчивость районированных и перспективных сортов
ярового ячменя к возбудителям пятнистостей листьев
Год
Сетчатая
Темно-бурая
Посевная Ринхоспориоз
допуска к
пятнистость пятнистость
Название
площадь,
использова
га [16]
балл
%
балл
%
балл
%
нию [7]
Ак жол
2006
48600
0
0
0
0
0
0
Арна
1997
149600
4
10
3
40
0
0
Асем
2000
3400
4
40
4
50
0
0
Жулдыз
1993
2500
3
30
2
20
2
10
Одесский 100
1985
35900
4
30
2
25
3
40
Север 1
2001
2100
3
40
1
10
2
15
Сауле
1991
3000
4
50
1
10
0
0
Туран 2
2005
500
3
30
2
20
1
10
Азык
-*
-*
0
0
0
0
2
15
Бота
2
20
2
20
2
15
Илек 2
3
40
2
15
0
0
Мереке 150
4
30
0
0
3
40
Целинный 93
4
50
1
10
0
0
Яссы
4
50
1
10
0
0
Шынар
3
40
1
10
0
0
ДН 26
2
25
2
20
0
0
Юбилейный 100 4
50
1
10
0
0
*- не допущенные сорта к возделыванию на территории Республики Казахстан
Как видно из таблицы 1, по устойчивости к сетчатой пятнистости отличились сорта
Акжол, Север 1, Сауле, Азык, Мереке 150, Целинный 93, Яссы, Шынар и Юбилейный
100, у которых в период проростков отмечен минимальный тип инфекции в 0-1 балла, а
степень развития болезни не превышала 10%. Однако широко возделываемые сорта
ярового ячменя пивоваренного направления Асем (посевная площадь 3400 га) и Арна
(посевная площадь 149600 га) показали сильную восприимчивость к патогену.
Исследуемые сорта ячменя отчетливо различались по устойчивости к темно-бурой
пятнистости. Наиболее сильное поражение возбудителем B. sorokiniana Sacc. наблюдалось
на сортах Мереке 150 и Одесский 100 (3/40). Сорта Азык, Бота, Жулдыз и Север 1
проявили среднюю устойчивость (2/10-15). Остальные сорта поражались в слабой степени.
Таким образом, среди изученных районированных и перспективных сортов ячменя
только два сорта показали устойчивую реакцию ко всем изученным гемибиотрофным
патогенам, один из них широко районированный сорт в Казахстане Акжол, а второй
148
перспективный сорт Азык. Однако по литературным данным семена сортов Азык и Асем
поражаются альтернарией, фузариумом и пинициллиумом [17].
Результаты опыта подтверждают о необходимости поиска новых источников
устойчивости к возбудителям пятнистостей листьев ячменя. В этом плане важное значение
приобретает коллекция ячменя, сосредоточенная в генофонде Научно-исследовательского
института проблем биологической безопасности (НИИПББ). В связи с этим нами изучены
коллекционные образцы, отобранные из следующих питомников СИММИТ (таблица 2):
 IBYT – International Barley Yield Trial (Международное испытание ячменя по
урожайности);
 IBON – International Barley Observation Nursery (Международный питомник
наблюдения ячменя);
 HBSN – Hull-led Barley Screening Nursery (Питомник отбора голозерного ячменя).
Таблица 2 – Иммунологическая характеристика коллекционных образцов ярового
ячменя по устойчивости к возбудителям пятнистостей листьев
Сетчатая Темно-бурая
пятнистость пятнистость
балл
%
балл
%
балл
%
Steploe 1
24IBYT
2
20
3
40
0
0
P.Sto/3/Lbiran/Una80…
24IBYT
3
30
2
25
1
10
Tocte/Tumbo//Shyri
29IBON
3
40
3
40
0
0
Alleli/Roland-Bar/Kc-B
29IBON
3
40
3
30
0
0
Hb855/467/Alpha-Bar…
29IBON
3
30
1
10
0
0
Jazmin/Cardo//Tocte
29IBON
1
10
1
5
0
0
Stipa/Chinia
11HBSN
1
5
1
10
0
0
Cerrazja/Congona
11HBSN
0
0
0
0
0
0
Aloe/Titiribi//Delo
11HBSN
3
35
3
40
0
0
Lino/Rmro//Jugl/3/Prtl
11HBSN
1
5
0
0
0
0
Nd155.77//Matnan/Eh165…
11HBSN
3
40
2
20
2
20
M9878/Cardo//Quina/3/…
30IBON
1
10
3
40
0
0
Bllu/4/Armelle/Cloria…
30IBON
3
30
2
25
0
0
Cardo/Quibenras/3/…
30IBON
3
40
3
30
0
0
Canela/3/Matico/Jet//…
30IBON
3
45
0
0
0
0
Zva/Petunia1/3/Chamico
11EMDSN
3
30
3
40
0
0
Jazmin/Cabuya/3/Chamico
12HBSN
0
0
1
5
0
0
Mja/Cerraja/Cloria-Bar/Come-B 12HBSN
3
40
0
0
3
40
Petunia 1/5/Post/Copal//…
12HBSN
3
30
3
40
0
0
6/98-20
КазНИИЗиР
1
10
0
0
0
0
59/87-30
КазНИИЗиР
2
15
1
5
0
0
3/95-12
КазНИИЗиР
2
25
2
20
0
0
В результате исследований были выделены образцы, устойчивые и восприимчивые
ко всем трем болезням, а также устойчивые к двум и одной из них. Так, поражение в
сильной степени ринхоспориозом и сетчатой пятнистости отмечено у образцов
Tocte/Tumbo//Shyri,
Alleli/Roland-Bar/Kc-B,
Aloe/Titiribi//Delo,
Cardo/Quibenras/3/,
Zva/Petunia1/3/Chamico и Petunia 1/5/Post/Copal. Однако коллекционные образцы проявили
ювенильную устойчивость к темно-бурой пятнистости. Только два образца
Lino/Rmro//Jugl/3/Prtl и Mja/Cerraja/Cloria-Bar/Come-B были восприимчивыми к данной
Название образцов
Название
питомника
149
Ринхоспориоз
инфекции. Не исключено, что темно-бурая пятнистость является более распространенной в
Казахстане, чем другие возбудители пятнистости листьев ячменя. В этом плане
устойчивые коллекционные образцы ячменя представляют большой интерес для
отечественной селекции. Среди зарубежных образцов Jazmin/Cardo//Tocte, Stipa/Chinia,
Cerrazja/Congona, Lino/Rmro//Jugl/3/Prtl, Jazmin/Cabuya/3/Chamico и 6/98-20 показали
комплексную устойчивость к возбудителям пятнистостей листьев ячменя. Многие
вышеперечисленные устойчивые формы были выделены из питомника отбора голозерного
ячменя (HBSN).
Известно, что среди зерновых культур при использовании их в кормовом
направлении наиболее ценными считаются те, которые содержат в зерне большое
количество легко усвояемого белка. По литературным данным голозерные сорта ячменя
наряду с устойчивостью к ряду заболеваний дают хороший урожай и высокое качество
зерна, а также являются засухоустойчивыми и устойчивыми к полеганию, то есть сочетают
в себе трудно совместимые признаки [18]. Кроме того, в пределах культурных ячменей,
голозерная группа превышает пленчатые по содержанию белка на 1,0-4,0%. Наряду с
высоким содержанием белка эта группа ячменей имеет повышенное содержание лизина и
натуру зерна, повышенную массу 1000 зерен и отсутствие пленок [19]. Указанные качества
ставят голозерные ячмени в категорию лучших сортов, как для кормовых целей, так и для
приготовления круп.
Выводы. Результаты лабораторных исследований показали, что устойчивость сортов
ячменя к возбудителям пятнистостей листьев зависит от сортовых особенностей культуры
и видового состава инфекций. Среди отечественного селекционного материала ячменя
только два сорта Азык и Акжол показали высокую устойчивость ко всем изученным
патогенам. Зарубежные голозерные образцы ячменя Jazmin/Cardo//Tocte, Stipa/Chinia,
Cerrazja/Congona, Lino/Rmro//Jugl/3/Prtl и Jazmin/Cabuya/3/Chamico проявили комплексную
устойчивость к листовым инфекциям. Следовательно, их можно использовать в
отечественной селекции при создании новых сортов ячменя, устойчивых к возбудителям
пятнистостей листьев. Полученные результаты исследований могут внести вклад в
решение проблемы повышения продовольственной безопасности и, соответственно, иметь
экономический и экологический эффекты.
Список литературы
1. Филиппов Е. Г. Селекция высокопродуктивных сортов озимого и ярового ячменя.
// Сборник трудов международной научно- практической конференции «Современные
принципы и методы селекции ячменя». – Краснодар, 2007. – С.63-66.
2. Щенникова И. Н. Изучение и создание исходного материала для селекции ячменя
на устойчивость к кислым почвам. // дисс. … канд. с.-х. наук. – Киров, 2002. – 152 с.
3. Глуховцев В.В. Об основных параметрах моделей сортов ярового ячменя и их
использование в селекции различных идиотипов для Среднего Поволжья. // С.-х .
биология. – 1996. – №1 . – С.41-45.
4. Родина H.A. Проблемы селекции ячменя на устойчивость к неблагоприятным
факторам. // Вестник РАСХН. – 1995. – №3. – С.11-14.
5. Мартьянова А.И. Качество и питательная ценность зерна разных культур. //
Зерновое хозяйство. – 2000. – №6. – C.28-31.
6. Каталог сортов зернофуражных культур (ячмень, овес) селекции ТОО «Казахского
НИИ земледелия и растениеводства». – Алмалыбак, 2011. – 21 с.
7. Государственный
реестр селекционных достижений
допущенных к
использованию в Республике Казахстан. – Астана, 2011. – 244 с.
8. Афанасенко О.С. Диагностика пятнистостей ячменя. // Школа по систематике
грибов-возбудителей болезней растений. – Санкт-Петербург, 2011. – 39 с.
150
9. Рсалиев А.С., Тилеубаева Ж.С., Агабаева А.Ч. Фитопатологический мониторинг
особо опасных болезней зерновых культур в Казахстане. // Сборник материалов науч.практ. конф. молод. учен. «Актуальные проблемы и перспективы биологической
безопасности», посвящ. дню образов. НИИПББ. – Алматы: Асыл-кітап, 2012. – С. 134-140.
10. Койшибаев М. Болезни зерновых культур. – Алматы: Бастау. 2002. – 367 с.
11. Бекежанова М.М., Кочоров А.С. Қазақстанның оңтүстік және оңтүстік-шығыс
аймақтарында арпаның жапырақ ауруларының таралуы. // Сборник научных трудов II-ой
Меж. науч. конф. молод. учен. Актуальные проблемы и перспективы защиты и карантина
растений. – Алматы-Рахат. 2012. – С.70-72.
12. Анисимова А.В. Характеристика генетического разнообразия ячменя по
устойчивости к возбудителям пятнистостей листьев и создание исходного материала для
селекции. // Дис. ... канд. биол. наук: 06.01.11. – Санкт-Петербург, 2006. – 269 с.
13. Мироненко Н.В., Афанасенко О.С., Филатова О.А., Копаньке Д. Генетический
анализ вирулентности возбудителя сетчатой пятнистости ячменя гриба Pyrenophora teres //
Методические основы селекции зерновых культур и картофеля на устойчивость к
болезням. – Санкт-Петербург, 2005. – С.41-54.
14. Изучение генетических ресурсов зерновых культур по устойчивости к вредным
организмам. Методическое пособие. / Под ред. Е.Е. Радченко. – Москва:
Россельхозакадемия, 2008. – С.112-142.
15. Peterson R.F., Campbell A.B., Hannah A.E. A diagrammatic scale for estimating rust
intensity on leaves and stems of cereals. // Canad. J. Res. – 1948. – V.26 – P.496-500.
16. Агентство Республики Казахстан по статистике / Итоги первой национальной
сельскохозяйственной переписи 2006-2007 гг. Зерновые и зернобобые культуры. – Астана,
2008. – Том 3. – 235 с.
17. Тохетова Л.А., Омарбаева К. Селекция ячменя на устойчивость к фузариозной
корневой гнили в условиях рисовых систем. // Агро ХХI. – 2009. №4-6. – С. 27-28.
18. Аниськов Н.И. Урожайность и качество голозерных сортов ячменя в Западной
Сибири. // Аграрный вестник Юго-Востока. – 2010. № 2 (5). – С.6-9.
19. Аниськов Н.И., Калашник Н.А., Козлова Г.Я., Поползухин П.В. Голозерный
ячмень в Западной Сибири. – Омск, 2007. – 160 с.
Түйін. Мақалада ринхоспориоз (Rhynchosporium secalis (Oud.) J.J. Davis), қара-қоңыр
дақ (Cochliobolus sativus Drechs. ex Dastur) және теңбіл дақ (Pyrenophora teres f. sp. teres
Drechsler.) қоздырғыштарына арпаның аудандастырылған, болашағы бар және
коллекциялық сорт-үлгілерінің төзімділігі туралы нәтижелер көрсетілді. Нәтижесінде,
отандық селекциялық материалдар арасынан арпаның екі сорты (Азық, Ақжол) ғана
зерттелінген патогендердің барлығына жоғары төзімділік танытты. Сонымен қатар, шет
елдің Jazmin/Cardo//Tocte, Stipa/Chinia, Cerrazja/Congona, Lino/Rmro//Jugl/3/Prtl және
Jazmin/Cabuya/3/Chamico үлгілері жапырақ дағы қоздырғыштарынан кешенді қорғана
білді.
Summary. Results of studying of the zoning, perspective and collection sorts of barley on
resistance to rhynchosporiosa agents (Rhynchosporium secalis (Oud.) J.J. Davis), dark-brown
spot (Cochliobolus sativus Drechs. ex Dastur) and reticular spot (Pyrenophora teres f. sp. teres
Drechsler) are presented. It has been demonstrated that among a domestic selection material of
barley only two sorts Azyk and Akzhol were showed a high resistance to all studied pathogens.
And also foreign bare-grained samples of barley (Jazmin/Cardo//Tocte, Stipa/Chinia,
Cerrazja/Congona, Lino/Rmro//Jugl/3/Prtl and Jazmin/Cabuya/3/Chamico) were showed
complex resistance to spot agents of leaves.
151
УДК 616-002.-5: 614.2
МУТАЦИЯ ГЕНА katG ИЗОЛЯТОВ M.TUBERCULOSIS,
ВЫДЕЛЕННЫХ В РЕСПУБЛИКЕ КАЗАХСТАН
Садикалиева С.О., Султанкулова К.Т. к.б.н., Строчков В.М., Тасыбаева А.С., Шыныбекова
Г.О., Өсербай М.А., Сандыбаев Н.Т. к.б.н., Сансызбай А.Р. к.в.н., профессор
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. В данной работе представлена молекулярно-биологическая характеристика
клинических изолятов M. tuberculosis, выделенных в Республике Казахстан.
Определена нуклеотидная последовательность гена katG, определяющая
лекарственную устойчивость к препарату - изониазиду. Было выявлено, что казахстанские
изоляты M. tuberculosis имеют мутацию AGC→ACC в гене, что соответствует
аминокислотной замене S315T. Это свидетельствует о мутации гена katG в 315 кодоне.
Введение.
Туберкулез
–
хроническое
инфекционное
заболевание,
характеризующееся поражением органов дыхания, костно-суставного аппарата, кожи, глаз,
мочеполовых и некоторых других органов и систем. Широкое распространение
туберкулезной инфекции в мире, большое количество случаев эпидемиологически
опасных активных форм, высокий уровень смертности делают ее одной из актуальнейших
проблем современной медицины и здравоохранения [1].
Эпидемиологическая
ситуация по туберкулезу в Республике Казахстан сохраняется крайне напряженной.
Отмечается четко выраженная тенденция к росту частоты случаев туберкулеза с
множественной лекарственной устойчивостью как среди повторных случаев, так и среди
впервые выявленных больных туберкулезом, что связано с расширенным охватом
пациентов тестом на лекарственную чувствительность. В настоящее время в Казахстане
насчитывается более 8000 больных, страдающих мультирезистентной формой заболевания
[2,3]
Рост популяции лиц с ослабленным иммунитетом (в том числе ВИЧинфицированных) хотя и увеличил опасность туберкулезной инфекции, однако полностью
объяснить ситуацию не может. Особую и весьма значительную роль в обострении
ситуации с туберкулезом играет появление и все большее распространение штаммов
микобактерий,
одновременно
устойчивые
почти
ко
всем
современным
противотуберкулезным препаратам, используемым в клинике [4-6]. Тем самым опасность
развития туберкулезной инфекции усиливается за счет явлений, происходящих и в клетках
организма - хозяина, и в клетках возбудителя.
Установлено, что устойчивость M. tuberculosis к рефампицину и изониазиду
обусловлена мутациями в генах, продукты которых являются мишенями для лекарств или
участвуют в их активации. Например, около половины изониазид - устойчивых изолятов
M.tuberculosis содержат мутацию (аргинин в лейцин) в 315 кодоне гена katG, что приводит
к потере активности интермедиатов изониазида [7].
Целью настоящей работы было охарактеризовать мутацию в гене katG в штаммах
M.tuberculosis, выделенных в Республике Казахстан.
Материалы и методы. Объектом для исследований являлись изоляты М. tuberculosis
под номерами 10047, 1089, 1200, 1043, 938, 35, 7585, 371, 768, 3212, доставленные из РГКП
«Национального центра проблем туберкулеза Республики Казахстан», г. Алматы.
Выделение ДНК. Выделение ДНК проводили с использованием набора "PrepMan
Ultra Sample Preparation Reagent" фирмы Applied Biosystems, согласно протоколу
производителя.
152
Наработка участка гена katG. Наработку специфического участка katG исследуемых
изолятов М. tuberculosis проводили с помощью ПЦР анализа с использованием набора
AccuPrime Taq DNA Polymerase High Fidelity, фирмы Invitrogen. Были использованы
праймеры с нуклеотидной последовательностью FP: 5/-CATGAACGACGTCGAAACAG-3/,
RP: 5/- CGAGGAAACTGTTGTCCCAT-3/, размер получаемого продукта 232 п.о. [8]. При
амплификации смесь ПЦР содержал: 5 мкл 10х буфера, 1 мкл dNTP, по 1 мкл 10 пмоль
праймера, 0.5 мкл Taq DNA polymerase и по 2 мкл исследуемых ДНК образцов. Начальная
денатурация прошла при 95°С в течение 5 минут, после 30 циклов денатурации при 94°С в
течение 1 мин, отжиг при температуре 55°С в течение 1 мин и репликация при 72°С в
течение 2 мин. Пост-репликация ПЦР прошла при 72°С в течение 10 мин.
Электрофорез ДНК в 2% агарозном геле проводили, используя ТВЕ буфер,
содержащий 1 мкл/мл бромистого этидия. Использовали аппарат для электрофореза
нуклеиновых кислот G-100, Pharmacia.
Секвенирование. Секвенирование ДНК проводили методом дидеоксисеквенирования
с использованием терминирующих дидеоксинуклеотидов (метод Сенгера) на
автоматическом 16-капиллярном секвенаторе GeneticAnalyser 3130 xl, AppliedBiosystems.
Результаты исследований. Развитие молекулярно - биологических методов открыло
новые перспективы для быстрого определения чувствительности M. tuberculosis к
противотуберкулезным препаратам, основано на амплификации с использованием
полимеразной цепной реакции (ПЦР) специфических участков генов, кодирующих
мишени лекарственных веществ, с определением мутаций, связанных с возникновением
устойчивости. На сегодняшний день существует множество различных методов
определения мутаций в генах M. tuberculosis, но основным и наиболее точным является
метод секвенирования ампликонов с последующим анализом нуклеотидных
последовательностей [9].
С целью определения мутаций в гене проводили наработку специфического участка
KatG.
Данные электрофореза наработанных ПЦР - продуктов представлены на рисунке 1.
М – Маркер, 50 bp, Invitrogen; 1 - №1004; 2 - №1089; 3 - №1200; 4 - №1043; 5 - №938;
6 - №35; 7 - №7585; 8 - №371; 9 - №768; 10 - №3213;
Рисунок 1 - Электрофоретический анализ ПЦР - продуктов
Как видно из рисунка 1, наработаны ПЦР продукты размером 232 п.о. во всех
исследуемых изолятах.
Для определения мутаций в полученных генах проводили прямое секвенирование
ПЦР - продуктов.
153
В результате секвенирования и сравнительного анализа 10 казахстанских изолятов,
было выявлено, что нуклеотидные последовательности гена katG, имеет 100% сходство
для всех изолятов.
Результаты сравнительного анализа гена katG с международным банком генов
GenBank представлены на рисунках 2 и 3.
Рисунок 2 - Сравнительный анализ нуклеотидных последовательностей гена katG с
международной базой GenBank
Рисунок 3 - Локализация нуклеотидной замены в гене katG
Как видно из данных рисунка 3, казахстанские изоляты имеют мутацию AGC→ACC,
что соответствует аминокислотной замене S315T.
Все исследуемые нами пробы казахстанских штаммов имели устойчивость к
изониазиду, которая была выявлена молекулярно-биологическими методами.
Изониазид является одним из наиболее действенных противотуберкулезные препараты
первого ряда, обладает эксклюзивной активностью в отношении M. Tuberculosis, основанной на
подавлении синтеза миколовых кислот - одного из основных компонентов стенки
микобактериальной клетки. Для проявления антибактериальной активности молекула
154
препарата должна быть активирована внутри микробной клетки, однако химическая
структура активной формы изониазида окончательно не выявлена. Активация происходит
под действием фермента каталазы - пероксидазы (ген katG). Мутации в этом гене (обычно
в положении 315), приводящие к снижению активности фермента на 50%, обнаруживают
приблизительно у половины изониазидорезистентных штаммов микобактерий. Для борьбы
с данной формой заболевания требуются особые, в большинстве случае весьма токсичные
препараты, вызывающие серьезные побочные эффекты [7].
В настоящее время в геноме M. Tuberculosis идентифицировано четыре основных гена,
мутации в которых приводят к изменениям ряда метаболических процессов, определяющих
развитие резистентности M. Tuberculosis к изониазиду.
Тип и частота встречаемости определенных мутаций в данных генах достаточно
стабильны среди микобактериальных штаммов, распространенных в различных
географических районах. В тоже время в ряде исследований была отмечена и
определенная географическая вариабельность таких мутаций [10].
По различным литературным данным, 60-96% всех изониазид - устойчивых изолятов
M. Tuberculosis имеют мутацию в 315 кодоне гена katG, которая имеется и во всех
исследованных изолятах, выделенные в Республике Казахстан.
Выводы.
Нами изучена молекулярно - биологическая характеристика
клинических изолятов M. tuberculosis, выделенных в Республике Казахстан.
Определена нуклеотидная последовательность гена - мишеня, определяющая
лекарственную устойчивость к препарату - изониазиду. Было выявлено, что казахстанские
штаммы имеют мутацию AGC→ACC, что соответствует аминокислотной замене S315T,
что свидетельствует о мутации гена katG в 315 кодоне.
Список литературы
1. Аксенова В. А., Леви Д. Т., Фонина Е. В. Вакцинопрофилактика туберкулеза:
значение и проблемы // Проблемы туберкулеза и болезней легких. - 2009. - № 1. - С. 10 16.
2. World Healh Organization. Global tuberculosis control - surveillance, planning,
financing WHO report 2011 // www.who.int/tb/challenges.
3. Рахматулин О. А. Анализ заболеваемости туберкулезом в Республике Казахстан //
Проблемы туберкулеза и болезни легких. - 2009. - № 4. - С. 38 – 44.
4. Альтшулер М. Л., Генерозов Э. В., Черноусова Л. Н., Говорун В. М. // Бюлл.
эксперим. биологии. - 1999. - № 11. - С. 555 - 558.
5. Cole S. Т. Mycobacterium tuberculosis: drug-resistance mechanisms // Trends
Microbiol. - 1994. - V.2, N 10. - P. 411 - 416.
6. Davies J. Antibiotic resistance in mycobacteria // Genetics and tuberculosis, John Wiley
and Suns. - 1998. Р. 195-205.
7. Michailovich V., Lapa S., Grydunov D. et al. Identification of Rifampin - Resistant
Mycobacterium tuberculosis Strains by Hybridization, PCR and Ligase Detection reaction on
Oligonucleotide Microchips // J. of Clinical Microbiology. - 2001. - Vol.39,№ 7. - P. 2531 2540.
8. Khosravi.A.D. Goodarzi H. Alavi S.M. Detection of genomic mutations in katG, inhA
and rpoB genes of Mycobacterium tuberculosis isolates using polymerase chain reaction and
multiplex allele-specific polymerase chain reaction.// Brazilian Journal of Infectious Diseases. –
2012. - Vol. 16, №1
9. Сетаре М., Титов Л. П., Суркова Л. К. Распространенность мутаций в кодоне 315
katG - гена в клинических изолятах лекарственно - устойчивых M. tuberculosis и
возможности применения метода ПЦР в экспресс-диагностике туберкулеза //
Медицинский журнал. - 2009.-№1. - С. 81 - 86.
155
10. Bartfai Z., Soomoskovi A., Kodmon C., et al. Molecular Characterization of Rifampin Resistant Isolates of Mycobacterium tuberculosis from Hungary by DNA Sequencing and the
Line Probe Assay.// J. Clinical Microbiology. - 2001. - Vol. 39, № 1. - P. 3736 - 3739.
Түйін. Бұл жұмыста Қазақстан Республикасында бөлініп алынған M. tuberculosis
клиникалық изоляттарының молекулалы - биологиялық сипаттамалары көрсетілген.
Изониазидин препаратына дәрілік тұрақтылықты анықтайтын katG генінің нуклеотидтік
тізбегі анықталды. M. Tuberculosis қазақстандық изоляттарында S315Т аминқышқылдық
ауысуға сәйкес келетін katG генінде AGC→ACC мутациясы бар екендігі көрсетілген. Бұл
katG генінің 315 кодонында мутация бар екендігін дәлелдейді.
Summary. This article presents the molecular biological characterization of clinical
isolates of M. tuberculosis, isolated in the Republic of Kazakhstan.
The nucleotide sequence of the gene katG, defining the drug resistance to the drug isoniazid. It was found that Kazakhstan isolates M. tuberculosis have AGC → ACC mutation in
the gene that corresponds to amino acid substitution S315T. This testifies to the katG gene
mutations in codon 315.
УДК 578.8:612.017.12
СРОКИ НАСТУПЛЕНИЯ ИММУНИТЕТА У ОВЕЦ,
ПРИВИТЫХ АССОЦИИРОВАННОЙ ВАКЦИНОЙ ПРОТИВ ЧУМЫ
МЕЛКИХ ЖВАЧНЫХ ЖИВОТНЫХ И ОСПЫ ОВЕЦ
Самолтырова А.Ж., Таранов Д.С., Булатов Е.А., к.б.н.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. В данной работе представлены результаты определения сроков наступления
иммунитета у овец, привитых ассоциированной вакциной против чумы мелких жвачных
животных и оспы овец.
Введение. Средства и методы профилактики чумы мелких жвачных животных
(ЧМЖЖ) и оспы овец (ОО) постоянно разрабатывались в разные периоды развития
ветеринарной службы и науки Казахстана. Важный этап был, достигнут с разработкой и
внедрением в практику вирусвакцин, изготовленных на основе аттенуированных штаммов
вируса ЧМЖЖ и ОО [1-4].
Разработка ряда живых вирусных вакцин создала предпосылки для изучения
возможности их совместного применения. Необходимость разработки ассоциированной
вакцины против ЧМЖЖ и ОО вызвана также тем, что против каждой из этих болезней в
неблагополучных регионах Казахстана ежегодно проводятся плановые прививки, в том
числе в близкие сроки и поэтому применение ассоциированной вакцины против ЧМЖЖ и
ОО позволит: одновременно проводить профилактику ЧМЖЖ и ОО; улучшить
эпизоотическую ситуацию; в сжатые сроки эффективно проводить противоэпизоотические
мероприятия; сократить затраты на вакцинацию; облегчить труд ветеринарных
специалистов.
На сегодняшний день существует острая необходимость создания новых
ассоциированных вакцин, позволяющие в сжатые сроки эффективно проводить
противоэпизоотические мероприятия против ЧМЖЖ и ОО. В этой связи, исследования по
156
определению сроков наступления иммунитета у овец, привитых экспериментальной
ассоциированной вакциной против ЧМЖЖ и ОО, разрабатываемой в Научноисследовательском институте проблем биологической безопасности (НИИПББ) являются
весьма актуальными.
Материалы и методы. В работе использована опытно-экспериментальная серия
ассоциированной вакцины против чумы мелких жвачных животных (ЧМЖЖ) и оспы овец
(ОО) из штаммов «G-45MK» и «НИСХИ» соответственно. Вакциной привито 14 гол овец
6-7 мес. возраста (по 3 гол на группу) подкожно в дозе 1000 ТЦД50. На 7, 10, 14 и 21 сут
после вакцинации отобраны сыворотки крови, которые исследовали в реакции
нейтрализации (РН) к вирусам ЧМЖЖ и ОО. Затем провели контрольное заражение
иммунизированных овец вирулентным штаммом «А» вируса ОО методом внутрикожного
заражения в область подхвостовой складки в дозе 500-1000 ИД50 в объеме 0,5 см3 на 7, 10,
14 и 21 сут после вакцинации. В качестве контроля использовали не вакцинированных
животных против ОО.
Результаты исследований. В результате проведенных исследований установлено,
что иммунитет наступает на 7 сут после вакцинации ассоциированной вакциной против
ЧМЖЖ и ОО, так как иммунизированные овцы не реагировали на контрольное заражение
вирулентным штаммом вируса ОО. Срок наступления иммунитета против ЧМЖЖ
формировался на 14 сут, при этом в сыворотках крови вакцинированных овец
обнаруживались протективные ВНА в титре 1:4, с динамикой накопления титра антител
1:8 на 21 сут. Тогда как на 10 сут у привитых овец отмечалась выработка ВНА к вирусу
ЧМЖЖ в титре 1:2, который не является достаточным для защиты иммунизированного
поголовья против заболевания ЧМЖЖ.
Полученные нами данные согласуются с результатами Баракбаева К.Б. [5] при
разработке ассоциированной вакцины против контагиозной эктимы и оспы овец, Евсеева
А.М. [6] при изучении иммунобиологических свойств штамма «45G» вируса ЧМЖЖ и
Сейткасымова Б.К. [7] при усовершенствовании технологии изготовления и способов
применения вирусвакцины против оспы овец из штамма «НИСХИ».
Выводы. На основании проведенных исследований можно сделать вывод, что у овец,
привитых в дозе 1000 ТЦД50 ассоциированной вакциной ЧМЖЖ и ОО, иммунитет
наступает против ЧМЖЖ на 14 сут, а ОО на 7 сут после вакцинации. Полученные нами
данные
в
будущем
позволят
в
сжатые
сроки
эффективно
проводить
противоэпизоотические мероприятия против ЧМЖЖ и ОО в угрожаемых зонах и в очагах
эпизоотий.
Список литературы
1. Иванющенков В.Н., Кореба О.А., Кекух В.Г. Биологические свойства вакцинного
штамма НИСХИ вируса оспы овец // Ветеринария. - 1990. - 8. – 22 с.
2. Васильев Д.А., Луговцев В.Ю., Колонцов А.А., Макаров В.В., Середа А.Д.
Классификация и номенклатура вирусов // - Ульяновск. - 1999. - 9 с.
3. Курченко Ф.П., Иванющенков В.Н., Уфимцев К.П. и др. Эффективность
культуральной вирус вакцины из штамма НИСХИ против оспы овец // Ветеринария. 1991. -10. - С. 21-23..
4. Диев В.И., Соколов Л.Н., Мамкова Р.В. и др. Изучение чувствительности
различных клеточных культур к вирусу чумы мелких жвачных животных // Вирусные
болезни с.-х. животных. – Владимир. - 1995. - С. 94 – 98.
5. Баракбаев К.Б. Разработка ассоциированной вакцины против контагиозной эктимы
и оспы овец: дисс…канд. вет. наук. - п.г.т. Гвардейский, 2007
157
6. Евсеев А.М. Иммунобиологические свойства вируса чумы мелких жвачных
животных: дисс…канд. вет. наук. - п.г.т. Гвардейский, 1992. - С. 55-104.
7. Сейткасымов Б.К. Усовершенствование технологии изготовления и способов
применения вирусвакцины против оспы овец из штамма НИСХИ: дисс…канд. вет. наук. п.г.т. Гвардейский, 1989.
Түйін. Бұл жұмыста ұсақ күйіс қайыратын малдардың обасы мен қой шешегіне
қарсы қауымдастырылған вакцинасымен егілген қойларда иммунитеттің басталу
мерзімдерін анықтау нәтижелері көрсетілген.
Summary. This paper presents the results of determining the of terms of approach
immunity in sheep vaccinated associated vaccine against peste des petits ruminants and sheep
pox.
УДК 001.32.001.3
ОСНОВНЫЕ ПРИНЦИПЫ РЕАГИРОВАНИЯ НА АКТЫ БИОТЕРРОРИЗМА
Сансызбай А. Р.1, д.в.н, Сыздыков М.С.,д.м.н. 2, Еспембетов Б.А.1, к.в.н.,,
Ирсимбетова Н.2, Сандыбаев Н.Т.1, к.б.н., Кузнецов А.Н.2 к.б.н., Сырым Н.С.1, к.в.н.,
Кормакова Н.Ф.1
«Научно-исследовательский институт проблем биологической безопасности» 1
«Казахский научный центр карантинных и зоонозных инфекций» им. Айкимбаева 2
Резюме. Основными принципами эффективных мер реагирования на акты
биотерроризма является организация специализированных противоэпидемических бригад,
адаптация законодательства к противодействию биотерроризму, работа со средствами
массовой информации, а также проведение противоэпидемических мероприятий,
индикации и идентификации микроорганизмов в случае актов биотерроризма.
Введение. Раннее распознавание опасных биологических материалов является
жизненно важным для стратегии биозащиты и биологической безопасности.
Безотносительно
того,
является
ли
проникновение
биологического
агента
преднамеренным, случайным или естественным, раннее обнаружение дает улучшенные
интервенционные возможности. Инфицированных людей можно выявить наиболее
быстро, которые смогут, получить иммунотерапию или лечение. Могут также быть
выполнены
организационые
мероприятия,
чтобы
предупредить
вторичное
распространение патогенных агентов и удержать проявления эпидемического процесса в
пределах ограниченного географического диапазона [1-6]. Это обусловливает
необходимость разработки принципов раннего реагирования на акты биотерроризма.
Общая информация. Биотеррористическим актом считается преднамеренный
выброс биологических агентов или токсинов с целью нанесения вреда или уничтожения
людей/животных/растений для запугивания или принуждения правительства или
гражданского населения, для того, чтобы добиться каких-либо политических или
социальных целей. На факт использования биологического оружия может указывать
наличие большого количества больных со сходными симптомами, или (и) наличие
необычной инфекции. Особая опасность биотерроризма объясняется его скрытой
158
природой, поэтому в отличие от других видов терроризма, требуется время для
обнаружения биотеррористической атаки [7].
Понятие «последствия биотерроризма» носит обобщенный неэкономический
характер. Понятие «ущерб биотерроризма» является экономической количественной
величиной (в натуральных единицах, свойственных рассматриваемому виду вреда, в
стоимостном выражении). Прогнозирование санитарно-эпидемиологических последствий
террористических актов является обязательным элементом подготовки исходных данных
для планирования оптимальных профилактических и противоэпидемических мероприятий
в целях минимизации возможного ущерба и ликвидации медико-санитарных последствий
в кратчайший период.
Особенности эпидемического процесса в очаге биотерроризма. Список
«классических» биологических агентов (БА), которые с большой степенью вероятности
могут быть использованы террористами, уже в достаточной степени сформирован и
состоит из следующих возбудителей:
1. Возбудители вирусной природы: натуральная оспа, геморрагическая лихорадка
Марбурга, Эбола, Ласса, боливийская геморрагическая лихорадка, венесуэльский
энцефаломиелит лошадей, восточный энцефаломиелит лошадей, желтая лихорадка,
японский энцефалит, лихорадка Денге, лихорадка долины Рифт, геморрагическая
лихорадка с почечным синдромом, Конго-крымская геморрагическая лихорадка.
2. Возбудители риккетсиозной природы: эпидемический сыпной тиф, пятнистая
лихорадка скалистых гор, Ку-лихорадка.
3. Возбудители бактериальной природы: чума, сибирская язва, туляремия, сап,
мелиоидоз, бруцеллез, легионеллез.
4. Токсины растительного и животного происхождения: ботулинические токсины,
столбнячный, сибиреязвенный, шигеллезный, стафилококковые энтеротоксины, рицин,
нейротоксины и др.
В зависимости от используемых БА, биотерроризм может быть «классическим» и «с
целью устрашения». При «классическом» биотерроризме использует особо опасные
патогены с высокой степенью летальностью (например, использование возбудителя
сибирской язвы во время теракта в сентябре 2001 г. в США). При биотерроризме «с целью
устрашения» используют не летальные бактерии и токсины, которые «удобны» тем, что
они могут вызвать не меньшую панику, чем классический теракт, и в то же время
относительно безопасны при изготовлении и диссеминировании.
В современных условиях вероятность «классического» терроризма значительно
ограничена, так как при разработке и производстве «боевых штаммов» первостепенным
требованием является обеспечение безопасности персонала. Однако было бы опрометчиво
утверждать, что террористы никогда не получат доступа к биологическому оружию и не
применят его для целей «классического» терроризма.
Особенностями эпидемического процесса в очаге биотерроризма являются:

Массовое заражение людей и формирование множественных очагов за счет
активации механизмов передачи возбудителей инфекции;

Значительная продолжительность заражающего действия источников
инфекции;

Отсутствие защиты населения от контакта с заразными больными, окружающей
средой, представляющей эпидемическую опасность.
Готовность к биотерроризму. Основные принципы реагирования на акты
биотерроризма были получены из Закона Республики Казахстан от 6 января 2012 года №
527-IV «О национальной безопасности Республики Казахстан»; Руководства ИНТЕРПОЛ
по предварительному планированию и принятию мер реагирования на акты биотерроризма
159
(2010) и других национальных и международных источников, посвященных вопросам
биологической безопасности [8-10].
Главным способом недопущения биологического терроризма является создание
национальных систем мониторинга и нераспространения технологий и материалов,
которые могут быть использованы для разработки бактериологического оружия.
Ключевым элементом в укреплении борьбы с международным биотерроризмом становится
разработка общих мировых стандартов по безопасности и защите. Казахстан
заинтересован в поддержании и укреплении имиджа предсказуемого и серьезного
государства, выполняющего цели Конвенции о запрещении разработки, производства и
накопления запасов бактериологического (биологического) и токсинного оружия и об их
уничтожении (далее – КБТО). С точки зрения внутренних факторов, обеспечивающих
Казахстану выполнение требований КБТО,
первостепенную роль играет наличие
соответствующей законодательной и нормативной базы и ее гармонизация с
международными договорами в области нераспространения. Казахстан присоединился к
КБТО 7 мая 2007 года. В настоящее время завершаются внутригосударственные
процедуры по присоединению Казахстана к Австралийской группе (АГ).
На
национальном уровне в Казахстане осуществляются следующие мероприятия:
1. В целях исключения возможности распространения биологических материалов
обеспечена их надежная физическая защита. Законодательно предусмотрена реализация
комплекса мер, обеспечивающих надежный учет, контроль, физическую защиту опасных
биологических материалов, а также исключающих несанкционированный доступ к таким
материалам и технологиям.
2. Казахстан активно участвует во многих международных организациях по защите
от распространения. Созданы механизмы и процедуры, обеспечивающие всестороннее и
эффективное правовое сотрудничество между государствами.
3. Установлен экспортный контроль биологических материалов, оборудования и
технологий, имеющими «двойное» назначение, и введена уголовная и административная
ответственность за нарушения в осуществлении внешнеторговой деятельности с ними.
4. Координация сотрудничества с ВОЗ, в том числе в области мониторинга и
сдерживания распространения заболеваний.
В национальном законодательстве Республики Казахстан на сегодняшний день
отсутствует самостоятельная отрасль по правовому регулированию общественных
отношений, связанных с биотерроризмом, хотя некоторые правовые нормы уже включены
в действующие законы. Основным законом в области мероприятий по предупреждению и
ликвидации последствий биотерроризма в Казахстане, является Закон Республики
Казахстан от 5 июля 1996 года № 19-I .
30 января 2008 г. Постановлением Правительства РК (№ 78) была создана Комиссия
по вопросам биологической безопасности, представленная пятнадцатью министерствами.
Данная Комиссия является консультативно-совещательным органом при Правительстве
РК. Основной задачей Комиссии является рассмотрение и подготовка предложений по
совершенствованию законодательства Республики Казахстан, регулирующих вопросы
биологической безопасности.
Важным шагом по снижению глобальных угроз явилось принятие Казахстаном
Международных Медико-санитарных правил (2005) (приказ МЗ РК от 27.06 2008 № 384
«О вводе в действие на территории Республики Казахстан Международных Медикосанитарных правил»).
4 января 2013 года Президент Казахстана Нурсултан Назарбаев подписал закон № 63V «О внесении изменений и дополнений в некоторые законодательные акты Республики
Казахстан по вопросам противодействия терроризму». Закон направлен на
совершенствование правовых основ государственной системы противодействия
терроризму. В соответствии с законом унифицировано понятие «терроризм» как
160
многостороннее социальное явление, направленное на достижение отдельными лицами
или группами лиц политических и иных целей, которые они преследуют и стремятся
достичь насильственными, преступными способами. Поправки в законе предусматривают
изменения и дополнения в Уголовный, Уголовно-исполнительный кодексы, Кодекс об
административных правонарушениях и десять законов. Нормы закона также будут
способствовать сокращению социальной базы терроризма, повысят доверие населения к
органам власти, позволят шире вовлечь гражданское общество в процесс противодействия
терроризму». Закон также предусматривает утверждение президентом правил
установления в стране уровня террористической опасности, а также порядка применения
вооруженными силами оружия, боевой техники, специальных средств при проведении
антитеррористической операции.
Оперативное реагирование на биотерроризм. Включает взаимосвязанные по цели,
времени и месту действия органов управления и исполнительных органов:
 своевременное получение информации о биотеррористическом акте;
 оповещение заинтересованных организаций;
 оценку обстановки;
 принятие решений;
 организация ликвидации биотеррорестического акта имеющимися силами и
средствами в целях смягчения их последствий.
Цель информирования и оповещения об угрозе и возникновении акта биотерроризма
является одним из основных принципов защиты населения, окружающей среды и
объектов хозяйствования от негативных последствий чрезвычайной ситуации, связанной с
использованием опасных биологических агентов. Задачами информирования являются
обмен информацией, который пpедусматpивает:
 прием и передачу справочных, отчетных и статистических данных о состоянии
территорий, населенных пунктов, зон pиска, объектов хозяйственного комплекса,
инфpастpуктуpы и т.д.;
 данных бактериологического мониторинга за состоянием пpиpодной среды и
потенциально опасных объектов;
 сведений о биотеррористическом акте.
Управление
в
чрезвычайных
ситуациях,
возникших
в
результате
биотеррористических атак, осуществляется на основе закрытого «Плана взаимодействия
АЧС с Миноброны, МВД и Национальной Гвардией Республики Казахстан в случае
возникновения чрезвычайных ситуаций», которым предписываются необходимые
скоординированные действия, объемы сил и средств, привлекаемые в конкретных случаях.
Для обеспечения координации деятельности различных министерств и ведомств на
республиканском и местном уровнях Правительство РК своим Постановлением от 28
августа 1997 г., № 1298 создало Государственную систему предупреждения и ликвидации
чрезвычайных ситуаций (ГСПиЛЧС).
Реагирование на биотерроризм проходит в 2 этапа:
 санитарно-эпидемиологическая разведка;
 активный санитарно-эпидемиологический надзор.
Основными мероприятиями санитарно-эпидемиологической разведки являются:

проведение неспецифической биологической разведки и контроля с целью
установления факта биотерроризма;

уточнение вида возбудителя;

определение зон биологического заражения.
В зависимости от вида, масштаба теракта и конкретно складывающейся санитарноэпидемиологической обстановки, которая оценивается в результате данных, полученных
161
на этапе санитарно-эпидемиологической разведки, в очаг поражения выставляются
формирования повышенной готовности - санитарно - эпидемиологические отряды (СЭО),
санитарно
эпидемиологические
бригады
(СЭБ)
или
специализированная
противоэпидемическая бригада (СПЭБ). Основной задачей этих формирований является
организация и проведение противоэпидемических и профилактических мероприятий,
направленных на сохранение жизни и здоровья пострадавшего населения, поддержание
санитарно-эпидемиологического благополучия в зоне биотеррористического акта.
Наиболее эффективным, мобильным и мощным формированием, способным к быстрому
развертыванию в полевых условиях и к автономной деятельности, является СПЭБ.
В общей системе противоэпидемических мероприятий, направленных на
ликвидацию медико-санитарных последствий биотеррористического акта, важное место
занимают режимно-ограничительные мероприятия, организуемые и проводимые в зонах
поражения. Они организуются и проводятся в целях предупреждения выноса и
последующего распространения инфекций за пределы зон биологического поражения. В
зависимости от эпидемиологических особенностей инфекции и сложившейся
эпидемической и биологической обстановки эти мероприятия подразделяются на
обсервацию и карантин.
Заключительным этапом ликвидации последствий в очаге биотерроризма является
проведение дезинфекции участков местности, внутренних и наружных поверхностей
зданий сооружений и техники. Дезинфекция в очаге поражения проводится бригадами
дезинфекции.
Сотрудничество для обеспечения эффективных мер реагирования. Начиная с
этапа раннего обнаружения очага биотерроризма, и вплоть до этапа восстановления,
различные ведомства должны осуществлять сотрудничество для обеспечения
эффективных мер реагирования. Уровень сотрудничества определяется степенью
поражения.
Для эффективного реагирования на биотеррористические атаки, имеют значение
прочные рабочие отношения между органами правопорядка и здравоохранения. В
перечень сил постоянной готовности к проведению медицинских мероприятий на случай
угрозы или совершения акта биотерроризма в системе Министерства здравоохранения
Республики Казахстан входят:
– Специализированная противоэпидемическая бригада (СПЭБ);
– Санитарно-эпидемиологические отряды (СЭО);
– Санитарно-эпидемиологические бригады (СЭБ);
– Группы эпидемиологической разведки (ГЭР).
В основу планирования медицинских мероприятий на случай угрозы или совершения
биотеррористической атаки положен территориально-производственный принцип,
осуществляемый разработкой оптимальных профилактических и противоэпидемических
мероприятий на всех уровнях (центральном, местном).
Центрами государственного санитарно-эпидемиологической экспертизы (далее –
ЦСЭЭ) в областях, городах, районах, на транспорте совместно с органами местного
самоуправления,
в соответствии с данными прогнозирования санитарноэпидемиологических
последствий
биологических
террористических
актов
и
комплексными планами противоэпидемических мероприятий по санитарной охране
территории Республики Казахстан разрабатываются Комплексные планы.
На основе комплексного плана в каждом медицинском учреждении составляют
оперативный план проведения противоэпидемических мероприятий в случае выявления
больного (трупа) в случае биотеррорестической атаки.
В каждом подразделении учреждений, задействованных в противоэпидемическом
обеспечении населения при ликвидации медико-санитарных последствий биологического
162
террористического акта, разрабатывается «План немедленного реагирования» (ПНР),
который становится основой для систематического подхода к руководству делами
организации сразу после происшествия.
Особо остро стоит проблема защиты потенциально опасных биологических агентов
от преднамеренного использования в террористических целях – биозащита. Биозащита
рассматривается, как свойство объекта не приводить к авариям при внешних воздействиях,
и свойство объекта не причинять вреда персоналу, населению и окружающей среде при его
нормальной эксплуатации и в случае аварийных ситуаций [10].
Таким образом, основными принципами эффективных мер реагирования на акты
биотерроризма является организация специализированных противоэпидемических бригад,
адаптация законодательства к противодействию биотерроризму, работа со средствами
массовой информации, а также проведение противоэпидемических мероприятий,
индикации и идентификации микроорганизмов в случае актов биотерроризма.
Список использованных источников
1. Laboratory biosafety manual. 2-d Edition. World Health Organization. Geneva, 1993,
133 p.
2. Sandia National Laboratories, a Survey of Asian Life Scientists: The State of
Biosciences, Laboratory Biosecurity, and Biosafety in Asia, Report no. SAND2006–0842
(Sandia National Laboratories: Albuquerque, N.M., Feb. 2006)
3. Roffey, R. and Kuhlau, F. Enhancing bio-security: the need for a global strategy, SIPRI
Yearbook 2006, Р. 732-748.
4. Globalization, Biosecurity, and the Future of the Life Sciences (National Academies
Press: Washington, DC, 2006.
5. World Health Organization (WHO), Biorisk Management: Laboratory Biosecurity
Guidance (WHO: Geneva, Sep. 2006), pp. iii–iv, 6.
6. Kuhlau, F., Countering Bio-Threats: EU Instruments for Managing Biological Materials,
Technology and Knowledge, SIPRI Policy Paper no. 19 (SIPRI: Stockholm, forthcoming 2007).
7. Руководство по предварительному планированию и принятию мер реагирования на
акты биотерроризма, ИНТЕРПОЛ, 2010, 137 с.
8. Закон Республики Казахстан от 6 января 2012 года № 527-IV «О национальной
безопасности Республики Казахстан».
9. Закон Республики Казахстан от 21 июня 2012 года № 19-V «О внесении изменений
и дополнений в некоторые законодательные акты Республики Казахстан по вопросам
противодействия легализации (отмыванию) доходов, полученных незаконным путем, и
финансированию терроризма и обналичивания денег» (с изменениями от 26.12.2012 г.)
10. Закон Республики Казахстан от 4 января 2012 года № 63-V «О внесении
изменений и дополнений в некоторые законодательные акты Республики Казахстан
по вопросам противодействия терроризму».
11. Практическое руководство по мерам реагирования на акты биотерроризма /
Тезисы научно-практической конференции. Чикаго, 2012 г.
Түйін. Биолаңкестіктің актілеріне тиімді шаралардың негізгі ұстанымдары болып
табылатын арнаулы эпидемияға қарсы бригада ұйымы болып табылады, биолаңкестікке
қарсы, заңнаманың бейімділігі, көптеген бұқаралық ақпаратпен жұмыс, сонымен қатар
эпидемияға қарсы іс-шара өткізу, биолаңкестік уақиғасы актісінде микроағза анықтау
және оқшаулау.
Summary. The basic principles of an effective response to acts of bioterrorism is an
organization specialized anti-teams, adapting legislation to combat bioterrorism, work with the
163
media, and conducting control activities, indication and identification of microorganisms in the
case of acts of bioterrorism.
УДК 573.6.086.83:615.317; 616-002.5
ИЗУЧЕНИЕ ТЕРАПЕВТИЧЕСКОЙ ЭФФЕКТИВНОСТИ РЕКОМБИНАНТНЫХ
ГРИППОЗНЫХ ВЕКТОРОВ, ЭКСПРЕССИРУЮЩИХ ПРОТЕКТИВНЫЕ
АНТИГЕНЫ МИКОБАКТЕРИЙ ТУБЕРКУЛЕЗА
Сарсенбаева Г.Ж., Касенов М.М. к.в.н., Хайруллин Б.М. к.в.н., Волгин Е.Н., Нурпейсова
А.С., Богданов Н.В., Исагулов Т.Е.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. В работе приведены результаты исследования изучения терапевтической
эффективности рекомбинантных гриппозных векторов, экспрессирующих протективные
антигены микобактерий туберкулеза. На основании биометрических, бактериологических
и гистологических исследований установлено, что иммунизация вакцинным препаратом 1
TB -FLU 2АEsat6 low при сублингвальном введении повышает эффективность
комплексной терапии экспериментального туберкулеза у мышей.
Введение. По данным ВОЗ около 30% населения Земли инфицировано
микобактериями, из них 10% заболевают туберкулезом. Каждый год от туберкулеза
погибают около 3 млн. человек, - это больше, чем от любой другой инфекции [1]. Широко
используемая в мире вакцина БЦЖ играет существенную роль в профилактике
туберкулеза, однако при определенных обстоятельствах она недостаточно эффективна в
предотвращении диссеминированных форм заболевания, особенно у лиц с признаками
иммунологической недостаточности. В настоящее время все показатели эффективности
лечения впервые выявленных больных туберкулезом легких в Республике Казахстан
остаются на крайне низком уровне, что обусловлено распространенностью устойчивости
микобактерий к химиопрепаратам, снижением способности организма больных к
репаративным процессам. Снижение эффективности лечебных мероприятий, реверсия
распространенных, остро прогрессирующих форм инфекций и значительный рост
лекарственно-устойчивого туберкулеза свидетельствует о необходимости оптимизации
терапии больных туберкулезом. Именно поэтому чрезвычайно важной задачей является
поиск новых средств и подходов в терапии туберкулеза [2, 3].
Основным подходом к эффективному контролю распространения туберкулеза
является профилактическая вакцинация, направленная на предотвращение развития
открытых форм заболевания и реактивации латентных очагов эндогенной инфекции. Более
80 лет для иммунизации против туберкулеза во многих странах, в том числе и в
Республике Казахстан, применяют живую аттенуированную вакцину БЦЖ. Вакцина БЦЖ
обладает доказанным защитным действием в отношении туберкулезного менингита и
диссеминированного туберкулеза среди детей. Однако она не предотвращает первичного
инфицирования и, что более важно, не предотвращает реактивацию латентной легочной
инфекции, являющейся основным источником бациллярного распространения среди
населения. Таким образом, влияние вакцинации БЦЖ на передачу микобактерий
туберкулеза является ограниченной. Кроме того, у привитых детей регистрируется рост
числа осложнений после вакцинации в виде костных поражений, развивающихся
вследствие диссеминации БЦЖ. Серьезную опасность представляет генерализация БЦЖинфекции при иммунодефицитных состояниях. Не исключено, что контакт
164
иммунизированных БЦЖ вакциной лиц с циркулирующими в окружающей среде
M.tuberculosis может усиливать или качественно изменять иммунитет, созданный с
помощью вакцины из штамма M.bovis (БЦЖ) [4].
Еще одним из возможных способов контроля туберкулеза является терапевтическая
вакцинация, т.е. вакцинация индивидуума уже после того, как он был инфицирован
вирулентными микобактериями. Данный подход направлен на предотвращение прогрессии
заболевания и реактивации туберкулеза у инфицированных индивидуумов с латентной
инфекцией. Терапевтическая вакцинация может также применяться с целью
специфической иммунотерапии больных с активным туберкулезом для повышения
эффективности и/или сокращения длительности курса химиотерапии, усиления
надежности и эффективности применяемой этиотропной лекарственной терапии.
Ожидается, что применение терапевтической вакцины даст возможность сократить
длительность применения туберкулостатических препаратов, что позволит отсрочить
появление мутантных форм микобактерий туберкулеза, резистентных к комплексной
терапии антибиотиками, и добиться перерыва в многомесячных курсах лечения.
Одним из способов, позволяющих повысить иммуногенность микобактериальных
антигенов, может служить использование в качестве векторов для их доставки и
экспрессии аттенуированных вирусов или бактерий. В настоящее время активно
исследуется протективный потенциал векторов на основе аттенуированных вирусов
(аденовирус, вирус осповакцины) и бактерий (F. tularensis, Shigella, S. typhimurium),
несущих протективные антигены возбудителя туберкулеза (ESAT6, 85А, SOD A и др.).
При разработке векторных вакцин основным условием их применения является надежная
аттенуация используемого в качестве вектора вакцинного штамма и его безопасность при
применении у людей. В то же время репликация рекомбинантного вектора должна
сопровождаться выработкой достаточного количества белка-вставки для формирования
защитного эффекта вакцинации [5, 6].
В Казахстане на базе Научно-исследовательского института проблем биологической
безопасности (НИИПББ) в 2012 году в рамках Научно-технической программы
«Разработка вакцины против туберкулеза для здравоохранения Республики Казахстан»
начались работы по созданию и изучению рекомбинантных гриппозных векторов,
экспрессирующих протективные антигены микобактерий туберкулеза.
В связи с этим целью настоящих исследований явилось изучение терапевтической
эффективности рекомбинантных гриппозных векторов,
при сублингвальном и
интраназальном
путях
введения
в
условиях
терапии
экспериментального
генерализованного туберкулеза у мышей.
Материалы и методы. Бактерия. Для заражения животных использовали культуру
вирулентного штамма M.tuberculosis Erdman, выращенную на среде ЛевенштейнаЙенсена, которая инкубировалась в термостате при t=370С в течение 3-х недель.
Интенсивность бактериовыделения составила 4 балла т.е сплошной рост колоний
(массивное бактериовыделение). В качестве контроля терапии использовали изониазид и
рифампицин.
Вакцинные кандидаты. Рекомбинантные гриппозные векторы, экспрессирующие
протективные антигены микобактерий туберкулеза:
Вакцинный препарат 1-2A Esat6 low
Вакцинный препарат 2-2A Esat6
Вакцинный препарат 3-Esat 2A IL2 low
Вакцинный препарат 4-Esat6 2A Ag85A
Животные. Для проведения опытов использовали мышей линии C57black/6 в
возрасте 6-8 недель.
165
Индекс поражения легких устанавливали по совокупности экссудативных и
продуктивных изменений в условных единицах – баллах [7]. Экссудативные изменения:
- легкие воздушны – 0
- единичные безвоздушные очаги – 0,25
- легкие безвоздушны на 1/2 - 0,5
- легкие безвоздушны на 2/3 – 0,75
- легкие безвоздушны на всем протяжении – 1,0
Продуктивные очаги:
- единичные субмилиарные очаги - 0,5
- многочисленные (не более 20) - 1,0
- многочисленные субмилиарные (более 20) - 1,5
- единичные милиарные - 1,75
- многочисленные сливающиеся субмилиарные и единичные милиарные - 2,0
- многочисленные милиарные (не более 10) - 2,25
- многочисленные милиарные, сливающиеся - 2,75
- появление мелких казеозных некротических фокусов - 3,0
- обширный казеоз - 4,0
- сплошное поражение легких - 5,0
Биометрические показатели. Коэффициенты массы (КМ) легких и селезенки
определяли по формуле:
масса органа (г) ×100
КМ = -----------------------------масса тела животного (г)
Бактериологические показатели. Проводили дозированный посев гомогената ткани
легких на плотную яичную среду Левенштейна-Йенсена методом серийных разведений.
Нижняя граница чувствительности метода - 2×103 КОЕ. Массивность роста микобактерий
туберкулеза (МБТ) выражали в десятичных lоg (lg) от числа колониеобразующих единиц
(КОЕ) на массу легких. Расчет индекса защиты органа проводился при вычитании lg КОЕ
иммунизированных мышей из lg КОЕ мышей группы контроля заражения. При анализе
результатов положительным эффектом по задержке роста МБТ считался индекс защиты
≥0,5 lg.
Гистологическое исследование легких. При гистологическом изучении легких, орган
фиксировали в 10% формалине, заливали в целлоидин-парафин-масло, срезы окрашивали
гематоксилином и эозином.
Иммунизация. Мышей по весу распределяли по экспериментальным группам и
формам введения исследуемых вакцинных препаратов на следующие группы которые
представлены в таблице 1.
Таблица 1- Эксперимент по оценке терапевтического эффекта вакцинных кандидатов
№
гр
уп
пы
Иммунизация
Кол-во
мышей
1
Контрольные группы
Контроль заражения
n=20
2
Контроль терапии
n=20
Специфическая терапия
Вакцинный препарат
3араженные мыши без
терапии
изониазид в дозе 10 мг/кг,
подкожно + рифампицин 10
мг/кг, внутрижелудочно 5
раз в неделю
-
166
-
3
Опытные группы
Вакцинный
препарат 1
сублингвально
n=20
4
Вакцинный
препарат 2
сублингвально
n=20
5
Вакцинный
препарат 3
сублингвально
n=20
6
Вакцинный
препарат 4
сублингвально
n=20
7
8
n=20
Вакцинный
препарат 1
интраназально
Вакцинный
препарат 2
интраназально
n=20
9
Вакцинный
препарат 3
интраназально
n=20
10
Вакцинный
препарат 4
интраназально
n=20
изониазид в дозе 10 мг/кг,
подкожно + рифампицин 10
мг/кг, внутрижелудочно 5 раз
в неделю
изониазид в дозе 10 мг/кг,
подкожно + рифампицин 10
мг/кг, внутрижелудочно 5 раз
в неделю
изониазид в дозе 10 мг/кг,
подкожно + рифампицин 10
мг/кг, внутрижелудочно 5 раз
в неделю
изониазид в дозе 10 мг/кг,
подкожно + рифампицин 10
мг/кг, внутрижелудочно 5 раз
в неделю
изониазид в дозе 10 мг/кг,
подкожно + рифампицин 10
мг/кг, внутрижелудочно 5 раз
в неделю
изониазид в дозе 10 мг/кг,
подкожно + рифампицин 10
мг/кг, внутрижелудочно 5 раз
в неделю
изониазид в дозе 10 мг/кг,
подкожно + рифампицин 10
мг/кг, внутрижелудочно 5 раз
в неделю
изониазид в дозе 10 мг/кг,
подкожно + рифампицин 10
мг/кг, внутрижелудочно 5 раз
в неделю
10 мкл(106 ТИД50)
сублингвально, курс - 5
введений, через день
10 мкл(106
ТИД50)сублингвально,
курс - 5 введений, через
день
10 мкл(106
ТИД50)сублингвально,
курс - 5 введений, через
день
10 мкл(106 ТИД50)
сублингвально, курс - 5
введений, через день
10 мкл(106
ТИД50)интраназально,
курс - 2 введения, с
интервалом 3 недели
10 мкл(106 ТИД50)
интраназально, курс - 2
введения, с интервалом
3 недели
10 мкл(106 ТИД50)
интраназально, курс - 2
введения, с интервалом
3 недели
10 мкл (106
ТИД50)интраназально,
курс - 2 введения, с
интервалом 3 недели
Мыши C57BL/6 были инфицированы введением в латеральную хвостовую вену
взвеси трехнедельной вирулентной культуры М. tuberculosis Erdman (106 КОЕ/мышь в 0,2
мл).
С 7-го дня после заражения один раз в 2-3 дня проводились пробные вскрытия (по 2
мыши) с проведением визуального осмотра легких для определения сроков появления
макроскопически заметных очагов специфического воспаления.
Результаты и обсуждение. Лечение зараженных животных всех групп начато с
момента образования милиарных очагов, соответственно на 12 день после заражения.
Забор биологического материала для биометрических исследований, визуальной оценки
распространенности специфического поражения с вычислением индекса поражения легких
и бактериологического исследования проводили на 6 и 8 недели после заражения всех
групп.
Инокуляция животным вирулентного штамма М. tuberculosis Erdman вызвала
развитие генерализованного туберкулеза с преимущественным
167
поражением легких. При этом на 12 день после инфицирования при пробных вскрытиях в
легких визуализированы множественные субмилиарные и единичные милиарные (d>1 мм)
очаги специфического воспаления, а гибель мышей группы контроля заражения в
результате прогрессирования туберкулезной инфекции началась на 25 день после
заражения.
Через 8 недель от начала терапии практически во всех группах животных, кроме
мышей, иммунизированных вакцинным препаратом 2, наблюдалось дальнейшее снижение
биометрических показателей и индекса поражения легких, что отражает эффект
продленной этиотропной терапии (таблица 2).
Таблица 2 - Показатели тяжести течения туберкулезной инфекции
№
гр
Условия
опыта
1.
Контроль
заражения n=1
H+R n=6
1,24±0,19
2.
Коэфф-т Коэфф-т
массы
массы
легких
селезенки
Индекс
поражени
я легких
(усл. ед.)
через 6: недель от начала лечения
3,31
1,57
3,5
Коэфф-т
массы
легких
Коэфф-т
массы
селезенки
0,45±0,0
3
0,46±0,0
5
1,09±0,09
0,47±0,02
2,13±0,04
Индекс
поражени
я легких
(усл. ед.)
через 8: недель от начала лечения
1,19±0,08 0,54±0,03 2,02±0,09
1,69±0,04
H+R+вак.1,
1,08±0,1
1,79±0,09 1,07±0,11 0,46±0,01 1,75±0,05
10 мкл,
подъяз. n=6
4. H+R+вак.2,
1,46±0,18 0,5±0,04 1,92±0,09 1,12±0,07 0,52±0,05 1,63±0,02
10 мкл,
подъяз. n=6
5. H+R+вак.3,
1,19±0,1
0,5±0,03 1,71±0,08 1,14±0,08 0,48±0,03 1,61±0,06
10 мкл,
подъяз. n=6
6. H+R+вак.4,
1,3±0,15
0,43±0,0 1,75±0,09 1,08±0,04 0,5±0,04
1,55±0,06
10 мкл,
2
подъяз. n=6
7. H+R вак.1,
1,38±0,26 0,56±0,0 1,79±0,09 1,52±0,15 0,66±0,06 2,02±0,12
10 мкл,
5
интраназ. n=6
8. H+R вак.2,
1,72±0,14 0,63±0,0 1,83±0,13 1,22±0,08 0,51±0,03 1,69±0,05
10 мкл,
7
интраназ. n=6
9. H+R вак.3,
1,6±0,33
0,61±0,0 1,63±0,04 1,4±0,13
0,57±0,03 1,66±0,01
10 мкл,
8
интраназ. n=6
10. H+R вак.4,
1,38±0,15 0,59±0,0 1,83±0,04 1,19±0,08 0,54±0,03 2,02±0,09
10 мкл,
4
интраназ. n=6
Примечание
H - Гидразид изоникотиновой кислоты (ГИНК) – изониазид — лекарственное средство,
противотуберкулёзный препарат
R - Рифампицин(Rifampicin) - лекарственное средство, противотуберкулёзный препарат
3.
168
Степень обсемененности легких МБТ (таблица 3) по отношению к группе животных,
леченных только противотуберкулезными препаратами, более всего (в 1,3 раза, р<0,05)
снизилась в гр.3 (вакцинный препарат 1 при сублингвальном введении). При этом индекс
защиты составил +0,62 lg.
Таблица 3 - Высеваемость МБТ из легких, зараженных M. tuberculosis Erdman
№ Условия опыта
гр
.
Log 10 числа
Индекс
Log 10 числа
Индекс
жизнеспособных защиты (Log жизнеспособных
защиты
бактерий в
10)
бактерий в легких
(Log 10)
легких
через 6: недель от начала
через 8: недель от начала
лечения
лечения
1. Контроль заражения 5,62
(n=6)
n=1
2,6±0,113
2. H+R
2,59±0,044
2,48±0,05
+0,12
n=6
3. H+R+вак.1,
1,97±0,447
+0,62
2,59±0,116
10 мкл, подъяз.
n=6
4. H+R+вак.2,
3,01±0,102
-0,42
2,61±0,08
10 мкл, подъяз.
n=6
5. H+R+вак.3,
2,6±00,139
2,63±0,11
10 мкл, подъяз.
n=6
6. H+R+вак.4,
2,39±0,182
+0,2
2,43±0,147
+0,17
10 мкл, подъяз.
n=6
7. H+R вак.1,
2,85±0,104
-0,26
2,56±0,109
10 мкл, интраназ.
n=6
8. H+R вак.2,
2,62±0,103
2,56±0,156
10 мкл, интраназ.
n=6
9. H+R вак.3,
2,43±0,015
+0,16
2,45±0,287
+0,15
10 мкл, интраназ.
n=6
10 H+R вак.4,
2,23±0,338
+0,36
2,6±0,113
.
10 мкл, интраназ.
n=6
Примечание
H - Гидразид изоникотиновой кислоты (ГИНК) – изониазид — лекарственное средство,
противотуберкулёзный препарат
R - Рифампицин(Rifampicin) - лекарственное средство, противотуберкулёзный препарат
Некоторое снижение роста МБТ отмечено также в гр. 6 и 9 (р<0,05 и р<0,01
соответственно), но поскольку индекс защиты при этом был достаточно низким (+0,2 lg
и+0,16 lg) – сделать вывод об увеличении клиренса легких от МБТ под влиянием этих
препаратов не представляется возможным. У мышей, иммунизированных интраназально
169
вакцинным препаратом 4 (гр. 10) также отмечено уменьшение высеваемости МБТ (индекс
защиты - +0,36 lg), но вследствие большого разброса показателей этот эффект был
недостоверным.
Уровень роста МБТ из легких достоверно снизился только в гр. 3 р<0,05 с
показателем контроля терапии (вакцинный препарат 1 при сублингвальном введении),
однако индекс защиты при этом составил только +0,12 lg, что при сравнении с данными
первого забоя позволяет говорить о кратковременном терапевтическом эффекте препарата.
При гистологическом исследовании срезов легких, проведенных на 54-й день после
инфицирования (6 недель от начала комплексной терапии) у единственной выжившей
инфицированной нелеченной мыши в легочной паренхиме выявлено большое количество
свежих инфильтративных изменений на фоне значительного (более чем на 30% площади
среза) снижения воздушности легочной ткани. Очаги инфильтрации сливались, имели
размытые границы без четкой пространственной ориентации клеток (рисунок 1).
Периваскулярные и перибронхиальные лимфогистиоцитарные инфильтраты были
выражены слабо.
Рисунок 1 - Легкие мыши контрольной группы на 54 день после заражения M.
tuberculosis Erdman. Сливные очаги специфической инфильтрации без четкой
пространственной ориентации клеток. Окраска гематоксилином и эозином х 600
Во всех других группах животных распространенность специфического
воспалительного процесса в легких была существенно меньшей, прежде всего под
влиянием шестинедельного курса этиотропной терапии.
В группе контроля терапии (гр. 2) снижение воздушности легочной ткани более чем
на 30% площади срезов отмечено только в одном из шести случаев (16,7%),
специфическое воспаление потеряло сливной характер, и было представлено отдельными
некрупными очагами инфильтрации.
У мышей, получавших вакцинные препараты, гистологическое исследование
проведено только в группах животных, иммунизированных вакцинными препаратами №1
и №4, введение которых в комплексную терапию отразилось на большем числе
показателей тяжести течения инфекции. При этом оценивались результаты обоих путей
введения препаратов (гр. 3, 6, 7 и 10).
Анализ данных показал, что применение вакцинных препаратов №1 и №4 в
комплексной терапии при обоих путях введения привело к дальнейшему снижению
распространенности специфического воспаления в легочной ткани. При этом ни у одной
мыши, иммунизированной ими, не отмечено значительного (более чем на 30% площади
срезов) снижения воздушности легочной ткани и крупных очагов инфильтрации, а в
170
составе участков специфического воспаления не обнаружено элементов альтеративного
компонента - нейтрофильных гранулоцитов.
Наиболее существенные отличия от мышей контроля терапии были отмечены у
мышей, иммунизированных вакцинным препаратом №1 при сублингвальном введении (гр.
3). Специфическая инфильтрация в этой группе мышей была представлена небольшими
участками альвеолярно-макрофагального гранулематоза.
При заключительном обследовании, проведенном через 8 недель от начала
комплексной терапии, где уже не было мышей контроля заражения, туберкулезное
воспаление во всех группах мышей было представлено исключительно небольшими
участками специфической инфильтрации и некрупными гранулемами. Эти данные
полностью согласуются с результатами биометрического обследования и индексом
поражения легких и, несомненно, обусловлены действием противотуберкулезных
препаратов.
По распространенности процесса несколько различались только контрольная группа и
мыши, иммунизированные вакцинным препаратом №1 сублингвально, где очаги
инфильтрации и гранулемы были очень небольшими и локализовались преимущественно
периваскулярно и перибронхиально (рисунок 2).
Рисунок 2- Лимфоидная гранулема в очаге специфической инфильтрации мыши,
зараженной M. tuberculosis Erdman, через 8 недель комплексной терапии с иммунизацией
вакцинным препаратом 1 сублингвально. Окраска гематоксилином и эозином х 600
Суммируя полученные результаты можно заключить, что терапевтическая
иммунизация вакцинным препаратом TB -FLU 2А Esat6 low при сублингвальном введении
повышает эффективность комплексной терапии экспериментального туберкулеза у
мышей. Оно проявилось снижением выраженности туберкулезного поражения по индексу
поражения легких, Log10 числа жизнеспособных бактерий в легких и селезенке,
уменьшением распространенности альвеолярно-макрофагального гранулематоза в
легочной ткани и альтеративного компонента специфического воспаления, а также в
стимуляции напряженности местного иммунитета легочной ткани. Использование
вакцинного препарата TB -FLU 2АEsat6 low сублингвально было несколько более
эффективным, что отмечено по значимому влиянию препарата на коэффициент массы
легких и более выраженной стимуляции лимфогистиоцитарной инфильтрации легких.
Выводы. По результатам проведенных исследований можно заключить, что при
иммунизации исследуемыми вакцинными кандидатами терапевтический эффект выявлен
только у вакцинного препарата 1 при сублингвальном введении.
171
Список литературы
1.
International
Union
Against
Tuberculosis
and
Lung
Disease.
http://www.theunion.org/index.php/conferences/index.php?option=com_flexicontent&view=item
s&id=85&Itemid=36.
2. Favorov M, Ali M, Tursunbayeva A. Comparative Tuberculosis (TB) Prevention
Effectiveness in Children of Bacillus Calmette-Gue´ rin (BCG) Vaccines from Different Sources,
Kazakhstan // PLoS ONE. -2012. – Vol.7, Issue 3. –e32567.
3. Симбирцев А. С. Достижения и перспективы использования рекомбинантных
цитокинов в клинической практике // Медицинский академический журнал.- 2013.- Т. 13.№ 1.-С.7-22
4. McShane H. Tuberculosis vaccines: beyond bacille Calmette-Guerin. Philos Trans R Soc
Lond B Biol Sci. 2011; 366(1579): 2782-2789.
5. Yan L., Xueqiong W. Immunogenicity and therapeutic effects of Ag85A/B chimeric
DNA vaccine in mice infected with Mycobacterium tuberculosis // FEMS Immunol Med. – 2012.
– Vol. 66. – Issue. – 3. – Р. 419-426.
6. Stukova M.A., Sereinig S. Vaccine potential of influenza vectors expressing
Mycobacterium tuberculosis ESAT-6 protein // Tuberculosis. – 2006. – Vol. 86. – P. 236-246.
7. Александрова А.Е., Ариель Б.М. Оценка тяжести туберкулезного процесса в
легких у мышей // Проблемы туберкулеза. 1993. №3. С.52-53.
Түйін. Аталмыш жұмыста туберкулез микобактерия антигенінің протективті
антигенін экспрессиялайтын рекомбинантты грипп векторларының терапиялық
эффектілігін зерттеу нәтижелері келтірілген. Бірінші преапарат TB -FLU 2АEsat6 low
тышқандарады туберкулезден кешенді емдеу барысында биометриялық, бактериологиялық
және гистологиялық зерттеулердің нәтижесі бойынша жоғары көрсеткіш көрсетті
Summary. The paper presents the results of research studying the therapeutic efficacy of
recombinant influenza virus vectors expressing protective antigens of Mycobacterium
tuberculosis. In biometrics, bacteriological and histological studies showed that the therapeutic
immunization vaccine preparation 1 TB-FLU 2AEsat6 low for sublingual administration
increases the efficiency of the treatment of experimental tuberculosis in mice.
УДК 619:578.821.21:573.6.083:57.083.3
БАКТЕРИАЛЬНАЯ ЭКСПРЕССИЯ ГЕНОВ ВИРУСА ОСПЫ
ОВЕЦ, КОДИРУЮЩИХ АНТИГЕННЫЕ БЕЛКИ А4 И B5
Тайлакова Э.Т., Червякова О.В. к.б.н., Султанкулова К.Т. к.б.н.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. Получены бактериально-экспрессированные рекомбинантные белки вируса
оспы овец А4 и В5, которые обладают антигенными свойствами и могут быть
использованы для разработки средств профилактики и диагностики оспы овец.
Введение. Оспа овец - тяжелое, высоко контагиозное заболевание, которое согласно
МЭБ относят к особо опасным болезням животных [1, 2]. В настоящее время наибольшую
опасность, наряду с другими болезнями, представляет данная инфекция. Она наносит
овцеводству огромный экономический ущерб, слагающийся из гибели и вынужденного
172
убоя больных животных, снижения продуктивности, затрат на проведение ветеринарносанитарных и охранно-карантинных мероприятий.
Решающая роль в борьбе с инфекционными болезнями животных отводится
специфической профилактике с использованием живых и инактивированных вакцин. В
настоящее время в странах СНГ для профилактики оспы овец применяют моновакцины
[3]. В Республике Казахстан и в ряде стран ближнего зарубежья
используют
культуральную вакцину, полученную на основе аттенуированного вируса оспы овец
(ВОО), штамм «НИСХИ» [4]. Однако ограничения на использование живых
аттенуированных вакцин в районах благополучных по данному заболеванию и недостатки
существующих вакцин (низкая иммуногенная активность, реактогенность и трудности,
обусловленные получением сырья в виде органов животных) создают необходимость
разработки нового поколения профилактических препаратов.
Исследования по созданию вакцин нового поколения против поксвирусов имеют
большое значение для сельского хозяйства Казахстана, где основу животноводства
составляет овцеводство.
Последним достижением молекулярной биологии, генной инженерии и
биотехнологии стало создание вакцин, содержащих высокоиммуногенные вирусные белки.
Получение вакцин на основе рекомбинантных белков является новейшим поколением
профилактических препаратов. Их очевидное преимущество обуславливает широкое
применение данного типа вакцин в медицине и ветеринарии для вакцинации населения и
сельскохозяйственных животных [5].
Поксвирусы формируют несколько инфекционных форм вирионов, в число которых
входит внеклеточный зрелый вирион (EEV) [6]. Он имеет двухслойную липидную
оболочку, в которой наряду с остальными белками идентифицирован иммуногенный белок
B5. Установлено, что иммуногенной активностью обладают также и внутренние белки
вируса оспы. Показано, что коровый белок А4 вызывает образование
вируснейтрализующих антител в организме иммунизированных животных и может быть
использован в качестве компонента вакцинных препаратов [7].
В данной статье описаны результаты исследований по получению рекомбинантных
белков А4 и В5 ВОО и определению их антигенных свойств.
Материалы и методы. Использовали полученные нами ранее рекомбинантные
плазмиды, содержащие гены SPPV-95 и SPPV-141 ВОО [8].
Экспрессию генов, кодирующих данные белки, проводили в клетках E. coli, штамма T7
(New England Biolabs). Анализ экспрессии проводили методом электрофореза в 15% ДСНПААГ-е [9].
Растворимость рекомбинантных белков определяли с использованием Bug Buster
(Novogen), очистку проводили методом металло-хелатной аффинной хроматографии на
колонках с Ni-NTA агарозой (Qiagen).
Антигенные свойства и специфичность рекомбинантных белков изучали методом
вестерн-блот-анализа с использованием сывороток от овец, экспериментально
инфицированных ВОО и антител к полигистидину.
Результаты и обсуждение. Компетентные клетки E. coli трансформировали
рекомбинантными плазмидами. В результате индукции бактериальных клеток,
содержащих рекомбинантные плазмиды pSPPVA4L и pSPPVB5RΔ, были получены белки
A4L и B5R с молекулярными массами 20 и 22 кДа. Обработка осадка клеток реагентом
Bug Buster с последующим электрофоретическим анализом позволило установить, что
рекомбинантные белки формируют в клетках тельца-включения. В связи с этим очистку
белков проводили в денатурирующих условиях в присутствии 8 М мочевины.
173
Специфичность и антигенная активность очищенных препаратов белков была
показана методом вестерн-блот-анализа. Антитела к полигистидину специфически
связывались с экспрессируемыми белками. Также анализируемые белки выявлялись
сывороткой полученной от овец, экспериментально инфицированных ВОО.
Выводы. Таким образом, в ходе проведенных исследований были получены
рекомбинантные белки оспы овец A4 и B5, обладающие антигенной активностью.
Рекомбинантные белки могут быть использованы для разработки средств специфической
профилактики нового поколения против оспы овец, что является одним из основных
моментов в улучшении благосостояния страны по особо опасным инфекционным
заболеваниям.
Список литературы
1. Сюрин В.Н., Самуйленко А.Я., Соловьев Б.Ф. и др. Вирусные болезни животных //
М. ВНИТИБП, 1998, С. 128-134.
2. Levefre P.C. Sheep and goats pox// Ins. Elev.Med.Vet. Pays trop. Prod.- 1983, P.171.
3. Особо опасные болезни животных. Справочник / И.А. Бакулов, Т.А.Власова,
С.Ф.Терновая, А.В. Книзе, И.Ю. Хухоров, Н.В.Дмитриенко / ВНИИВВиМ.- Покров, 2002,
С.-159.
4. World Animal Health. Reports on the animal Health Status and Disease Control Methods
and List a Disease Outbreaks. Paris: Statistics O.I.E. 1996, P.4.
5. Лебедев Л.Р., Экспериментальные препараты на основе рекомбинантных ДНК и
белков для лечения и профилактики инфекционных заболеваний : автореф. дис. д-ра мед.
наук: 03.02.02: защищена 2011/ Л.Р. Лебедев; Кольцово,2011. - 256 с.
6. Moss B., Knipe D.M., etc. Poxviridae and their replication. Fields virology,
2nd ed. Raven p ress, New York, NY. 1990, Р. 120.
7. Boyce,T.G., W.C.Gruber, S.D.Coleman-Dockery, E.C.Sannella, G.W.Reed,
M. Wolff, and P. F. Wright. Mucosal immune response to trivalent live
attenuated intranasal influenza vaccine in children. Vaccine 18: 1999, Р. 82–88.
8. Тайлакова Э.Т., Ажибаева Д.Т., Червякова О.В. и др., Создание генетических
конструкции для экспрессии рекомбинантных белков А4L и B5R вируса оспы овец //
Науч.-практ. конф. «Актуальные проблемы и перспективы биологической безопасности»,
п.г.т. Гвардейский, 7 августа 2012 г., С.174-179.
9. Laemmli U.K. Cleavage of structural proteins during the assembly of the head of
bacteriophage T4// Nature. 1970. – Vol. 227. – P. 680-685.
Түйін. Жүргізілген зерттеулер нәтижесінде шешек вирусының диагностикасы мен
прафилактика құралдарын жасақтау мақсатында қолдануға болатын, антигенді қасиеттерге
ие, шешек вирусының А4 және В5 рекомбинантты ақуыздары бактериалы-экспрессия
әдісі арқылы алынды.
Summary. We obtained a bacterially expressed recombinant sheep pox virus A4 and B5
proteins, which have antigenic properties and can be used to developing of sheep pox prophylaxis
and diagnostic means.
174
УДК 578.824.1:57.085.23
ЭКСПЕРИМЕНТАЛЬНОЕ ИЗУЧЕНИЕ ВОЗМОЖНОСТИ
КУЛЬТИВИРОВАНИЯ ВИРУСА БЕШЕНСТВА ШТАММ «VRC-RZ2» В
СУСПЕНЗИОННОЙ КУЛЬТУРЕ КЛЕТОК ВНК-21
Таранов Д.С., Жилин Е.С., Ершебулов З.Д., Булатов Е.А., Баракбаев К.Б., Далбаев Н.К.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. При суспензионном культивированиии зараженнных клеток ВНК-21 с
использованием поддерживающей среды DMEM, содержащей 5% сыворотки КРС индекс
пролиферации составил 2,5, при жизнеспособности 95% клеток. Инфекционная и
антигенная активность вирусной суспензии на 96-120 ч культивирования составила > 7,5 lg
МЛД50/см3 и > 11 log2, соответственно. Полученные результаты позволяют рекомендовать
суспензионный метод культивирования вируса для масштабирования с целью
использования в промышленной наработке вирусной биомассы вируса бешенства.
Введение. Антирабическая вацинация является безальтернативным методом
профилактики бешенства среди диких и домашних животных, позволяющим
минимизировать риск заражения и гибели человека [1].
Основой современных антирабических вакцин являются фиксированные штаммы
вируса бешенства. Иммунологическая эффективность антирабических вакцин зависит от
системы культивирования вируса, выбора штамма и степени его аттенуации для живых
вакцин, антигенной активности штамма вируса, величины его накопления при
культивировании, конечного соотношения количества вирусного антигена и
сопутствующих балластных тканей для инактивированных вакцин [2].
В НИИПББ получен вирус бешенства (ВБ) штамм «VRC-RZ2» адаптированный к
репродукции в культурах клеток ПС, ВНК-21 [3]. Результаты патогенных, антигенных,
иммуногенных свойств позволили рекомендовать данный штамм в качестве кандидата для
изготовления антирабических вакцин [4]. При культивировании ВБ штамм «VRC-RZ2»
использованы стационарный и роллерный методы культивирования, которые позволяют
нарабатывать вирусную биомассу с инфекционной активность до 7,5 lg МЛД50/см3 [5].
Трудоемкость данных методов культивирования, обусловленная проведением
значительного количества технологических процедур, не позволяют нарабатывать
вирусный материал в объеме необходимом для промышленного изготовления вакцин
против бешенства. В связи с вышеуказанным испытания масштабных способов
культивирования вышеуказанного штамма ВБ являются актуальными.
Целью настоящих исследований стало экспериментальное изучение возможности
культивирования вируса бешенства штамм «VRC-RZ2» в суспензионной культуре клеток
ВНК-21.
Материалы и методы. В экспериментах использовали перевиваемую культуру
клеток почки сирийского хомячка ВНК-21, питательную среду DMEM с добавлением Lглутамина 0,6 г/л, сыворотку крупного рогатого скота 5%, вирус бешенства штамм «VRCRZ2» (5 пассаж на ВНК-21, титр 7,25 lg МЛД50/см3).
Интактные и инфицированные вирусом клетки ВНК-21, выращивали во взвеси в 5
литровых спиннерах фирмы Techne при постоянном перемешивании мешалки 50 – 60
об/мин при 35 °C в течение 24-120 ч. Клетки в концентрации 1,2 млн/см3 заражали
вирусом в дозе 0,01-0,05 МЛД50 на клетку. Инкубировали суспензию клеток в течение 60
мин, и добавляли свежую питательную среду DMEM, содержащую 5% сыворотки КРС, в
объеме аналогичном объему суспензии зараженных клеток. рН питательной среды
175
поддерживали в пределах 7,2-7,4 добавлением раствора бикарбоната натрия (7,5%
NHCO3).
Биологическую активность в пробах суспензии зараженных клеток определяли по
инфекционности на белых мышах и выражали в lg МЛД50. Антигенную активность
оценивали в ТФ ИФА [6].
Статистическую обработку результатов экспериментов проводили с использованием
программы GraphPadPrism 5.0.
Концентрация жизнеспособных
клеток на мл, млн. клеток
Результаты и обсуждение. В ходе экспериментов были определены
пролиферативные свойства используемой линии клеток, инфицированной вирусом
бешенства штамм «VRC-RZ2», а также незараженных клеток ВНК-21. Результаты
исследований представлены на Рисунке 1.
2.0
Интактные клетки
96
95
1.5
Зараженные клетки
93
87
97
1.0
79
84
96
54
98 98
0.5
9
0.0
0
24
48
72
96
Срок культивирования, час
120
Рисунок 1 – Результаты культивирования зараженных и интактных клеток ВНК-21
суспензионным методом. В верхней части столбцов указан процент жизнеспособных
клеток от общего числа клеток суспензии.
Из данных рисунка 1 следует, что на 48 ч после заражения наблюдалась наибольшая
пролиферативная активность клеток. Концентрация жизнеспособных клеток в зараженной
и интактной культуре ВНК-21 составляла 1,45 и 1, 5 млн. клеток на см3, соответственно.
Индекс пролиферации в данный период составил 2,5. При последующем культивировании
отмечали снижение количества жизнеспособных клеток в суспензии и параллельное
увеличение доли мертвых клеток. По истечению 72-96 ч в инфицированных клетках
процент жизнеспособных клеток составил 54-84%. При достижении уровня 90% мертвых
клеток, культивирование останавливали. Указанный уровень был достигнут на 5 сут
культивирования для зараженной культуры клеток, тогда как для интактной культуры
клеток составил – 8 сут.
Результаты исследований инфекционной и антигенной активности проб вирусной
суспензии, отобранных через 24-120 ч после заражения, представлены на рисунке 2.
176
14
8
12
7
10
6
8
5
6
4
4
3
2
0
2
0
24
48
72
96
Антигенная активность, log2
Инфекционная активность,
lg MЛД50/cм3
9
Инфекционная
активность
Антигенная
активность
120
Период культивирования, час
Рисунок 2 – Результаты определения инфекционной и антигенной активности в
вирусных суспензиях
Данные приведенные на рисунке 2, свидетельствуют о наличии признаков
репродукции вируса в суспензионной культуре клеток по истечению 24-120 ч
культивирования вируса. Антигенная и инфекционная активность проб вирусной
суспензии через 48-72 ч составила 10-11 log2 и 4,75-6,25 lg МЛД50/см3, соответственно. В
пробах суспензии отобранных через 96-120 ч отмечены пиковые значения биологической
активности. Следует отметить, что при проведении корреляционного анализа, выявлена
высокая степень зависимости (r=0,97), между инфекционной и антигенной активностью в
пробах вирусных суспензий.
В работах Жестерова В.И., Лаптевой О.И. приведены результаты аналогичных
экспериментов по культивированию вируса бешенства штаммов «РБ-71» и «ТС-80» с
использованием питательной среды ФГМ [7, 8]. В отличие от указанных работ, в наших
экспериментах для суспензионного культивирования клеток ВНК-21 зараженных ВБ
штамм «VRC-RZ2» использовалась среда DMEM, при этом нами получены сравнительно
меньшие показатели пролиферативной активности при аналогичной первоначальной
посевной концентрации клеток. В тоже время инфекционная активность в пробах
суспензий отобранных через 96-120 была выше на 2 lg МЛД50/см3, что свидетельствует об
эффективности используемых параметров культивирования. Значительная разница в
титрах антигенной активности вирусного материала выявленная в наших экспериментах
(до 1:4096) по сравнению с результатами выше представленных авторов (до 1:90),
наиболее вероятно связана с использованием разных тест-систем ИФА для выявления
антигена ВБ.
Учитывая сроки снижения жизнеспособности клеток и отсутствия пролиферативной
активности зараженной культуры ВНК-21, зафиксированные через 72-96 ч, а также
максимальное накопление в суспензии клеток инфекционной и антигенной активности
регистрируемое к 96-120 ч следует заключить, что оптимальным периодом
культивирования вируса бешенства является 96 ч.
Полученное вирусное сырье по показателям инфекционной и антигенной активности
соответствует требованиям, предъявляемым к суспензиям вируса, используемым для
приготовления вакцин против бешенства, без дополнительных технологических приемов
(сепарирование, концентрирование) [2].
177
Заключение. Экспериментальным путем установлена возможность культивирования
ВБ штамм «VRC-RZ2» в суспензии культуры ВНК-21.
Максимальный прирост зараженных культур клеток ВНК-21 регистрировался через
72 ч, при этом концентрация жизнеспособных клеток достигала 1,45 млн на см 3, что
составляло 95% от общего количества клеток суспензии.
Максимальные значения инфекционной и антигенной активности отмечены в пробах
суспензий отобранных через 96-120 ч после заражения суспензии, которые составили 7,758,25 МЛД50/см3 и 11-12 log2, соответственно.
Полученные результаты позволяют рекомендовать суспензионный метод
культивирования ВБ штамм «VRC-RZ2» для масштабирования с целью использования в
промышленной наработке вирусной биомассы вируса бешенства.
Список литературы
1. Макаров В.В. Оральная вакцинация лисиц против бешенства безальтернативна
//Ветерианрная патология, №4, - 2009, С. 104-106
2. OIE Terrestrial Manual (2013) CHAPTER 2.1.13.RABIES, OIE
3. Русанова А.М., Жилин Е.С., Мамадалиев С.М., Троицкий Е.Н. Адаптация
органотканевого вируса-фикс бешенства к перевиваемым культурам клеток // Мат. межд
.конф. «Развитие межд. сотруд. в обл. изуч. инф. заб.» Новосибирск, 2004. С. 269
4. Жилин Е. С., Русанова А. М., Червякова О. В№ и др. Изучение
иммунобиологических свойств вируса бешенства штамма «VRC-RZ2» адаптированного к
перевиваемым клеткам сирийского хомяка // Актуальные вопросы современной биологии
: Мат. межд. конф. молодых ученых и студентов. – Алматы, 2006, - С. 90-91.
5. Жилин Е. С. Оптимизация условий культивирования вируса бешенства штамм
«VRC-RZ2» [Текст]/ Е. С. Жилин, А. М. Русанова, О. В. Червякова. // Ж. Биотехнология.
Теория и практика. – Степногорск, 2011. - №4. - С.104-109.
6. Жилин Е. С. Разработка и оптимизация условий постановки тест-системы для
диагностики бешенства сэндвич методом твердофазного иммуноферментного анализа
[Текст] / Е. С. Жилин, Ж. К. Кошеметов, В. М. Матвеева, А. Т. Татыбаева. // Ж.
Биотехнология. Теория и практика. – Степногорск, 2012. – №1. – С.77-83
7. Жестеров В.И., Лаптева О.И., Горшкова Т.Ф. Культивирование вируса бешенства
в суспензии клеток ВНК-21 // Биолого-экологические проблемы заразных болезней диких
животных и их роль в патологии сельскохозяйственных животных и людей: материалы
науч.-практ. конф. / ГНУ ВНИИВВиМ Покров, 2002.- С. 113-116
8. Лаптева О.И., Горшкова Т.Ф. Инфекционная и антигенная активность вируса
бешенства, выращенного в суспензии клеток ВНК-21 // Ветеринария. -2003,-№3.-С. 18-20.
Түйін. Құтырық вирусымен жұқтырылған ВНК-21 торша өсіндісін құрамында
сиырдың 5% қан сарысуы бар DMEM сүйемелдеуші қоректік ортасын қолдана отырып
суспензиялық жағдайда өсіргенде тіршілік қабілеті 95% болатын торшалардың
пролиферациялық индексі 2,5 құрады. Өсіру мерзімі 96-120 сағат аралығында вирустық
суспензияның инфекциялық және антигендік белсенділігі сәйкесінше >7,5 lg МЛД 50/см3
және > 11 log2 болды. Алынған нәтижелер құтырық вирусының биомассасын өндірістік
мақсатта өндіру үшін суспензиялық әдісті вирусты өсіруге мүмкіндік береді.
Summary. Proliferation index was > 2,5 at cell viability of 95% with using maintenance
medium DMEM containing 5%cattle serum for suspension cultivation of infected ВНК-21 cells.
Infectious and antigenic activity of virus suspension for 96-120 hours of cultivation was > 7,5l
gMLD50/cm3 and > 11 log2, respectively. The obtained results allow to recommend the
suspension method of virus cultivation for using in industrial for production of virus biomass of
rabies virus.
178
УДК 619:616.98:579.843.95
ГЕНЕТИЧЕСКИЙ АНАЛИЗ ФИМБРИАЛЬНЫХ ГЕНОВ
БАКТЕРИЙ PASTEURELLA MULTOCIDA ВЫДЕЛЕННЫХ ОТ САЙГАКОВ
Тленчиева Т.М., Шораева К.А., Строчков В.М.., Султанкулова К.Т., к.б.н., Сандыбаев
Н.Т., к.б.н., Сансызбай А.Р., д.в.н., профессор
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. В данной статье представлены результаты работ по молекулярно генетической характеристике генов fimA и ptfA штаммов бактерий Pasteurella multocida,
выделенных от сайгаков на территории Республики Казахстан. Результаты проведенных
исследований показали, что по генам fimA и
ptfA штаммы «Сайгачий», 1988г.,
Pasteurella/Saigas/2010/ZKO/KZ и Pasteurella/Saigas/2011/ZKO/KZ, выделенные в
Республики Казахстан, идентичны между собой на 100 %.
Также было выявлено, что нуклеотидная последовательность участка гена fimA
казахстанских штаммов на 97 % идентичен со штаммом Pasteurella multocida 3480
(СР001409.1), из международной базы данных Genbank, тогда как по участку гена ptfA
степень идентичности составила 99 %.
Введение. Благодаря применяемым мерам по охране сайгаков основное поголовье
сохранилось только в Казахстане. Из-за резкого сокращения их численности они были
занесены в Международную Красную книгу. В настоящее время основная роль в развитии
смешанных септических и респираторных инфекций сайгаков отводится бактериям, в
частности Pasteurella multocida.
Pasteurella multocida - патогенная грамотрицательная бактерия, обитающая на
слизистой оболочке верхних дыхательных путей животных. Бактерия обладает
несколькими факторами вирулентности (капсула, дермонекротический токсин, адгезины,
протектины, гиалуронидаза, железотранспортирующие протеины), обуславливающими ее
патогенность для крупного рогатого скота [1]. Комбинация факторов вирулентности у
штаммов и изолятов бактерии Pasteurella multocida может быть разной, но во всех случаях
обеспечивает проявление их патогенности.
В качестве объекта исследований нашей работы были выбраны фимбриальные гены,
являющиеся одним из факторов вирулентности бактерии. Они играют решающую роль в
обеспечении колонизации и инвазии в клетке хозяина. Таким образом, их присутствие на
бактериальной поверхности, как правило, связаны с их вирулентностью. В число
фимбриальных генов относятся гены fimA и ptfA [2].
Целью данной работы является проведение генетического анализа фимбриальных
генов бактерии Pasteurella multocida, выделенных от сайгаков на территории Республике
Казахстан.
Материалы и методы. Биоматериалы. В работе использовали следующие штаммы:
Pasteurella/Saigas/2010/ZKO/KZ
,
Pasteurella/Saigas/2011/ZKO/KZ
и
«Сайгачий»,
выделенные 1988 г. от павших сайгаков на территории Республики Казахстан.
Выделение бактериальной ДНК. Выделение ДНК проводили с использованием
коммерческого набора “PrepMan Ultra Sample Preparation Reagent” фирмы Applied
Biosystems, согласно протоколу производителя.
Постановка ПЦР. Амплификацию фрагментов ДНК генов бактерии Pasteurella
multocida проводили на термоциклере «GeneAmp PCR 9700», фирмы «Applied Biosystems»,
с использованием следующих праймеров:
179
fimA-f (CCATCGGATCTAAACGACCTA) и fimA-r (AGTATTAGTTCCTGCGGGTG),
ptf-f
(TGTGGAATTCAGCATTTTAGTGTGTC)
и
ptf-r
(TCATGAATTCTTATGCGCAAAATCCTGCTGG)
[3]. Реакционной
смеси
была
приготовлена согласно протоколу набора «AccuPrime Taq DNA Polymerase High Fidelity»:
2,5 µl - 10X ПЦР буфера, 1 µl каждого праймера (20 pmol/µl), 0,2µl - Taq DNA полимеразы,
4 µl - ДНК, 16,3 µl - H2O. Условия амплификации: 94ºC - 2 мин; 35 циклов 94ºC - 30 сек,
55ºC - 30 сек, 68 ºC - 1 мин, и 1 цикл 68ºC - 10 мин.
Анализ ПЦР продуктов. Детекцию ПЦР продуктов проводили на 2% агарозном геле в
1 х ТАЕ буфере с бромистым этидием.
Секвенирование
ДНК.
Секвенирование
ДНК
проводили
методом
дидеоксисеквенирования с использованием терминирующих дидеоксинуклеотидов (метод
Сенгера) на автоматическом 16-капиллярном секвенаторе Genetic Analyser 3130 xl, Applied
Biosystems. В качестве полимера для капилляров использовали РОР-7. Наработку
терминирующих продуктов ДНК проводили методом циклического секвенирования.
Сравнительный анализ нуклеотидных последовательностей генов проводили,
используя компьютерную программу BLAST.
Результаты исследований. Молекулярные основы патогенеза и защитного
иммунитета животных против инфекции Pasteurella multocida до конца не изучены.
Предполагают, что белки наружной мембраны, белки, участвующие в приобретении
железа, ферменты- сиалидазы, токсины, а также различные адгезины могут играть
определенную роль в механизмах патогенеза.
Наработку продуктов участков генов fimA и ptfA, относящиеся к фимбриальным
генам, штаммов Pasteurella/Saigas/2010/ZKO/KZ, Pasteurella/Saigas/2011/ZKO/KZ и штамма
«Сайгачий» проводили методом ПЦР. Результаты электрофореза наработанных продуктов
представлены на рисунке 1.
А
Б
М - Маркер, 1 kb, Invitrogen; о.к. - отрицательный контроль; 1 - изолят
Pasteurella/saigas/2010/ZKO/KZ; 2 - изолят Pasteurella/saigas/2011/ZKO/KZ и 3 - штамм
«Сайгачий». А - участок гена fimA (850 п.о.), Б - участок гена ptfA (488 п.о.)
Рисунок 1 - Электрофореграмма фрагментов fimА и ptfA штаммов, выделенных от
павших сайгаков на территории Республики Казахстан.
Как видно из рисунка 1, во всех исследуемых пробах получены ПЦР продукты
размером 850 п.о. и 488 п.о. для участков генов fimA и ptfA соответственно. Методом
секвенирования определены их нуклеотидные последовательности и проведен
генетический анализ с использованием компьютерной программы BLAST (рисунок 2).
180
fimA
ptfA
Рисунок 2 - Сравнительный анализ участков генов fimA и ptfA штаммов «Сайгачий»,
Pastreurella/Saigas/ 2010/ZKO/KZ, Pastreurella/Saigas/ 2011/ZKO/KZ с данными ГенБанк
По результатам проведенного сравнительного анализа было выявлено, что по участку
гена fimA казахстанские штаммы имеют 97 % идентичности со штаммом Pasteurella
multocida 3480 (СР001409.1) из международной базы данных ГенБанк. Тогда как при
сравнительном анализе нуклеотидных последовательностей участка гена ptfA
казахстанских штаммов со штаммами Pasteurella multocida3480 (CP001409.1), Pasteurella
multocidaHN06 (CP003313.1), Pasteurella multocida3480 Pm70 (AE004439.1) и Pasteurella
multocida 36950 (CP003022.1), взятых из международной базы ГенБанк, степень
идентичности составило 99 %.
Далее проводилось сравнительный анализ участков генов fimA и ptfA штамма
«Сайгачий» со штаммами Pasteurella/Saigas/ 2010/ZKO/KZ, Pasteurella/Saigas/
2011/ZKO/KZ, результаты преставлены на рисунке 3.
fimA
ptfA
Рисунок 3 - Сравнительный анализ фрагментов fimA и ptfA штамма «Сайгачий» со
штаммами Pasteurella/Saigas/ 2010/ZKO/KZ, Pasteurella/Saigas/ 2011/ZKO/KZ программой
BLAST
181
Результаты сравнительного анализа по участкам генов fimA и ptfA показывают, что
идентичность штамма «Сайгачий» со штаммами Pasteurella/Saigas/2010/ZKO/KZ и
Pasteurella/Saigas/2011/ZKO/KZ составляет 100 %.
В работах зарубежных исследователей Ewers соавт. [4] и Тан и др. [3] представлены
данные по определению вирулентных генов в геноме Pasteurella multocida, кодирующие
белки с различными функциями, такими как железо связывающие белки (exbB, exbD,
TonBех), гиалуронидазы (pmHAS), гемоглобин связывающие белки (hgbA и hgbB),
супероксид дисмутазы (SodC), порины, нейраминидаза (nanH и nanB), адгезины (fimA, hsf1, hsf-2) и мембранные белки (oma87, ompH, plpB).
Также в литературе встречаются работы которые показывают, что ген ptfA,
выделенный из разных регионов Азии и Австралии имеет две основные
последовательности в геноме бактерии Pasteurella multocida. Поэтому, требуются
дополнительные информации о последовательности гена ptfA бактериального штамма,
выделенных в других географических регионах. Изучение генетического полиморфизма
данного гена может помочь определить ключевые факторы, ответственные за различные
клинические исходы инфекции Pasteurella multocida у животных. Кроме того, зарубежные
исследователи относят генов fimA и ptfA к компонентам вакцинных препаратов против
пастереллеза [5].
Выводы. В работе была изучена молекулярно - генетическая характеристика
фрагментов
fimA и ptfA казахстанских штаммов бактерий Pasteurella multocida,
выделенных от сайгаков на территории Республике Казахстан.
Результаты сравнительного анализа по участкам генов fimA и ptfA показали, что
штаммы «Сайгачий», Pasteurella/Saigas/2010/ZKO/KZ и Pasteurella/Saigas/2011/ZKO/KZ
идентичны между собой на 100 %.
Сравнительный анализ нуклеотидной последовательности участка гена fimA на 97 %
идентичен со штаммом Pasteurella multocida 3480 (СР001409.1), из международной базы
данных ГенБанк, тогда как по фрагментам ptfA казахстанских штаммов степень
идентичности составила 99 %.
Список литературы
1 . Dabo S.M., Taylor J.D., Confer A.W. Pasteurella multocida and bovine respiratory
disease // Animal Health Research Reviews. - 2008. - Vol.8 (2). - P.129 - 150.
2. Jing Yeng Chung, Jan Wilkie, John D. Boyce, Kirsty M. Townsend, Alan J.Frost, Majid
Ghoddusi, Ben Adler. Role of Capsule in the Pathogenesis of Fowl Cholera Caused by
Pasteurella multocida Serogroup A // Infection and Immunity. - 2001. - P. 2487 - 2492.
3. Xibiao Tang, Zhanqin Zhao, Junyong Hu, Bin Wu, Xuwahg Cai, Qigai He, Huanchun
Chen. Isolation, Antimicrobial Resistance, and Virulence Genes of Pasteurella multocida Strains
from Swine in Chine // Journal of Clinical Microbiology. - 2009. - P. 951 - 958.
4. Ewers C., Lübke Becker A., Bethe A., Kießling S., Filter M., Wieler L.H. Virulence
genotype of Pasteurella multocida strains isolated from different hosts with various disease status
// Veterinary Microbiology. - 2006. - P. 304 - 317.
5. Ernie A., Zamri Sead M., Zunita Z., Omar A.R., Siti Kairani B. and sabri M.Y.
Sequencing and Expression of Fimbrial Gene of Pasteurella multocida B:2 // Journal of Animal
and Veterinary Avidances. - 2005. - P. 254 - 259.
Түйін. Бұл мақалада Қазақстан Республикасындағы киіктерден бөлініп алынған
Pasteurella multocida бактериясының қазақстандық штамдарының fimA және ptfA
гендерінің молекулалы – генетикалық сипаттамары көрсетілген. Жүргізілген зерттеулер
нәтижесінде Қазақстан Республикасында бөлініп алынған штамдар «Сайгачий», 1988г.,
Pasteurella/Saigas/2010/ZKO/KZ және Pasteurella/Saigas/2011/ZKO/KZ fimA және ptfA
182
гендері бойынша өзара 100 % ұқсастықты көрсетті. Сондай – ақ қазақстандық штамдардың
fimA ген бөлігінің нуклеотидтік тізбегі халықаралық база ГенБанк мәліметтерінен алынған
Pasteurella multocida 3480 (СР001409.1) штамымен 97 %, және де ptfA ген бөлігінің
нуклеотидтік тізбегі 99 % құрады.
Summary. This article presents the results of studies on the molecular - genetic
characterization of genes fimA and ptfA of Kazakhstan strains of bacteria Pasteurella multocida,
isolated from the saiga in Kazakhstan. The studies showed that the genes fimA and ptfA the
“Saiga”
strains
isolated
in
1988,
Pasteurella/Saigas/2010/ZKO/KZ
and
Pasteurella/Saigas/2011/ZKO/KZ, isolated in the Republic of Kazakhstan are identical to each
other in 100 %.
It was also revealed that the nucleotide sequence of the gene fimA of Kazakhstan strains by
97% identical with the strain of Pasteurella multocida 3480 (SR001409.1), from international
database of GenBank , while the section of the gene ptfA degree of identity was 99%.
УДК 579.674
БАКТЕРИОЦИНПРОДУЦИРУЮЩИЕ ШТАММЫ МОЛОЧНОКИСЛЫХ
БАКТЕРИЙ ПОДАВЛЯЮЩИЕ РОСТ LISTERIA MONOCYTOGENES
Уразова М.С. (к.б.н.)1, Молдагулова А.К.1, Джаилбекова А.С. (к.б.н.)2, Келдибекова Р.Н.1,
Кажыбаев А.К.1, Абдыкадырова А.Б.1, Бекенова Э.Е.1
РГП «Республиканская коллекция микроорганизмов» МОН РК, Казахстан, г. Астана
1
РГП «Национальный референтный центр по ветеринарии» МСХ РК, Казахстан, г.
Астана 2
Резюме. Нами были выделены и идентифицированы 17 культур молочнокислых
бактерий из национального мясного продукта питания Қазы. Была проведена оценка
антагонистической и бактериоциногенной активностей выделенных культур. В результате
отобран один штамм Lactobacillus sakei - 24A, продуцирующий бактериоцин активный в
отношении ряда патогенов в том числе Listeria monocytogenes.
Введение. В последние годы структура инфекционной патологии человека
претерпевает существенные изменения, связанные в первую очередь с открытием ранее
неизвестных возбудителей, а также с изменением роли и удельного веса известных ранее
патогенов. К числу последних относится и Listeria monocytogenes. Листериоз не привлекал
к себе большого внимания исследователей до 80-х годов 20 века, когда стали
регистрироваться частые эпидемические вспышки данного заболевания пищевого
происхождения с тяжелым клиническим течением и летальностью до 24-40% в
большинстве развитых стран (США, Франция, Великобритания, Испания, Дания и др).
Причины подобного изменения эпидемической ситуации в мире связывают с длительным
хранением пищевых продуктов при низкой температуре, что способствует размножению в
них листерий при первично слабой контаминации ими. С другой стороны, нельзя
исключать возможности изменения свойств штаммов, циркулирующих в окружающей
среде и представляющих опасность для человека [1].
Проблема пищевого листериоза, как и медицинского также имеет существенное
социально-экономическое значение. Так изъятие зараженных листериями партий
продуктов из торговли, ограничение ввоза и вывоза продуктов, остановка их производства,
183
заболеваемость и падеж сельскохозяйственных животных наносят ущерб в сотни
миллионов странам – экспортерам сыра и мясных продуктов. В целях предупреждения
вспышек листериозов в ряде европейских стран введен строгий контроль за уровнем
контаминации листериями продуктов питания. Для решения поставленной цели
приоритетным направлением является разработка новых эффективных и безопасных
технологий. К ним относится поиск и изучение биологически-активных штаммов
молочнокислых бактерий, продуцирующих органические кислоты и бактериоцины,
способные подавлять рост Listeria monocytogenes в продуктах питания при длительных
сроках хранения [2]. Проведение подобных исследований целесообразно и для Казахстана,
агропромышленный комплекс которого, преодолев многолетний кризис, сейчас активно
развивается.
В данных исследованиях нами была изучена бактериоциногенная активность
штаммов молочнокислых бактерий, выделенных из казахского национального продукта
питания Қазы и воздействие данных бактериоцинов на рост Listeria monocytogenes.
Материалы и методы. Объектами исследования стали 17 культур молочнокислых
бактерий, которые были выделены нами из казахского национального продукта қазы
(Караганда) в апреле 2012.
Для получения чистых культур был использован метод десятичных разведений с
последующим пересевом на твердую питательную среду (MRS, HiMedia), селективную по
отношению к МКБ. Были отобраны грамположительные кокки и палочки,
каталазонегативные и не образующие колонии на мясопептонном агаре.
Для определения нуклеотидной последовательности 16S rDNA проводили ПЦР с
использованием праймеров 8f и 806r, которые являются универсальными для бактерий
(Applied Biosystems, США), согласно инструкциям фирмы-производителя.
Антагонистическую активность МКБ по отношению к тест-культурам: E.coli,
S.marcescens, S.aureus, P.vulgaris изучали методом отсроченного антагонизма. Для
изучения бактериоциногенной активности использовали метод диффузии в агар,
описанный Yang et al. (2012г), с тремя видами супернатантов: 1 – чистый; 2 - с
добавлением NaOH, для подавления действия кислоты; 3 - с добавлением NaOH и
каталазы, для нейтрализации, как кислоты, так и перекиси водорода [3]. Супернатанты
молочнокислых бактерий получали в результате осаждения 16-часовой культуры,
выращенной на жидкой среде МРС, на центрифуге при 15 тыс. оборотов в течение 5 мин.
После добавления реагентов супернатанты фильтровали (0,40µМ – Millipore,США) в целях
стерилизации [4].
Проверка антагонистической и бактериоциногенной активности МКБ по отношению
к Listeria monocytogenes, проводилась нами на базе РГП «Национальный референтный
центр по ветеринарии» МСХ РК, штамм В 0600 КДК-1 был предоставлен музеем данной
организации. Данный штамм был выделен в апреле 2012 года от павшего верблюда
Мангистауской области, Бейнеуский р-н, к/х "Абен".
Результаты исследований. В результате идентификации методом анализа
нуклеотидных последовательностей гена 16S rRNA были определены виды
молочнокислых бактерий, выделенных из қазы. Согласно генетической идентификации 17
культур были отнесены к семи различным видам: Lactobacillus sakei (4), Leuconostoc
garlicum (1), Weissella spp. (5), Pediococcus spp.(2), Lactococcus garvieae(2), Lactococcus
lactis(2), Leuconostoc mesenteroides(1).
При помощи метода отсроченного антагонизма были отобраны 4 наиболее активных
штамма: Pediococcus spp-8А, Lactococcus garvieae-10А, Lactococcus lactis-17А, Lb.sakei 24A, обладающие высокими показателями антагонистической активности в отношении
всех четырех тест-культур.
184
Далее, с применением методики Yang et al. (2012) была исследована
бактериоциногенная активность у всех 17 выделенных культур. В итоге только у двух
штаммов было подтверждено наличие в супернатантах бактериоцинов, а именно у
Lactococcus garvieae - 10А и Lactobacillus sakei -24A.
Используя ту же методику мы определили ингибирующую активность
бактериоцинов штаммов Lactococcus garvieae - 10А и Lactobacillus sakei -24A по
отношению к L. monocytogenes. Полученные данные представлены в таблице.
Таблица - Бактериоциногенная активность штаммов Lactococcus garvieae - 10А и
Lactobacillus sakei -24A по отношению к Listeria monocytogenes.
№
Название штамма МКБ
1
24A - Lactobacillus sakei
Различные
модификации
супернатантов
Чистый супернатант
+NaOH
2
10а - Lactococcus garvieae
pH 6
Диаметр зоны лизиса
роста
Listeria
monocytogenes (мм)
14
12
+NaOH +каталаза
рH 6 -H2O2
Чистый супернатант
12
+NaOH
10
pH 6
+NaOH +каталаза
рH 6 -H2O2
10
-
Из таблицы видно, что исследуемые два штамма способны ингибировать рост
L.monocytogenes, но у штамма Lactococcus garvieae - 10А данное свойство не связано с
продукцией бактериоцина. Напротив бактериоциногенная ингибирующая активность
штамма Lactobacillus sakei - 24A по отношению к L.monocytogenes является ярко
выраженной.
Согласно литературным данным бактериоцины Lactobacillus sakei ингибирующие
листерии относятся к бактериоцинам класса 2 – сакацинам. Идентификация бактериоцина
штамма Lactobacillus sakei - 24A ведется в настояшее время.
Выводы. Инновационным подходом в данное время является выделение
бактериоциногенных штаммов непосредственно из продуктов питания, так как в этом
случае сами бактерии, как и их бактериоцины, могут быть использованы в качестве
природных биологических консервантов [4]. Штамм Lactobacillus sakei - 24А относится к
гетероферментативным лактобациллам, он был выделен нами из мясного национального
продукта питания Қазы, обладает рядом ценных свойств, одним из которых являются
высокие показатели антагонистической активности в отношении основных патогенных
бактерий, контаминирующих продукты питания, в том числе по отношению к особо
опасному микроорганизму Listeria monocytogenes. Он является умеренным
кислотообразователем, что также делает его производственно ценным, так как его
применение не вызовет у продукта изменение вкусовых характеристик в сторону
повышения кислотности. Использование данного штамма при производстве мясных
полуфабрикатов как отдельно, так и в составе композиции других стартерных культур
благоприятно скажется на качестве продуктов и продлит срок их хранения.
185
Список литературы
1. Hartmann H., Wilke T. Efficacy of bacteriocin containing cell-free culture supernatants
from lactic acid bacteria to control Listeria monocytogenes in food // International Journal of
Food Microbiology, 2011, P. 192-199.
2. Anna Sip, Michal Wieckowicz, Olejnik-Schmidt A. Anti-Listeria activity of lactic acid
bacteria isolated from golka, a regional cheese produced in Poland //Food control, 2012, P.117124.
3. Yang E., Fan L., Doucette C., Fillmore S. Antimicrobial activity of bacteriocinproducing lactic-acid bacteria isolated from cheeses and yogurts // AMB Express a Springer
Open Journal.- Canada.- 2012. – P.134-139.
4. Todorov S. Bacteriocin production of Lactobacillus plantarum isolated from Amasi, a
Zimbabwean fermented milk product and study of adsorption of bacteriocin to Listeria spp.//
Brazilian Journal of microbiology, 2008,P.178-187.
Түйін. Ұлттық ет тағамы Қазыдан сүтқышқылы бактерияларының
17 түрлі
культуралары бөлініп алынды және анықталды. Бактериоциногенді белсенділігіне
қабілетті штаммдар алынған. Нәтижесінде Listeria monocytogenes патогенді қатардың
салыстыруында бактериоцин өндіретін белсенді Lactobacillus sakei - 24A штаммы
таңдалып алынды.
Summary. 17 cultures of lactic acid bacteria were isolated and identificated from Kazakh
national meat product Khazy. Strains which posses bacteriocinogenic activity were defined. In a
result we selected one strain Lactobacillus sakei - 24A with bacteriocinogenic activity, which
active against a number of pathogens including Listeria monocytogenes.
УДК 579.695
ВЫДЕЛЕНИЕ РАЗЛИЧНЫХ ФИЗИОЛОГИЧЕСКИХ ГРУПП
МИКРООРГАНИЗМОВ БЫТОВЫХ СТОЧНЫХ ВОД
Хасенова Э.Ж., Молдагулова Н.Б. к.в.н.
РГП «Национальный центр биотехнологии» КН МОН РК
Резюме. Выделены из сточной воды и ила протеолетически, липолитически,
целлюлолитически, амилолитически активные изоляты, а также изоляты разрушающие
СПАВ. Изучены культурально-морфологические свойства выделенных изолятов
и
определена родовая принадлежность.
Введение. Проблема охраны окружающей среды требует ускоренного внедрения
высокоэффективных систем защиты водоемов от антропогенных загрязнений. Основным
источником загрязнения водоемов, приводящим к ухудшению качества воды, являются
сбросы промышленных и бытовых сточных вод [1].
Сточные воды обычно содержат в своем составе отходы бытового характера и
производственные отходы, т.е. состоят из органических веществ и биологического
загрязнения. Органическое вещество бытовых сточных вод представлено в основном
мочевиной, белками, жирами, углеводами и продуктами их разложения, различными
органическими кислотами, синтетическими поверхностно активными веществами (СПАВ).
К биологическим загрязнениям относят различные микроорганизмы, бактерии, вирусы,
дрожжевые и плесневые грибки, мелкие водоросли т.д. [2] В сточные воды
186
микроорганизмы поступают в количествах составляющих триллионы организмов
ежесуточно. Немало микроорганизмов попадает в сточные воды с отбросами пищевых
продуктов, либо с туалетными стоками. Преобладающими классами микроорганизмов
являются бактерии и вирусы.
В сточных водах микроорганизмы окисляют органические вещества, при этом часть
расходуется на энергетические нужды микроорганизмов, а другая часть на синтез
клеточного вещества. Часть поллютантов сточных вод, расходуемая на энергетические
потребности, окисляется микроорганизмами до конечных продуктов разложения, состав
которых зависит от вида окисляемого компонента, окислительно-восстановительных и
кислотно-щелочных условий среды. В процессе разложения в сточных водах появляются
запахи сероводорода, аммиака, меркаптана.
Численное преобладание того или иного компонента биоценоза служит индикатором
стабильности и эффективности технологического процесса очистки сточных вод. Данный
метод позволяет определить отклонения микроорганизмов и изменение видового состава
биоценоза от нормального состояния и прогнозировать сроки и перспективы изменения
нормального протекания технологического процесса биологической очистки сточных вод.
Биологическая очистка может осуществляться, как в естественных, так и в искусственных
условиях.
Исходя из вышеизложенного, цель работы заключается
в выделении
микроорганизмов различных физиологических групп участвующих в биологической
утилизации неприятных запахов и илов городских бытовых стоков и изучении основных
свойств выделенных бактериальных культур.
Материалы и методы исследований. Выделение культур микроорганизмов
проводили из сточной воды и ила методом накопительных культур с последующим
высевом на селективные среды.
Проверку чистоты культур проводили методом
микроскопии.
Методика выделения микроорганизмов заключалась в приготовлении пробы
активного ила и воды, посеве их на селективные среды, визуальном анализе выросших
колоний.
Пробу из надосадочного слоя активного ила в объеме 1 мл высевали на пластинки
селективной среды. Посевы инкубировали в течение пяти суток, после чего проводили
учет результатов (анализ роста культур микроорганизмов).
Культуральные свойства выделенного изолята определяли визуально, анализируя
изолированные колонии. Определяли вид колонии, ее окраску, размеры, форму, профиль и
характер края. Чистую культуру микроорганизмов обязательно контролировали под
микроскопом.
Морфологические свойства микроорганизмов оценивали, окрашивая бактериальные
клетки по Грамму и микроскопируя в проходящем свете оптического микроскопа.
Для определения липолитических, протеолитических, углеводородокисляющих,
амилолитических активных микроорганизмов и микроорганизмов, разрушающие
синтетические поверхностно-активные вещества, использовали следующие виды
питательных сред: сухой питательный агар (СПА); сухой питательный бульон (СПБ);
МРС, псевдомонадный агар с добавлением специфических субстратов.
Идентификацию
микроорганизмов
проводили
генотипированием
по
консервативному локусу 16S r DNA.
Результаты исследований. Из проб сточной воды и ила выделены 60 изолятов
микроорганизмов, относящиеся к различным физиологическим группам.
Для изучения культуральных свойств и получения изолированных колоний из
отсеянной на скошенный агар чистой культуры приготовили взвесь микроорганизмов с
187
концентрацией 107 клеток в 1 мл, проводили десятикратные разведения и высевали на
пластинки питательного агара в чашки Петри. Выросшие на питательном агаре колонии
оценивали визуально, описывая характер роста выросших колонии. При этом выросшие
колонии имели цвет: красный, желтый, белый, оранжевый и бежевый. Некоторые
культуры выделяли желтоватый, коричневый и зеленый пигмент на среду.
По макроморфологическим свойствам исследуемые изоляты бактерий представляют
собой круглые колонии диаметром 1-3 мм, мягкой консистенции, с ровными краями и
плоским или выпуклым профилем, а некоторые круглые колонии с выраженным центром,
плоские, с диаметром 2 мм или меньше, с неровными краями в зависимости от условий
культивирования и фазы роста. Наблюдались колонии как гладкие, так и шероховатые,
слегка опалесцирующие, прозрачные, редко белые, красные, желтые. Большинство
изолятов имели колонии гладкой S –формы с ровными краями (рисунок 1). По характеру
роста в жидкой питательной среде изоляты характеризовались ростом в виде равномерного
помутнения столбика бульона.
Микроморфология изолятов была представлена грамположительными, длинными и
тонкими удлиненными или толстыми палочками с закругленными краями,
расположенными единично, скоплениями или в виде цепочек различной длины. Размеры
выделенных бактерий в среднем варьирируют в диапазоне от 2 до 10 мкм. Однако,
встречаются грамнегативные и грампозитивные палочки более мелких размеров, что
придает вид кокковидной формы, расположенных одиночно, попарно или цепочками,
некоторые виды бактерий образовали споры.
Рисунок 1- Культуральные свойства выделенных изолятов
Выделенные чистые культуры
проверяли на биологическую активность
(липидолитическая, протеолитическая, углеводородокисляющая, амилолитическая и.т.д.)
при этом амилолитической активностью обладали 6 культур. Размеры зоны гидролиза
колебались в пределах 0,6-1,8 мм. 8 культур обладали протеолитической активностью, т.е
расщепляли казеин на молочном агаре. Целлюлолитическими свойствами обладали 5
культур, липолитической активностью обладали 8 кульур и углеводородокисляющая
активность, наблюдалась у 7 культур.
188
Рисунок 2 - Протеолитическая, амилолитическая и целлюлозная активности
выделенных культур
Для определения способности микроорганизмов разрушать, СПАВ, осуществляли с
помощью визуального наблюдения за изменением уровня дегидрогеназной активности
микроорганизмов по размерам зоны их роста на плотной питательной среде Е-8,
окрашенной за счет цветной реакции с реактивом ТТХ, добавленного в среду и
восстанавливающегося из бесцветной соли в соединении трифенилформазана (ТФФ)
красного цвета при окислительно-восстановительных реакциях микробного разложения
СПАВ. При этом положительная реакция, окрашенная в красный цвет наблюдали у 2
культур.
Видовую принадлежность активных изолятов определяли генотипированием по
консервативному локусу 16S r DNA [3,4 ].
Генотипирование выделенных культур проводили по анализу нуклеотидной
последовательности гена 16S r DNA. Выделение ДНК из бактериальных клеток проводили
методом Вильсона. Наличие продукта амплификации с праймером 16S рРНК проверяли
электрофорезом в агарозном геле. По результатам генетической идентификации
выделенные микроорганизмы с 98-99% гомологией отнесены к следующим родам:
Bacillus, Pseudomonas, Rhodococcus, Serratia, Lactobacillus, Comomonas ,Stenotrophomonas,
Aeromonas, Acidovorax.
Выводы. Таким образом, в результате проведенных исследований были выделены
протеолетически, липолитически, целлюлолитически, амилолитически активные изоляты,
а также изоляты разрушающие СПАВ, перспективные для использования в биологической
очистке сточных вод. По макро и микроморфологическим свойствам выделенные
культуры принадлежат к группе грамопозитивных и грамнегативных микроорганизмов. В
результате определения родовой принадлежности, выделенные
микроорганизмы
отнесены к различным физиологическим группам.
Список литературы
1. Ершов М.Е. Самые распространенные способы очистки воды. - М.: ACT; Донецк:
Сталкер, 2006. - 94 с.
2. Яковлев СВ., Волков Л.С, Воронов Ю.В., Волков В.Л. Обработка и утилизация
осадков производственных сточных вод. – М.: Химия, 1999. – 448
3. Clayton R. A., Sutton G., Hinkle P. S., Bult Jr. C., Fields C.. 1995. Intraspecific
variation in small-subunit rRNA sequences in GenBank: why single sequences may not
adequately represent prokaryotic taxa // International Journal of Systematic Bacteriology. – 1995.
– Vol. 45. – P. 595–599.
4. Werle E., Schneider C., Renner M., Völker M., Fiehn W. Convenient single-step, one
tube purification of PCR products for direct sequencing // Nucleic Acids Res. – 1994. – Vol. 22. P. 4354-4355.
189
Түйін. Қайтарылған сумен лайдан
протиолитикалық, липолитикалық,
целлюлолитикалық, амилолитикалық және синтетикалық беткейлік белсенді заттарды
ыдырататын белсенді изоляттар болініп алынды. Бөлініп алынған изоляттардың
культуралық, морфологиялық қасиеттері зерттеліп? Олардың түрлері анықталды.
Summary. Isolates with high proteolytic, lipolytic, cellulolytic, amylolytic activity and
isolates with ability to degrade synthetic surface active agentswere isolated from wastewater and
sewage sludge. The
cultural-morphological
properties of
these
isolates were
studied and determined their genus.
УДК 606:62:628.16.08:579.5
СКРИНИНГ НЕФТЕОКИСЛЯЮЩИХ МИКРООРГАНИЗМОВ ПО
СПОСОБНОСТИ К РОСТУ НА РАЗЛИЧНЫХ УГЛЕВОДОРОДАХ
Хасенова Э.Ж., Шарипова Г.Ж., Молдагулова Н.Б. к.в.н.
РГП на ПХВ «Национальный центр биотехнологии» КН МОН РК
Резюме. В статье приводятся результаты исследований по способности к росту на
углеводородах нефтеокисляющих микроорганизмов, выделенных из почв Западного
Казахстана. Определен спектр потребления различного ряда углеводородов активными
штаммами углеводородокисляющих микроорганизмов.
Введение. Нефть представляет сложную смесь углеводородов. Известно, что
почвенная микрофлора активно участвует в процессах естественной деструкции
углеводородов [1,2].
Углеводороокисляющие бактерии эффективно окисляют ароматические и
нециклические компоненты. Особенно важной частью является рост на ароматических
углеводородах, таких как толуол, бензол, которые в естественных условиях и при
биоремедиации разлагаются сложнее. Трудно утилизируемыми субстратами для
микроорганизмов являются тяжелые фракции нефти. Эти компоненты малодоступны
бактериям [3,4].
Поэтому для исследования процесса биодеградации нефтепродуктов представляется
интересным изучение спектров потребления углеводородов у нефтеокисляющих
микроорганизмов. Нами был изучен нефтеокисляющий потенциал активных штаммов
нефтедеструкторов, благодаря своей высокой утилизирующей способности.
Целью работы являлась оценка способности нефтеокисляющих микроорганизмов к
росту на различных углеводородах и их утилизации.
Материалы и методы исследования. Изучение способности культур
микроорганизмов к росту на отдельных углеводородах и нефтепродуктах определяли
методом отпечатков. Для скрининга микроорганизмов по способности к росту на жидких
углеводородах и нефтепродуктах проводили посев культур на агаризованную среду В-Д с
помощью репликатора, на крышку чашки Петри помещали стерильную фильтровальную
бумагу, пропитанную 2 мл углеводорода или нефтепродукта. Засеянные, таким образом,
чашки Петри помещали в термостат при температуре 30 0С. Результаты снимали через 7
суток роста.
Для изучения способности культур микроорганизмов к росту на различных
углеводородах производили посев чистых культур на минеральную среду с добавлением
190
алифатических, ароматических, полициклических углеводородов и твердых парафинов в
концентрации 1%. Культивирование осуществляли при температуре 10 0С в шейкере
«Innova 43» в течение 14 суток. Динамику роста культур на различных источниках
углерода оценивали по изменению оптической плотности суспензии микроорганизмов на
спектрофотометре, степени накопления клеток по Коху в процессе культивирования на
минеральной среде и степени деструкции углеводородов методом ИК-фурье.
Результаты исследований. Нефтеокисляющий потенциал 105 культур УОМ изучали
путем выращивания на питательных средах в атмосфере насыщенной парами
нефтепродуктов (жидких и твердых углеводородов) методом отпечатка (рисунок 1). В
качестве единственного источника углерода и энергии в среду вносили: бензин, керосин,
дизельное топливо, гексан, бензол, О-ксилол, хлороформ, нафталин, фенантрен, дифенил и
салициловую кислоту. О деструкции углеводородов судили по интенсивности роста
культур.
Рисунок 1- Деструкция углеводородов методом отпечатка
В
результате
проведенного
скрининга
выявлено,
что
культуры
углеводородокисляющих микроорганизмов различались между собой по спектру
усвояемых углеводородов и нефтепродуктов. При этом интенсивный рост в парах
дизельного топлива показали только 30 культур микроорганизмов, в парах керосина – 8 и в
парах бензина 6 культур микроорганизмов. Средний и слабый рост на керосине и
дизельном топливе показали примерно 30 культур микроорганизмов, на бензине – 23
культуры микроорганизмов.
На твердых ароматических углеводородах (нафталин, фенантрен, дифенил)
интенсивный рост показали всего 12 культур микроорганизмов, тогда как отсутствие роста
отмечалась у 52% случаев слабым и средним ростом обладали примерно 43 культур.
Наиболее токсичным среди жидких углеводородов оказался хлороформ,
относящийся, к хлорированным углеводородам, в присутствии которого только одна
культура показала слабый рост.
Среди твердых углеводородов – токсичным оказалась салициловая кислота,
(производная фенола) в присутствии которой подавление роста наблюдали у 98 культур
микроорганизмов.
Гексан, пентадекан, относится к алифатическим углеводородам, при внесении
данных углеводородов по сравнению с другими были получены наилучшие результаты,
при этом 34 культур микроорганизмов давали интенсивный рост, отсутствие роста
наблюдали у 45 изолятов и у 26 культур микроорганизмов наблюдали слабый и средний
рост.
Приведенные данные иллюстрируют избирательную способность испытуемых
изолятов к деградации различных видов углеводородов, что необходимо для составления
эффективных ассоциации микроорганизмов-деструкторов.
191
Таким образом, проведение первичной, качественной оценки активности
нефтеокисляющих микроорганизмов в лабораторных условиях по отношению к нефти,
нефтепродуктам, жидким и твердым углеводородам показало, что из выделенных изолятов
микроорганизмов только 17 проявили наибольшую активность.
В
процессе
изучения
психротрофности
только
у
7
культур
(Rodococcus erythropolis КЛ1, Rhodoccocus erythropolis ДН-1, Rhodoccocus sp. А/1,
Rhodococcus sp. S20, Rhodococcus gordoniae КЛ4, Rhodococcus pyridinovorans 15/6) выявлен
рост при низких температурных значениях ( +10 0С - +40С).
Для качественного определения способности отобранных активных штаммов была
изучена способность к росту на различных углеводородах методом культивирования на
минеральной среде с добавлением углеродов, определения степени накопления клеток по
изменению оптической плотности, жизнеспособности и деструкции углеводородов.
Известно, что нефть имеет многокомпонентный состав, наиболее токсичными являются ее
летучие фракции, поэтому в качестве углеводородов и нефтепродуктов были
использованы – из ряда ароматических углеводородов – бензол, толуол, из алифатических
ряда - пентадекан, гептан, из полициклических – фенантрен, твердые парафины –
нонадекан.
Исходя их результатов экспериментов, наибольший процент потери, равный 60-90%,
наблюдается у низкомолекулярных фракций, в то время как остальные фракции имеют
потери от 30-50%. Также стоит отметить, что разветвленные углеводороды утилизируются
данными бактериями хуже, чем нормальные. С добавлением в качестве источника
углерода и энергии нонадекана отмечается отсутствие роста у 2 штаммов – Rhodococcus
gordoniae КЛ4, Rhodococcus pyridinovorans 15/6. Соответственно уменьшается и степень
деструкции углеводорода.
Выводы. На основании проведенных исследований можно сделать следующие
выводы:
1. Изучено нефтеокисляющий потенциал 105 культур УОМ на питательных средах в
атмосфере насыщенной парами жидких и твердых углеводородов;
2. Проведена оценка активности нефтеокисляющих микроорганизмов по отношению
к нефти, нефтепродуктам, жидким и твердым углеводородам. Результаты показали, что из
выделенных изолятов микроорганизмов только 17 проявили наибольшую активность.
3. Проведен скрининг микроорганизмов по способности к росту в условиях низких
температурных режимов. Выявлено, что из 17 изолятов 7 микроорганизмов обладали
способностью к росту при +4 0С. Важно, что исследуемые штаммы, перспективные для
биотехнологических разработок по утилизации нефти, являются психотолерантными. Это
дает возможность использования их при пониженных температурах.
Список литературы
1. Мельников Д.А., Гирич И.Е., Карасева Э.В. Спектры потребляемых углеводородов
у гетеротрофных бактерий, выделенных на различных средах из чернозема, загрязненного
Тенгизской нефтью. С.1-5
2. Белоусова Н.И., Шкидченко А.Н. Деструкция нефтепродуктов различной степени
конденсации микроорганизмами при пониженных температурах // Прикладная биохимия и
микробиология. - 2004. - № 3. - С. 312-316.
3. Стабникова Е.В. Выбор активного микроорганизма-деструктора углеводородов
для очистки нефтезагрязненных почв // Прикладная биохимия и микробиология. – 1995. –
Т. 31, № 5. – С. 534–539.
4. Кобзев Е.Н. Б. Биодеструкция нефти и нефтепродуктов микробными
ассоциациями в модельных системах. Дисс.канд.биол.наук. Оболенск, 2002. 179 с.
192
Түйін. Мақалада Батыс Қазақстан топырағынан бөлінген мұнайтотықтырғыш
микроағзалардың көмiрсутектерде өсу қабiлеттiлiгінің зерттеу нәтижелері келтірілген,
көмiрсутек микроағзалардың белсенді штаммдары әр түрлi қатарда тұтынуы анықталған.
Summary. The results of studies of oil oxidizing microorganism’s ability to grow on
hydrocarbons are presented in this article. Oil oxidizing microorganisms were isolated from soils
of western Kazakhstan. It was determined the spectrum of consumption of different series of
hydrocarbons by active strains of microorganisms.
УДК 619:616.98:578.831.11:616-078:639.12(470)
РЕЗУЛЬТАТЫ СЕРОМОНИТОРИНГОВЫХ ИССЛЕДОВАНИЙ ПО
НЬЮКАСЛСКОЙ БОЛЕЗНИ СРЕДИ ДИКИХ И СИНАНТРОПНЫХ ПТИЦ НА
ТЕРРИТОРИИ РОССИЙСКОЙ ФЕДЕРАЦИИ В 2013 Г.
Циванюк М.А., к.б.н., ФГБУ «ВНИИЗЖ»; Брундакова Т.Н. , биолог, ФГБУ «ВНИИЗЖ»;
Чагина С.А., технолог 2 кат., ФГБУ «ВНИИЗЖ»; Чвала И.А., к.в.н., ФГБУ «ВНИИЗЖ»;
Ирза В.Н., д.в.н., ФГБУ «ВНИИЗЖ»
Резюме. В 2013 г. в рамках государственного эпизоотологического мониторинга
было исследовано 457 проб сыворотки крови диких и синантропных птиц на наличие
антител к вирусу ньюкаслской болезни из 9 субъектов РФ. Пробы были получены от не
менее чем 30 видов птиц, относящихся к 7 отрядам. В результате тестирования было
выявлено 78 проб сыворотки крови, имеющих антитела к вирусу ньюкаслской болезни.
Введение. Ньюкаслская болезнь (НБ) - острое инфекционное вирусное заболевание
птиц, подлежащее уведомлению в Международную организацию здравоохранения
животных (МЭБ) [1]. При остром течении НБ летальность среди молодняка достигает
100%. Возбудителем является вирус НБ, являющийся представителем парамиксовирусов
птиц серотипа 1 (AMPV-1), и относящийся к семейству Paramyxoviridae.
Многие виды птиц являются природными резервуарами и переносчиками
возбудителя НБ [2]. Вирус НБ был выделен от птиц 241 вида, относящихся к 27 отрядам
[3]. При этом наибольшее значение имеют представители перелетных видов,
распространяющие инфекцию за счет сезонных миграций [4]. Вакцинация и ветеринарносанитарные мероприятия способны достаточно эффективно контролировать заболевание.
Однако НБ продолжает представлять потенциальную угрозу для птицеводства, так как в
небольших частных хозяйствах часто не проводят вакцинацию, что повышает опасность
возникновения эпизоотий [5].
С 2012 г. на территории РФ проводят государственный эпизоотологический
мониторинг для осуществления контроля за особо опасными заболеваниями животных и
птиц. Исследования биоматериала, в том числе проб сыворотки на наличие антител к
вирусу НБ среди диких и синантропных птиц является одним из составляющих системы
контроля, предупреждения и прогнозирования возникновения заболевания. В связи с этим,
серомониторинговые исследования по НБ среди диких птиц являются актуальными [2].
Материалы и методы. Исследуемые сыворотки. В работе использовали 457 проб
сыворотки диких и синантропных птиц из Астраханской, Владимирской, Волгоградской,
Нижегородской, Саратовской областей, Алтайского края, Красноярского края, а также из
Республик Тыва и Мордовия. Пробы были получены от не менее чем 30 видов птиц,
принадлежащих к 7 отрядам.
193
Коммерческий набор. «Набор для выявления антител к вирусу ньюкаслской болезни в
реакции торможения гемагглютинации» (ФГБУ «ВНИИЗЖ»). Набор использовали
согласно инструкции по применению.
Результаты исследований. Антитела к вирусу НБ были обнаружены в 78 (17,1%)
пробах сыворотки крови от 7 видов птиц, относящихся к отрядам Гусеобразные
(Anseriformes), Голубеобразные (Columbiformes) и Воробьинообразные (Passeriformes).
Таблица 1- Пробы сыворотки от различных видов диких и синантропных птиц,
поступившие на исследование из различных субъектов РФ в 2013 г.
Отряд
Гусеобразные
(Anseriformes)
Вид
Серый гусь (Anser anser)
Кряква (Anas platyrhynchos)
Широконоска (Anas clypeata)
Серая утка (Anas strepera)
Красноносый нырок (Netta rufina)
Кол-во
проб
0/1*
7/83
0/2
0/2
0/1
Поганкообразные
(Podicipediformes)
Большая поганка (Podiceps cristatus)
0/19
Ржанкообразные
(Charadriiformes)
Озерная чайка (Larus ridibundus)
Чибис (Vanellus vanellus)
Тулес (Pluvialis squatarola)
Перевозчик (Actitis hypoleucos)
Фифи (Tringa glareola)
Речная крачка (Sterna hirundo)
0/1
0/1
0/4
0/7
0/6
0/2
Большой баклан (Phalacrocorax carbo)
0/3
Пеликанообразные
(Pelecaniformes)
Голубеобразные
(Columbiformes)
Воробьинообразные
(Passeriformes)
Сизый голубь (Columba livia)
Вяхирь (Columba palumbus)
Большая горлица (Streptopelia orientalisorientalis)
Домовый воробей (Passer domesticus)
Ворон (Corvus corax)
Ворона серая (Corvus cornix)
Ворона черная (Corvus corone)
Грач (Corvus frugilegus)
Сорока (Рica pica)
Береговая ласточка (Riparia riparia)
Полевой жаворонок (Alauda arvensis)
Белая трясогузка (Motacilla alba)
Рябинник (Turdus pilaris)
Обыкновенная каменка (Oenanthe oenanthe)
Обыкновенная овсянка (Emberiza citrinella)
Вьюрок (Fringilla montifringilla)
Соколообразные
Черный коршун (Milvus migrans)
(Falconiformes)
Вид неизвестен (дикие и синантропные птицы)
Итого:
* - количество положительных из общего количества исследованных проб.
194
42/147
0/10
0/18
4/6
0/6
1/10
0/3
0/4
0/2
0/6
0/16
0/1
1/7
0/6
1/4
1/2
0/9
21/68
78/457
Положительные к вирусу НБ пробы были получены из всех вышеперечисленных
субъектов РФ, кроме Республики Тыва. Как видно из табл. 2, наиболее часто
положительные к вирусу НБ пробы сыворотки доставлялись из Астраханской и
Владимирской областей, а также Красноярского края.
Таблица 2 - Пробы сыворотки, отобранные от диких и синантропных в 2013 г., в
которых были обнаружены антитела к вирусу НБ
Вид птиц
Кряква
Сизый голубь
Домовый воробей
Ворона серая
Рябинник
Обыкновенная
овсянка
Вьюрок
Вид неизвестен
Субъект РФ, из которого
получены пол. пробы
Алтайский край
Республика Мордовия,
Астраханская область,
Владимирская область,
Волгоградская область,
Нижегородская область
Астраханская область
Астраханская область
Красноярский край
Положительные
пробы сыв-ки, %
8,4
Титры в
РТГА
1:16 - 1:256
28,6
1:16 - 1:512
66,7
10
14,3
1:256-1:1024
1:32
1:32
Красноярский край
25
1:32
Красноярский край
Астраханская область
Владимирская область,
Саратовская область
50
1:32
30,9
1:16 - 1:512
Как представлено в табл. 1 и 2, наибольшее количество проб сыворотки было
получено от птиц отряда Голубеообразные (Columbiformes), поступивших из 7 субъектов
РФ. По результатам исследований в 28,6% проб от сизого голубя из 5 субъектов РФ были
обнаружены антитела с различным уровнем антител к вирусу НБ. Количество проб
поступивших на исследование от птиц, принадлежащих к другим отрядам значительно
меньше, но и в 12,8% из них были выявлены антитела к вирусу НБ. По результатам
серологических исследований, при отсутствии клинических признаков или случаев падежа
диких птиц, нет оснований считать, что выработка антител была индуцирована
вирулентными вирусами НБ, однако очевиден факт циркуляции парамиксовируса птиц 1
серотипа в популяции диких и синантропных птиц в большинстве из обследованных
субъектов РФ.
Выводы. В 2013 г. было исследовано 457 проб сыворотки на наличие антител к
вирусу ньюкаслской болезни, полученных от диких и синантропных птиц из 9 субъектов
РФ. Были обнаружено 78 (17,1%) проб сыворотки положительных к ньюкаслской болезни
от 7 видов диких и синантропных птиц из 8 субъектов РФ. На основании данных
исследований можно сделать вывод о циркуляции парамиксовируса птиц 1 серотипа на
территории РФ как среди диких и синантропных птиц.
Список литературы
1. Alexander, D.J. Newcastle disease and other avian paramyxoviruses // Rev Sci Tech. –
2002. -Vol. 19, N 2. – P. 443 – 462.
195
2. Эпизоотологический мониторинг гриппа птиц и ньюкаслской болезни среди
диких птиц Северо-Западного Причерноморья в 2004-2009 годах/ Д.В. Музыка, А.Б.
Стегний// Ветеринария и кормление. –2010. №6. – с. 18–19.
3. Alexander, D.J. & Senne, D.A. (2008). Newcastle disease, other avian
paramyxoviruses, and pneumovirus infections. In Y.M. Saif, H.J. Barnes, J.R. Glisson, A.M.
Fadly, L.R. McDougald & D.E. Swayne (Eds.). Diseases of Poultry 12th edn (pp. 74Б115). Iowa,
USA: Blackwell Publishing.
4. Инфекционные болезни диких птиц в лесостепной области Алтайского края/
Барышников. П.И., Бондарев А.Ю., Новиков Б.В. //Ветеринария. – 2012. №6. – с. 28–31.
5. Характеристика штаммов вируса болезни Ньюкасла, выделенных в России от
мигрирующих птиц/ Донченко А.С., Силко Н.Ю., Глущенко А.В.// Ветеринария. – 2013.
№1. –с. 60-67.
Summary. In 2013 within the state epizootic screening 457 sera samples from wild and
synanthropic birds on presence of antibodies to Newcastle disease virus from 9 subjects of the
Russian Federation have been investigated. The samples have been received from no less than 30
species of birds related to 7 orders. As a result of testing 78 samples of blood sera having
antibodies to Newcastle disease virus have been detected.
УДК 619:616.9-636.1
ВЫДЕЛЕНИЕ И КУЛЬТИВИРОВАНИЕ ВИРУСА РИНОПНЕВМАНИИ
ЛОШАДЕЙ НА КУЛЬТУРЕ КЛЕТОК
Шалгынбаев Э.К., Рябинникова А.И., Рыстаева Р.А., Омарова З.Д.,
Орынбаев М.Б.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. В работе представлены результаты выделения герпесвируса лошадей и
изучения культуральных свойств выделенного вируса. В результате проведенных
исследований от больных лошадей выделен эпидемиологически актуальный для
территории РК изолят герпесвируса лошадей 1 серотипа. Отработаны оптимальные
условия культивирования герпесвируса лошадей 1 серотипа, позволяющие нарабатывать
вирусную массу для приготовления диагностических и профилактических препаратов
Введение. К одним из широко распространенных вирусных заболеваний относятся
герпесвирусные инфекции лошадей. В настоящее время известны герпесвирусы лошадей 9
типов, представленные альфа – и гаммагерпевирусами. Из герпесвирусных болезней
лошадей наибольшее экономическое значение имеют инфекции, возбудителями которых
являются ВГЛ-1, вызывающий массовые аборты у кобыл, патологию органов дыхания у
жеребят, спорадические случаи миелоэнцефалопатии у лошадей, независимо от возраста и
физиологических особенностей; ВГЛ-4 – возбудитель ринопневмонии и спорадических
абортов; ВГЛ-3 – возбудитель коитальной экзантемы лошадей, острого контагиозного
заболевания, при котором поражается эпителий влагалища у кобыл и полового члена у
жеребцов; ВГЛ-9 – возбудитель миелоэнцефалопатии лошадей и других гетерогенных
хозяев: газелей, зебр, антилоп - часто с летальным исходом. Вирусы 2 и 5 типов
(гаммагерпесвирусы) вызывают латентную инфекцию, а также участвуют в развитии
196
респираторных поражений у жеребят. Наиболее значимые для коневодства заболевания
вызывают вирусы 1-го (вирусный аборт) и 4-го (ринопневмония) типов [1, 2].
Ринопневмония - это вирусная инфекция лошадей, которая может проявляться
поражением органов дыхания, абортами, пневмонией новорожденных жеребят или
миелоэнцефалитами. Ранее заболевание было описано разными названиями: вирусный
аборт кобыл, половая экзантема лошадей, катаральная инфлюэнца, герпес, ринотрахеит
лошадей [1-3].
В естественных условиях болеют лошади, пони, ослы и мулы всех возрастов и пород
независимо от пола. Более чувствительны чистокровные породы и молодняк до 1 года.
Различные штаммы вируса ринопневмании размножаются в первичных культурах и
субкультурах почек лошадей, пони, свиньи, теленка, овцы, тестикуллов, легких и
селезенки лошади, а также в перевиваемых линиях клеток BHK-21, AND, HeLa, RK-13.
Размножение вируса в чувствительных культурах клеток сопровождается развитием
цитопатических изменений характерных для вирусов группы герпес. Штаммы вируса,
адаптированные к культурам клеток, оказывают более выраженный цитопатический
эффект и накапливаются в высоких титрах. Цитопатогенное действие адаптированных
штаммов наступает через 24-48 часов, а неадаптированных через 3-5 суток. Первым
признаком цитопатических изменений служит появление отдельных округленных светлых
клеток через 24-36 часов после заражение. В менее чувствительной к вирусу перевиваемой
линии клеток почки теленка цитопатические изменения в первые 2-3 суток имеют
очаговый характер, затем они постепенно распространяются по всему монослою клеток.
Пораженные клетки округляются и отделяются от стекла, в них образуются
внутриядерные эозинофильные тельца-включения [4].
Ранее нами было показано, что ГПЛ 1 и 4 серотипов циркулируют в популяциях
лошадей в различных регионах РК [5].
Целью настоящей работы являлось выделение эпидемиологически актуального
штамма герпесвируса лошадей циркулирующего на территории РК и изучение
культуральных свойств выделенного вируса.
Материалы
и
методы.
Исследования
проводили
с
использованием
вирусологических, молекулярных и серологических методов.
Исследования по обнаружению вируса ринопневмонии лошадей проводили с
использованием иммуноферментного анализа (ИФА) и полимеразой цепной реакции
(ПЦР).
Материалом для исследований служили 20% суспензии из паренхиматозных органов
(легких, печени, селезенки), содержимое желудка плода и смывы из носовой полости.
Культуры клеток выращивали в среде Игла МЕМ с добавлением 2мМ глутамина, 5%
сыворотки крови КРС для культур клеток, пенициллина по 100 ЕД/мл и стрептомицина по
100 мкг/мл.
Для выделения вируса использовали однодневную диплоидную клеточную культуру
почки кролика (RK-13). Для этого с пробирок (матрасов) со сплошным клеточным
монослоем сливали ростовую питательную среду, клетки 1 - 2 раза промывали раствором
Хенкса для удаления сывороточных антител и ингибиторов. В каждую пробирку (матрас)
вносили соответствующее количество вируссодержащего материала и с помощью
покачивания распределяли его равномерно по слою клеток и для адсорбции вируса
оставляли в течение 1 - 2 часа при комнатной температуре. После этого вируссодержащий
материал удаляли и добавляли поддерживающую среду (в пробирку 1 - 2 мл, в матрасы
около 10% объёма). Инкубировали в термостате при 37 оС. Все пробирки (матрасы) после
заражения клеток ежедневно исследовали под малым увеличением микроскопа на наличие
цитопатического действия (ЦПД), сравнивая культуры клеток, заражённые вирусом, с
197
контрольными. Титр вируса определяли по инфекционному действию на культуру клеток
и оценивали по методу Рида и Менча [6].
Для обнаружения антител ЕНV1 или EHV4-Ab в сыворотке крови лошади вируса
ринопневмонии лошадей использовали набор «ELISA test for the detection of EHV1 and
EHV4 antibodies in serum» производства Svanovir. Постановку реакции осуществляли
согласно наставлениям, по применению вложенным в набор.
Результаты и обсуждение. В 2011-12 гг. из частных хозяйств Жамбылской области
были доставлены пробы патологических материалов от абортированных лошадей.
Доставленные пробы были исследованы методом ОТ-ПЦР на ГВЛ серотипа 1 и ГВЛ
серотипа 4. В результате проведенных исследований в одной пробе патологического
материала из двух исследованных проб был выявлен продукт амплификации размером 770
п.о. характерный для ГВЛ - 1 серотипа, а в шести пробах из девяти исследованных проб
был выявлен продукт размером 580 п.о. характерный для ГВЛ - 4 серотипа.
Для выделения и культивирования вирусов использовали диплоидную клеточную
культуру почки кролика RK-13. Материалом для выделения вируса служили 20%
суспензии из паренхиматозных органов (легких, печени, селезенки), содержимое желудка
плода и смывы из носовой полости. В результате культивирования специфическое
цитопатогенное действие наступало через 24 - 36 часов, первым признаком
цитопатических изменений служило появление отдельных округленных, светлых клеток
через 36 часов после заражения, затем они постепенно распространялись на весь
клеточный пласт. Идентификацию выделенного возбудителя проводили методом ПЦР и
электронной микроскопией.
В результате электронномикроскопических исследований в культуральных пробах
был обнаружен вирус, который по морфологии и размерам вириона характерно к ГВЛ.
Вирион имеет суперкапсид (наружную оболочку) диаметром 200-210 нм и центральный
капсид гексогональной формы диаметром 80-90 нм (рис.1).
Рисунок 1 – Электронная фотография герпесвируса лошадей (негативное
контрастирование 2% раствором ФВК. *120 000)
ПЦР исследование выделенного возбудителя позволило идентифицировать ГВЛ 1
серотипа.
С целью изучения культуральных свойств выделенного возбудителя было проведено
3-7 последовательных пассажей с использованием 1-2 суточной культуры клеток Vero,
RK-13, BHK-21, СПЭВ, ПТ-80.
Культивирование проводили в стационарных условиях в матрасах и пробирках в
течение 2-10 суток при 37 оС до 70-90 %-ного поражения монослоя клеток. Полученные
пробы вируссодержащего материала каждого пассажного титровали в одноименной
культуре клеток с целью определения биологической активности.
198
Результаты исследований по определению чувствительности различных культур
клеток к вирусу ГПЛ представлены в таблице 1.
Таблица 1 – Чувствительность различных культур клеток к вирусу ринопневмонии
лошадей
Биологическая активность вируса, lg ТЦД50/см3
Культура
клеток
1 пас
2 пас
3 пас
4 пас
5 пас
6 пас
7 пас
н.и.
н.и.
BHK-21
СПЭВ
-
-
2,75 ±
0,14
2,26 ±
0,07
н.и.
н.и.
3,25 ±
0,14
2,75 ±
0,14
н.и.
н.и.
4,0 ± 0,14
-
6,58 ±
0,08
2,26 ±
0,07
1,21 ±
0,31
-
н.и.
ПТ-80
3,25 ±
0,14
1,83 ±
0,08
-
н.и.
Vero
1,67 ±
0,08
-
4,50 ±
0,25
3,50 ±
0,25
н.и.
н.и.
RK-13
2,75 ±
0,14
н.и.
н.и.
В результате проведенных исследований было установлено, что наиболее активные
вирусные материалы получены в культуре клеток RK-13, на уровне 3-го пассажа титр
вируса составлял 6,58 ± 0,08 lg ТЦД50/см3. Цитопатическое действие вируса проявлялось
на 1-2 сутки.
Менее чувствительными культурами клеток оказались ПТ-80 и Vero, титр на уровне
7-го пассажа вируса составлял 3,50 ± 0,14 и 4,50 ± 0,14 ТЦД50/см3, соответственно. ЦПД не
было отмечено в перевиваемых культурах клеток BHK-21 и СПЭВ.
В дальнейших исследованиях использовали перевиваемую линию культуры клеток
RK-13.
Отработка оптимальных условий культивирования показало, максимальное
накопление вируса ГВЛ 1 серотипа в культуре клеток при заражающей дозе от 0,01 до 1,0
ТЦД50/см3 с инкубированием при 37 оС в течение 2-3 суток обеспечивает получение вируса
с биологической активностью до 6,58 ± 0,08 lg ТЦД50/см3.
Выводы. Таким образом, в результате проведенных опытов из патологических
материалов больных лошадей в культуре клеток RK-13 выделен изолят герпесвируса
лошадей 1 серотипа, который подтверждено в ПЦР и методом электронной микроскопией.
С использованием различных культур клеток определена наиболее чувствительная система
для культивирования выделенного изолята и на основе культуре клеток RK-13 отработана
оптимальная условие культивирование.
Список литературы
1. Юров К.П. Инфекционные болезни лошадей // Изд-во «Грааль».-2000. - С.19 -36.
2. OIE - World organization for animal health / World Animal Health Information Database
(WAHID)
Interface
//
http://www.oie.int/wahis_2/public/wahid.php/
Countryinformation/Countryre ports
3. Patel J.R., Heldens J. Equine herpesviruses 1 (EHV-1) and 4 (EHV-4)-epidemiology,
disease and immunoprophylaxis: a brief review // Vet J. – 2005. – Vol. 170, №1. – P. 14-23.
4. Татаурова А. В., Юров К. П., Алексеенкова С. В. //Нейропатогенные штаммы
возбудителя ринопневмонии – вирусного аборта лошадей. // Ветеринария, 3, С.20 – 23.
2006
199
5. Омарова З., Керимбаев А., Мусаева Г., Орынбаев М.Б. Обнаружение и
типирование герпесвируса лошадей методом ПЦР
//
Сборник
материалов
международной научно-практической конференции молодых ученых, посвященной 55летию НИИПББ. Гвардейск-2013г. С.152-159
6. Сюрин В.Н., Белоусова Р.В., Фомина Н.В. Ветеринарная вирусология // Изд-во
«Колос». – 1984. - С.267 - 272.
Түйін. Ғылыми жұмыста жылқының герпесвирусын бөліп алу мен бөлінген
вирустың торша өсіндісінде өсу қасиеттерін зерттеу нәтижелері көрсетілген. Зерттеулер
нәтижесінде ауру жылқылардан алынған биологиалық сынамалардан Қазақстан
Республикасы аумағы үшін көкейкесті аурулардың бірі - жылқы герпесвирусының 4
серотипті штамы бөлініп алынды. Аурудың алдын-алу және балау шараларына арналған
препараттар жасау үшін жылқы герпесвирусының 4 серотипті штамын өсірудің үйлесімді
жағдайлары мен оның вирустық массасын жинақтау әдістері анықталды.
Abstract. This investigation shows the results of isolation of equine herpesvirus and
studies the properties of the isolated virus culture. The result of studies of sick horses is isolation
of epidemiologically relevant to the territory of the RK strain of equine herpesvirus serotype 4.
Optimal cultivation conditions of equine herpesvirus serotype 4 were practiced which allow viral
load to turn out for preparation of diagnostic and preventive drugs.
УДК 579.695
ПЕРВИЧНЫЙ СКРИНИНГ МИКРООРГАНИЗМОВ-ДЕСТРУКТОРОВ АПАВ
Шарипова Г.Ж., Аипова Р., Махатова А.С., Курманбаев А.А. д.б.н.
РГП «Национальный центр биотехнологии» КН МОН РК
Резюме. Из сточных вод и нефтезагрязненной почвы, методом накопительных
культур были выделены 54 культуры микроорганизмов. Для ускоренного определения
микроорганизмов-деструкторов
АПАВ,
был
проведен
первичный
скрининг
биохимическим тестом с индикатором 2,3,5-трифенилтетразолий хлоридом.
Введение. Значительную часть антропогенной нагрузки, приходящейся на
поверхностные водные объекты, составляют сточные воды, содержащие поверхностноактивные вещества (ПАВ), которые входят в состав всех хозяйственно-бытовых и
большинства промышленных сточных вод. Для очистки бытовых и промышленных
сточных вод от ПАВ широко используются физико-химические и биологические методы.
Решить проблему безопасности промышленных стоков с высоким содержанием
синтетических ПАВ позволяет микробиологический метод, который базируется на
применении высокоактивных культур микроорганизмов-деструкторов. Известно, что чем
больше ксенобиотики отличаются от природных субстратов и метаболитов основного
обмена, тем меньше вероятность широкого распространения штаммов, способных к их
утилизации. Вследствие попадания ПАВ в окружающую среду в естественных субстратах
появляются микроорганизмы с повышенной устойчивостью к этим соединениям, многие
из которых способны к их деструкции [1].
Целью исследования являлось выделение из промышленных отходов
микроорганизмов–деструкторов анионных поверхностно-активных веществ (АПАВ).
200
Материалы и методы. В качестве АПАВ был выбран сульфанол, так как в
настоящее время самым распространенным ПАВ в синтетических моющих средствах
является алкилбензосульфонат. [2]
Микроорганизмы выделяли из сточных вод и нефтезагрязненной почвы методом
накопительного культивирования, 5-10 г (мл) пробы вносили в 0,25 л колбы с 100 мл
среды М9, содержащей 1 г/л ПАВ в качестве единственного источника углерода и энергии.
Культуры инкубировали 3 недели при комнатной температуре, затем высевали на
полноценные питательные среды СПА [3].
Для проведения скрининга культур микроорганизмов на способность утилизировать
анионные поверхностно-активные вещества использовали биохимический тест. Изоляты,
выделенные из накопительной культуры, окисляющие АПАВ, проверяли с индикатором
2,3,5-трифенилтетразолий хлорид (ТТХ) на минеральной среде Е-8, с содержанием какоголибо ПАВ, в нашем случае мы использовали сульфонол. Посевы инкубировали в
термостате при 28оС. Через 3, 6, 9, суток производили учет цветной реакции исследуемого
микроорганизма[4].
Результаты исследований. Микроорганизмы-деструкторы анионных поверхностноактивных веществ выделяли методом накопительных культур из сточных вод и
нефтезагрязненой почвы, с последующими пересевами на минеральную среду М9,
содержащую 1г/л сульфонола в качестве единственного источника углерода и энергии.
Инкубировали на шейкере 3 недели при комнатной температуре с периодическими
пересевами на питательные среды СПА и псевдомонадный агар методом предельных
разведений. Культуры инкубировали в течение 5 суток при температуре 28 0С. Проверку
чистоты культур определяли по методу Гоулда. Посевы из накопительной культуры
проводили через 4, 7, 10, 14, 21 сутки и анализировали микрофлору. Из накопительной
культуры было выделено 54 изолята, 18 культур из почвы и 36 из сточной воды.
Далее проводили скрининг выделенных культур на способность утилизировать
АПАВ с использованием биохимического теста с индикатором ТТХ. Качественную оценку
способности микроорганизмов разрушать АПАВ, осуществляли с помощью визуального
наблюдения за изменением уровня дегидрогеназной активности микроорганизмов по
размерам зоны их роста на плотной питательной среде Е-8, окрашенной за счет цветной
реакции с реактивом ТТХ, добавленного в среду и восстанавливающегося из бесцветной
соли в соединении трифенилформазана (ТФФ) красного цвета при окислительновосстановительных реакциях микробного разложения АПАВ.Результаты исследования
качественного анализа представлены на рис.1
1
2
201
3
4
1-контроль; 2 - на 3 сутки; 3 - на 6 сутки; 4 - на 9 сутки
Рисунок 1 - Проявление окрашенных зон изолятов
Положительная реакция, окрашенная в красный цвет свидетельствует о том, что
выделенные микроорганизмы деструктируют АПАВ.
Окрашенная зона на чашках Петри проявилась на третьи сутки и увеличивалась в
течение девяти суток (рис.1).
Таким образом, после первичного скрининга микроорганизмов-деструкторов АПАВ
положительный результат дали 12 культур.
Выводы. Из накопительных культур микроорганизмов было выделено 54 штамма
микроорганизмов. Из нефтезагрязненной почвы было выделено 18 культур, из сточной
воды 36. Посев проводили периодически через 4,7,10,14 и 21 сутки с анализом
микрофлоры. Далее после проведения биохимического теста с индикатором 2,3,5терафенилтетразолий хлоридом нами было отобрано 12 культур микроорганизмов, давшие
положительный результат.
Список литературы
1. Ставская С. С., Удод В. М., Таранова Л. А. Микробиологическая очистка воды от
поверхностно-активных веществ. – Киев: Наук. думка, 1988. – 184 с.
2. Волков В.А. Поверхностно-активные вещества в моющих средствах и усилителях
химической чистки. – М.: Легпромбытиздат, 1985. - 200 с.
3. Турковская О.В. Биологические и технологические аспекты микробной очистки
сточных вод и природных объектов от поверхностно-активных веществ и нефтепродуктов:
дис. на соискание уч. степени док. биол. наук: 03.00.07, 03.00.04: Саратов, - 2000. – С. 8688.
4. Способ выявления микроорганизмов-деструкторов ксенобиотиков: пат. 2051961
Республика Молдова: МПК C12N1/00, C12N1/14, C12N1/20, C12Q1/00, C12Q1/32
Гранатская Т.А., Пында В.А., Дворникова Т.П., Сирецану Л.Ф.; заявитель и
патентообладатель Институт микробиологии АН; заявл. 04.06.92; опубл. 10.01.96
Түйін. Ағынды сулардан және мұнаймен ластанған топырақтан жинақтаушы
культуралардын әдісімен 54 культура микроағзалары бөлініп алынды. АББЗ деструктормикроағзалардын
жылдам
анықтау
үшін,
биохимиялық
тестпен
2,3,5трифлаенилтетразолий индикатормен алғашқы іріктеу өткізілді.
Summary. The 54 cultures of microorganisms were isolated from sewage and oily soil by
accumulative cultures method. For the rapid determination of microorganisms-destructors of
202
anionic surfactants was performed primary screening by biochemical test with 2,3,5triphenyltetrazolium chloride indicator.
УДК 594.38:577.21:546.817:546.47
ВОЗДЕЙСТВИЕ АЦЕТАТА СВИНЦА НА РОСТ И ЭКСПРЕССИЮ
МЕТАЛЛОТИОНЕИНА У МОЛОДИ МОЛЛЮСКА LYMNAEA STAGNALIS ПОСЛЕ
ВЛИЯНИЯ АЦЕТАТА ЦИНКА В ТЕЧЕНИЕ ЭМБРИОГЕНЕЗА
Шевцова С.Н., Институт генетики и цитологии НАН Беларуси
Бабенко А.С., к.х.н., РНПЦ онкологии и медицинской радиологии им. Н.Н.
Александрова, Беларусь
Резюме. Проведена оценка уровня экспрессии МТ в результате 14-суточного
воздействия 0,003–0,3 мг/л Pb2+ на ювенильных особей L. stagnalisс применением метода
полимеразной цепной реакции в режим реального времени. Установлено существенное
угнетение роста и уровня экспрессии МТ у ювенильных особей L. stagnalis в результате
14-суточного воздействия 0,003–0,3 мг/л Pb2+. Показано, что влияние 0,05 мг/л ионов
цинка в течение эмбрионального развития не оказывает значительного воздействия на рост
и уровень экспрессии МТ у ювенильных особей L. stagnalis при воздействии 0,003–0,3 мг/л
ионов свинца. Разработанный подход может быть рекомендован к применению в качестве
альтернативной системы в биотестировании металлосодержащих отходов.
Введение. Наряду с рыбами, жаброногими рачками и двустворчатыми моллюсками,
брюхоногие моллюски находят всё более широкое применение в процедурах оценки
качества пресных вод [1, 2]. На сегодняшний день молекулярные биомаркёры
неблагополучия водной среды у гастропод используются недостаточно широко.
Применение метода полимеразной цепной реакции в режиме реального времени (ПЦР
ВРРВ) при оценке влияния солей тяжёлых металлов и других загрязнителей на изменение
уровня экспрессии металлотионеинов (МТ) у пресноводного легочного моллюска Lymnaea
stagnalis (большого прудовика) в перспективе может повысить репрезентативность
экотоксикологических исследований.
В данной работе представлены результаты оценки 14-суточного воздействия
относительно низких концентраций уксуснокислого свинца на рост (от выклева до 14суточного возраста), а также уровень экспрессии гена МТ в теле ювенильных особей L.
stagnalis. Исследован также характер влияния 0,05 мг/л ионов цинка в течение
эмбриогенеза на последующий рост и уровень экспрессии МТ у ювенильных особей
моллюска, которые после выклева подвергались 14-суточному воздействию ацетата
свинца.
Материалы и методы. Расчётные концентрации ионов свинца, полученные путем
добавления трёхводного ацетата свинца (Pb(CH3COO)23H2O) в отстоявшуюся в течение
суток водопроводную воду, составили 0,003; 0,03 и 0,3 мг/л. В качестве источника ионов
цинка использовали двухводный ацетат цинка (Zn(CH3COO)22H2O). В эксперименте
использовали практически единовременно отложенные кладки в количестве 10 штук,
полученные от особей L. stagnalis лабораторного разведения и содержащие зародыши на
ранних стадиях дробления. С целью сравнительной оценки эффектов предварительного
инкубирования кладок при 0,05 мг/л Zn2+ и в водопроводной воде в течение эмбриогнеза
моллюсков на темпы роста и уровень экспрессии МТ в результате дальнейшего 2203
недельного влияния 0,003-0,3 мг/л Pb2+, кладки делили скальпелем вдоль на 2 равные
части, одну из которых до момента выклева инкубировали в водопроводной воде, другую
– при воздействии 0,05 мг/л ионов цинка. Выклюнувшуюся молодь, инкубировавшуюся в
воде, случайным образом расформировывали на контрольную группу (далее инкубировали
14 суток в воде) и три опытных группы, которые далее инкубировали при 0,003; 0,03 и 0,3
мг/л Pb2+. Молодь, содержавшуюся в течение эмбриогенеза при 0,05 мг/л Zn2+,
распределяли на контрольную группу (далее инкубировали 14 суток при 0,05 мг/л Zn2+) и
три опытных группы, которые далее инкубировали при 0,003; 0,03 и 0,3 мг/л Pb2+. Водную
среду обновляли каждые вторые сутки, моллюсков кормили листьями салата с избытком.
По окончании экспозиции моллюсков индивидуально взвешивали, каждую
экспериментальную группу помещали в одноразовую полипропиленовую пробирку,
содержащую 0,5 мл буфера для гомогенизации, замораживали и хранили в
низкотемпературной морозильной камере.
Общую фракцию РНК выделяли из тела (мягких тканей и раковины) L. stagnalis. Для
выделения использовали набор реагентов «РНК-ВТК» (ИБОХ, Беларусь). Реакцию
обратной транскрипции проводили с помощью набора реагентов «Реверта» (Амплисенс,
Россия). Ввиду отсутствия последовательности гена МТ Lymnaea stagnalis в электронных
базах данных NCBI Gene и NCBI Nucleotide, при конструировании праймеров за основу
была взята последовательность гена МТ пресноводного брюхоногого моллюска Physa
acuta (GenBank: GU259686.1). C помощью онлайн сервиса NCBI Blast была обнаружена
последовательность кДНК гена МТ Lymnaea stagnalis на неохарактеризованном подробно
участке длиной 778 пар оснований (GenBank: ES578255.1). С применением программного
обеспечения «VectorNTI v10.0.1» проведен сравнительный анализ последовательностей
кДНК обоих видов моллюсков и выбран участок c наибольшей степенью гомологии (90%),
что позволило ограничить участок кДНК, соответствующий гену МТ Lymnaea stagnalis. На
основании этих данных были сконструированы олигонуклеотидные праймеры и
флуоресцентно-меченые зонды для проведения ПЦР РРВ. В качестве референсного был
выбран ген LPC2 (molluscan putative prohormone convertase) GenBank: X68850.1. Все
постановки ПЦР РРВ проводили в формате TaqMan, а полученные данные экспортировали
в формат «Microsoft Excel» и обрабатывали с помощью программы «OriginPro 8.6 32Bit».
Результаты исследований. Установлено отсутствие угнетающего воздействия 0,003
и 0,03 мг/л ионов свинца на рост молоди большого прудовика, которую в период
эмбриогенеза культивировали в воде (рисунок 1, а). Показано, что в результате 14суточного воздействия 0,3 мг/л ионов свинца отмечены достоверные различия с контролем
по сырой массе тела у моллюсков, содержавшихся в период эмбриогенеза в воде (рисунок
1, а), а также у особей, инкубировавшихся до выклева при влиянии 0,05 мг/л ионов цинка
(рисунок 1, б). При влиянии 0,03 и 0,3 мг/л ионов свинца установлено значительное
снижение уровня экспрессии гена МТ по сравнению с контролем в теле улиток, в течение
эмбриогенеза содержавшихся в воде (рисунок 1, в). У моллюсков, в течение эмбриогенеза
подвергавшихся воздействию 0,05 мг/л ионов цинка, отмечено существенное снижение
уровня экспрессии гена МТ только при действии 0,003 мг/л ионов свинца (рисунок 1, г).
В целом, полученные нами данные свидетельствуют о выраженном негативном
влиянии 0,3 мг/л ионов свинца на рост ювенильных особей L. stagnalis и подтверждаются
результатами других исследований влияния солей данного металла на рост и
выживаемость молоди гастропод. Например, зарубежные исследователи наблюдали
значительное угнетение роста ювенильных особей L. stagnalis в 28-суточном эксперименте
при воздействии 0,003 мг/л ионов свинца, причём после дополнительного 28-суточного
содержания в отсутствии токсиканта у данной экспонированной молоди отмечалось лишь
частичное восстановление [3].
204
***
Уровень экспрессии
МТ
а
Масса тела, мг
Контроль
0,003 мг/л Pb
0,03 мг/л Pb
0,3 мг/л Pb
2,5
2
1,5
1
0,5
0
0,05 мг/л Zn
0,003 мг/л Pb
0,03 мг/л Pb
0,3 мг/л Pb
*
***
б
1,5
1,2
0,9
0,6
0,3
0
Контроль
0,003 мг/л Pb
0,03 мг/л Pb
0,3 мг/л Pb
0,02
0,04
Уровень экспрессии
МТ
Масса тела, мг
3
2,5
2
1,5
1
0,5
0
1,5
1,2
0,9
0,6
0,3
0
0,05 мг/л Zn
0,003 мг/л Pb
0,03 мг/л Pb
0,3 мг/л Pb
в
г
Относительные величины приведены как M ± SE, достоверность различий с
контролем по t-критерию: * – p<0,05; *** – p<0,001
Рисунок 1 – а – изменение веса, в – уровня экспрессии МТ у молоди
L. stagnalis, инкубировавшейся в течение эмбриогенеза в воде, после 14 суток воздействия
0,003-0,3 мг/л ионов свинца; б – изменение веса, г – уровня экспрессии МТ у молоди,
инкубировавшейся при 0,05 мг/л ионов цинка, после 14 суток воздействия ионов свинца
Выводы. Показано, что 14-суточное воздействия 0,3 мг/л ионов свинца на
ювенильных особей большого прудовика приводит к существенному угнетению роста.
Установлено, что инкубирование большого прудовика в течение эмбрионального развития
в присутствии 0,05 мг/л ионов цинка не оказывает значительного воздействия на
последующий рост и уровень экспрессии металлотионеина в теле ювенильных особей L.
stagnalis в результате 14-суточного воздействия 0,003–0,3 мг/л ионов свинца. Выявлено
значительное снижение уровня экспрессии гена МТ в теле ювенильных особей большого
прудовика в результате 14-суточного воздействия 0,03 и 0,3 мг/л ионов свинца.
Список литературы
1. Sieratowicz, A. Reproductive toxicity of bisphenol A and cadmium in Potamopyrgus
antipodarum and modulation of bisphenol A effects by different test temperature / A. Sieratowicz
[et al.] // Environ Pollut. – 2011. – Vol. 159, № 10. – P. 2766–2774.
2. Ansaldo, M. Effect of cadmium, lead and arsenic on the oviposition, hatching and
embryonic survival of Biomphalaria glabrata / M. Ansaldo [et al.] // Sci Total Environ. – 2009. –
Vol. 407, № 6. – P. 1923–1928.
3. Munley, K.M. Growth inhibition in early life-stage tests predicts full life-cycle toxicity
effects of lead in the freshwater pulmonate snail, Lymnaea stagnalis / K.M. Munley [et al.] //
Aquat Toxicol. – 2013. – Vol. 128-129. – P. 60–66.
Summary. There was estimated MT expression of L. stagnalis juvenile individuals as a
result of 0.003-0.3 mg/L Pb2+ 14-day exposure using the polymerase chain reaction in real-time
mode. There was revealed a significant growth inhibition and suppression of MT level in L.
stagnalis juvenile individuals as a result of 14-day 0.3 mg/L Pb2+ exposure. It was shown that
205
0.05 mg/L Zn2+ pretreatment during embryonic development had no significant effect on growth
and MT expression in juvenile individuals estimated as a result of 14-day exposure to 0.003-0.3
mg/L Pb2+. The developed approach can be recommended for use as an alternative system in
metal waste bioassay practice.
УДК 577.212.3
ХАРАКТЕРИСТИКА ШТАММА
PASTEURELLA/SAIGAS/2010/ZKO/KZ МЕТОДОМ MLST
Шораева К.А., Тленчиева Т.М., Султанкулова К.Т. к.б.н, Строчков В.М.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме.
Штамм
выделенный
из
патологического
материала
Pasteurella/Saigas/2010/ZKO/KZ анализирован методом MLST. Результаты данной работы
показали, что исследуемый штамм, выделенный от сайгаков по 7 аллелям: аdk, aroA, рgi,
g6pd, gdhA, mdh, deoD близкородственен к штамму ST 47 из международной базы
PubMLST.org, отличие наблюдается только по аллели gdhA. При сравнении нуклеотидных
последовательностей аллели gdhA штамма Pasteurella/Saigas/2010/ZKO/KZ со штаммом ST
47 обнаружена нуклеотидная замена: Т234С (Тимин→Цитозин).
Введение. Пастереллезная инфекция известна как гетерогенный бактериальный
агент, вызывающий тяжелые заболевания среди многих животных, в том числе
геморрагическую септицемию у сайгаков. Пастереллез - острое заболевание,
характеризующееся быстрым течением и с высокой смертностью животных [1]. Если
учитывать то, что сайгаки (Saiga tatarica) занесены в Международную Красную книгу изза резкого сокращения их численности возникает вопрос о глубоком изучении
молекулярно-генетических характеристик данного возбудителя.
Так, в 2010 году наблюдалась массовая гибель сайгаков от пастереллеза на
территории Республики Казахстан, в Жанкельдинском районе Костанайской области.
Болезнь всего за несколько дней сократила популяцию сайги в Казахстане на 12000 особей
[2].
Факты заболевания пастереллезом у сайгаков ранее были зафиксированы 80-х годах
прошлого века, тогда 1984 году в Уральской области погибло 250 тысяч сайгаков, а в 1988
году в Торгайских степях погибло 434 тысячи голов сайги [3]. Однако, все работы,
направленные на изучение генетических характеристик данной инфекции у сайгаков
ограничивались выявлением бактерий как пастереллы.
Разработка систем молекулярного типирования возбудителей особо опасных
инфекционных болезней на межвидовом, внутривидовом и межштаммовом уровне с
учетом эпидемиологической значимости, географической и иной приуроченности имеют
особую значимость. Для выполнения такого анализа наиболее перспективное значение
имеет использование метода мультилокусного секвенирования (MLST). Этот метод
позволяет решить и стандартизовать глобальную эпидемиологическую информацию [5].
Исходя из вышеизложенного, целью данной работы является характеристика штамма
Pasteurella/Saigas/2010/ZKO/KZ, выделенного от сайгаков в Казахстане методом MLST.
206
Материалы и методы. Материалы. Объектом исследований является штамм
Pasteurella/Saigas/2010/ZKO/KZ, выделенный от сайгаков на территории Республики
Казахстан.
Выделение ДНК. Выделение ДНК проводили с использованием набора "PrepMan
Ultra Sample Preparation Reagent" фирмы Applied Biosystems, согласно протоколу
производителя.
Анализ MLST. Для проведения анализа MLST были отобраны праймеры из сайта
PubMLST.org, который содержит программное обеспечение и базу данных по анализу
MLST (Таблица 1).
Таблица 1 - Последовательность праймеров для наработки ПЦР-продуктов
Pasteurella multocida для анализа MLST.
№ Локусы
Последовательность праймеров
Прямые
Обратные
Размер
продукта
(п.о.)
1
adk
AAGGBACWCAAGCVCAAT
CACTTTTTKYGTMCCGTC
531
2
aroA
TTTACCDGGYTCYAAAAG
CTTTYACVCGCCAGTTAT
558
3
pgi
GCCWGTGYTKGTTGATGG
TTGKGCTGGCGCRATRAA
609
4
g6pd
CHGGYGAYYTMACTYATCG
TTTBGCGATBARTTTRTCRGC
651
5
gdhA
YTTAGTTGARCCTGAACG
CTTGACCTTCAATYGTGC
513
6
mdh
AAGTTGCWGTWYTAGGTG
CCTAATTCAATATCYGCACG
552
7
deoD
GTGCATTTGCYGATGTTG
TGSYGTKGTTTGTTCGTG
576
Наработку ПЦР продуктов проводили с использованием набора AmpliTaq Gold
(Applied Biosystems). Реакционная смесь содержала 25 мкл 2х буферов AmpliTaq Gold, по 1
мкл 20 пкм праймеров, 1 мкл ДНК и воды до 50 мкл. Режимы амплификации: начальная
денатурация прошла при 950С в течение 5 минут, денатурация при 940С - 45 сек, отжиг при
56-600С в течение 45 сек, репликация при 720С в течение 2мин, 35 циклов, пострепликация при 720С в течение 10 минут.
Анализ нуклеотидных профилей и определение полученной карты для штаммов
Pasteurella multocida, выделенных от сайгаков, проводили с использованием базы данных,
расположенной на сайте http://pubmlst.org/.
Электрофорез ДНК в 2% агарозном геле проводили, используя ТВЕ буфер
содержащий 1 мкл/мл бромистого этидия. Использовали аппарат для электрофореза
нуклеиновых кислот G-100, Pharmacia.
Обработка данных. Сравнительные анализы нуклеотидных последовательностей
исследуемых генов проводили с помощью компьютерных программ Vector NTI Suite 9 и
BLAST (на сайте NCBI, http://www.ncbi.nlm.nih.gov).
Результаты и обсуждение. Метод MLST (MultiLocus Sequence Typing,
мультилокусное секвенирование-типирование) разработан Mайденом и соавт. в 1998г. [6].
Имеется база данных http://www.mlst.net, где содержится огромное количество описанных
207
последовательностей, так называемых генов "домашнего хозяйства", а также инструкции
по выполнению типирования и програмное обеспечение для анализа последовательностей.
Электрофорез ПЦР продуктов проводили на 2%-ном агарозном геле с бромистым
этидием. Результаты представлены на рисунке 1.
М – 1 kb Marker, Invitrogen; 1 - аdk, 600 п.о.; 2 - aroA, 1275 п.о.; 3 - рgi, 1650 п.о.; 4 g6pd, 1425 п.о.; 5 - gdhA, 1350 п.о.; 6 - mdh, 1425 п.о.; 7 - deoD, 675 п.о.
Рисунок 1 - Электрофореграмма ПЦР продуктов локусов казахстанского штамма
Pasteurella multocida для анализа MLST
Из рисунка 1 видно, что получены ПЦР фрагменты исследуемых аллельных
профилей.
Далее анализ нуклеотидных профилей и определение полученной карты для штаммов
Pasteurella multocida, выделенных от сайгаков, проводили с использованием базы данных,
расположенной на сайте http://pubmlst.org/ (рисунок 1). В результате анализа был получен
следующий профиль: adk - 26 аллельных профилей; aroA - 28 аллельных профилей; deoD 23 аллельных профилей; gdhA - 6 аллельных профилей; g6pd - 23 аллельных профилей;
mdh - 22 аллельных профилей; pgi – 25 аллельных профилей.
Рисунок 2 - MLST анализ Pasteurella multocida с использованием базы PubMLST
Ближайшим штаммом, схожим по 6 аллелям, был штамм, имеющий порядковый
номер схемы (ST) - 47. Отличия от штаммов, выделенных от сайгаков, находятся в аллели
gdhA (рисунок 3).
208
Рисунок 3 – Сравнение нуклеотидных последовательностей аллелей gdhA
Из рисунка 3 видно, что при сравнительном анализе нуклеотидной
последовательности аллели gdhA казахстанского штамма с ST 47, выявлена одна
нуклеотидная замена: Т234С (Тимин→Цитозин). Идентичность двух штаммов по
нуклеотидным последовательностям аллели gdhA составляет 99,85%.
Штамм ST 47 был выделен из легких свиней, больных пневмонией в Англий (регион
Саттон Бонингтон), в 2009 году. Казахстанский штамм Pasteurella/Saigas/2010/ZKO/KZ,
выделенный от сайгаков в 2010 году на территории Казахстана является отличным от всех
других представленных в базе данных. Таким образом, с использованием мультилокусного
анализа генома казахстанского штамма бактерии Pasteurella multocida, выделенного в 2010
г. выявлены аллельные профили при сравнении с международной базы данных
(http://www.mlst.net/).
MLST считается в настоящее время одним из перспективных методов
генотипирования с помощью которого можно идентифицировать и прослеживать
распространение вирулентных, резистентных к антибиотикам патогенов используя
информации международной базы в сети Интернет (PubMLST.org) [7].
Заключение. Проведен анализ MLST штамма Pasteurella/Saigas/2010/ZKO/KZ,
выделенного от сайгаков на территории Республики Казахстан. Штамм с номером схемы
ST 47 по 6 аллелям близкородственен к казахстанскому штамму, имеет отличие только в
аллели gdhA. Обнаружена одна нуклеотидная замена: Т234С (Тимин→Цитозин) по
нуклеотидной последовательности аллели gdhA.
Список литературы
1. Tang X. Isolation, antimicrobial resistance, and virulence genes of Pasteurella multocida
strains from swine in Chine / X.Tang, Zh. Zhao, J. Hu, B. Wu, X. Cai, Q. He, and H. Chen //
Journal of Clinical Microbiology, Apr. 20019, p. 951-958.
209
2. Сайгак. http://ru.wikipedia.org/wiki/Сайгак.
3. Грачев Ю.А., Бекенов А.Б., Массовая гибель сайгаков в Казахстане – погибло
около 12000 особей // Saiga News-2010. –Вып.11, Cтр. 2-3.
4. Миронов К.О. Генетическая характеристика московских штаммов Neisseria
meningitides / К.О. Миронов, А.Е. Платонов, И.С. Королева, Т.А. Тагаченкова, С.И.
Браславская, Г.А. Шипулин // Болезни и возбудители. -2011, Том 13 (12). -Стр. 135-148.
5. Maiden M.C., Bygraves J.A., Feil E. Multilocus sequence typing: a portable approach to
the identification of clones within populations of pathogenic microorganisms //
Proc.Nat.Asad.Sci. USA. -1998, (95). –P 3140-3145.
6. Платонов А.Е., Шипулин Г.А., Платонова О.В. Мультилокусное секвенирование –
новый метод генотипирования бактерий и первые результаты его применения // Генетика. 2000, 36(5). -Cтр. 21-25.
Түйін. Патологиялық материалдан бөлініп алынған Pasteurella/Saigas/2010/ZKO/KZ
штамы MLST әдісімен талданды. Берілген жұмыстың нәтижелері киіктерден бөлініп
алынған зерттелуші штамның 7 аллель: аdk, aroA, рgi, g6pd, gdhA, mdh, deoD бойынша
PubMLST.org халықаралық базасындағы ST 47 штамына туыс екендігін көрсетті,
айырмашылық тек gdhA аллелінде байқалады. Pasteurella/Saigas/2010/ZKO/KZ штамының
gdhA аллелінің нуклеотидтік тізбегін PubMLST.org халықаралық базасындағы ST 47
штамымен салыстыру барысында нуклеотидтік алмасу: Т234С (Тимин→Цитозин)
анықталды.
Summary. The isolated strain Pasteurella/Saigas/2010/ZKO/KZ from the pathological
material is analyzed by MLST method. The results of this work is showed that the tested strain
isolated from saiga by 7 alleles: аdk, aroA, рgi, g6pd, gdhA, mdh, deoD is closely related to
strain ST 47 from the international data base (PubMLST.org) and observed only by gdh a allele.
Nucleotide replacement of Т234С (Thimine→Cytosine) is detected for comparative nucleotide
sequences of gdh a allele of strain Pasteurella/Saigas/2010/ZKO/KZ with ST 47 strain.
УДК 616-002.5-074 (574)
МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЙ АНАЛИЗ ГЕНА ESAT-6 ИЗОЛЯТОВ М.
TUBERCULOSIS, ВЫДЕЛЕННЫХ В КАЗАХСТАНЕ
Шыныбекова Г.О., Садикалиева С.О., Султанкулова К.Т. к.б.н., Строчков В.М.,
Сандыбаев Н.Т. к.б.н., Хайруллин Б.М. к.в.н., Сансызбай А.Р. д.в.н., профессор,
Өсербай М.А.
РГП «Научно-исследовательский институт проблем биологической безопасности»
КН МОН РК
Резюме. В данной статье представлены результаты молекулярно-генетического
анализа гена ESAT-6 изолятов М. tuberculosis, выделенных в Казахстане. Результаты
сравнительного анализа показали, что полученные нуклеотидные последовательности гена
ESAT-6 всех исследуемых изолятов 100 % идентичны как между собой, так и со
штаммами, представленными в базе данных GenBank.
Введение. Как известно, туберкулез по-прежнему считается одной из самых опасных
инфекционных болезней, распространенных во всем мире. Единственной разрешенной в
настоящее время вакциной от туберкулеза является вакцина BCG (Bacillus Calmette210
Guerin), которая представляет собой живой аттенуированный штамм Mycobacterium bovis.
Она безопасна, недорога, достаточно эффективно защищает детей, однако для защиты
взрослого населения от легочной формы заболевания, приводящей к тяжелой
эпидемической ситуации, ее эффективность колеблется от 0 до 80% [1].
Mycobacterium tuberculosis – это внутриклеточный патоген, и основная роль в
адаптивном иммунитете к туберкулезу принадлежит клеточным, а не гуморальным
факторам защиты [2]. Разные группы антигенов микобактерий, например, белки теплового
шока, липопротеины, секреторные белки, ферменты, изучены достаточно хорошо [3]. По
мнению многих авторов, основными мишенями (иммунодоминатными антигенами)
протективного иммунитета являются секреторные белки, присутствующие в
культуральном фильтрате М. tuberculosis. Среди них наиболее полно охарактеризованы
близкородственные белки комплекса Ag85 (Ag85A, В и С), ESAT-6 (Early Secret Antigen
Target) и CFP-10 (Culture-Filtrate Protein) [4].
Генно-инженерные препараты, содержащие отдельные антигены микобактерий,
представляют большой интерес. Они обладают такими существенными преимуществами
как низкая реактогенность, высокая чистота получаемого продукта, а также безопасность
для людей с ослабленным иммунитетом.
Значительный интерес с точки зрения разработки новых вакцинных кандидатов
представляют белки культурального фильтра микобактерий туберкулеза ESAT-6 (Early
Secreted Antigen, 6 кДа) [5]. Данный белок кодируется RD1 геномной областью
микобактерий, утраченной в процессе длительного культивирования в вакцинном штамме
BCG, и является иммунодоминантной мишенью для клеточного иммунного ответа как на
ранней стадии туберкулезной инфекции у человека, так и в различных моделях
экспериментального туберкулеза у животных [6].
Целью данной работы является проведение молекулярно-генетического анализа гена
ESAT-6 изолятов М. tuberculosis, выделенных в Республике Казахстан.
Материалы и методы. В качестве объектов исследований в работе использованы
изоляты бактерии М. tuberculosis (номера изолятов 35, 323, 371, 768, 938, 1004, 1043, 1089,
1200, 7585) доставленные из РГКП «Национальный центр проблем туберкулеза
Республики Казахстан», г. Алматы.
Выделение ДНК. Выделение ДНК проводили с использованием набора "PrepMan
Ultra Sample Preparation Reagent" фирмы Applied Biosystems, согласно протоколу
производителя.
Наработка гена. Наработку гена ESAT-6 исследуемых изолятов М. tuberculosis
проводили с помощью ПЦР анализа с использованием набора AccuPrime Taq DNA
Polymerase High Fidelity, фирмы Invitrogen. Были использованы праймеры с нуклеотидной
последовательностью PF:, 5'-GGCGCCGGCAAGCTTGCCATGACAGAGCAGCAGTGG-3'
PR: 5'-CGAACTCGCCGGATCCCGTGTTTCGC-3', размер получаемого продукта 344 п.о.
Амплификацию проводили на термоциклере GeneAmp PCR System 9700, Applied
Biosystem. Начальная денатурация прошла при 94 °С в течение 5 минут, после 30 циклов
денатурации при 94 °С в течение 1 мин, отжиг при температуре 55 °С в течение 1 мин и
репликация при 72 °С в течение 2 мин. Пост-репликация ПЦР прошла при 72 °С в течение
10 мин.
Электрофорез ДНК в 2% агарозном геле проводили, используя ТВЕ буфер
содержащий 1 мкл/мл бромистого этидия. Использовали аппарат для электрофореза
нуклеиновых кислот G-100, Pharmacia.
Секвенирование. Секвенирование ДНК проводили методом дидеоксисеквенирования
с использованием терминирующих дидеоксинуклеотидов (метод Сенгера) на
автоматическом, 16-капиллярном секвенаторе Genetic Analyser 3130 xl, Applied Biosystems.
211
Результаты и обсуждение. ESAT-6 является ранним секреторным антигеном массой
6кДа.
Данные электрофореза наработанных продуктов амплификации представлены на
рисунке 1.
M - маркер 1kb "Biolabs " 1 - изолят №35; 2 - изолят №323; 3 - изолят №371; 4 изолят №768; 5 - изолят №1089; 6 - изолят №1004; 7 - изолят №1043; 8 - изолят №938; 9
- изолят №1200; 10 - изолят №7585
Рисунок 1– Электрофореграмма ПЦР-продуктов гена ESAT-6 изолятов
М. tuberculosis
Для молекулярно-генетического анализа было проведено секвенирование данных
продуктов. В результате были получены нуклеотидные последовательности размером 344
п.н.
На рисунках 2 и 3 представлены результаты сравнительного анализа гена ESAT-6
казахстанских изолятов М. tuberculosis.
Рисунок 2 – Сравнительный анализ нуклеотидных последовательностей гена ESAT-6
212
Рисунок 3 – Сравнительный анализ нуклеотидных последовательностей
гена ESAT-6 с данными Genbank
Результаты сравнительного анализа нуклеотидных последовательностей гена ESAT-6
казахстанских изолятов М. tuberculosis по компьютерной программе Bio Edit показали, что
они идентичны между собой на 100 %. Также было выявлено 100 % гомологичность
данных изолятов со штаммами М. tuberculosis, представленными в международной базе
данных, с ID номерами CP002992.1, HES72590.1. FR878060.1 и др.
Ген, кодирующий ранний секреторный белок М. tuberculosis – ESAT-6 является
высококонсервативным. ESAT-6 распознается иммунной системой на начальной стадии
туберкулезной инфекции, способствуя пролиферации лимфоцитов, ответственных за
продукцию интерферона-гамма (ИФН-) – ключевого фактора протективного иммунитета
[7].
Полученные данные можно использовать как основу для конструирования
рекомбинантных штаммов, что является перспективным подходом в решении задач при
создании противотуберкулезных вакцин нового поколения.
Выводы. Сравнительный анализ показал, что нуклеотидные последовательности
гена ESAT-6 всех исследуемых изолятов М. tuberculosis, выделенные в Республике
Казахстан, идентичны между собой и со штаммами представленными в международной
базе Genbank. Степень идентичности составляет 100%.
Список литературы
1. Rook G.A.W., Seah G., Ustianowski A. M. tuberculosis immunology and vaccination //
EurRespir J. – 2001. – V.17. – P. 537-557
2. Sarhan M.A. Progress in Tuberculosis Vaccines Development // Research Journal of
Medicine and Medical Sciences. – 2007. –Vol. 2. № 2. – P. 35-41.
3. D'Souza S. Improved Tuberculosis DNA Vaccines by Formulation in Cationic Lipids //
IAI. – 2002. – Vol. 70. № 7. – P. 3681-3688.
4. Roche P.W. Expression of Mycobacterium tuberculosis MPT64 in recombinant Myco.
smegmatis: purification, immunogenity and application to skin tests for tuberculosis // Clin Exp
Immnol – 1996. – Vol. 103. – P. 226-232.
213
5. Andersen P. Specific immune- besed diagnosis of tuberculosis // Lancet. – 2000. – № 356.
– P.1099-1104.
6. Brodin P., Rosenkrands I., Andersen P., Cole S.T., Brosch R ESAT-6 proteins:
Protective antigens and virulence factors? Trends Microbiol – 2004. – V. 12 № 11. – P. 500508.
7. Татьков С.И., Дейнеко Е.В., Фурман Д.П. Перспективы создания
противотуберкулезных вакцин нового поколения // Вавиловский журнал генетики и
селекции – 2001. – Т.15 №1 – С. 114-129.
Түйін. Бұл мақалада, Қазақстанда бөлініп алынған М. tuberculosis изоляттарының
ESAT-6 генінің молекулалы-генетикалық талдауының нәтижелері көрсетілген.
Салыстырмалы талдау нәтижелері барлық зерттелініп отырған изоляттардың ESAT-6
генінен алынған нуклеотидті тізбектері Genbank базасында келтірілген штамдарымен және
өзара ұқсастығы 100 % құрайтынын көрсетті.
Summary. This article presents the results of the molecular and genetic analysis of gene
ESAT-6 of isolates M. tuberculosis, isolated in Kazakhstan. The results of comparative analysis
showed that the obtained nucleotide sequence of the gene ESAT-6 of all studied isolates are 100%
identical, both among themselves and with the strains represented in the database of GenBank.
214
СОДЕРЖАНИЕ
Алғысөз ……………………………………………………………………………………5
Предисловие ……………………………………………………………………………... 7
Introduction ………………………………………………………………………………. 9
Абитаева Г.К., Бекенова Н.Е., Нағызбекқызы Э., Ануарбекова С.С.
Создание консорциума на основе штаммов lactobacillus ................................................11
Абитаева Г.К., Туякова А.К., Уразова М.С.
Новые пробиотические препараты направленного действия .........................................14
Абсатова Ж.С., Мамбеталиев М., Ажибаев А.Ж.,
Килибаев С.С., Битешова Э.Т., Валиева А.Д., Есимбекова Н.Б.,
Кенжебаева М.К., Табынов К.К.
Сохраняемость лиофилизированной вакцины против оспы верблюдов
при разных температурно-временных режимах хранения ..............................................17
Акжунусова И.К., Асанжанова Н.Н., Табынов К.К.
Технологические аспекты культивирования вирусов гриппа А и В для
разработки трехвалентной сплит-вакцины против сезонного гриппа .......................... 20
Акылбаева К.К., Шораева К.А., Тленчиева Т.М., Садикалиева С.О.,
Строчков В.М., Султанкулова К.Т. к.б.н., Сандыбаев Н.Т.,
Сансызбай А.Р.
Генетический анализ вирулентного гена споруляции сигма фактора
(SIGK) Clostridium perfringens, выделенный от сайгаков ............................................... 23
Алиева А.Б., Далбаев Н.К., Жилин Е.С., Баракбаев К.Б.
Изучение иммуногенности экспериментальной инактивированной
вакцины против бешенства животных ............................................................................. 29
Аманова Ж.Т., Таранов Д.С., Ершебулов З.Д., Булатов Е.А.,
Баракбаев К. Б., Сансызбай А.Р.
Оценка безвредности и реактогенности ассоциированной вакцины
против чумы мелких жвачных животных и оспы овец .................................................. 32
Аюпова А.Ж., Сарсенова А.С., Молдагулова Н.Б.
Оптимизация условий культивирования активных
штаммов-нефтедеструкторов ............................................................................................ 38
Базылова Т.А., Уразалиев К.Р., Абекова А.М.
Использование молекулярно - генетических маркеров в
генотипировании сортов озимой пшеницы ..................................................................... 41
Барышникова Е.И., Колбасова О.Л.
Выявление лентивирусных инфекций мелких жвачных
в популяциях мелкого рогатого скота ...............................................................................43
215
Безрукова А.Н., Жилин Е.С., Кайсенов Д.Н., Зинина Н.Н.,
Строчков В.М., Еспембетов Б.А.
Определение патогенности штамма «Pasteurella/Saigas/2011/ZKO/KZ»
на лабораторных животных ............................................................................................... 47
Бекенова Н.Е., Егинчибаева А.Д., Ануарбекова С.С.
Изучение заквасочных свойств штаммов бактерий рода Lactobacillus,
перспективных в качестве стартерных культур для производства
кисломолочных продуктов функционального питания .................................................. 52
Богданов Н.В., Касенов М.М., Волгин Е.Н., Нурпейсова А.С.,
Исагулов Т.Е., Сарсенбаева Г.Ж., Хайруллин Б.М.
Методы технологического и биологического контроля качества
рекомбинантных вакцин против туберкулеза в
Научно-исследовательском институте проблем
биологической безопасности ………………………………………………..................... 55
Богданова П.Д., Дрошнев А.Е., Завьялова Е.А., Гулюкин М.И.
Тест-система для дифференциальной диагностики йерсиниоза
лососевых рыб ..................................................................................................................... 61
Варенцова А.А., Шевченко И.В., Зиняков Н.Г.
Создание клонотеки, кодирующей иммунологически значимые белки
полевого изолята вируса африканской чумы свиней ..................................................... 64
Гоцкина Т.М., Табынов К.К.
Краткий обзор по гриппозным вакцинам, зарегистрированным на
территории стран таможенного союза .............................................................................. 68
Ермилова О.С., Гинько З.И., Белявская В.А.
Оценка связи демографических факторов и клинических проявлений с
эффективностю первичной вакцинации живой осповакциной ...................................... 77
Есенбаева А.Е., Тен О.А., Балпанов Д.С.
Перспективные симбиотические азотфиксирующие микроорганизмы .........................80
Есенбаева А.Е., Тен О.А., Балпанов Д.С.
Bacillus subtilis S-2 для создания биопестецидов ............................................................. 83
Еспембетов Б.А., Сырым Н.С., Зинина Н.Н., Табынов К.К.,
Рыскельдинова Ш.Ж., Нисанова Р.К., Сармыкова М.К.,
Безрукова А.Н., Конбаева Г.М.
Определение минимальной заражающей дозы контрольного штамма
B. abortus 544 для крупного рогатого скота конъюнктивальным методом ……………87
Жилин Е.С., Безрукова А.Н., Червякова О.В., Кайсенов Д.Н.,
Строчков В.М., Зинина Н.Н., Еспембетов Б.А.
Аттенуированые штаммы Pasteurella multocida, их безопасность и
иммуногенные свойства ...................................................................................................... 92
216
Зиняков Н.Г., Овчинникова Е.В., Лазарева С.П., Дрыгин В.В.
Применение технологии 454 life sciences в работах по изучению возбудителей
вирусных болезней птиц ..................................................................................................... 98
Исагулов Т.Е., Нурпейсова А.С., Касенов М.М., Волгин Е.Н.,
Богданов Н.В., Сарсенбаева Г.Ж., Акунова С.О., Хайруллин Б.М.
Доклиническое изучение безопасности противогриппозного лекарственного
препарата на основе эфирного масла Nepeta ucranica …………………………………102
Исмагамбетова Д.Ж., Наханов А.К., Жаппарова Г.А.
Оценка влияния фармазина на элиминацию микоплазм в культурах клеток …......... 109
Карпова М.А., Завьялова Е.А., Дрошнев А.Е., Гулюкин М.И.
Получение конъюгата в составе тест-системы для выявления вируса
возбудителя инфекционного некроза поджелудочной железы лососевых
рыб (IPNV) иммуноферментным методом ……………………………………………. 112
Килибаев С.С., Мамбеталиев М., Ажибаев А.Ж., Абсатова Ж.С.,
Битешова Э.Т., Валиева А.Д., Есимбекова Н.Б., Кенжебаева М.К.,
Табынов К.К.
Тестирование реверсибельности аттенуированного штамма «КМ-40»
вируса оспы верблюдов, применяемого для разработки живой вакцины ................... 115
Кожамкулов Е.М., Рыскельдинова Ш.Ж., Табынов К.К.
Новый кандидат вакцины против В. abortus на основе гриппозного вектора:
оценка безопасности на крупном рогатом скоте ……………………………………… 117
Козлов А.А., Андрейчук Д.Б., Андриясова А.Н., Мудрак Н.С.
Очистка и концентрирование вируса инфекционного
ларинготрахеита птиц ………………………………………………………................... 125
Костеневич А.А., Тригубович А.М., Черноок Т.В., Пучкова Т.А.,
Иконникова Н.В.
Подбор ассоциаций дрожжевых культур для эффективного использования
послеспиртовой барды ………………………………………………………………….. 128
Кошеметов Ж.К., Кыдырбаев Ж.К., Султанкулова К.Т.,
Нурабаев С.Ш., Матвеева В.М., Богданова М.И., Сугирбаева Г.Д.,
Оразымбетова Н.К., Бурашев Е.Д.
Чума плотоядных угрожает редким животным ……………………………………….. 131
Maksyutov R.A., Gavrilova E.V., Meyer H., Shchelkunov S.N.
Real-time PCR assay for specific detection of cowpox virus ……………………………..136
Никонова З. Б., Ярославцева П. С., Волкова М. А., Мудрак Н. С.
Выявление антигена метапневмовируса птиц в твердофазном непрямом
«Сэндвич»-варианте иммуноферментного анализа с использованием
моноклональных антител ………………………………………………………………... 140
217
Осокина Н.В., Калашникова Е.А.
Изучение и анализ развития различных видов фузариума тритикале
in vitro под влиянием регуляторов роста растений …..……………………………….. 143
Рсалиев А.С., Амирханова Н.Т., Агабаева А.Ч., Омарова Г.Х.,
Асраубаева А.М., Байгутов М.Ж.
Устойчивость сортов ячменя к возбудителям пятнистостей листьев
в Казахстане ……………………………………………………………………………… 146
Садикалиева С.О., Султанкулова К.Т., Строчков В.М., Тасыбаева А.С.,
Шыныбекова Г.О., Өсербай М.А., Сандыбаев Н.Т., Сансызбай А.Р.
Мутация гена katG изолятов M.tuberculosis, выделенных в
Республике Казахстан ……………………………………………………….................... 152
Самолтырова А.Ж., Таранов Д.С., Булатов Е.А.
Сроки наступления иммунитета у овец, привитых ассоциированной
вакциной против чумы мелких жвачных животных и оспы овец ……………………. 156
Сансызбай А. Р., Сыздыков М.С., Еспембетов Б.А.,Ирсимбетова Н.,
Сандыбаев Н.Т., Кузнецов А.Н., Сырым Н.С., Кормакова Н.Ф.
Основные принципы реагирования на акты биотерроризма ……………...................... 158
Сарсенбаева Г.Ж., Касенов М.М., Хайруллин Б.М., Волгин Е.Н.,
Нурпейсова А.С., Богданов Н.В., Исагулов Т.Е.
Изучение терапевтической эффективности рекомбинантных
гриппозных векторов, экспрессирующих протективные антигены
микобактерий туберкулеза ………………………………………………………………. 164
Тайлакова Э.Т., Червякова О.В., Султанкулова К.Т.
Бактериальная экспрессия генов вируса оспы овец, кодирующих
антигенные белки А4 и B5 …………………………………………………..................... 172
Таранов Д.С., Жилин Е.С., Ершебулов З.Д., Булатов Е.А.,
Баракбаев К.Б., Далбаев Н.К.
Экспериментальное изучение возможности культивирования вируса
Бешенства штамм «VRC-RZ2» в суспензионной культуре клеток ВНК-21 …………. 175
Тленчиева Т.М., Шораева К.А., Строчков В.М., Султанкулова К.Т.,
Сандыбаев Н.Т., Сансызбай А.Р.
Генетический анализ фимбриальных генов бактерий Pasteurella multocida
выделенных от сайгаков ………………………………………………………………… 179
Уразова М.С., Молдагулова А.К., Джаилбекова А.С., Келдибекова Р.Н.,
Кажыбаев А.К., Абдыкадырова А.Б., Бекенова Э.Е.
Бактериоцинпродуцирующие штаммы молочнокислых бактерий
подавляющие рост Listeria monocytogenes ………………………………………………183
Хасенова Э.Ж., Молдагулова Н.Б.
Выделение различных физиологических групп микроорганизмов
бытовых сточных вод ……………………………………………………….................... 186
218
Хасенова Э.Ж., Шарипова Г.Ж., Молдагулова Н.Б.
Скрининг нефтеокисляющих микроорганизмов по способности к росту
на различных углеводородах …………………………………………………………… 190
Циванюк М.А., Брундакова Т.Н., Чагина С.А., Чвала И.А., Ирза В.Н.
Результаты серомониторинговых исследований по Ньюкаслской
болезни среди диких и синантропных птиц на территории
Российской Федерации в 2013 г. ………………………………………………………... 193
Шалгынбаев Э.К., Рябинникова А.И., Рыстаева Р.А., Омарова З.Д.,
Орынбаев М.Б.
Выделение и культивирование вируса ринопневмании лошадей
на культуре клеток ……………………………………………………………………….. 196
Шарипова Г.Ж., Аипова Р., Махатова А.С., Курманбаев А.А.
Первичный скрининг микроорганизмов-деструкторов АПАВ ……………………….. 200
Шевцова С.Н., Бабенко А.С.
Воздействие ацетата свинца на рост и экспрессию металлотионеина
у молоди моллюска Lymnaea stagnalis после влияния ацетата цинка
в течение эмбриогенеза …………………………………………………………………... 203
Шораева К.А., Тленчиева Т.М., Султанкулова К.Т., Строчков В.М.
Характеристика штамма Pasteurella/Saigas/2010/ZKO/KZ методом MLST ……………206
Шыныбекова Г.О., Садикалиева С.О., Султанкулова К.Т., Строчков В.М.,
Сандыбаев Н.Т., Хайруллин Б.М.,Сансызбай А.Р., Өсербай М.А.
Молекулярно-генетический анализ гена ESAT-6 изолятов М. tuberculosis,
выделенных в Казахстане …………………………………………………………………210
219
1/--страниц
Пожаловаться на содержимое документа