close

Вход

Забыли?

вход по аккаунту

...Смертельная схватка с Другим;docx

код для вставкиСкачать
РОССИЙСКАЯ АКАДЕМИЯ НАУК
ИНСТИТУТ ОБЩЕЙ ГЕНЕТИКИ им. Н. И. ВАВИЛОВА
На правах рукописи
УДК 575.174
Наумова Оксана Юрьевна
ЭТНИЧЕСКАЯ ГЕНЕТИКА ТОБОЛО-ИРТЫШСКИХ СИБИРСКИХ
ТАТАР ПО ДАННЫМ О РАЗНООБРАЗИИ МИТОХОНДРИАЛЬНОЙ ДНК
Диссертация
на соискание ученой степени
кандидата биологических наук
Специальность
03.00.15 – Генетика
Научный руководитель
к.б.н. Рычков С.Ю.
Москва
2008
2
ОГЛАВЛЕНИЕ
ВВЕДЕНИЕ
ГЛАВА 1. ОБЗОР ЛИТЕРАТУРЫ
1.1. Митохондриальная ДНК как инструмент исследований
популяционной и исторической генетики
1.2. Формирование этнической общности сибирских татар
3
8
8
по совокупным данным археологии, антропологии и этнографии 21
ГЛАВА 2. МАТЕРИАЛЫ И МЕТОДЫ
2.1. Материалы
2.2. Методы
ГЛАВА З. РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ
3.1. Соотношение европеоидного и монголоидного
32
32
35
41
компонентов в митохондриальном генофонде сибирских татар
41
выявленных у тоболо-иртышских сибирских татар
54
генофондов населения Северной Евразии
65
локальных популяциях тоболо-иртышских татар
70
3.2. Разнообразие и филогеография гаплотипов мтДНК,
3.3. Положение генофонда сибирских татар в ряду этнических
3.4. Изменчивость мтДНК в этнолингвистических группах и
ЗАКЛЮЧЕНИЕ
ВЫВОДЫ
СПИСОК ЛИТЕРАТУРЫ
88
94
95
3
ВВЕДЕНИЕ
Актуальность темы. Основоположник исторических и этнографических
исследований в Сибири Г.Ф. Миллер писал: «Если до сих пор, несмотря на
большой положенный труд, нельзя было пролить полный свет на происхожде-
ние и древнейшую историю самых известных народов Европы, то можно ли
надеяться достигнуть этого в отношении столь отдаленной страны, о которой
сохранилось еще меньше исторических источников, причем нельзя рассчитывать на их пополнение.» (Миллер, 1999, стр. 166). В качестве новых источни-
ков знаний об истории народов выступают данные археологии, антропологии
и генетики и проводимые на основе этих данных и их совокупности реконструкции происхождения и истории групп населения.
Эта работа выполнена в контексте реконструкции генетической истории
тюркоязычного населения бассейна Тобола и Иртыша, основанной на данных
о разнообразии митохондриальной ДНК (мтДНК), зарекомендовавшей себя как
надежный и высокоинформативный инструмент исследований эволюционной,
популяционной и исторической генетики. Тому способствуют уникальные осо-
бенности мтДНК, во-первых, отсутствие рекомбинации способствует простоте
реконструкции предковых форм, гаплотипов-основателей, наблюдаемого генетического разнообразия. Во-вторых, высокая скорость накопления мутаций
приводит к высокому уровню полиморфизма мтДНК, и соответственно к высокому уровню дифференциаций митохондриального генофонда населения.
Многочисленные популяционно-генетические исследования выявили большое
разнообразие линий или гаплотипов мтДНК в популяциях населения мира, а
также показали, что все эти гаплотипы объединяются в монофилетические,
имеющие исходные предковые формы, кластеры или гаплогруппы. Гаплогруппы мтДНК обладают высокой степенью расоспецифичности; так, различные их наборы описывают разнообразие в монголоидных и европеоидных
популяциях Евразии. Эти два больших класса гаплогрупп, определяя соответ-
ственно монголоидный и европеоидный пулы гаплотипов мтДНК, могут с вы-
4
сокой степенью надежности читаться как соответствующие компоненты в генофондах популяций. Сравнительный анализ распространения индивидуаль-
ных гаплотипов мтДНК в популяциях позволяет восстановить сценарии
межпопуляционных взаимодействий – установить общность происхождения
популяций, направления межпопуляционных генетических взаимосвязей и т.д.
Сибирские татары – тюркоязычный народ, населяющий обширный ареал
степной и лесостепной зоны Сибири от Урала до Алтая. Совокупные данные ар-
хеологии, палеоантропологии и этнографии свидетельствуют, что формирова-
ние этноса «сибирские татары» восходит к раннему средневековью – времени
Великого переселения народов, и связано с проникновением тюрков из Минусинской котловины, Средней Азии и Алтая на земли, населенные предками сов-
ременных угорских и самодийских народов Западной Сибири. В средние века
взаимодействие населения западносибирской лесостепи с тюрко- и монголоязычными народами Средней и Центральной Азии становится процессом не-
прерывным и связано с образованием в этих регионах мощных государств. Так,
с VI по XVI вв. южные территории Западной Сибири последовательно входили
в состав 1-го и 2-го Тюркских, Уйгурского и Кыргызского каганатов, в Золото-
ордынское государство, Тюменское и Сибирское ханства. Во времена последних сложились основные группы татар. В настоящее время выделяют
этнолингвистические группы: томская, барабинская и тоболо-иртышская, кон-
солидация которых привела к возникновению этнической общности «сибирские татары», а степень этой консолидации остается дискуссионным вопросом.
Этногенез сибирских татар представляет собой яркий пример смешения
угорских, самодийских, тюркских и монгольских племен и народов. Эти ком-
поненты в различных соотношениях присущи множеству народов Северной
Евразии, поэтому исследование генофонда сибирских татар представляется зна-
чимым для анализа генетической структуры и генетической истории народонаселения всего североевразийского региона. Кроме того, генофонд сибирских
татар представляет интерес в плане исследований генетических процессов, сопутствующих взаимодействиям групп населения с разным хозяйственно-куль-
5
турным укладом и уровнем социально-экономического развития.
Данная работа акцентирует внимание на изучении полиморфизма мтДНК
у тоболо-иртышских сибирских татар. Эта группа самая крупная, занимает гео-
графически центральное место в этническом ареале сибирских татар и пред-
ставлена наибольшим числом этнолингвистических подгрупп, в их числе
тюменские, тобольские, заболотные, тарские и тевризские татары. Кроме того,
бассейн Тобола и Иртыша являлся одним из важнейших регионов в истории
тюркского населения юга Западной Сибири. Именно здесь складывались соб-
ственно сибирские государственные образования – Тюменское (XIV в.) и Сибирское (XVI в.) ханства. С этим регионом связаны представления о
географической родине происхождения сибирских татар.
Цель и задачи исследования. Основная цель работы – исследование раз-
нообразия мтДНК в популяциях тоболо-иртышских татар в контексте реконструкции генетической истории тюркского населения юга Западной Сибири.
В рамках исследования были поставлены следующие задачи:
1) на основе полиморфизма последовательности ГВСI мтДНК выявить индивидуальное разнообразие мтДНК в популяциях тоболо-иртышских татар;
2) на основании данных об изменчивости нуклеотидной последовательности
ГВСI и/или рестрикционного полиморфизма мтДНК рассмотреть особенности
распространения у сибирских татар европеоидных и монголоидных линий
мтДНК;
3) определить степень изменчивости мтДНК на различных уровнях популя-
ционной структуры изучаемого населения – оценить вклад локальных популяций и территориально-лингвистических групп в генетическое разнообразие
тоболо-иртышских сибирских татар;
4) провести сравнительный анализ характеристик митохондриальных гено-
фондов сибирских татар и других, в особенности тюркоязычных, народов Северной Азии;
5) оценить филогенетическое положение генофонда сибирских татар в ряду этнических генофондов населения Северной Евразии.
6
Научная новизна работы. Сведения о генофонде сибирских татар крайне
немногочисленны – это данные о частотах групп крови систем AB0 и Rhesus в
локальной популяции (Багашёв, 1993) и частотах гаплотипов Y-хромосомы у
томских татар (Харьков, 2005). Поэтому данная работа фактически открывает
тему исследования генетического разнообразия и генетической истории си-
бирских татар и впервые предоставляет данные о разнообразии мтДНК у тюр-
коязычного населения Западной Сибири – у тоболо-иртышских сибирских
татар.
Исследования разнообразия мтДНК в популяциях человека в настоящее
время акцентируют внимание на изучении генетического разнообразия и генетической истории регионов, этнических групп и народов. В качестве наименьшей неподразделенной популяции в работах, как правило, выступает этнос.
Лишь в последние годы стали появляться данные о разнообразии мтДНК в популяциях субэтнического уровня (Dubut et al., 2004; Kasperavičiūté et al., 2004;
Malyarchuk et al., 2004; Pliss et al., 2005; Морозова, 2007; Голубенко и др.,
2007). Т.е. вопросы изменчивости мтДНК на различных уровнях популяционной структуры населения слабо разработаны. В этом плане являются новыми и,
по-видимому, должны представлять интерес приводимые в этой работе результаты анализа изменчивости мтДНК в этнотерриториальных группах и, в
особенности, в локальных популяциях тоболо-иртышских татар.
Научно-практическое значение. Полученные данные о полиморфизме
мтДНК у тоболо-иртышских сибирских татар, оценка внутриэтнической изменчивости мтДНК и реконструкция филогенетических отношений сибирских
татар и народов Северной и Центральной Азии являются важным вкладом в
систему знаний об этнических генофондах населения Северной Евразии. Полученные в работе результаты могут быть привлечены для решения теорети-
ческих и практических задач в различных областях естественных и
гуманитарных наук, включая генетику, антропологию, этнографию и историю.
Полученные результаты могут быть использованы в учебном процессе для лекционных курсов по перечисленным выше отраслям науки.
7
Апробация работы и публикации. Основные положения и результаты
диссертационной работы представлены и обсуждены на международных науч-
ных конференциях «Генетика в России и в мире» (Москва, 2006) и «Северная
Азия в антропогене: человек, палеотехнологии, геоэкология, этнология и антропология» (Иркутск, 2007), на отчетной конференции по подпрограмме фун-
даментальных исследований РАН «Динамика генофондов» (Москва, 2007), на
научном семинаре «Популяционная и эволюционная генетика» отдела генетики
популяций и природопользования ИОГен РАН (Москва, 2008).
По материалам диссертации опубликовано 5 работ.
Структура и объем диссертации. Работа состоит из введения, трех глав
(Обзор литературы, Материалы и методы, Результаты и обсуждения), заключения, выводов и списка литературы, содержащего 151 ссылку: 59 на русском и
92 на английском языках. Диссертация изложена на 107 страницах и содержит
15 таблиц и 18 рисунков.
Автор выражает глубокую признательность научному руководителю С.Ю.
Рычкову и зав. лаб. генетики человека ИОГен РАН О.В. Жуковой за оказанную
всестороннюю помощь в проводимом исследовании; Ю.В. Шнейдеру, И.Ю.
Морозовой и А.Н. Евсюкову за плодотворное обсуждение результатов работы;
И.Е. Кондратьевой за участие и неоценимую поддержку на всех этапах работы;
А.Н. Багашёву и работникам местных органов здравоохранения Омской и Тюменской обл. РФ за помощь в экспедиционных сборах материала; коллегам ге-
нетикам, археологам и антропологам – участникам конференций за обсуждение
и конструктивную критику результатов исследования. Особую благодарность
автор приносит жителям деревень Юртобор, Варвара, Кутарбитка, Тоболтура и
Ачиры Тюменской обл., Утузы и Саургачи Омской обл. РФ за предоставление
проб крови для генетического анализа.
8
Глава 1. ОБЗОР ЛИТЕРАТУРЫ
1.1. Митохондриальная ДНК как инструмент исследований популяционной и исторической генетики
Митохондриальная ДНК представляет собой геном клеточных органелл –
митохондрий. Эндосимбиотическое происхождение этих органелл (Wallace,
1982) обусловливает полуавтономное существование их генетической системы
(Wallace et al., 1975; Минченко, Дударева, 1990). Так, синтез ДНК в митохон-
дриях проходит независимо от синтеза ДНК ядерной, а наследование этой цитоплазматической генетической структуры – митохондриальной «хромосомы»
– происходит в норме строго по материнской линии. Такие особенности генома
позволяют рассматривать совокупность митохондриальных генов и любых реп-
лицирующихся фрагментов мтДНК как отдельный генетический ресурс популяции – «митохондриальный генофонд».
Митохондриальная «хромосома» представлена кольцевой двухцепочеч-
ной молекулой ДНК, которая присутствует в органелле в виде ковалентно замкнутой суперспирализованной формы, ассоциированной с внутренней
мембраной митохондрии. В каждой клетке присутстует от нескольких сотен до
тысяч копий мтДНК (Гаузе, 1977; Shoubridge et al., 2007). Как правило, один ор-
ганизм характеризуется единой формой мтДНК, т. е. одним гаплотипом, унаследованным по материнской линии.
Высокая степень изученности генетического аппарата митохондрий обу-
словлена небольшими размерами митохондриального генома, отличающегося
плотной локализацией генов, отсутствием интронов и протяженных нетранскрибируемых участков. По сравнению с другими видами, митохондриальный
геном человека, состоящий из 16569 пар нуклеотидов (п. н.), отличается наи-
большей компактностью: здесь гены белковых комплексов и рибосомальных
РНК чередуются с генами РНК транспортной, а межгенные участки представлены короткими, в несколько нуклеотидов, вставками (Anderson et al., 1981;
Wallace, 1989; Минченко, Дударева, 1990). Единственной протяженной (1122
9
п. н.) некодирующей структурой митохондриального генома является петля смещения, или D-петля (от англ. «displacement loop»), участки которой обеспечи-
вают ассоциацию митохондриальной хромосомы на мембране органеллы и
выполняют регуляторные функции в геноме.
Несмотря на компактное расположение экспрессируемых последова-
тельностей и отсутствие интронных структур, митохондриальный геном отли-
чается выраженной нестабильностью – скорость эволюции мтДНК превышает
таковую ДНК ядерной в 10–20 раз (Brown et al., 1979; 1982). Высокий уровень
мутагенеза мтДНК объясняется отсутствием эффективных систем репарации,
измененным генетическим кодом и протекающими в митохондрии окислительно-восстановительными процессами (Richter et al., 1988; Минченко, Ду-
дарева 1990; Lindahl, 1993). Разной степенью изменчивости характеризуются
не только отдельные гены, но и различные участки одного и того же гена или
фрагмента мтДНК (Saccone et al., 1982; 1991). Наиболее изменчивая область
митохондриального генома – D-петля – также обладает консервативными и вариабельными участками, наиболее полиморфным из которых является домен,
расположенный между позициями 16024 и 16400 п. н., или гипервариабельный
сегмент I – ГВСI (Vigilant et al., 1989).
Работы Брауна с соавторами (Brown, 1980; Brown et al., 1982), посвя-
щенные сравнению последовательностей мтДНК у приматов и человека, а
также у представителей различных человеческих рас, впервые показали высокую информативность мтДНК как инструмента исследований эволюционной,
популяционной и исторической генетики. Этому способствуют уникальные
особенности мтДНК: во-первых, высокая скорость изменчивости мтДНК при-
водит к высокому уровню ее полиморфизма в популяциях такого молодого вида,
как человек. Во-вторых, отсутствие рекомбинаций (хотя в литературе появлялись сообщения о возмости рекомбинации мтДНК (Hagelberg et al., 1999; Awa-
dalla et al., 1999), вызвавшие оппонирующие отзывы (Science, 2000; 288:1931a)
способствует простоте реконструкции предковых форм – гаплотипов-основателей наблюдаемого сегодня генетического разнообразия. И, в-третьих, насле-
10
дование от одного родителя определяет мтДНК как нейтральный маркер материнской линии. Расшифровка Андерсоном с сотрудниками (Anderson et al.,
1981) полной нуклеотидной последовательности мтДНК человека предоста-
вила исследователям единый стандарт и большую степень свободы в выборе
маркеров для изучения разнообразия мтДНК народонаселения.
В исследовании полиморфизма мтДНК в населении мира наиболее рас-
пространены следующие подходы. Первый подход – это высокоразрешающее
рестрикционное картирование тотальной молекулы мтДНК. Работы в этом направлении выявили высокий уровень разнообразия и показали наличие географической специфичности типов мтДНК (Ward et al., 1991; Ballinger et al.,
1992; Horai et al., 1993; Torroni et al., 1993; Chen et al., 1995; Wallace, 1995).
На основе диагностических рестрикционных сайтов в различных, преимущественно кодирующих участках мтДНК, ее гаплотипы объединяются в филоге-
нетические кластеры или гаплогруппы. Эти кластеры гаплотипов мтДНК были
обозначены заглавными латинскими буквами – A, B, C, D и т.д.. При этом географическое распространение этих кластеров отличается высокой специфичностью («континент-специфичностью»), различные наборы гаплогрупп
описывают разнообразие последовательностей мтДНК населения, принадлежащего к разным расам – негроидной (африканские гаплогруппы), европеоидной
(западноевразийские)
гаплогруппы) (рис. 1).
и
монголоидной
(восточноевразийские
Второй подход в исследовании разнообразия мтДНК – это изучение по-
лиморфизма ГВСI, реализуемое с помощью методов секвенирования. Поли-
морфизм ГВСI может на данный момент считаться наиболее изученным в
популяционном плане. Было установлено, что при большом разнообразии ин-
дивидуальных линий ГВСI мтДНК, эти гаплотипы объединяются в монофилитические группы. Так, для населения Европы и Передней Азии было выявлено
пять таких групп, объединяющих близкородственные гаплотипы на основе наиболее устойчивых ассоциаций нуклеотидных замен (Richards et al., 1996).
11
Рисунок 1. Схема филогенетического древа
гаплогрупп мтДНК, идентифицированных у
населения мира
В результате интеграции описанных подходов к концу 90-х гг. была раз-
работана единая систематика и классификация типов мтДНК народонаселения
на основе диагностических сайтов в кодирующих регионах и точечных мутаций
в ГВСI мтДНК (Torroni et al., 1993; 1996; Ward et al., 1996; Richards et al.,
1996; 2000; Macaulay et al., 1999). Наиболее полная сводка этих данных была
представлена в работе (Richards et al., 2000) (табл. 1). В основе этой система-
тики лежат все те же континентспецифические кластеры гаплотипов мтДНК.
Накопление данных о разнообразии мтДНК в популяциях из различных географических регионов позволило сделать систематику линий внутри гаплогрупп более детальной. На филогенетическом древе гаплотипов мтДНК
выявляются субкластеры (подгруппы мтДНК), обозначаемые цифробуквенным
кодом в дополнение к основному символу гаплогруппы (табл. 1; рис. 2), исследуются особенности географического распространения различных субкластеров мтДНК.
12
Таблица 1. Мотивы ГВСI и рестрикционный полиморфизм, маркирующие гаплогруппы митохондриальной ДНК (по: Richards et al., 2000)
Гапло-
Мотив ГВСI*
группа
A
16223 T, 16290 T, 16319 A
Мутации в кодирующем регионе
663 Hae III (+)
B
16189 C, 16217 C
D
16223 T, 16362 C
8271–8281 делеция 9 п. н.; 16517 Hae III (+)
10397 Alu I (+); 13259 Hinc II (–)/
13262 Alu I (+)
5176 Alu I (–); 10397 Alu I (+)
16304 C
12406 Hinc II (–)/12406 Hpa I (–)
C
E
F
G
H
HV
HV1
16223 T, 16298 C, 16327 T
16223 T, 16227 G, 16362 C
16017 C, 16129 A, 16223 T
Cтандарт
Стандарт
16067 T
pre-HV Стандарт / 16126 C, 16362 C
I
16129 A, 16223 T, 16391 A
J1
16069 T, 16126 C, 16261 T
J
J1a
J1b
J1b1
J2
JT
K
16069 T, 16126 C
16069 T, 16126 C, 16145 A, 16231 C, 16261 T
16069 T, 16126 C, 16145 A, 16222 T, 16261 T
16069 T, 16126 C, 16145 A, 16172 C, 16222 T,
16261 T
16069 T, 16126 C, 16193 T
16126 C
7598 Hha I (–); 10397 Alu I (+)
4830 Hae II (+) /4831 Hha I (+); 10397 Alu I (+)
7025 Alu I (–); 11718 Hae III (+);
14766 Mse I (–)
11718 Hae III (+); 14766 Mse I (–)
11718 Hae III (+); 14766 Mse I (–)
11718 Hae III (+)
10032 Alu I (+)
4216 Nla III (+); 13704 BstO I (–)
4216 Nla III (+); 13704 BstO I (–)
4216 Nla III (+); 13704 BstO I (–)
4216 Nla III (+); 13704 BstO I (–)
4216 Nla III (+); 13704 BstO I (–)
4216 Nla III (+); 13704 BstO I (–)
4216 Nla III (+)
L2
16224 C, 16311 C
16148 T, 16172 C, 16187 T, 16188 G, 16189 C, 16223
T, 16230 G, 16311 C, 16320 T
16126 C, 16187 T, 16189 C, 16223 T, 16264 T, 16270
T, 16278 T, 16311 C
16129 A, 16187 T, 16189 C, 16223 T, 16278 T, 16294
T, 16311 C, 16360 T
16129 A, 16148 T, 16166 G, 16187 T, 16189 C, 16223
T, 16278 T, 16311 C
16169 T, 16187 T, 16189 C, 16223 T, 16230 G, 16278
T, 16311 C, 16327 T
16223 T, 16278 T, 16390 A
L3b
16124C, 16223 T, 16278 T, 16362 C
10084 Taq I (+)
16223 T
2349 Mbo I (+)
L1a
L1b
L1c
L1e
L1f
L3
L3d
L3e
M
M1
N
N1
N1a
N1b
N1c
16223 T
16124C, 16223 T
16223 T
16129 A, 16189 C, 16223 T, 16249 C, 16311 C
16223 T
16223 T
16147 A/G, 16172 C, 16223 T, 16248 T, 16355 T
16145 A, 16176 G, 16223 T
16223 T, 16265 G
9052 Hae II (–)/9053 Hha I (–); 12308 Hinf I (+)
3592 Hpa I (+)
3592 Hpa I (+)
3592 Hpa I (+)
3592 Hpa I (+)
3592 Hpa I (+)
3592 Hpa I (+)
8616 Mbo I (–)
10397 Alu I (+)
10397 Alu I (+)
10871 Mnl I (+)
10237 Hph I (+)
10237 Hph I (+)
10237 Hph I (+)
10237 Hph I (+)
Таблица 1. (продолжение)
Гаплогруппа
Мотив ГВСI*
R1
16278 T, 16311 C
T
16126 C, 16294 T
R2
T1
T2
T3
T4
T5
U
U1
U1a
U1b
U2
U3
U4
U5
U5a
U5a1
U5a1a
U5b
U5b1
U6
U6a
U6a1
U6b
U7
V
W
X
Y
16071 T
16126 C, 16163 G, 16186 T, 16189 C, 16294 T
16126 C, 16294 T, 16304 C
16126 C, 16292 T, 16294 T
16126 C, 16294 T, 16324 C
16126 C, 16153 A, 16294 T
Стандарт
16249 C
16189 C, 16249 C
16249 C, 16327 T
16051 G, 16129 C
16343 G
13
Мутации в кодирующем регионе
4216 Nla III (+) 13366 BamH I (+)/13367 Ava II (–)/
13367 Mbo I (+) 15606 Alu I (+) 15925 Msp I (–)
4216 Nla III (+) 12629Ava II (–) 13366 BamH I (+) /13367
Ava II (–)/13367 Mbo I (+) 15606 Alu I (+) 15925 Msp I (–)
4216 Nla III (+) 13366 BamH I (+)/13367 Ava II (–)/
13367 Mbo I (+) 15606 Alu I (+) 15925 Msp I (–)
4216 Nla III (+) 13366 BamH I (+)/13367 Ava II (–)
/13367 Mbo I (+) 15606 Alu I (+) 15925 Msp I (–)
4216 Nla III (+) 13366 BamH I (+)/13367 Ava II (–)
/13367 Mbo I (+) 15606 Alu I (+) 15925 Msp I (–)
4216 Nla III (+) 13366 BamH I (+) /13367 AvaII (–)
/13367 Mbo I (+) 15606 Alu I (+) 15925 Msp I (–)
12308 Hinf I (+)
4990 Alu I (–) 12308 Hinf I (+) 13103 Hinf I (–) / 13104
Mbo I (+) 14068 Taq I (+)
4990 Alu I (–) 12308 Hinf I (+) 13103 Hinf I (–) / 13104
Mbo I (+) 14068 Taq I (+)
4990 Alu I (–) 12308 Hinf I (+) 13103 Hinf I (–) / 13104
Mbo I (+) 14068 Taq I (+)
12308 Hinf I (+) 15907Rsa I (+)
16356 C
12308 Hinf I (+)
4643 Rsa I (+) 11329 Alu I (+) 12308 Hinf I (+)
16192 T, 16270 T
12308 Hinf I (+)
16270 T
16192 T, 16256 T, 16270 T
16256 T, 16270 T, 16399 G
16189 C, 16270 T
16144 C, 16189 C, 16270 T
16172 C, 16219 G
16172 C, 16219 G, 16278 T
16172 C, 16189 C, 16219 G, 16278 T
16172 C, 16219 G, 16311 C
16318 T
16298 C
16223 T, 16292 T
16189 C, 16223 T, 16278 T
16126 C, 16231 C, 16266 T
12308 Hinf I (+)
12308 Hinf I (+)
12308 Hinf I (+)
12308 Hinf I (+)
12308 Hinf I (+)
12308 Hinf I (+)
12308 Hinf I (+)
12308 Hinf I (+)
12308 Hinf I (+)
12308 Hinf I (+)
4577 Nla III (–) 11718 Hae III (+) 14766 Mse I (–)
8994 Hae III (–)
14465 Acc I (+)
7933 Mbo I (+) 8391 Hae III (–)
Z
16185 T, 16223 T, 16224 C, 16260 T, 16298 C
10397 Alu I (+)
Примечание. * Приведены отличия от стандартной последовательности, опубликованной Андерсоном с соавторами (Anderson et al., 1981)
14
Рисунок 2. Филогенетическое древо гаплогрупп мтДНК, обнаруженных у китайцев хань (а) и в популяциях
Юго-Западной и Центральной Азии (б); приводится соответственно по: Yao et al., 2002 и Quintana-Murci et al.,
2004
15
За последние семь лет филосистематика линий мтДНК, оставаясь в ос-
нове своей неизменной, продолжает уточняться и детализироваться, иссле-
дуются особенности географического распространения субкластеров мтДНК.
Большую роль в этом играет третий подход в исследовании полиморфизма
мтДНК – это полногеномное секвенирование (Ingman et al., 2000; Finnila et al.,
2001; Derbeneva et al., 2002; Herrnstadt et al., 2002; Kong et al., 2003; 2006;
Quintana-Murci et al., 2004; Palanichany et al., 2004; Staricovskaya et al., 2005;
Macaulay et al., 2005; Sun et al., 2006; Derenko et al., 2007 и др.).
Каждая гаплогруппа представляет собой монофилетический кластер гап-
лотипов мтДНК, для которого может быть реконструирован гаплотип-основатель. На основе наблюдаемого сегодня разнообразия мтДНК у народонаселения
мира и с помощью метода «поиск основателя» (Richards et al., 2000) установ-
лены предполагаемый географический регион и время появления каждой гап-
логруппы мтДНК как среднее время дивергенции между гаплотипомоснователем и дочерними ему гаплотипами. Такие даты для евразийских по
происхождению гаплогрупп восходят к палеолитической эпохе и варьируют от
50 (для гаплогрупп U и B) до 13 (для гаплогруппы K) тысяч лет назад. Под-
робно вопросы происхождения гаплогрупп и иррадиации принадлежащих им
гаплотипов мтДНК освещены в ряде работ (Watson et al., 1997; Richards et al.,
1996; 2000; 2002; Torroni et al., 1998; 2001; Macaulay et al., 1999; QuintanaMurci et al., 1999; Kivisid et al., 1999; Mishmar et al., 2003; Reidla et al., 2003;
Kong et al., 2003; 2006; Hill et al., 2007 и др.). В научно-популярной книге Р.
Сайкса «Семь дочерей Евы» безликие гаплотипы-основатели, или прароди-
тельницы семи европейских гаплогрупп мтДНК персонифицированы, им присвоены имена, начинающиеся с соответствующей обозначению гаплогруппы
буквы (H – Helena, U – Ursula и т.д.), в художественной форме представлены
жизнеописания этих жительниц палеолитической Европы (Сайкс, 2003). Этот
опыт поэтического определения гаплогрупп мтДНК был распространен и на
гаплогруппы азиатского происхождения.
Сложившееся сегодня представление о филогении гаплогрупп мтДНК на-
16
селения Ойкумены соответствуют гипотезе «митохондриальной Евы» (Cann et
al., 1987), согласно которой прародительница наблюдаемого сегодня разнооб-
разия мтДНК населения мира позиционируется в Африку ~ 200 тыс. лет назад.
Так все евразийские (как европеоидные, так и монголидные) гаплогруппы
мтДНК производят от африканской гаплогруппы L3. Возникает понятие макрогрупп – M, N и R, объединяющих на филогенетическом древе ряд неафри-
канских кластеров мтДНК (рис. 1 и 2). Установившееся представление о
формировании современного разнообразия мтДНК у населения мира, в рамках
теории его происхождения «из Африки» и с позиций экспансии гаплогрупп
мтДНК отражено на рисунке 3. Рисунок приводится с минимальными изменениями из интернет-ресурса: www.worldfamilies.net.
Рисунок 3. Филогеография гаплогрупп мтДНК и экспансия населения, оценки времени экспансии
Выделение таких крупных таксономических единиц в разнообразии
мтДНК человека как гаплогруппы позволило в первую очередь объять это гигантское разнообразие, где теоретически возможное число гаплотипов может
насчитывать как минимум 165694. Исследование разнообразия мтДНК на этом
уровне общности гаплотипов наиболее успешно применяется для изучения ге-
нетических аспектов крупных миграционных событий, процессов заселения
17
континентов и субконтинентов. Здесь в качестве примера можно привести ре-
конструкции процессов заселения Нового Света на основе данных о филогеографии гаплогрупп мтДНК, согласно которым заселение происходило
несколькими миграционными волнами: 26–34, 12–15 и 7–9 тыс. лет назад (Torroni et al., 1993; Wallace et al., 1995; Forster et al., 1996; Merriwether et al.,
1996). Последняя миграционная волна из перечисленных ассоциируется с появлением в Северной Америке предков современных на-дене. Истоки происхождения
разнообразия
мтДНК
коренного
населения
Америки
позиционируются по данным разных авторов в Южную Сибирь (Сукерник и
др., 1996), или Монголию (Merriwether et al., 1996).
Установленная расоспецифичность гаплогрупп предоставляет уникаль-
ную возможность оценить роль процессов метисации в формировании генети-
ческого разнообразия народонаселения: большие классы гаплогрупп, определяя
соответственно европеоидный, монголоидный и негроидный пулы гаплотипов
мтДНК, могут читаться как соответствующие компоненты в генофондах популяций. Этот подход особенно востребован при исследовании генетического раз-
нообразия населения, в истории формирования которого процессы метисации
предположительно играли большую роль. В Северной Евразии к таковым относятся в первую очередь население Урала, Западной и Южной Сибири, Средней и Центральной Азии.
В митохондриальных генофондах народов Средней Азии выявлены рав-
новеликие доли европеоидного и монголоидного компонентов (Comas et al.,
1998; 2004; Батырова, 2004). У финно-угорских и тюркских народов Волго-
Уральского региона также определен вклад монголоидного компонента в фор-
мирование разнообразия мтДНК: показано, что доля этого компонента в
этнических генофондах населения региона варьирует от 3 % у мордвы до 65 %
у гайнинских башкир (Бермишева, 2001).
Исследование западносибирских народов – кетов, нганасан и манси, по-
казало уникальное сочетание европейских и азиатских гаплогрупп в митохонд-
риальных генофондах этих народов (Дербенева, 2002). Анализ географического
18
распределения выявленных гаплогрупп мтДНК и филогенетические рекон-
струкции позволили авторам поддержать гипотезу о генетическом следе, оставленном в населении Зауралья и соседних сибирских территорий ранними
(палеолитическими) мигрантами с Ближнего Востока.
В митохондриальных генофондах народов Южной и Восточной Сибири
– алтайцев, бурят, тувинцев, тоджинцев, тофаларов, якутов и эвенков (Деренко
и др., 2002; Derenko et al., 2002; 2003) – также было показано присутствие как
азиатских, так и европейских линий мтДНК в разных соотношениях: максимум
монголоидных гаплогрупп был обнаружен у эвенков и бурят – 92 % и 90 %,
соответственно, а европеоидных – у тофаларов (20,7 %) и якутов (14,5 % или
6 % по: Пузырев и др., 2003). На основе данных о распространенности монго-
лоидных и европеоидных гаплогрупп мтДНК у алтайцев и хакасов был оценен
вклад европеоидного компонента в формирование антропологического типа населения Алтая и Саянского нагорья (Деренко и др., 2002). Привлекая данные о
гаплотипической структуре митохондриальных генофондов населения Центральной и Западной Азии, Кавказа и Восточной Европы, авторы предположили, что в генофонде населения Алтая и Саян порядка 60 % европеоидных
линий мтДНК происходят от южных европеоидов, а около 10 % – привнесены
из восточноевропейского региона.
Сравнительный анализ распространения индивидуальных гаплотипов
мтДНК в популяциях позволяет восстановить сценарии межпопуляционных
взаимосвязей, например, установить общность происхождения популяций выявить уровень их смешения и т.д. Кроме того, хорошо разработанная для мтДНК
система «молекулярных часов» (Ward et al., 1991; Lundstrom et al., 1992; Forster et al., 1996; Saillard et al., 2000) позволяет датировать основные этапы
истории генофонда и его носителя – популяции. Примером такого рода иссле-
дований может служить работа, посвященная анализу митохондриального генофонда трех сибирских народов – коряков, эвенов и якутов (Деренко, 1997,
Деренко, Шилдс, 1998). Было показано, что митохондриальные генофонды этих
народов отличаются выраженной этноспецифичностью – наряду с общими гап-
19
лотипами мтДНК они содержат от 60 до 80 % уникальных линий. Впервые была
получена оценка межэтнической метисации, составившая для пар коряки–
эвены и якуты–эвены, соответственно, 6 и 9 %. Было установлено, что древняя
компонента сибирского генофонда имеет «общемонголоидные» корни, восхо-
дящие к палеолитической эпохе 30–50 тыс. лет назад. В то же время были выявлены специфические компоненты митохондриальных генофондов коряков и
эвенов, эволюционный возраст которых, по мнению автора (Деренко, 1997), составляет 9–22 тыс. лет.
Исследования разнообразия мтДНК в популяциях человека в настоящее
время акцентируют внимание на изучении генетического разнообразия и генетической истории населения регионов, этнических групп и народов. Наимень-
шей неподразделенной популяцией в работах, как правило, выступает этнос.
Лишь в последние годы стали появляться некоторые данные о разнообразии
мтДНК в популяциях субэтнического уровня. Для населения Северной Евра-
зии – это данные об изменчивости мтДНК в этногеографических группах башкир (Бермишева, 2001), у французов из различных районов Франции (Dubut et
al., 2004), данные о частотах гаплотипов мтДНК в этнолингвистических группах латышей (Pliss et al., 2005). Достаточно подробно изучена изменчивость
мтДНК у русских в плане выявления особенностей дифференциации митохон-
дриального генофонда этого народа в его основном этническом ареале (Malyarchuk et al., 2004; Морозова и др., 2006; Морозова, 2007).
В контексте данной работы особый интерес представляют результаты ис-
следования изменчивости мтДНК в подразделенных популяциях коренных народов Сибири – алтайцев, тувинцев, якутов и бурят (Голубенко и др., 2007), а
также в подразделенной – на две большие этнолингвистические и шесть диалектных групп популяции литовцев (Kasperavičiūté et al., 2004). Первая работа
предоставляет данные о нуклеотидной изменчивости мтДНК на уровне ло-
кальных популяций и этносов: было показано, что вклад внутрипопуляцион-
ной, межпопуляционной и межэтнической изменчивости в тотальное
разнообразие мтДНК вышеперечисленных сибирских народов составляет соо-
20
тветственно 95,78, 2,09 и 2,13 %, при этом доля вклада межпопуляционной из-
менчивость варьирует от этноса к этносу в широких пределах – от 0,43 % у
бурят до 3,78 % у алтайцев. Во второй работе представлены данные о вариации
мтДНК на нескольких уровнях популяционной структуры населения Литвы,
которые также следует здесь процитировать (табл. 2).
Таблица 2. Результаты анализа AMOVA разнообразия мтДНК в населении Литвы
Уровень группировки популяций
Диалектные группы (популяции)
Группы Aukštaičiai и Žemaičiai
Источник вариации
Между популяциями
Доля изменчивости, %
0,42
В популяциях
99,58
Между популяциями в группах
0,23
Между группами
В популяциях
0,32
99,45
Примечание. Литовцы классифицированы в две основные группы Aukštaičiai и Žemaičiai (между группами
и между популяциями в группах значения были не значимыми, р > 0.05 на основе 1000 пермутаций). Рассматривались генетические дистанции – число попарных различий последовательностей ГВСI мтДНК. Таблица
приводится по: Kasperavičiūté et al., 2004, стр. 443.
Таким образом, следует отметить, что исследования внутриэтнической
дифференциации митохондриального генофонда народонаселения – на уровне
субэтнических групп, и в наибольшей мере локальных популяций – находятся
на начальной стадии.Это направление представляется особенно актуальным в
свете общей успешности и широкой применяемости мтДНК как инструмента
исследований популяционной генетики и этногеномики народонаселения.
21
1.2. Формирование этнической общности сибирских татар по совокупным
данным археологии, антропологии и этнографии
В преддверие краткого описания истории сибирских татар небезынте-
ресно подробнее рассмотреть этимологию и историю самого этнонима «татары». Этимология слова татары укладывается в общепринятую систему
построения многих тюркских этнонимов, таких как хазары, болгары, уйгуры,
авары и многие другие (Закиев, 1995). Завершающая часть тюркских этнонимов
(–ар, –эр, –ур, –ир) восходит к источнику эр, т.е. «человек, люди, род, племя».
Первая часть – обозначает характерные признаки этноса. К примеру, булг –
«вода, источник» и хаз – «скала, ущелье, грот, крутая гора», обозначаются пле-
мена, имеющие, соответственно, какое-то отношение к воде или горам, или счи-
тающие своим тотемом воду или скалу. По аналогии «тат» в слове татар также
несет смысловую нагрузку и применяется в некоторых тюркских языках в значении «чужой, не своего племени». Таким образом, будучи тюркским по проис-
хождению, этноним татар дословно переводится как «чужие люди, люди чужого
племени».
Принято считать, что этноним «татары» появился в среде тюрко-мон-
гольских племен в VI–IX вв. (Народы …, 1988). По мнению М.З. Закиева, еще
до нашей эры татарами назывались племена, населявшие сопредельные с Ки-
таем территории и имевшие с ним тесные военно-политические отношения,
причем предполагается, что племена эти были тюркскими (Закиев, 1995). С те-
чением времени значение этнонима ни в коей мере не сужается. Напротив, начиная с IX в. китайские письменные источники именуют одних кочевников
белыми татарами, монголов, маньчжуров и тунгусов — черными татарами. В
XIII веке в составе созданной монголами Золотой орды находились монгольские и тюркские племена, здесь этноним «татары» был усвоен преобладавшими
по численности тюрками-кыпчаками (Народы …, 1988). Во времена монголо-
татарских завоеваний, с подачи европейцев, этноним приобретает еще более
широкое значение. Так в Европе татарами называют все тюркские, монголь-
22
ские, маньчжурские, финно-угорские, даже палеоазиатские племена и народности.
С распадом Золотой орды в отдельных тюркских ханствах татарами на-
зывают себя потомки золотоордынских кыпчаков, составляющих знатные слои
и военно-служилые группы в государствах. С европейской (русской) позиции
татарами обозначаются тюркоязычные народы, составлявшие основное население бывшей Золотой Орды. Но самоназванием слово татар якобы ни у кого из
тюркских народов не являлось. С продвижением русских на восток для евро-
пейской науки становятся различимыми сибирские этносы. К XVIII–XIX вв.
вместо общего этнонима татары в русский язык проникают и закрепляются са-
моназвания тюркских народов: азербайджанцы, казахи, киргизы, башкиры и т.
д.; татарами же именуются тюркские народы Поволжья, Приуралья и Сибири.
В материалах сибирской экспедиции, целью которой являлось «историю сей
пространной земли обстоятельно описать» (Миллер, 1999, стр. 158), Г.Ф. Мил-
лер четко определяет татарами тюркское население степей по рекам Тоболу,
Иртышу, Оби, Томи и Енисею. Сами же татары Сибири, признавая единство
своего происхождения и описывая свою историю с древнейших времен, самоопределялись, сохраняя территориальные названия: тоболик (тобольские),
бараба (барабинские), томтатарлар (томские), тюменик (тюменские) и т.д., либо
же называли себя мусульманами (Тюркские народы …, 2006). Считается, что
окончательное принятие самоназвания «татары» в современном его значении и
наполнении – татары Поволжья, астраханские и сибирские татары, относится
к 20–30-м гг. XX в. и связано с образованием этнической автономии – Татарской
АССР. Это послужило дополнительным стимулом для распространения этнонима «татары» и на другие этнические общности – тюрко-мусульманское население Нижнего Поволжья, Приуралья и Сибири (Закиев, 1995).
Если обращаться к истории Сибири в целом, либо к истории какого-либо
из народов региона, то нельзя не отметить, что начало академическому сиби-
реведению было положено Второй камчатской экспедицией (1733–1743 гг.),
23
возглавляемой В. Берингом. При этом в исследовании истории и этнографии
сибирских народов основная заслуга принадлежит Сухопутному отряду Экспедиции, неофициальным руководителем которой был Г.Ф. Миллер. Исследо-
вание базировалось на тщательном обследовании всех доступных летописей и
архивных материалов из сибирских городов и поселений, копировании документов, записи устных рассказов.
Итогом десятилетней экспедиции и почти двадцатилетней работы с соб-
ранными материалами явился многотомный труд Г.Ф. Миллера «История Сибири». Далеко немалая часть этого труда в части «События древнейших времен
до русского владычества» посвящена истории сибирских татар. История эта ре-
конструирована по летописям, составленным ранее (со времен походов Ермака)
русскими, по устным рассказам татар, и по монгольским летописям. Миллер
отмечает отсутствие собственно татарских летописей и высказывает сомнение
в их существовании вообще. В своем труде Миллер пишет о древности и един-
стве собственно тюркской истории, в качестве сильного доказательства он приводит совпадение самоназвания отдаленного тюркского народа якутов –
«сохалар», с одним из татарских родов Красноярского уезда, а также тот факт,
что одному из почитаемых якутами богов присваивается имя древнего татарского князя Татара. При этом историю собственно сибирских татар Миллер
фактически возводит ко времени империи Чингиз-хана: «Главнейшим народом
Сибири являются татары, которые живут в южных местностях по рекам Тоболу,
Иртышу, Оби, Томи и Енисею и лежащих между ними степях. Хотя история татарского народа относит начало его к таким далеким временам, какими не
может похвалиться ни один из европейских народов, но нужно признать, что
древнейшие события ее основываются на недостоверных и баснословных рассказах, ходивших в народе, и что настоящая достоверная история татар начи-
нается только со времен великого Чингиз-хана, который в начале XIII столетия
после Р.Х. народ, пребывавший до тех пор во тьме, вывел на свет.» (Миллер,
1999. cтр. 166).
24
Современные точки зрения о начале формировании тюрко-язычного на-
селения юга Западной Сибири расходятся незначительно. Предполагается, что
появление древних тюрков на этой территории восходит к V–VIII вв., и наиболее активно тюркизация населения проходила в XIII в. (Тюркские народы …,
2006). Отдельные исследователи связывают происхождение тюркского населе-
ния юга Западной Сибири с распадом Хуннской империи в Срединной Азии
начала новой эры и появлением племен хунну в сибирских степях (напр., Файзрахманов, 2005). В результате в Приуралье к IV в. на основе хуннских, сар-
матских и угорских племен формируется надэтническая общность – гунны,
продвижение которых на запад дало толчок Великому переселению народов.
Предположительно среди гуннских тюркских племен были сибиры, или сыбыры (по мнению Л.Н. Гумилева это племя было угорским (Гумилев, 1960). По
преданиям тоболо-иртышских татар это племя населяло среднее течение Иртыша, но затем покинуло эту территорию. Сегодня версия происхождения си-
бирских татар «от сибиров» активно поддерживается в среде национальной
интеллигенции. Все мнения о происхождении сибирских татар едины в одном
– этот народ сложился в результате смешения угорских, самодийских, различных тюркских (происходящих из Минусинской котловины, Средней Азии и
Алтая) и отчасти монгольских племен и народов. При этом каждый из этих ком-
понентов привносился с различной интенсивностью и имел различный вес на
разных исторических этапах формирования разных субэтнических групп сибирских татар. Дискутируемым остается вопрос о весе местного сибирского
угро-самодийского субстрата и о природе тюркского (древнетюркского, либо
средневекового кыпчакского) «ядра» сибирских татар.
История тюркского населения юга Западной Сибири тесно связана с фор-
мированием тюркских государств. Так, с VI по XIII вв. южные территории За-
падной Сибири последовательно входили в состав Первого и Второго
Тюркского, Уйгурского и Кыргызского каганатов. Во времена двух последних
и позже в составе сибирских татар предполагается усиление кыпчакского ком-
25
понента, по сравнению с древнетюркским, в результате межэтнической мети-
сации татар с казахами, башкирами, уйгурами и другими народами кыпчакской
общности. В XIII в. южные территории Западной Сибири входили в Белую
Орду – восточную провинцию образованного ханом Батыем Золотоордынского
государства. Во времена его существования предполагается вливание монгольского этнического компонента в состав сибирских татар.
С распадом Золотой Орды в бассейне Тобола и Иртыша в XIV в. сложи-
лось собственное государство – Тюменское ханство с центром в Чимге-Туре на
месте современной Тюмени, возглавляемое потомками Шыбани-хана (брата
Батыя). Позднее эта территория подпадает под власть Узбекской орды. В XV в.
на смену чингизидам к власти в этом государстве приходят представители мест-
ной аристократии, и государство именуется Сибирским ханством с центром в
селе Сибирь (Искер) на Иртыше. В XVI в. небескровным образом власть в ханстве переходит вновь к потомку чингизидов – хану Кучуму. Происходит некоторая централизация власти, расширение ханства, активно распространяется
единая религия – ислам, крепнут хозяйственные и культурные связи. Эти про-
цессы приводят к сложению основных этнических общностей – групп сибирских татар, существующих и в настоящее время: томская, барабинская и
тоболо-иртышская (Народы …, 1988).
С XVII в. территории Западной Сибири, населяемые татарами, входят в
состав Русского государства с сохранением подразделений – национальных волостей. К XVII–XVIII вв. сибирские татары представляли собой историко-этнографическую общность указанных выше трех групп населения с близкими
языками, хозяйственно-культурными укладами, религией и единым представлением о географической родине своего происхождения (Тоболо-Иртышский
бассейн), но не объединенную единым самосознанием и самоназванием, как
это описано в главе ранее. В качестве самоназвания использовались термины
«ясашные», «инородцы», «мусульмане». Татарами тюркское население Сибири
называли русские, постепенно к XIX–XX вв. этот этноним закрепился среди
26
татар с определением «сибирские», в основном для отделения себя от татар по-
волжских, приток которых в Западную Сибирь в это время усилился. Таким образом, к началу XX в. консолидация трех основных групп тюркского населения
Западной Сибири привела к возникновению этноса «сибирские татары», при
этом степень и завершенность этой консолидации остается в настоящее время
дискуссионным вопросом (Тюркские народы …, 2006; Тумашева, 1969).
Немаловажную роль в истории сибирских татар сыграли поволжско-приу-
ральские татары, переселение которых в Сибирь началось, по-крайней мере, с
XVI и усиливалось в середине XX в. Влияние европейских групп татар особенно выражено в культурной и образовательной сфере, т.к. язык казанских
татар становится литературным языком для татар сибирских – народа имеющего свой язык, но бесписьменного. Достаточно острым в настоящее время
является вопрос объединения татар сибирских, поволжских и приуральских в
единую метаэтническую общность – татары, зачастую именно так рассматри-
валось тюркоязычное население этих регионов в советской литературе (напр.,
Народы …, 1988). В 90-х гг. XX в. в населении бывшего СССР наблюдается
рост этнического самосознания и самоопределения, не оставивший в стороне
и сибирских татар; была создана «Ассоциация татар Тюменской области
«Сыбыр». В результате обращений этой организации в Институт языкознания
и Институт этнографии им. Н.Н. Миклухо-Маклая были разработаны обраще-
ния-рекомендации в государственные комитеты по статистике и делам нацио-
нальностей об обоснованности и целесообразности включения сибирских татар
в список народов России и создания для них собственной письменности и грам-
матики (подробно эти документы представлены на http://tatar-history.narod.ru/
sibir-tatar.htm).
Сложная история формирования сибирских татар отражается в многооб-
разии наблюдаемых у них антропологических типов – это уральский, южносибирский, центральноазиатский и европеоидный понтийский (представленная
здесь и далее информация приводится по данным многих исследований, све-
27
денным в книге (Татары …, 2001). Уральский тип является основным на севере
и менее выражен на юге ареала расселения сибирских татар. Южносибирский
тип характерен барабинским татарам и в качестве примеси отмечается во всех
группах сибирских татар. Европеоидные тип (понтийского облика) в наиболь-
шей степени проявляется у сибирских татар, живущих в городах, чем у сельских жителей (Трофимова, 1947, цит. по: Татары …, 2001). Выделенный
среди сибирских татар как основной уральский антропологический тип предположительно связывают с сибирским угро-самодийским населением; южно-
сибирский монголоидный компонент – со степными кыпчакскими племенами
и группами тюркоязычного населения с Алтая. Монголоидный центральноазиатский тип, наблюдаемый у барабинских татар, предполагают следствием тес-
ных контактов этой группы татар с калмыками в XVII в., а усиление
европеоидных черт у сибирских татар в целом и у городских жителей особенно
соотносят с процессом их смешения с поволжско-приуральскими татарами и
выходцами из Средней Азии, так называемыми бухарцами (преимущественно
узбеки и таджики).
В целом по расово-диагностическим признакам «сибирские татары зани-
мают промежуточное положение между населением лесной зоны Западной Сибири (носители уральского антропологического типа) и тюркоязычным
населением Южной Сибири и Алтая-Саян (представители южносибирского
морфотипа)» (Татары …, 2001). Примечательно, что изложенные здесь
взгляды на формирование сибирских татар на основе угорского населения, по-
ложение сибирских татар в ряду других народов Северной Азии и выявляемые
направления межэтнических взаимосвязей полностью воспроизводятся в представленной здесь работе, основанной на данных о разнообразии мтДНК у тоболо-иртышских татар.
Итак, в настоящее время этнический ареал сибирских татар охватывает
степную и лесостепную зоны Западной Сибири, простирается от Урала до
Алтая. В терминах административного деления России – это территории, вхо-
28
дящие в Кемеровскую, Тюменскую, Томскую, Омскую и Новосибирскую области. Общая численность сибирских татар в пределах этого ареала составляет
около 190 тыс. человек (еще около 20 тыс. человек проживает в странах Средней Азии и в Турции) (Народы …, 1988; Тюркские народы …, 2006). Как уже
отмечалось в работе ранее, в составе сибирских татар на основе этнографических и лингвистических (различные диалекты) данных выделяется три субэтнические группы: томская, барабинская и тоболо-иртышская; их расселение в
бассейне Оби и Иртыша показано на рисунке 4.
Рисунок 4. Расселение сибирских татар на юге Западной Сибири: 1 – тобольские, 2 – заболотные (ясколбинские), 3 – тюменские, 4 – тевризские (курдакско-саргатские), 5 – тарские, 6 – томские, 7 – барабинские. Приводится по: (Тюркские народы …, 2006, стр. 30).
Наиболее широкорасселенная и многочисленная – это группа тоболо-ир-
тышских татар; она же является наиболее подразделенной на этнолингвисти-
ческие (различные говоры) подгруппы – это заболотные (ясколбинские),
тюменские, тобольские, тарские и тевризские (курдакско-саргатские) татары
(рис. 4). Именно тоболо-иртышские татары, а вернее их генетическое разнообразие является объектом данной работы.
Наиболее полно исследование этногенеза и этнической истории групп
тюркоязычного населения Западной Сибири, в период после их сложения (XVI
29
в.) и до начала XIX в., представлено в работе Н.А. Томилова (Томилов, 1981).
Здесь следует подробней остановиться на некоторых результатах этого исследования в приложении к тоболо-иртышским татарам. У всех тоболо-иртыш-
ских татар, вне зависимости от их принадлежности к той или иной группе, в
качестве общих и основных компонентов отмечаются угорский и древнетюркский, идентифицируются и кыпчакские разноэтничные компоненты и направления взаимосвязей.
Одними из наиболее древних тюркских насельников Тоболо-Иртышского
бассейна видятся тюменские татары, которые наряду с тобольскими, тарскими
и тевризскими составили в XIV в. ядро населения Сибирского ханства. В составе тюменских татар особенно выражены, по мнению автора (Томилов, 1981,
стр. 247), «группы башкирского происхождения или, вернее, группы вошедшие
в состав как башкир, так и тюменско-туринских татар». Другой особенностью
тюменских татар из этнографических данных является вхождение в их состав
ранних узбекских племен и активное их смешение в XVII–XIX вв. с бухарцами
(в основном узбеками и таджиками). При общем сходстве с тюменскими татарами и наличии с ними тесных контактов в тобольской, наиболее многочис-
ленной группе, видится некоторое увеличение веса казанских татар. Группы
заболотных и тевризских татар отличаются отсутствием смешения с бухарцами
и казанскими татарами.
По наличию общих этнических компонентов и тесных этноисторических
контактов отмечена тесная связь всех групп сибирских татар, в том числе и в Тоболо-Иртышском бассейне, на степени этой связи в первую очередь отража-
лась географическая близость\удаленность ареалов расселения сибирских
татар, принадлежащих к той или иной группе. При этом наиболее «многочис-
ленный узел нитей, связывавших их со всеми территориально-этническими
группами» тюрков Западной Сибири имели тобольские татары (Томилов, 1981).
С позиций антропологических исследований положение тоболо-иртыш-
ских татар среди народов Северной Евразии наилучшим образом показано в
30
работе А.Н. Багашёва (Багашёв, 2000). В целом работа посвящена изучению ра-
совых составляющих в населении лесостепной зоны Западной Сибири эпохи
раннего железа (V в. до н.э. – III в. н.э.) и роли этих морфотипов в расогенезе
современных западносибирских этносов. В контексте исследования генетического разнообразия и генетической истории тоболо-иртышских татар по данным о системе с матрилинейной формой наследования особый интерес
представляют результаты анализа изменчивости краниометрических призна-
ков в современном (близком к современности) населении Северной Евразии, и
особенно в женских сериях, и, конечно, положение тоболо-иртышских татар в
картине этой изменчивости (рис. 5).
Рисунок 5. Расположение женских серий раннего железа и близких к современности в пространстве главных
компонент по краниологическим данным. Серии, близкие к современности обозначены соответствующими этнонимами. Приводится по: (Багашёв, 2000, стр. 231).
Согласно описанию автора (Багашёв, 2000) по первой главной компоненте
наибольшие значения приходятся на серии, где более выражен монголоидный
морфотип, или наблюдается монголоидная примесь – это центральноазиатские,
южносибирские и западносибирские народы. В поле отрицательных значений
I-ой компоненты сосредоточены серии с минимальной монголоидной примесью
31
– преимущественно финские народы Приуралья и Поволжья. По II-ой компо-
ненте популяции дифференцируются внутри европеоидной и монголоидной совокупностей. Здесь в положительном поле располагаются «серии гармоничного
монголоидного типа» – народы, относящиеся к североазиатской и южносибир-
ской расам, в отрицательном – «серии европеоидного облика» – тюрки и финны
Поволжья и Приуралья. В положительно-отрицательном поле пространства
главных компонент сконцентрированы популяции западносибирской расы.
По-видимому, можно отметить, что по краниологическим характеристи-
кам североевразийские популяции дифференцируются в первую очередь по сте-
пени выраженности монголоидного компонента, и во вторую – в соответствии
с разнообразием и дифференцированностью самого монголоидного компонента. Согласно расположению тоболо-иртышских татар в пространстве глав-
ных компонент изменчивости краниометрических признаков у народов
Северной Евразии эта группа сибирских татар, по-видимому, обладает достаточно выраженной долей монголоидной примеси и особенно сближается с западносибирскими угро-самодийскими народами.
В этом литературном обзоре в целом сделана попытка осветить те мо-
менты исследований, которые представляются наиболее значимыми в контексте предпринятого этногенетического исследования тоболо-иртышских татар,
либо в той или иной мере перекликаются с полученными в данной работе результатами.
2.1. Материалы
32
Глава 2. МАТЕРИАЛЫ И МЕТОДЫ
Материалом в работе послужили образцы крови сельского населения Тю-
менской и Омской областей Российской Федерации. Материал получен от совершеннолетних первичных доноров с их добровольного согласия в ходе
экспедиционных работ лаборатории генетики человека ИОГен РАН в 2004–2005
гг. при участии представителей местных органов здравоохранения. Принад-
лежность доноров и их родителей к этнической общности сибирские татары, а
также наличие близкородственных связей между донорами определялись с помощью анкетирования.
Изученная выборка составляет 218 человек и включает в себя представи-
телей четырех из пяти этнолингвистических подгрупп тоболо-иртышских
татар: тюменские татары – жители деревень Юртобор (N=25) и Варвара (N=25),
тобольские – Кутарбитка (N=28) и Тоболтура (N=28), заболотные – Ачиры
(N=52) Тюменской обл., и тевризские татары – деревни Утузы (N=30) и Саургачи (N=30) Омской обл. Локализация исследованных в работе популяций приведена на рисунке 6.
Для сравнительного анализа использовались данные о разнообразии
линий мтДНК у 5,5 тысячи человек из 40 этносов, привлеченный материал со
ссылками на источники информации описан в таблице 3. Кроме того, использовались данные о распространении последовательностей ГВСI мтДНК (около
25 тыс. индивидуальных последовательностей) в популяциях Евразии из банка
данных лаборатории генетики человека ИОГен РАН «Генофонд».
Рисунок 6. Этнический ареал сибирских татар в окружении ареалов других народов Северной Евразии; приводится по: (Генофонд …, 2000). На врезке: локализация исследованных в работе популяций тоболо-иртышских татар, населенные пункты: 1 – Юртобор, 2 – Варвара, 3 – Кутарбитка, 4 – Тоболтура, 5 – Ачиры, 6 – Саургачи и 7 – Утузы.
33
34
Таблица 3. Привлеченные в работе данные о разнообразии мтДНК в популяциях Северной Евразии
Этносы
Алтайцы
Башкиры
Буряты
Ительмены
Казахи
Кеты
Киргизы
Коми-зыряне
Коми-пермяки
Корейцы
Коряки
Манси
Мари
Монголы
Мордва
Негидальцы
Ненцы
Нивхи
Русские
Сойоты
Татары
Тофалары
Тувинцы
Туркмены
Удмурты
Удэгейцы
Узбеки
Уйгуры
Ульчи
Хакасы
Ханты
Хань
Чуваши
Чукчи
Эвенки
Размер
выборки
173
218
116
45
389
38
94
139
74
164
147
98
136
176
102
33
58
56
670
30
228
104
233
41
101
46
156
178
87
53
210
323
91
89
195
Эвены
65
Энцы/нганасаны
24
Эскимосы
127
Юкагиры
27
Якуты
145
Суммарно: 5479 человек из 40 этносов
Источник данных
Shields et al., 1993; Derenko et al., 2003; Starikovskaya et al., 2005
Бермишева и др., 2002
Derenko et al., 2003; Starikovskaya et al., 2005
Schurr et al., 1999
Comas et al., 1998; Батырова, 2004
Дербенева, 2002
Comas et al., 1998
Бермишева и др., 2002; Губина и др., 2005
Бермишева и др., 2002
Деренко и др., 2004
Деренко, 1997; Schurr et al., 1999
Дербенева, 2002
Бермишева и др., 2002
Kolman et al., 1996; Деренко и др., 2004
Бермишева и др., 2002
Starikovskaya et al., 2005
Saillard et al., 1999
Torroni et al., 1993; Starikovskaya et al., 2005
Malyarchuk et al., 2004; Морозова, 2007
Derenko et al., 2003
Бермишева и др., 2002
Derenko et al., 2003; Starikovskaya et al., 2005
Derenko et al., 2003; Starikovskaya et al., 2005
Quintana-Murci et al., 2004
Бермишева и др., 2002
Torroni et al., 1993; Starikovskaya et al., 2005
Comas et al., 1998; Батырова, 2004
Comas et al., 1998; Батырова, 2004
Starikovskaya et al., 2005
Derenko et al., 2003
Voevoda, Shkarpenko, 2000; Губина и др., 2005; Наумова и др., 2008
Kivisild et al., 2002; Yao et al., 2002
Richards et al., 2000; Бермишева и др., 2002
Torroni et al., 1993; Starikovskaya et al., 1998
Torroni et al., 1993; Лебедева и др., 1999; Деренко и др., 2002;
Starikovskaya et al., 2005
Деренко, 1997
Дербенева, 2002
Starikovskaya et al., 1998; 2005
Torroni et al., 1993
Деренко, 1997; Пузырев и др., 2003
35
2.2. Методы
Гаплотипы мтДНК были идентифицированы на основе рестрикционного
полиморфизма кодирующих регионов митохондриального генома и полиморфизма нуклеотидной последовательности ГВСI. Для этого использовались стандартные методы исследования нуклеотидных последовательностей –
экстракция ДНК из образцов крови, амплификация участков мтДНК, рестрикционный анализ и секвенирование.
Тотальная ДНК экстрагировалась из образца крови объемом 200 мкл стан-
дартным методом фенольно-хлороформной экстракции (Маниатис и др., 1984).
Разрушение мембран форменных элементов крови проводилось двух-трех-
кратным центрифугированием образца (9 мин. при 12000 об./мин.) в 1 мл содержащего сахарозу буфера: 0,32 М сахароза, 0,005 М MgCl, 0,001% тритон
Х-100, 0,01 М Tris-HCl pН 7,6, 1% лимоннокислого натрия. Дальнейшая про-
цедура выделения ДНК соответствовала методу, предложенному Маниатисом
с соавторами (Маниатис и др., 1984). Протеолиз осуществлялся с помощью
протеиназы К инкубированием образца в 200 мкл буфера: 0,1 М NaCl, 0,01 М
Tris-HCl pН 8,0, 0,001 М ЭДТА pН 8, 2% SDS, в течении 10–12 часов при 37ºС.
Очистка образца от белков проводилась с помощью двух фенол-хлороформных
и одной хлороформной вытяжек. После депротеинизации ДНК концентрировалась осаждением в 70 % этаноле. Водный раствор ДНК хранился при –20ºС.
Амплификация участков мтДНК проводилась с использованием сухих на-
боров реагентов «GenePakТМ PCR Core» (ООО «Лаборатория Изоген»), в соответствии
с
рекомендованным
производителем
протоколом.
Объем
реакционной смеси составлял 20 мкл. ПЦР осуществлялась в циклическом термостате «Терцик» (ООО «ДНК-Технология»). Использовался следующий тем-
пературный режим: первичная денатурация матричных цепей ДНК – 1 мин 30
сек. при 94 ºС; 33 основных цикла амплификации: денатурация – 20 сек. при
94ºС, отжиг праймеров – 10 сек. при 47–65ºС (см. табл. 5); синтез – 10 сек. при
72ºС. В завершающий цикле стадия синтеза длилась 1 мин. Оценка качества
36
продукта амплификации проводилась в окрашенном бромистым этидием (0,5
мкг/мл) 2,5–3 % агарозном геле в присутствии электрофоретического стандарта
длины. В ПЦР использовались 16 пар праймеров предложенных в работах (Torroni et al., 1996; Finnila et. al., 2000; Yao et al., 2002). Нуклеотидные последовательности праймеров и их локализация в геноме представлены в таблице 4.
Для рестрикционного анализа использовались 11 эндонуклеаз производ-
ства ООО «СибЭнзим» и компании «Fermentas». Реакция проводилась согласно
протоколам фирм-производителей. Электрофоретическое разделение и детекция рестрикционных фрагментов проводились в 2,5–6 % агарозных гелях, окрашенных бромистым этидием (рис. 7).
Рисунок 7. Электрофореграммы в 3 % агарозном геле ПДРФ мтДНК: амплифицированный фрагмент 13583–
13843, гидролизованный рестриктазой BstNI (а); фрагмент 6890–7131, рестриктаза AluI (б); фрагмент 8829–
9184, рестриктаза HaeIII (в).
37
Таблица 4. Исследованные участки мтДНК: последовательности праймеров, локализация участка в геноме, анализируемые маркеры
№
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
Последовательность праймера
5’-CACCATTAGCACCCAAAGCT
5’-AACGTGTGGGCTATTTAGGC
5’-ACCGCTGCTAACCCCATACC
5’-GGTGAACTCACTGGAACGGGGA
5’- TGGCCCAACCCGTCATCTAC
5’-GGAATGCGGTAGTAGTTAGG
5’-CCAAATCTCTCCCTCACTAA
5’-AATGGCCCATTTGGGCAAAA
5’-AAGCAATATGAAATGATCTG
5’-CGTAGGTTTGGTCTAGG
5’- CGCCCTCCCATCCCTACGCA
5’- GAAACTGTGGTTTGCTCCAC
5’-AGCAAACCACAGTTTCATGC
5’-TTTCACTGTAAAGAGGTGTTGG
5’-CCTAGCCATGGCCATCC
5’-GGCTTACTAGAAGTGTGAAAAC
5’-CGAAGCCGCCGCCTGATACTGG
5’-GTAGTAAGGCTAGGAGGGTG
5’-TCCTTTTACCCCTACCATGAG
5’-ATTATTCCTTCTAGGCATAGTAG
5’-CTCAACCCCGACATCATTACC
5’-ATTACTTTTATTTGGAGTTGCACCAAgATT
5’- ACAAGAACTGCTAACTCATG
5’- TGGAGAAGTAGTCTAGTTTG
5’-GCTTAGGCGCTATCACCAC
5’-ATATCTTGTTCATTGTTAAG
5’-CCTCCCTGACAAGCGCCTATAGC
5’-CTAGGGCTGTTAGAAGTCCT
5’-TCACAGCACCAAATCTCCAC
5’-AAGCCTTCTCCTATTTATGG
5’-ACCCGACCACACCGCTAACA
5’-AGGAGGATAATGCCGATGTT
Локализация
фрагмента
Анализируемый маркер
15978–16545
ГВСI
523–725
663 HaeIII
4480–5118
4577 NlaIII, 4830 HaeII
4898–5267
5176 AluI
6890–7131
7025 AluI
7813–8203
7933 MboI
8188–8366
Делеция 9 п.н.
8829–9184
9052 HaeII, 8994 HaeIII
9911–10107
10032 AluI
10270–10579
10397 AluI
12104–12338
12308 HinfI
12217–12595
12406 HincII
13172–13403
13262 AluI, 13366 BamHI
13583–13843
13704 BstNI
14035–14610
14465 AccI
14556–15105
14766 MseI
Примечание: Для праймеров длиной 20 п.н. температура отжига определялась как ta = 2AT + 4GC – 5, свыше
20 п.н. ta = 81,5 + 16,6(lgM) + 0.41(%GC) – 600/L, где М – ионная сила раствора, L – длина праймера (Рыбчин,
1999). Модифицированный праймер в паре № 11 создает сайт узнавания для фермента HinfI при наличии мутации мтДНК в позиции 12308 (Torroni et al., 1996).
38
Анализ электрофореграмм осуществлялся с помощью программы «DNA-
Analysis» (Евсюков и др., 1996). Полиморфизм учитывался по наличию (+) и
отсутствию (–) сайта рестрикции. Идентифицировались сайты рестрикции,
маркирующие распространенные в населении Евразии гаплогруппы мтДНК:
663 HaeIII (гаплогруппа A), 12406 HincII (F1), 10397 AluI (M), 13262 AluI (C),
5176 AluI (D), 4830 HaeII (G), 7025 AluI (H), 14766 MseI (HV), 10032 AluI (I),
13704 BstNI (J), 13366 BamHI (T), 12308 HinfI (U), 9052 HaeII (K), 4577 NlaIII
(V), 8994 HaeIII (W), 14465 AccI (X), 7933 MboI (Y), а также делеционный полиморфизм в регионе V мтДНК (гаплогруппа B).
Для амплификации ГВСI мтДНК использовалась пара праймеров № 1,
локализация участка в геноме 15978–16526 (табл. 4). Определение нуклеотид-
ных последовательностей проводилось на автоматическом секвенаторе MegaBACE 500 (Amersham Biosciences) в ЗАО «Евроген Ру». Анализ отличий
нуклеотидных последовательностей от стандартной (Anderson, 1981) осуществлялся с помощью оригинальной программы «MitoSeq» (ИОГен РАН).
Принадлежность гаплотипов мтДНК к той или иной гаплогруппе опре-
делялась на основании маркирующих соответствующий кластер вариантов по-
лиморфизма сайтов рестрикции и/или нуклеотидных замен в ГВСI с учетом
существующей классификации евразийских типов мтДНК (Torroni et al., 1996;
Macaulay et al., 1999; Richards et al., 2000; Kivisild et al., 2002; Yao et al.,
2002; Kong et al., 2003; Quintana-Murci et al., 2004); встреченные варианты
описаны в таблице 5.
Филогенетические связи гаплотипов мтДНК устанавливались методом
построения медианных сетей (Bandelt et al., 1995), реализованным в пакете Ne-
twork 4.1 (http://www.fluxus-engeneering.com). Филогенетическое древо гаплотипов строилось вручную.
Разнообразие гаплотипов мтДНК в популяциях и генетические расстоя-
ния между популяциями оценивались описанными ниже методами с помощью
пакета программ Arlequin 3.0 (Schneider et al., 2000).
39
Таблица 5. Полиморфные маркеры мтДНК, использованные для определения гаплогрупп мтДНК у тоболо-иртышских сибирских татар
Гаплогруппа
A
B
B4a
B4c
B5b
F1
F1b
M
M7c
C
D
M10
D4a
D4b
G
D5
H
K
T
U
8271–8281 делеция 9 п.н.
8271–8281 делеция 9 п.н.
8271–8281 делеция 9 п.н.
8271–8281 делеция 9 п.н.
12406 HincII –
J1b1
J2
T1
T2
U1
U2
U3
U4
U5
U5a1a
U5b
U7
W
Нуклеотидные замены в ГВСI
223 290 319
189
189 217 261
140 189 217 274
140 189 243
304
12406 HincII –
189 304
10397 AluI +
223 295
10397 AluI +
10397 AluI +
223
223 311
10397 AluI +, 13262 AluI +
223 298 327
10397 AluI +, 5176 AluI –
129 223 362
10397 AluI +, 5176 AluI –
10397 AluI +, 5176 AluI –
5176 AluI –
10397 AluI +, 4830 HaeII +
10032 AluI +
U1a
V
663 HaeIII +
7025 AluI –
I
J
Рестрикционно-делеционные маркеры в кодирующем регионе
13704 BstNI –
13704 BstNI –
13704 BstNI –
12308 HinfI +, 9052 HaeII –
13366 BamHI +
13366 BamHI +
13366 BamHI +
12308 HinfI +
12308 HinfI +
223 362
223 319 362
223 362
223 362
129 223 391
069 126
069 126 145 172 222 261
126 193
224 311
126 294
126 163 186 189 294
126 294 304
249
12308 HinfI +
189 249
12308 HinfI +
343
12308 HinfI +
12308 HinfI +
12308 HinfI +
051
356
270
12308 HinfI +
256 270 399
12308 HinfI +
318T
12308 HinfI +
4577 NlaIII –
8994 HaeIII –
189 270
298
223 292
Примечание. Позиция нуклеотида в ГВСI определяется как + 16000, цифровое обозначение сайта указывает
на транзицию, сопровождаемое буквой – на трансверсию в данном нуклеотидном локусе в сравнении со стандартном (Anderson et al., 1981).
40
Оценка внутрипопуляционного разнообразия на основе частот гаплоти-
пов мтДНК (H) проводилась аналогично оценке уровня гетерозиготности методом, предложенным в (Nei, Tajima, 1981):
где xi – частота i-го гаплотипа в популяции x, n – размер выборки.
Уровень полиморфизма митохондриальной ДНК, или внутрипопуля-
ционное (dx) и межпопуляционное (dxy) нуклеотидное разнообразие, оценивался методами, описанными в (Nei, Li, 1979; Nei, Tadjima, 1981; Nei, 1985):
где xi, xj и yj – частоты гаплотипов i и j в популяциях х и y, πij – индекс
нуклеотидных различий между гаплотипами i и j: πij= – 3/4 log (1 – 4/3pij) ,где
pij – доля различающихся нуклеотидов (Jukes and Cantor, 1969).
Средний показатель нуклеотидных различий между гаплотипами в попу-
ляции рассчитывалось как:
где πij – индекс нуклеотидных различий между каждой парой сравниваемых гаплотипов, n – размер выборки (Nei, Li, 1979; Takahata, Nei, 1985).
Генетическое расстояние (d), или среднее число нуклеотидных различий
между гаплотипами из двух различных популяций, определялось согласно (Nei,
Li, 1979; Nei 1985) как:
Исследование генетических взаимосвязей популяций проводилось на ос-
нове результатов многомерного шкалирования (использовалось двумерное про-
странство) матрицы попарных генетических расстояний d и кластерного
анализа популяций – построения классификационных древ методом UPGMA
(unweighed pair group method by average). Анализ проводился в пакете Statistica
6.0 (StatSoft, Inc., Tulsa, OK, USA).
Размах изменчивости мтДНК в локальных популяциях и территориаль-
ных группах тоболо-иртышских татар, а также их вклад в тотальное разнооб-
разие мтДНК изученного населения определялись с помощью оценки варианс
частот гаплотипов мтДНК с учетом числа мутаций между гаплотипами –
AMOVA (analysis of molecular variance, Excoffer et al, 1992). Расчеты проводились в пакете программ Arlequin 3.0 (Schneider et al., 2000).
41
Глава З. РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ
3.1. Соотношение европеоидного и монголоидного компонентов в митохондриальном генофонде сибирских татар
В этом параграфе приводятся данные о структуре гаплотипов мтДНК у то-
боло-иртышских татар, идентифицированных по результатам анализа полиморфизма сайтов рестрикции, диагностических для евразийских гаплогрупп
мтДНК, и нуклеотидной последовательности ГВСI. На общей выборке 218 человек было выявлено 98 различных гаплотипов мтДНК. В таблице 6 приведена
структура этих гаплотипов и их частота в исследованной выборке. На основании данных об изменчивости нуклеотидной последовательности ГВСI и/или
рестрикционного полиморфизма мтДНК установленные гаплотипы отнесены к
17 монофилетическим линиям мтДНК или гаплогруппам.
Как отмечалось в обзорной главе этой работы, гаплогруппы мтДНК об-
ладают высокой степенью расоспецифичности: одни из них распространены в
европеоидных популяциях Евразии, другие – в монголоидных. В генофонде сибирских татар, за редким исключением, представлены все идентифицированные
в
популяциях
Северной
Евразии
гаплогруппы
мтДНК
как
восточноевразийские (монголоидные) – A, B, F, M7, M10, C, D и G, так и западноевразийские (европеоидные) – N1, H, V, J, T, U, K, I и W. В митохондри-
альном генофонде сибирских татар эти два больших класса гаплогрупп
представлены в соотношении 1:1.5. Гаплотипами мтДНК, принадлежащими к
монголоидным гаплогруппам, охвачено 39,5 % разнообразия, доля европеоидных гаплотипов в общем разнообразии составляет 58 %. Такое равновеликое, но
с преобладанием европеоидного, распределение вклада расовых компонентов
в генофонд исследованной группы органично вписывается в общую картину
исторических событий, протекавших на территории Северной Евразии.
Реконструкции стадиальной изменчивости материальной культуры насе-
ления позднего палеолита Северной Евразии, 26–12 тыс. лет назад, (рис. 8) указывают на территорию Западной Сибири, в границах Урал–Енисей, и Среднюю
42
Таблица 6. Гаплотипы мтДНК, выявленные у тоболо-иртышских сибирских татар
№ Гаплоп/п группа
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
A
A
A
B4
B4
B4
B4a
B4c
B5b
F1b
F1b
F1b
F1b
F1b
M7c
M10
M10
C
C
C
C
C
C
C
C
D
D
D
D
D
D
D
D4a
D4b
D5
G
N1a
N1c
H
H
H
H
ПДРФ кодирующего
региона мтДНК
Нуклеотидные замены в ГВСI мтДНК
663 HaeIII +
187 223 266 290 319
663 HaeIII +
220 223 290 319 362
663 HaeIII +
223 227C 230 290 311 319
делеция 9 пн
183С 189 217
делеция 9 пн
182С 183С 189 217
делеция 9 пн
182С 183С 189 217 388
делеция 9 пн
183С 189 217 261
делеция 9 пн
051 129 140 166 183дел 188 189 213 217 274 335
делеция 9 пн
111 140 189 234 243 399
12406 HincII –
172 189 304 309
12406 HincII –
182С 183С 189 232A 249 304 311
12406 HincII –
172 183С 189 232A 249 293 304 311
12406 HincII –
172 183С 189 203T 223 232A 249 293 304 311
12406 HincII –
172 183С 189 203T 223 232A 249 298 304 311
10397 AluI +
223 254 295
10397 AluI +
093 129 172 223 266 311 357 390
10397 AluI +
093 129 153 172 223 266 311 357 390
10397 AluI +, 13262 AluI +
223 298 327
10397 AluI +, 13262 AluI +
223 298 311 327
10397 AluI +, 13262 AluI +
223 298 327 329
10397 AluI +, 13262 AluI +
093 223 298 327
10397 AluI +, 13262 AluI +
093 203 223 298 327
10397 AluI +, 13262 AluI +
148 223 288 298 327
10397 AluI +, 13262 AluI +
180 223 261 288 298
10397 AluI +, 13262 AluI +
093 148 223 288 298 327
10397 AluI +, 5176 AluI –
223 362
10397 AluI +, 5176 AluI –
223 294 362
10397 AluI +, 5176 AluI –
223 245 362
10397 AluI +, 5176 AluI –
223 245 311 362 368
10397 AluI +, 5176 AluI –
092 111 213 223 362
10397 AluI +, 5176 AluI –
192 223 261 316 362
10397 AluI +, 5176 AluI –
223 227 278 358 362
10397 AluI +, 5176 AluI –
129 223 262 362 368
10397 AluI +, 5176 AluI –
172 173 215 223 319 362
5176 AluI –
223 362
10397 AluI +, 4830 HaeII +
223 362 388
147A 172 189 223 248 320 355
201 223 265
7025 AluI –
7025 AluI –
189
7025 AluI –
304
7025 AluI –
362
Число Частота
1
1
2
1
6
1
1
5
1
1
5
3
1
1
1
6
3
6
1
2
1
2
15
1
1
3
1
1
1
1
3
1
1
2
1
1
1
1
19
1
2
5
.0046
.0046
.0092
.0046
.0275
.0046
.0046
.0229
.0046
.0046
.0229
.0138
.0046
.0046
.0046
.0275
.0138
.0275
.0046
.0092
.0046
.0092
.0688
.0046
.0046
.0138
.0046
.0046
.0046
.0046
.0138
.0046
.0046
.0092
.0046
.0046
.0046
.0046
.0872
.0046
.0092
.0229
Таблица 6. (продолжение)
№ Гапло- ПДРФ кодирующего реп/п группа
гиона мтДНК
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
H
H
H
H
H
H
I
J
J1b1
J2
J2
J2
K
K
T
T
T1
T1
T1
T1
T1
T1
T1
T2
U
U1
U1
U1a
U1a
U2
U3
U4
U4
U4
U4
U4
U4
U4
U4
U4
U4
U4
7025 AluI –
7025 AluI –
7025 AluI –
7025 AluI –
7025 AluI –, 9052 HaeII –
7025 AluI –
10032 AluI +
13704 BstNI –
13704 BstNI –
13704 BstNI –
13704 BstNI –
13704 BstNI –
12308 HinfI +, 9052 HaeI –
12308 HinfI +, 9052 HaeI –
13366 BamHI +
13366 BamHI +
13366 BamHI +
13366 BamHI +
13366 BamHI +
13366 BamHI +
13366 BamHI +
13366 BamHI +
13366 BamHI +
13366 BamHI +
12308 HinfI +
12308 HinfI +
12308 HinfI +
12308 HinfI +
12308 HinfI +
12308 HinfI +
12308 HinfI +
12308 HinfI +
12308 HinfI +
12308 HinfI +
12308 HinfI +
12308 HinfI +
12308 HinfI +
12308 HinfI +
12308 HinfI +
12308 HinfI +
12308 HinfI +
12308 HinfI +
43
Нуклеотидные замены в ГВСI мтДНК
31 387
162 356
278 304
169 184
169 184
111A 184
129 172 223 311 391
126
069 126 145 172 222 239 261
126 193 301
069 126 193 301
069 092 126 193 301
224 311
224 278 311
126 294
126 209 294 296
126 163 186 189 294
126 163 186 189 261 294
086 126 163 186 189 261 294
126 163 186 189 269 294
092 126 163 186 189 294
093 126 163 186 189 294 296
093 126 163 186 189 228 294 296
126 294 296 304
249 311
249 287 311
189 249
189 249 304 311
051 209 239 270 327 352 353
343 390
356
134 356
259A 356
261 356
261 356 387
113C 356 362
209 264 311 356
228 248 311 356
111 189 356
111 163 189 356
169 189 356
Число Частота
1
1
1
2
5
1
1
1
1
2
1
1
3
1
3
1
2
4
1
2
1
4
1
1
1
3
1
3
1
1
1
7
11
1
1
2
1
1
1
1
1
1
.0046
.0046
.0046
.0092
.0229
.0046
.0046
.0046
.0046
.0092
.0046
.0046
.0138
.0046
.0138
.0046
.0092
.0183
.0046
.0092
.0046
.0183
.0046
.0046
.0046
.0138
.0046
.0138
.0046
.0046
.0046
.0321
.0505
.0046
.0046
.0092
.0046
.0046
.0046
.0046
.0046
.0046
Таблица 6. (окончание)
№ Гапло- ПДРФ кодирующего реп/п группа
гиона мтДНК
44
Нуклеотидные замены в ГВСI мтДНК
Число Частота
85 U5a
12308 HinfI +
192 256 270 399
2
.0092
86 U5a
12308 HinfI +
192 239 256 270 399
1
.0046
87 U5a
12308 HinfI +
256 270 278 399
2
.0092
88 U5a
12308 HinfI +
256 257 264 270 278 399
1
.0046
89 U5a
12308 HinfI +
256 270 291 399
2
.0092
90 U5b
12308 HinfI +
183С 189 270
2
.0092
91 U5b
12308 HinfI +
183С 189 270 362
1
.0046
92 U7
12308 HinfI +
309 318T
4
.0183
93 U7
12308 HinfI +
189 309 318T
1
.0046
94 U7
12308 HinfI +
189 309
1
.0046
95 V
4577 NlaIII –
38 298
1
.0046
96 W
8994 HaeIII –
111 223 292 295
1
.0046
97 N
093 133 223
2
.0092
98 N
189 311 357
2
.0092
Примечание. Позиция нуклеотида в ГВСI определяется как + 16000. Цифровое обозначение сайта указывает
на транзицию, сопровождаемое буквой – на трансверсию, дел – на делецию в данном нуклеотидном локусе в
сравнении со стандартном (Anderson et al., 1981).
Азию как на зону трансгрессии трех культурных миров – европейского, сибир-
ского и центрально-азиатского, с преобладанием первого по силе влияния на
позднем, 15–12 тыс. лет назад, этапе палеолита (Грехова и др., 1996). При этом
территории, на которых акцентируется внимание в данной работе (юг Западной Сибири), входили в круг европейских палеолитических культур.
В неолите и бронзовом веке граница между монголоидными и европео-
идными племенами также располагалась гораздо восточнее современной. В
ареал европеоидной расы входили территории Средней Азии и Южной Сибири.
В это время складываются основные внутрисибирские и центральноазиатский
типы монголоидной расы, а в зоне контакта европеоидов и монголоидов (преимущественно в Средней Азии) – восточный вариант европеоидной расы. В ран-
нем железном веке начинается и продолжается в эпоху средневековья широкое
и постепенное расселение центральноазиатских монголоидов на запад. Этими
процессами метисации объясняется появление современного расового разнообразия населения Средней Азии, Западной и Южной Сибири, принадлежащего в основном к западно- и южносибирской локальным расам (Алексеев,
Гохман, 1984).
45
Рисунок 8. Карты первой главной компоненты изменчивости признаков позднепалеолитической культуры
26–16 (а) и 15–12 (б) тыс. лет назад. Приводится по: (Грехова и др., 1996, стр. 298–299).
46
Население юга Западной Сибири в эпохи неолита, бронзы, а затем и ран-
него железного века характеризуется как безусловно европеоидное с некото-
рым включением монголоидных признаков, восходящих к насельникам
таежной зоны Сибири, с одной стороны, и племенам Центральной Азии, с другой. Вес южного монголоидного компонента в палеонаселении лесостепи За-
падной Сибири значительно возрастает в позднем железном веке – во времена
продвижения на запад хуннов (Багашёв, 2000; Гумилев, 1960). В последующие
эпохи, с VI по XV вв., усиливается влияние тюркских и отчасти монгольских на-
родов на население юга Западной Сибири и связано оно с тюркскими государственными образованиями в Средней Азии и возникновением империи
Чингиз-хана, северными провинциями которой являлись территории Южной
Сибири (Народы …, 1988, Тюркские народы …, 2006).
Согласно этому историческому сценарию градиент соотношения евро-
пейских и азиатских компонентов в генофонде населения Северной Евразии
должен быть плавным и ориентированным по оси запад-восток, а на территории Южной Сибири должна наблюдаться зона трансгрессии северных и южных
монголоидных признаков в населении. Долготно-ориентированное направле-
ние изменчивости множества полиморфных маркеров мтДНК у североевразийского населения описано как основное направление географической
изменчивости мтДНК в геногеографическом исследовании (Генофонд…, 2003).
На рисунке 9 показано соотношение пулов монголоидных и европеоид-
ных гаплогрупп мтДНК в генофондах североевразийских народов. Здесь отчетливо проявляется связь распределения расоспецифических компонентов в
этнических генофондах с географической локализацией этнических ареалов, а
именно с долготой местности. С запада на восток плавно убывает доля евро-
пеоидных (rlong = –0.88, P < 0,05) и возрастает доля монголоидных (rlong =
0.89, P < 0,05) гаплотипов мтДНК. Примечательно, что Енисей, как и в картине
распространения позднепалеолитических культур (см. рис. 8 и 9а), выступает
в качестве естественной границы, к востоку от которой практически отсут-
ствует европеоидный компонент в генофондах коренных народов Восточной
Рисунок 9. Распределение пулов монголоидных и европеоидных гаплогрупп мтДНК в генофондах народов Северной Евразии
а)
б)
47
48
Сибири и Дальнего Востока – на рисунке 9б это пул популяций ульчи–чукчи.
Исключение составляет северная тюркская группа – якуты, по показателю «соотношение расоспецифических гаплогрупп мтДНК» закономерно близкая к
тюрко- и монголоязычным народам Южной Сибири.
В населении региона Западная и Южная Сибирь–Средняя Азия, на рис. 9б
это последовательный ряд популяций ханты–буряты, отмечается еще один градиент рассматриваемого показателя – широтный. В целом доля монголоидного
компонента здесь убывает с юга на север (rlong = –0.29, P < 0.05), в то же время
наблюдается ее возрастание на севере у представителей палеоазиатских язы-
ков кетов и самодийской группы энцы\нганасаны. Такая география изменчи-
вости признака «монголоидность» в митохондриальном генофонде населения
региона хорошо соответствует данным палеоантропологии о распределении антропологических типов – таежного западносибирского на севере и центрально-
азиатского на юге, разделенных клиной европеоидных племен, населявших
лесостепи и степи Южной Сибири (до Минусинской котловины на востоке) и
Средней Азии. Это европеоидное население существовало на данной террито-
рии длительное время, а его хронологическая преемственность на юге Западной Сибири установлена как минимум от раннего бронзового века до раннего
средневековья (Багашёв, 2000).
В свете представленных выше данных можно предположить двуслож-
ность монголоидного компонента в митохондрииальных генофондах народов
Приуралья, юга Западной Сибири и Средней Азии при менее выраженной дифференцированности компонента европеоидного. Для проверки этих предполо-
жений для каждой пары народов были оценены генетические расстояния d (Nei,
1985), соответственно для монголоидной и европеоидной составляющих ми-
тохондриальных генофондов народов Северной Евразии. В расчет вовлекались
данные по популяциям, в генофондах которых доля монголоидных (либо евро-
пеоидных) гаплотипов превышала 5 %-ный порог частоты. Результаты многомерного шкалирования матрицы попарных величин генетических расстояний
отражены на рисунке 10.
Рисунок 10. Многомерное шкалирование попарных генетических расстояний между народами Северной Евразии, оцененных по Nei, 1985 на основе данных о структуре (нуклеотидные последовательности ГВСI) и распространении монголоидных (а) и европеоидных (б) гаплотипов мтДНК. В окружности заключены описываемые
в тексте группы популяций.
49
50
Расположение народов в пространстве генетических расстояний, оценен-
ных на основе данных о сируктуре и распространении монголоидных (рис. 10а)
гаплотипов мтДНК имеет следующие особенности. По первому измерению подавляющее большинство популяций стремится к нулевой оси, крайнее поло-
жение здесь занимают финно-угорские народы Предуралья мари и удмурты, с
одной стороны, и представители палеоазиатских сибирских языков кеты, с другой. Упорядоченность популяций отчетливо проявляется по второму измерению.
Здесь
народы
Сибири,
всех
ее
субрегионов,
располагаются
преимущественно в отрицательном поле, а Средней и Центральной Азии, Китая
– в положительном поле пространства. На рисунке 10а описываемые группы
выделены окружностями. Дистанцированность сибирских народов от групп населения Монголии и Китая уже отмечалась ранее М.В. Деренко с соавторами в
работе, рассматривающей разнообразие гаплогрупп мтДНК у народов Алтая и
Саянского нагорья (Деренко и др., 2004). Представленные здесь данные свиде-
тельствуют о том, что фактически в той же мере сибирские народы дистанци-
руются от населения Средней Азии. Следует напомнить, что в основе
представленного на рис. 10а распределения популяций лежат оценки различия
гаплотипов монголоидных гаплогрупп мтДНК между популяциями. Соответ-
ственно и читаться он может как присутствие в генофонде североевразийского
населения, как минимум, двух различающихся типов монголоидного компонента, определить которые можно как «сибирский» и «центральноазиатский».
В пространстве генетических расстояний, оцененных по данным о струк-
туре и распространении европеоидных (рис. 10б) гаплотипов мтДНК, популя-
ции распределяются следующим образом. В отрицательном поле пространства
располагаются преимущественно финно-угорские народы, в положительном –
монголы и китайцы, в отрицательно-положительном – тюркоязычные народы
Приуралья и Южной Сибири, а в положительно-отрицательном – тюркоязычные народы Средней Азии. При этом распределение популяций на рис. 10б, в
отличие от такового на рис. 10а, отличается компактностью и менее выражен-
51
ной дистанцированностью популяций и вышеописанных групп популяций.
Особенно выражено сближение русских, финно-угорских и тюркских народов
(на рисунке эта группа очерчена окружностью), что может рассматриваться в
пользу сделанного ранее предположения о менее выраженной дифференцированности европеоидного компонента в генофондах народов Приуралья, юга Западной Сибири и Средней Азии в сравнении с компонентом монголоидным.
Такова общая картина изменчивости генофонда населения Северной Ев-
разии, если ее рассматривать на основе распределения расоспецифических гап-
логрупп и гаплотипов мтДНК у коренных народов региона. Задача состоит в
том, чтобы оценить положение тоболо-иртышских сибирских татар в этом ге-
нетическом пространстве. Прежде всего, следует напомнить, что генофонд тоболо-иртышских татар оказывается в высокой степени смешанным и включает
в себя как восточно-, так и западноевразийские типы мтДНК. По показателю соотношение монголоидных и европеоидных гаплотипов в митохондриальном генофонде (1:1,5, соответственно) тоболо-иртышские сибирские татары занимают
строго пограничное положение между западносибирскими угорскими (ханты и
манси) и среднеазиатскими тюркскими народами (рис. 9б). Такое положение
исследованной группы сибирских татар полностью соответствует географии
их расселения и представлению о формировании сибирских татар преимуще-
ственно на основе угорских народов Сибири и тюркских групп населения Средней и Центральной Азии (Томилов, 1981; Народы …, 1988).
Чтобы приблизиться к ответу на вопрос – как именно описанные в гено-
фонде сибирских татар расовые компоненты соотносятся с таковыми у других
североевразийских народов? – рассмотрим представленные на рис.10 этноге-
нетические пространства в сочетании с конкретными генетическими расстояниями d между сибирскими татарами и другими народами Северной Евразии.
Последние представлены в виде графика на рисунке 11.
Как видно на рис. 11, в той его части, которая отражает степень сходства
народов на основе европеоидных гаплотипов мтДНК, достаточно удалены от
52
сибирских татар кеты, самоеды энцы/нганасаны, народы Южной Сибири и мон-
голы; к совершенно иному миру, по-видимому, принадлежат европеоидные
линии, обнаруженные у китайцев хань. Выявленные у тоболо-иртышских татар
европеоидные гаплотипы мтДНК близки к пулу западноевразийских гаплоти-
пов у народов Волго-Уральского региона, обских угров, тюркоязычных народов
Средней Азии. Если обратиться к данным рис. 10б, учитывающим взаимоот-
ношения всех (изученной и привлеченных к сравнению) популяций, то более
выраженной становится близость европеоидной компоненты в генофонде то-
боло-иртышских татар к соответствующей составляющей генофондов финноугорских народов Приуралья и Западной Сибири, с этими народами сибирские
татары располагаются в отрицательном поле пространства на рис. 10б.
Рисунок 11. Генетические расстояния d (Nei, 1985) между сибирскими татарами и другими народами Северной Евразии, оцененные по данным о распространении монголоидных – d(A), и европеоидных – d(E) гаплотипов мтДНК.
Монголоидная компонента разнообразия мтДНК сибирских татар осо-
бенно сходна с таковой у населения Алтая и Саянского нагорья, у монголов и
китайцев, а также сближается с монголоидной составляющей генофондов тюркоязычных народов Средней Азии (рис. 11). В пространстве генетических раз-
личий популяций в пределах пула монголоидных гаплотипов мтДНК (рис. 10а)
53
сибирские татары дистанцируются от приуральских популяций, в том числе и
от тюркоязычных чувашей и татар Поволжья; и при этом занимают промежуточное положение между группами народов Сибири, с одной стороны, и Средней и Центральной Азии, с другой. В свете приведенных в этой главе
рассуждений такое положение изученной группы может означать присутствие
в генофонде тоболо-иртышских татар и сибирских, и центральноазиатских мон-
голоидных линий мтДНК. В большей мере сибирские татары сближаются со
средне-центральноазиатской группой преимущественно тюркоязычных наро-
дов, вместе с которыми они располагаются в положительном поле пространства на рис. 10а. Это в свою очередь указывает на то, что Средняя–Центральная
Азия, по видимому, является основным «донорским» регионом для монголоидных линий мтДНК в генофонде тоболо-иртышских татар.
Более подробно особенности распространения выявленных у сибирских
татар индивидуальных гаплотипов мтДНК в населении Северной Евразии, положение тоболо-иртышских татар в этногенетическом пространстве Северной
Евразии будут рассмотрены в следующих параграфах главы. Но уже на первом
этапе работы становится очевидной многокомпонентность митохондриального
генофонда тоболо-иртышских татар, и становится ожидаемой тесная генетическая взаимосвязь тоболо-иртышских татар с финно-угорскими народами
Приуралья и Западной Сибири, и тюркскими народами Средней Азии.
54
3.2. Разнообразие и филогеография гаплотипов мтДНК, выявленных у тоболо-иртышских сибирских татар
В этом параграфе представлен сравнительный анализ распределения гап-
лотипов и гаплогрупп мтДНК, а также уровня разнообразия мтДНК у тоболо-
иртышских татар и других народов Северной Евразии. Распространение
выявленных у сибирских татар гаплогрупп мтДНК у народов из различных географических регионов и лингвистических групп отражено в таблице 7. На ри-
сунке 12 представлено филогенетическое древо идентифицированных у
сибирских татар гаплотипов мтДНК. Совокупность накопленных на сегодня
данных о разнообразии мтДНК в популяциях Евразии позволяет достаточно
подробно рассмотреть особенности распространения выявленных гаплотипов,
либо филогенетически близких им последовательностей мтДНК.
Пул восточноевразийских линий в митохондриальном генофонде сибир-
ских татар представлен гаплогруппами A, B, C, D, F, G, M7 и M10. Гаплотипы
группы A отмечаются у сибирских татар с невысокой (1,8 %) частотой, близкой
к таковой у тюрков Волго-Уральского региона и Восточной Сибири, у носителей угорских и пермских языков, у монголоязычных бурят (табл. 7). Три гап-
лотипа, принадлежащих кластеру А (рис. 12), имеют следующие особенности
распространения. Гаплотип, маркируемый мутациями в позициях 16227, 16230
и 16311, отмечен в Волго-Уральском регионе у чувашей, татар и марийцев (Бермишева, 2001). Распространение гаплотипов 16220/16362 и 16187/16266 ука-
зывает на другое, юго-восточное, направление генетических взаимосвязей, эти
линии отмечены у уйгуров (Comas et al., 1998) и китайцев хань (Yao et al., 2002;
Kivisild et al., 2002).
Юго-восточное же направление взаимосвязей сибирских татар с другими
еразийскими народами воспроизводится при сравнительном анализе частот гаплогрупп B, F и М, и географических особенностей распространения принадлежащих им последовательностей. Наиболее высокими частотами этих
гаплогрупп характеризуются народы Центральной и Восточной Азии (табл. 7).
Западная Сибирь
тюркская
славянская18
17
монгольская
корейская
хань
16
0,7
4,8
0
4,6
27
195
1095
176
164
323
858
127
166
281
145
116
0,2
5,7
9,2
5,9
4,3
78,0
0
23,1
0,7
1,7
0
593
82
7,9
308
38
3,7
2,0
238
314
537
1,8
3,7
A
218
N1
6,9
5,1
3,4
4,6
8,4
2,6
1,2
6,2
6,9
4,7
D
0,1
0
3,3
0
1,0
0
6,8
0
0,3
10,7
3,9
0
3,6 16,5
0 10,5
45,5 30,3
59,3 33,3
64,6 21,0
2,1
2,6
9,1
4,7
17,5
17,3
0,7
0,4
0
0
0
0
0
4,5
0
0
0
0
0
0,2 41,0 2,6
4,5
6,7
3,1
4,7 17,7 0,4
0
0
0
4,1
0
0
0,9
0,2
0
0
0
41,3 3,3
1,1 28,1 0,9
2,1 24,3 1,9
9,2
0
0
0
4,8
0
0
0
3,4
0
0
2,6
2,2
1,0
U
9,2 25,7
6,2 27,3
T
1,1
4,1
1,7
0
0
1,4
0
0
0
0
0
1,0
0
0,7
0
8,0
0
0
0
1,4
0
0
3,4
7,4
0
0
8,9 19,7
0,6
0
0,3
4,0 10,3
0
0
0
0
0
0
0,9
1,2
8,5 19,0
8,2 25,0
0 34,2
6,5 25,4
1,4 19,1 23,2
6,0
1,8
K
12,3 1,7
0
0
3,9
7,6
J
0
I
2,8
5,0
H
0,5 17,4 0,5
G
31,0 28,4 12,9 3,4
36,8 18,2
32,7 25,6
13,9
15,8
1,3
4,7
4,9
13,3
C
10,2 15,4 15,4 12,9
0
21,0 4,6 42,9
2,1
0
1,0
2,6
2,5
0
0,5
0
0,4
0
1,9
M
9,7 6,3 15,3 12,5 22,2
20,7 4,9 16,5 0,6 34,8
19,5 17,6 22,6 2,5 20,4
0
4,1
0
0
0,4
0
2,8
0
1,0
0,9
7,1
0
0,5
23,7
0
0
2,1
F
4,0
4,1
0
2,0
6,0
4,5
0
0
0
0
0
0,3
B
Гаплогруппы мтДНК
0,5
3,3
0
0
0
0,3
0
0
0
0
0
0
0,9
0
0
0,5
0
7,5
0
3,9
V
1,8
0
0
0,3
1,0
0
0
0
0
0
0
0
0,2
0
0
2,6
0
0,2
0,5
1,1
W
7,5
9,6
6,6
7,8
10,2
0
41,7
8,4
3,5
7,4
1,2
4,4
6,4
2,5
5,2
2,7
3,7
9,2
2,5
4,6
другие
Примечание. 1 – суммарная выборка. Группы популяций: 2 – татары, чуваши, башкиры; 3 – удмурты, коми-пермяки, коми-зыряне; 4 – мордва, мари; 5 – ханты, манси;
6 – кеты; 7 – энцы\нганасаны, ненцы; 8 – алтайцы, тувинцы, хакасы, тофалары, сойоты; 9 – буряты; 10 – юкагиры; 11 – эвенки, 12 – якуты; 13 – ульчи, негидальцы, удэгейцы; 14 – чукчи, коряки, ительмены; 15 – эскимосы; 16 – казахи, киргизы, туркмены, узбеки, уйгуры; 17 – монголы, преимущественно халха; 18 – русские. Частота
дана в %. Жирным шрифтом отмечены частоты, не имеющие достоверных (P < 0.05) отличий от соответствующих характеристик выборки сибирских татар.
Восточная Европа
Восточная Азия
Средняя и Центральная Азия
эскимосско-алеутская 15
13
Дальний Восток
тюркская
12
тунгусская
чукотско-камчатская 14
10
Восточная Сибирь
монгольская9
8
тюркская
cамодийская
5
изолированный язык
тунгусская11
Южная Сибирь
угорская
палеоазиатская6
финская
4
пермская3
Волго-Уральский регион
тюркская2
7
лингвистическая
Сибирские татары
географическая
Группы популяций
группах населения Северной Евразии
Таблица 7. Распространение выявленных у сибирских татар гаплогрупп мтДНК в различных территориальных и лингвистических
55
56
Рисунок 12. Филогенетическое древо гаплотипов мтДНК, выявленных у тоболо-иртышских татар. На ветвях
древа перечислены полиморфные маркеры мтДНК, обозначения соответствуют приведенным в табл. 6. В круге
указано отличное от 1 число носителей гаплотипа.
57
Исключением являются кеты, где высокая частота кластера F (23,7 %) при
крайне низком разнообразии гаплотипов объясняется эффектом основателя
(Дербенева, 2002). Значимыми частотами гаплогрупп B и F, и при этом близ-
кими к выявленным у сибирских татар величинами, отличаются тюрко- и монголоязычные народы Сибири, Средней и Центральной Азии (табл. 7).
Разнообразие нуклеотидных последовательностей гаплогруппы B у си-
бирских татар восходит к двум подгруппам – B4 и B5 (см. табл. 6). Эти же под-
группы описывают разнообразие кластера B у народов Южной Сибири, но при
ином составе гаплотипов ГВСI (Derenko et al., 2003). Установленные у тоболо-
иртышских татар последовательности ГВСI, принадлежащие группам B4, B4a
и B5b (табл. 6), распространены в Китае. Филогенетически наиболее близкая
гаплотипу B4c последовательность – 16129/16140/16145/16166/16189/16217/
16274/16335 – также отмечена в выборке китайцев хань (Yao et al., 2002). Гап-
логруппа F в митохондриальном генофонде сибирских татар представлена
одной подгруппой F1b (табл. 6), выявленные последовательности гаплогруппы
F и/или ближайшие к ним гаплотипы также отмечены в Китае (Yao et al., 2002;
Kivisild et al., 2002).
Частота кластера M у сибирских татар составляет 4,6 %, она сопоставима
с таковой у тюрко- и монголоязычного населения Сибири и Центральной Азии
и в наибольшей степени сближается с величиной для среднеазиатской тюрк-
ской группы (табл. 7). У сибирских татар этот кластер представлен гаплогруп-
пами M7 и M10. Если гаплотип, несущий транзиции в позициях 16223, 16254
и 16295, может являться производной от базового мотива M7c – 16223/16295,
то линию M10 (рис. 12), по-вимому, следует определить как уникальную. На
данном этапе знаний об индивидуальных последовательностях ГВСI мтДНК в
популяциях Евразии не удается интерполировать географию этой линии.
Гаплогруппы С и D относятся к наиболее широко распространенным кла-
стерам мтДНК в генофонде населения Азии. Частота их изменяется в широком
интервале в различных географических и лингвистических группах населения
Азии. Примечательно соотношение частот этих гаплогрупп в различных ре-
58
гионах: в Приуралье частоты этих гаплогрупп оказываются фактически равной
величины, в Сибири превалирует гаплогруппа С, а в Центральной и Восточной
Азии, напротив, резко преобладает по частоте группа D (табл. 7). Распределе-
ние частот групп С и D у сибирских татар в наибольшей мере соответствует таковому у обских угров (ханты и манси) и кетов.
Гаплогруппа С у сибирских татар представлена в основном базовым –
16223/16298/16327 – и дочерними от него гаплотипами (рис. 12), распространение которых не проявляет какой-либо выраженной специфичности; эти гап-
лотипы отмечаются в географически и лингвистически различных группах
населения Азии. Вместе c тем в ряду гаплотипов группы С выделяется линия,
несущая транзиции в позициях 16148 и 16288 и имеющая две производные (рис.
12). Эта линия характерна для тюркоязычного населения Сибири: с частотами
3–5 % она отмечена у якутов, тофаларов и тувинцев (Деренко, 1997; Derenko et
al., 2003; Starikovskaya et al., 2005).
Группа D у сибирских татар отличается высоким разнообразием соста-
вляющих ее гаплотипов (рис. 12). В большинстве своем выявленные у тоболоиртышских
татар
гаплотипы,
либо
филогенетически
близкие
им
последовательности мтДНК, распространены преимущественно в Южной Сибири и в Средней Азии (Comas et al., 1998; Derenko et al., 2003; Starikovskaya
et al., 2005); таковы линии, маркируемые транзициями 16294 и 16245, гаплотипы
подгрупп
D4a
–
16129/16223/16262/16362/16368,
и
D4b
–
16172/16173/16215/16223/16319/16362. Два варианта ГВСI относятся к ранее
не описанным, – это гаплотипы, несущие, соответственно, транзиции в пози-
циях 16092, 16111, 16213 и 16227, 16278, 16358. Индивидуальным гаплотипом
у сибирских татар представлена группа D5, наиболее широко распространенная
(с частотой 5–10 %) в популяциях китая (Yao et al., 2002; Kivisild et al., 2002).
Пул западноевразийских линий в митохондриальном генофонде сибир-
ских татар представлен гаплогруппами N1, H, V, J, T, U, K, I и W. Распределе-
ние частот этих гаплогрупп наиболее сходно с таковым у угроязычного
населения Западной Сибири; единственное наблюдаемое здесь различие в срав-
59
нительно низкой частоте у сибирских татар гаплогруппы J (табл. 7). Группа J в
генофонде тоболо-иртышских татар представлена двумя подгруппами J1 и J2.
Последовательность J1 – 16069/16126/16145/16172/16222/16239/16261 – отмечена у русских (Морозова, 2007) и волжских татар (Бермишева, 2001). Гапло-
типы группы J2 характеризуются мутацией в позиции 16301 ГВСI (рис. 12) и
очевидно принадлежат к распространенной у обских угров линии мтДНК
16069/16126/16193/16301, обнаруженной с частотами свыше 5 и 10 % у ханты
и манси, соответственно (Дербенева, 2002).
Достаточно распространенной у сибирских татар оказалась гаплогруппа
T, ее частота 9,2 % (табл. 7) близка к таковой у населения европейской части
России (русские и народы Волго-Уральского региона) и Западной Сибири (народы угорской и самодийской лингвистических групп). Основное разнообразие кластера T представлено гаплотипами подгруппы T1. Преобладают по
частоте линии, маркируемые тразициями в позициях 16261 и 16093 (рис. 12).
Первая зафиксирована у обских угров, у ханты и манси с частотой 3 и 1 % (Дербенева, 2002), вторая – у башкир – 3,2 % (Бермишева, 2001).
Группы V, I, W и N1 выявлены у сибирских татар с частотами ниже 1 %
(табл. 7), они представлены в основном базовыми, маркирующими соответ-
ствующие гаплогруппы, и достаточно широко распространенными последовательностями ГВСI. К таковым же относятся выявленные гаплотипы группы K.
Некоторую специфичность географического распространения проявляет гап-
лотип 16147A/16172/16189/16223/16248/16320/16355, принадлежащий группе
N1, с частотой 1–2 % он отмечен в Приуралье и Южной Сибири – у башкир, алтайцев, и в сочетании с транзицией 16272 у коми-пермяков. К макрогаплогруппе N отнесены в работе гаплотипы 16189/16223/16311/16357 и
16093/16133/16223 (рис. 12), более детально их положение в систематике линий
мтДНК определить не удалось, как и интерполировать географию распространения этих линий в евразийских популяциях.
Свыше 40 % тотального разнообразия мтДНК у тоболо-иртышских татар
описывается гаплотипами кластеров H и U. Частота гаплогруппы Н (17,4 %) у
60
сибирских татар особенно близка к таковой у обских угров и тюркоязычных
народов Средней Азии (табл. 7). В генофонде сибирских татар резко преобла-
дает по частоте гаплотип, соответствующий стандартной последовательности
(Anderson et al., 1981), присутствуют гаплотипы достаточно распространенные
в населении Северной Евразии, маркируемые соответственно транзициями
16189, 16304 и 16362 (рис. 12). У отдельных индивидов выявлены ранее не опи-
санные гаплотипы группы H – 16031/16387, 16162/16356 и 16278/16304. От-
дельной ветвью выделяются гаплотипы с мотивом ГВСI 16169/16184, линия,
маркируемая транзициями в позициях 16169 и 16184, идентифицирована у
манси (3,1 %) и ханты (0,4 %) и отмечена на Алтае (1 %). Помимо основного мо-
тива ГВСI (16169/16184) у сибирских татар отмечены две производные этого
гаплотипа, маркируемые, соответственно, трансверсией в позиции 16111 и потерей сайта 9052 HaeII (рис. 12).
Четверть выявленного у тоболо-иртышских татар разнообразия мтДНК
приходится на гаплогруппу U, сходно высокая частота этой гаплогруппы на-
блюдается у населения европейской части России и Западной Сибири (табл. 7).
Двадцать восемь идентифицированных гаплотипов принадлежат субкластерам
U1, U2, U3, U4, U5 и U7. Подгруппа U1, на древе это ветвь, маркируемая му-
тациями в позициях 16249 и 16311 (рис. 12), в основном представлена достаточно распространенными базовыми мотивами ГВСI, отмечаемыми с низкими
частотами в Восточной Европе, Средней и Центральной Азии (Comas et al.,
1998; Malyarchuk et al., 2002; Quintana-Murci et al., 2004; Морозова, 2007).
Кластеры U2 и U3 в изученной выборке сибирских татар представлены
индивидуальными последовательностями – 16051/16209/16239/16270/16327/
/16352/353 и 16343/16390, соответственно. Подгруппа U3 имеет географически
широкое распространение в Северной Евразии при низкой (1–3 %) частоте в
популяциях, при этом в списке популяций, несущих эту линию мтДНК преобладают тюрко- и ираноязычные народы. Так, линия U3 мтДНК отмечена в Вос-
точной Европе у русских (Морозова, 2007), в Передней Азии у турков Анатолии
и в населении Азербайджана (Quintana-Murci et al., 2004), в Южной Сибири у
61
алтайцев и тувинцев (Derenko et al., 2003), у тюркоязычных народов Волго-
Уральского региона (Бермишева, 2001), в населении Средней Азии (Comas et
al., 1998; Quintana-Murci et al., 2004). С частотой 3–5 % кластер U3 отмечен
на Кавказе (данные по объединенной выборке, включающей грузин, балкарцев
и чеченцев) и в Иране (у персов и гилянцев). Здесь же в Иране у горской попу-
ляции луров выявлен максимум частоты (17,6 %) линии мтДНК U3 (QuintanaMurci et al., 2004).
Кластер U2 в Евразии характеризуется двумя пулами линий. Первый, ха-
рактерный для населения Европы, несет трансверсию в позиции 16129 (Macaulay et al., 1999; Richards et al., 2000), второй, без данной трансверсии, по
области распространения назван «индийским» (Kivisild et al., 1999). Выявлен-
ный у сибирских татар гаплотип кластера U2 16051/16209/16239/16270/
16327/16352/353 оказался достаточно уникальным в Северной Евразии, основная область распространения филогенетически близкого ему мотива ГВСI –
U2b 16051/16209/16239 – Пакистан и Индия, где частота его распространения
составляет 3–9 % (Kivisild et al., 1999; Quintana-Murci et al., 2004).
Гаплотипами кластера U4 описывается 13 % тотального разнообразия
мтДНК сибирских татар. Сходно высокая частота этого кластера известна у народов Западной Сибири – у манси (16 %), ханты – (18,6 %), энцев и нганасан
(21 %), особенно высока его частота (29 %) у кетов (Дербенева, 2002; Губина и
др., 2005). У сибирских татар кластер U4 представлен в основном распростра-
ненными в популяциях Северной Евразии гаплотипами – 16356 и 16134/16356
(рис. 12). Вместе с тем выделяются некоторые линии, распространение которых
более специфично и указывает на генетические взаимосвязи изученной группы
с популяциями Волго-Уральского региона и Западной Сибири. К таковым от-
носится идентифицированный у чувашей и коми (пермяков и зырян) мотив
16261/16356 (Бермишева, 2001; Губина и др., 2005), распространенный у манси
с частотой 3 % мотив 16113C/16356/16362 (Дербенева, 2002). Отдельной ветвью
выделяются гаплотипы, маркируемые транзицией в позиции 16189 (рис. 12),
известный в настоящее время ареал распространения мотива 16189/16356 – За-
62
падная Сибирь, где он отмечен у манси и нганасан, а в сочетании с транзицией
16111 – у кетов (Дербенева, 2002).
Подгруппа U5 в исследованной выборке тоболо-иртышских татар пред-
ставлена линиями U5a и U5b, это достаточно широко распространенные в по-
пуляциях Северной Евразии мотивы – 16192/16256/16270/16399 и 16189/16270,
и их дочерние гаплотипы (рис. 12). Исключение составляет гаплотип, марки-
руемый транзицией 16291, в настоящее время он отмечен у славян Восточной
Европы (Malyarchuk et al., 2002; Морозова, 2007).
Кластер U7, обнаруженный у сибирских татар с частотой 2,8 %, пред-
ставлен в изученной выборке мотивом 16309/16318T, а также производными
этого мотива (рис. 12). Известна достаточно высокая частота данного мотива U7
у манси – 5 % (Дербенева, 2002). Основной ареал распространения гаплотипов
мтДНК подгруппы U7 – это Ближний Восток, Центральная и Южная Азия, осо-
бенно высока частота этого кластера (в среднем 9 %) у населения Ирана и долины Инда (Kivisild et al., 2003; Quintana-Murci et al., 2004).
По итогам подробного рассмотрения гаплотипического состава митохон-
дриального генофонда тоболо-иртышских татар и филогеографии выявленных
у сибирских татар последовательностей ГВСI мтДНК можно сделать ряд заключений.
Во-первых, профиль распределения гаплогрупп мтДНК в генофонде си-
бирских татар наиболее сходен с таковым у обских угров (ханты и манси); в
особенности это касается наиболее распространенных кластеров, суммарная
частота которых у сибирских татар составляет свыше 70 %, – это гаплогруппы
C, D, H, T и U (табл. 7). Примечательно, что многие общие для сибирских татар
и обских угров, и специфичные для последних, гаплотипы – например:
16169/16184 (гаплогруппа H); 16126/16193/16301 (гаплогруппа J), 16126/16163/
/16186/16189/16261/16294 (гаплогруппа T) – имеют ранг узловых на филогенетическом древе гаплотипов мтДНК сибирских татар (рис. 12). По-видимому,
«угорский» компонент может быть определен как один из основных генетических компонентов в митохондриальном генофонде тоболо-иртышских татар.
63
Во-вторых, наблюдается сходство сибирских татар с тюркскими группами
Сибири и Средней Азии, которое наиболее ярко проявляется в распределении
гаплогрупп восточноазиатского происхождения – B и F. При этом есть основа-
ние полагать, что гаплотипы этих кластеров привнесены в первую очередь древними тюрками и сохранились здесь на северной окраине тюркской Ойкумены
до настоящего времени: так, филогенетически ближайшие выявленным гапло-
типы кластеров В и F идентифицируются сегодня не в Сибирско-Среднеазиатском регионе, а в Китае.
И, в третьих, появление в генофонде сибирских татар гаплотипов, при-
надлежащих кластерам U2, U3 и U7, учитывая описанные выше особенности
их распространения в Евразии, по-видимому, также обусловлено влиянием
ирано- и тюркоязычных племен и народов, на протяжении многих веков населявших североевразийские степи.
Выявленная гетерогенность митохондриального генофонда тоболо-ир-
тышских татар должна проявиться в высоком уровне разнообразия мтДНК этой
группы населения. В таблице 8 представлены оценки разнообразия мтДНК у
сибирских татар и интервалы соответствующих оценок, рассчитанных в работе
и привлеченных из публикаций, для народов различных регионов и лингви-
стических групп. Если не рассматривать население Китая и Монголии, на высокое генетическое разнообразие которого указывалось в ряде работ (Батсуурь,
1986; Самбуугийн, 1992; Kolman et al., 1996; Деренко и др., 2004), то наибо-
лее высоким разнообразием мтДНК обладают тюркоязычные народы, и в особенности насельники Южной Сибири и Средней Азии. У тоболо-иртышских
татар, как видно из таблицы 8, все показатели разнообразия – распределение
частот гаплотипов в популяции H (Nei, Tadjima, 1981), среднее число нуклеотидных различий между гаплотипами π (Jukes and Cantor, 1969; Nei, 1985), и,
наконец, интегральный показатель разнообразия индивидуальных гаплотипов
мтДНК в популяции dx (Nei, 1987) – сближаются с верхней границей интервала соответствующих оценок для тюркоязычных народов Северной Евразии.
64
Таблица 8. Оценки разнообразия мтДНК у тоболо-иртышских татар и некоторых евразийских популяций
Регион; лингвистическая
группа
Сибирские татары
Волго-Уральский регион;
финская, пермская 1
Выборка (N)
218
Разнообразие
гаплотипов (H)
0.993
Среднее число поНуклеотидное
парных различий
разнообразие (π)
(dx)
0.018
6.65
74–140
0.931–0.979
0.009–0.017
3.58–6.12
24–267
0.886–0.979
0.015–0.018
5.29–6.59
Волго-Уральский регион;
тюркская 3
91–228
0.981–0.994
0.013–0.017
4.59–6.26
Средняя Азия; тюркская 5
30–234
40–94
0.920–0.981
0.012–0.017
4.86–6.70
128
0.997
0.018
6.73
Западная Сибирь; угорская,
самодийская 2
Южная Сибирь; тюркская 4
Монголия; монгольская
Китай; хань
331
0.989–0.995
0.999
0.015–0.018
0.023
5.48–6.72
8.31
Примечание. Народы, входящие в состав групп: 1 – мари, мордва, коми пермяки и зыряне, удмурты; 2 – ханты,
манси, ненцы, энцы/нганасаны, кеты; 3 – татары, чуваши, башкиры; 4 – алтайцы, тувинцы, хакасы, сойоты, тофалары (приведено по: Derenko et al., 2003); 5 – казахи, киргизы, туркмены, узбеки, уйгуры.
Согласно изложенным результатам митохондриальный генофонд тоболо-
иртышских татар представляет собой многокомпонентную систему, гетероген-
ность которой определяется присутствием европеоидного, преимущественно
финно-угорского, и различных (северо- и центральноазиатского) монголоидных компонентов. Гетерогенность митохондриального генофонда тоболо-ир-
тышских татар проявилась, прежде всего, в высоком уровне разнообразия
мтДНК. С помощью филогеографического анализа гаплотипов мтДНК показаны генетические взаимосвязи сибирских татар с населением различных регионов – Приуралья, Западной и Южной Сибири, Средней Азии. Все это, как
и предположение о фактически равновеликом вкладе угорских и тюркских пле-
мен и народов в формирование сибирских татар не противоречит, а, напротив,
воспроизводит реконструкции происхождения сибирских татар, предпринятые
в этнографических и антропологических исследованиях (Багашёв, 1993; 2000;
Томилов, 1981). Описанные особенности митохондриального генофонда то-
боло-иртышских татар должны проявиться в соответствующем их положении
в современном этногенетическом пространстве Северной Евразии.
65
3.3. Положение генофонда сибирских татар в ряду этнических генофондов
населения Северной Евразии
В качестве меры генетической взаимосвязи популяций в работе исполь-
зовались генетические расстояния d (Nei, 1985), оцененные для ГВСI мтДНК.
Попарные оценки расстояний от сибирских татар до привлеченных к анализу
североевразийских народов приведены в таблице 9. Если рассматривать ран-
жированные в первом столбце таблицы величины генетических расстояний в
сравнении со средней величиной d «до сибирских татар» – 0.209, то положе-
ние изученной группы в ряду народов Северной Евразии следующее: тоболо-
иртышские татары характеризуются генетическими расстояниями ниже
средней величины при сравнении с обскими уграми, русскими, народами
Волго-Уральского региона и Средней Азии; выше средней – с кетами, само-
дийской группой энцы/нганасаны, народами Южной и Восточной Сибири, монголами и китайцами.
Наименьшие величины генетического расстояния до сибирских татар об-
наружены для следующих народов: башкиры (d = 0.071), манси (0.104), казахи
(0.110), туркмены (0.113) и ханты (d = 0.123) (табл. 9), т.е. это в первую очередь
угорские народы Сибири и тюркоязычные народы, в истории формирования
которых предполагается значимое участие племен тюркской кыпчакской об-
щности, сложившейся в XIII в. на территории современного Казахстана (Народы …, 1988). Полученные данные косвенно указывают на эти компоненты –
угорский и тюркский кыпчакский – как на основные составляющие разнообразия мтДНК у тоболо-иртышских татар.
Результаты многомерного шкалирования матрицы попарных генетиче-
ских расстояний позволяют рассмотреть расположение популяций в генетическом пространстве (рис. 13). Примечательно то, что расположение народов в
этом пространстве в высокой степени воспроизводит географическую упоря-
доченность их этнических ареалов. По первому измерению эта упорядочен-
ность хорошо соотносится с географией расселения народов по долготе – от
Популяция
Сибирские татары
Башкиры
Манси
Казахи
Туркмены
Ханты
Татары
Коми-пермяки
Мордва
Уйгуры
Чуваши
Узбеки
Русские
Коми-зыряне
Мари
Удмурты
Киргизы
Алтайцы
Монголы
Хакасы
Кеты
Китайцы хань
Энцы/нганасаны
Тувинцы
Буряты
Якуты
Эвенки
2
.098
.061
.072
.098
.115
.067
.165
.100
.096
.090
.188
.183
.161
.204
.123
.108
.152
.219
.317
.340
.268
.440
.372
.571
.745
1
.071
.104
.110
.113
.123
.127
.130
.138
.139
.145
.146
.155
.158
.186
.196
.198
.219
.236
.254
.292
.339
.350
.533
.556
.673
.882
.196
.125
.054
.117
.134
.165
.218
.142
.180
.178
.141
.161
.244
.245
.245
.328
.311
.400
.558
.375
.578
.583
.740
.897
3
.010
.177
.225
.170
.316
.006
.221
.020
.327
.307
.332
.233
.003
.083
.045
.213
.423
.118
.244
.412
.269
.474
.729
4
.111
.147
.113
.225
.061
.174
.012
.242
.225
.245
.190
.037
.133
.140
.283
.518
.252
.323
.468
.346
.550
.825
5
.101
.129
.182
.201
.135
.101
.182
.123
.174
.200
.253
.240
.315
.412
.467
.537
.400
.626
.577
.802
.959
6
8
9
.101
.041 .113
.178 .192 .261
.016 .134 .080
.119 .171 .264
.018 .137 .020
.022 .130 .055
.033 .198 .064
.160 .152 .135
.326 .257 .446
.358 .276 .472
.390 .312 .507
.516 .401 .557
.508 .439 .499
.583 .469 .627
.600 .515 .763
.811 .670 .959
.737 .623 .927
1.023 .789 1.161
1.220 1.053 1.396
7
.139
.004
.260
.274
.242
.244
.058
.146
.091
.299
.459
.158
.371
.561
.384
.652
.915
10
.125
.059
.083
.013
.203
.304
.328
.356
.499
.455
.542
.552
.826
.709
1.026
1.210
11
.236
.221
.212
.228
.045
.125
.095
.329
.543
.256
.321
.471
.326
.583
.801
12
14
15
16
.037
.046 .064
.196 .167 .220
.457 .462 .423 .390
.489 .475 .435 .431
.531 .518 .484 .417
.601 .581 .546 .540
.521 .531 .503 .661
.660 .708 .671 .531
.782 .718 .655 .682
.983 .950 .905 .871
.943 .912 .841 .789
1.211 1.180 1.155 .960
1.435 1.375 1.300 1.289
13
.061
.039
.195
.570
.153
.177
.272
.134
.338
.551
17
.034
.111
.457
.272
.088
.189
.146
.291
.419
18
.148
.522
.182
.184
.233
.132
.297
.483
19
.333
.368
.126
.129
.228
.204
.265
20
.688
.615
.832
.952
.960
1.120
21
.511
.588
.444
.612
.920
22
24
25
26
.076
.111 .088
.158 .081 .140
.171 .074 .203 .110
23
Примечание. Популяции в таблице перечислены в соответствии с возрастающими генетическими дистанциями до сибирских татар; средняя величина расстояния от перечисленных народов до сибирских татар составляет 0.209. Все значения расстояния значимы при P < 0.05, за исключением выделенных подчеркиванием.
№
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
Таблица 9. Генетические расстояния d (Nei, 1985) между народами Северной Евразии по данным о разнообразии мтДНК
66
67
русских на западе до эвенков на востоке, и соответствует описанному в первом
параграфе данной главы долготному распределению показателя «соотношение
европеоидных и монголоидных гаплотипов мтДНК» в генофондах североевра-
зийских народов (см. рис. 9а). Положение сибирских татар полностью соответствует описанному ранее (см. п. 3.1. главы 3), т.е. является промежуточным
между обскими уграми и тюркоязычными среднеазиатскими народами.
Рисунок 13. Многомерное шкалирование попарных генетических расстояний между народами Северной Евразии по данным о разнообразии мтДНК
Второе измерение преимущественно дифференцирует народы Сибири,
расположенные в положительном поле, от народов Средней и Центральной
Азии – в отрицательном поле измерения. Сибирские татары в рассматривае-
мом генетическом пространстве особенно сближаются с башкирами, достаточно дистанцируются от народов, в том числе и тюркоязычных, Южной и
Восточной Сибири, от монголов (d = 0.236) и самодийской группы энцы/нганасаны (d = 0.350). Тоболо-иртышские татары занимают промежуточное положение между западносибирскими угорскими народами (манси и ханты),
68
среднеазиатскими (туркмены, узбеки, казахи и уйгуры) и приуральскими (чу-
ваши и татары) тюркскими народами. При этом степень генетической близости до каждой из перечисленных групп ранжируется следующим образом: угры
Западной Сибири (d = 0.114), тюрки Средней Азии (0.127) и тюрки ВолгоУральского региона (d = 0.136).
Особенная близость изученной группы сибирских татар к башкирам, а их
обоих к обским уграм, проявляется и в результатах кластерного анализа матрицы генетических расстояний (табл. 9), отраженных на рисунке 14. Здесь си-
бирские татары, башкиры, ханты и манси образуют тесный кластер, наряду с
кластером русских и народов Волго-Уральского региона, кластером народов
Средней Азии и кластером народов Южной и Восточной Сибири.
Рисунок 14. Дендрограмма генетических взаимоотношений популяций Северной Евразии, построенная на
сонове данных табл. 9 методом UPGMA.
69
Таким образом, представленные в работе результаты свидетельствуют о
том, что по данным о разнообразии мтДНК и спозиций современных знаний о
разнообразии мтДНК у народов Северной Евразии основной вклад в форми-
рование генофонда тоболо-иртышских татар принадлежит угорскому генети-
ческому компоненту, достаточно выраженным представляется генетический
вклад тюркских (и в большей мере, по-видимому, кыпчакских), а менее весомым – самодийских и монгольских племен и народов.
Возможно, с расширением числа выборок по ряду рассматриваемых в ра-
боте народов расставленные акценты могут быть несколько изменены. Так,
ожидаемо еще большее сближение сибирских татар с ханты, поскольку в на-
стоящее время исследовано генетическое разнообразие лишь северных ханты
(Губина и др., 2005, Наумова и др., 2008), с казахами – на данный момент изучены лишь южные казахи Таласской долины (Comas et al., 1998); ожидаемо
некоторое сближение сибирских татар с самодийскими народами при условии
изученности южных самодийцев – селькупов. Тем не менее, вывод о ведущей
роли угорских племен и народов в формировании генофонда тоболо-иртыш-
ских татар видится достаточно обоснованным и согласуется с общим представлением об исключительно большой роли аборигенных субстратов в
формировании разнообразия тюркоязычных групп населения Евразии (Алексеев, Гохман, 1984).
70
3.4. Изменчивость мтДНК в этнолингвистических группах и локальных
популяциях тоболо-иртышских татар
В этом разделе приводятся результаты анализа разнообразия мтДНК в
семи локальных популяциях (деревнях) и четырех этнолингвистических группах тоболо-иртышских татар. Представлены данные о распределении индиви-
дуальных гаплотипов и гаплогрупп мтДНК в популяциях, даны оценки уровня
дифференциации митохондриального генофонда тоболо-иртышских татар, оце-
нена степень генетической взаимосвязи территориальных групп тоболо-иртышских татар с народами Северной Евразии.
В таблице 10 представлено распределение гаплогрупп мтДНК в локаль-
ных популяциях и территориальных группах тоболо-иртышских татар. Прежде
всего, стоит отметить широкий интервал изменчивости частот гаплогрупп
мтДНК: так, частота гаплогруппы U варьирует в популяциях от 12 до 36 % (18–
34 % в территориальных группах), гаплогруппы H – от 0 до 28 % (7–27 % в
группах) и гаплогруппы C – от 0 до 47 % (4–33 % в группах).
Столь же изменчиво от популяции к популяции соотношение пулов ев-
ропеоидных и монголоидных гаплотипов мтДНК в генофонде тоболо-иртышских татар (рис. 15). Как отмечалось в работе ранее, в генофонде
тоболо-иртышских татар в целом соотношение монголоидных линий мтДНК к
европеоидным составляет 1:1,5; в различных территориальных группах оно изменяется от 1:1,2 у тевризских до 1:2,2 у заболотных татар. Примечательно, что
в рамках полученных данных, а именно в пределах ареала проживания изученной группы сибирских татар, проявляется описанная в 1-ом параграфе главы
изменчивость соотношения монголоидного и европеоидного компонентов в ми-
тохондриальном генофонде населения Северной Евразии, ориентированная в
направлении запад–восток. Так, с запада на восток, от заболотных татар к тев-
ризским, доля европеоидного компонента в митохондриальном генофонде сибирских татар убывает от 70 до 55 %, а монголоидного, соответственно,
возрастает от 30 до 45 % (рис. 15).
0
F
3,57
7,14
N
32,14
3,57
W
3,57
0
0
35,71
7,14
0
0
0
3,57
0
0
0
7,14
0
17,86
28,57
0
0
0
0
1,79
1,79
24,00
8,00
0
0
4,00
20,00
0
4,00
16,00
0
0
16,00
8,00
33,93
7,14
0
3,57
0
7,14
3,57
0
1,79
8,93
0
8,93
17,86
0
0
12,00
8,00
12,00
4,00
0
28,00
4,00
0
4,00
8,00
4,00
4,00
8,00
4,00
2,00
0
0
0
18,00
8,00
6,00
2,00
2,00
24,00
2,00
2,00
10,00
4,00
2,00
10,00
8,00
0
0
10,00
30,00
0
0
0
26,67
6,67
0
3,33
20,00
3,33
0
0
0
0
30,00
3,33
3,33
0
0
0
0
0
10,00
46,67
0
0
3,33
3,33
Саургачи
N=30
0
0
20,00
16,67
1,67
0
0
13,33
3,33
0
6,67
33,33
1,67
0
1,67
1,67
Суммарно
Тевризские
0 – 7,14
0
0
30,77
3,85
0
0 – 3,57
0 – 3,57
12,00 – 35,71
3,33 – 30,00
0 – 12,00
0 – 4,00
5,77
0
0 – 28,00
0 – 7,14
0 – 4,00
0 – 16,00
0 – 46,67
0 – 15,38
0 – 17,86
0 – 28,57
0 – 7,14
Интервал
частоты *
26,92
1,92
0
9,62
3,85
15,38
1,92
0
0
Ачиры
N=52
Заболотные
0,46
0,46
25,69
9,17
1,83
2,75
0,46
17,43
2,75
0,46
6,88
13,30
4,60
5,05
6,88
1,83
p
Примечание. * – приведен интервал изменчивости частоты в локальных популяциях. p – средняя частота для изученной выборки (N = 218). Жирным шрифтом обозначены максимальные для территориальных групп тоболо-иртышских татар частоты гаплогрупп мтДНК.
V
7,14
U
T
0
7,14
0
10,71
0
K
J
I
H
G
10,71
D
C
0
M
7,14
7,14
B
3,57
Тюменские
Кутарбитка Тоболтура
Юртобор Варвара
Утузы
Суммарно
Суммарно
N=28
N=28
N=25
N=25
N=30
A
Гаплогруппа
Тобольские
Таблица 10. Частоты гаплогрупп мтДНК (%) в локальных популяциях и этнолингвистических группах тоболо-иртышских татар
71
72
Рисунок 15. Распределение пулов европеоидных и монголоидных гаплотипов мтДНК в популяциях и территориальных группах тоболо-иртышских татар. Принадлежность элементарных популяций к территориальным
группам обозначена как: (ТЕ) – тевризские, (ТО) – тобольские, (ТЮ) – тюменские и (ЗБ) – заболотные татары.
Последующие, приводимые в работе оценки разнообразия мтДНК у то-
боло-иртышских татар, результаты сравнительного анализа популяций сибирских татар друг с другом и с другими народами Северной Евразии строятся на
данных о распределении индивидуальных гаплотипов, нуклеотидных после-
довательностей ГВСI мтДНК. Распределение 98-ми выявленных гаплотипов в
популяциях и территориальных группах сибирских татар представлено в табл.
11, и более наглядно в графическом виде – на рисунке 16. Из 98-ми гаплотипов
61 гаплотип является «уникальным», т.е. отмечен только у одного индивида из
218. Этими гаплотипами описывается 28 % общего разнообразия мтДНК в исследованной выборке сибирских татар. Результаты расчетов, проведенных в работе по ряду привлеченных североевразийских популяций, свидетельствуют,
что доля «уникальных» гаплотипов, идентифицируемых на основе нуклеотидных последовательностей ГВС I мтДНК, составляет 25–30 %, и является вели-
чиной достаточно постоянной, во всяком случае, на принятых сегодня в работах
выборках от нескольких десятков до нескольких сотен индивидов из популяции
этнического уровня.
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
№
п\п
A
A
A
B4
B4
B4
B4a
B4c
B5b
F1b
F1b
F1b
F1b
F1b
M7c
M10
M10
C
C
C
C
C
C
C
C
D
D
Гаплогруппа
Тобольские
Кутарбитка Тоболтура
Суммарно
N=28
N=28
0
0
0
0
0
0
7,14 (2)
0
3,57 (2)
3,57 (1)
0
1,79 (1)
3,57 (1)
10,71 (3)
7,14 (4)
0
3,57 (1)
1,79 (1)
0
0
0
0
14,29 (4)
7,14 (4)
0
0
0
0
0
0
0
17,86 (5)
8,93 (5)
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
3,57 (1)
0
1,79 (1)
0
0
0
0
0
0
3,57 (1)
0
1,79 (1)
0
0
0
3,57 (1)
7,14 (2)
5,36 (3)
0
0
0
0
0
0
0
0
0
0
0
0
Юртобор
N=25
0
0
0
0
4,00 (1)
0
4,00 (1)
0
0
0
0
8,00 (2)
4,00 (1)
4,00 (1)
0
0
0
0
0
0
0
0
0
0
0
4,00 (1)
0
Тюменские
Варвара
Суммарно
N=25
0
0
4,00 (1)
2,00 (1)
0
0
0
0
4,00 (1)
4,00 (2)
0
0
0
2,00 (1)
4,00 (1)
2,00 (1)
0
0
0
0
0
0
4,00 (1)
6,00 (3)
0
2,00 (1)
0
2,00 (1)
0
0
4.00 (1)
2,00 (1)
0
0
8,00 (2)
4,00 (2)
0
0
0
0
0
0
0
0
0
0
0
0
0
0
4,00 (1)
4,00 (2)
0
0
Утузы
N=30
0
0
0
0
0
0
0
0
0
0
0
0
0
0
3,33 (1)
0
0
3,33 (1)
0
6,67 (2)
0
0
10,33 (3)
0
0
3,33 (1)
0
Тевризские
Саургачи
N=30
3,33 (1)
0
0
0
0
0
0
0
3,33 (1)
0
0
0
0
0
0
0
0
6,67 (2)
3,33 (1)
0
0
6,67 (2)
26,67 (8)
3,33 (1)
0
0
3,33 (1)
Таблица 11. Распространение гаплотипов мтДНК в популяциях и группах тоболо-иртышских татар
1,67 (1)
0
0
0
0
0
0
0
1,67 (1)
0
0
0
0
0
1,67 (1)
0
0
5,00 (3)
1,67 (1)
3,33 (2)
0
3,33 (2)
18,33 (11)
1,67 (1)
0
1,67 (1)
1,67 (1)
Суммарно
Заболотные
Ачиры
N=52
0
0
0
0
0
0
0
0
0
1,92 (1)
0
0
0
0
0
9,62 (5)
5,77 (3)
0
0
0
0
0
1,92 (1)
0
1,92 (1)
0
0
73
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
№
п\п
D
D
D
D
D
D4a
D4b
D5
G
N1a
N1c
H
H
H
H
H
H
H
H
H
H
I
J
J1b1
J2
J2
J2
Гаплогруппа
Тобольские
Кутарбитка Тоболтура
Суммарно
N=28
N=28
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
3,57 (1)
0
1,79 (1)
0
0
0
0
0
0
0
0
0
0
0
0
7,14 (2)
0
3,57 (2)
0
3,57 (1)
1,79 (1)
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
3,57 (1)
0
1,79 (1)
0
0
0
0
0
0
0
0
0
3,57 (1)
0
1,79 (1)
3,57 (1)
0
1,79 (1)
0
0
0
0
0
0
0
0
0
Таблица 11. (продолжение)
Юртобор
N=25
4,00 (1)
0
0
0
4,00 (1)
0
0
4,00 (1)
4,00 (1)
0
0
16,00 (4)
0
0
0
0
4,00 (1)
0
0
0
0
4,00 (1)
0
0
0
0
0
Тюменские
Варвара
Суммарно
N=25
0
2,00 (1)
0
0
0
0
0
0
0
2,00 (1)
0
0
0
0
0
2,00 (1)
0
2,00 (1)
0
0
4,00 (1)
2,00 (1)
8,00 (2)
12,00 (6)
0
0
8,00 (2)
4,00 (2)
0
0
0
0
0
2,00 (1)
4,00 (1)
2,00 (1)
0
0
8,00 (2)
4,00 (2)
0
0
0
2,00 (1)
0
0
0
0
0
0
4,00 (1)
2,00 (1)
0
0
Утузы
N=30
0
0
0
0
0
0
0
0
0
0
0
23,33 (7)
0
0
0
3,33 (1)
0
0
0
0
0
0
0
0
0
0
0
Тевризские
Саургачи
N=30
0
3,33 (1)
0
0
0
3,33 (1)
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
1,67 (1)
0
0
0
1,67 (1)
0
0
0
0
0
11,67 (7)
0
0
0
1,67 (1)
0
0
0
0
0
0
0
0
0
0
0
Суммарно
Заболотные
Ачиры
N=52
0
0
1,92 (1)
5,77 (3)
0
0
1,92 (1)
0
0
1,92 (1)
0
7,69 (4)
0
0
9,62 (5)
0
0
0
1,92 (1)
5,77 (3)
1,92 (1)
0
0
0
3,85 (2)
0
1,92 (1)
74
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
№
п\п
K
K
T
T
T1
T1
T1
T1
T1
T1
T1
T2
U
U1
U1
U1a
U1a
U2
U3
U4
U4
U4
U4
U4
U4
U4
U4
U4
Гаплогруппа
Тобольские
Кутарбитка Тоболтура
Суммарно
N=28
N=28
0
0
0
0
0
0
0
0
0
0
3,57 (1)
1,79 (1)
0
0
0
0
0
0
0
0
0
7,14 (2)
0
3,57 (2)
0
0
0
0
3,57 (1)
1,79 (1)
0
0
0
0
0
0
0
0
0
3,57 (1)
0
1,79 (1)
0
0
0
0
0
0
0
3,57 (1)
1,79 (1)
0
0
0
0
3,57 (1)
1,79 (1)
3,57 (1)
0
1,79 (1)
7,14 (2)
14,29 (4)
10,71 (6)
0
0
0
0
0
0
0
0
0
3,57 (1)
0
1,79 (1)
0
0
0
0
0
0
0
0
0
Таблица 11. (продолжение)
Юртобор
N=25
0
0
0
0
0
0
0
0
0
4,00 (1)
4,00 (1)
0
0
0
0
0
0
0
0
0
8,00 (2)
0
4,00 (1)
8,00 (2)
0
0
0
0
Тюменские
Варвара
Суммарно
N=25
12,00 (3)
6,00 (3)
0
0
0
0
0
0
4,00 (1)
2,00 (1)
0
0
0
0
0
0
4,00 (1)
2,00 (1)
0
2,00 (1)
0
2,00 (1)
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
8,00 (2)
4,00 (2)
4,00 (1)
6,00 (3)
0
0
0
2,00 (1)
0
4,00 (2)
0
0
0
0
0
0
0
0
Утузы
N=30
0
0
10,00 (3)
0
3,33 (1)
6,67 (2)
0
0
0
6,67 (2)
0
3,33 (1)
0
0
0
0
0
0
0
3,33 (1)
0
3,33 (1)
0
0
0
0
0
0
Тевризские
Саургачи
N=30
0
3,33 (1)
0
0
0
0
3,33 (1)
0
0
0
0
0
0
0
0
10,00 (3)
0
3,33 (1)
0
0
0
0
0
0
0
3,33 (1)
3,33 (1)
0
0
1,67 (1)
5,00 (3)
0
1,67 (1)
3,33 (2)
1,67 (1)
0
0
3,33 (2)
0
1,67 (1)
0
0
0
5,00 (3)
0
1,67 (1)
0
1,67 (1)
0
1,67 (1)
0
0
0
1,67 (1)
1,67 (1)
0
Суммарно
Заболотные
Ачиры
N=52
0
0
0
0
0
3,85 (2)
0
0
0
0
0
0
1,92 (1)
3,85 (2)
1,92 (1)
0
0
0
0
5,77 (3)
3,85 (2)
0
0
0
0
0
0
1,92 (1)
75
U4
U4
U5a
U5a
U5a
U5a
U5a
U5b
U5b
U7
U7
U7
V
W
N
N
Гаплогруппа
Тобольские
Кутарбитка Тоболтура
Суммарно
N=28
N=28
0
3,57 (1)
1,79 (1)
0
0
0
7,14 (2)
0
3,57 (2)
0
0
0
0
0
0
0
0
0
0
7,14 (2)
3,57 (2)
0
7,14 (2)
3,57 (2)
3,57 (1)
0
1,79 (1)
0
0
0
0
0
0
0
0
0
3,57 (1)
0
1,79 (1)
3,57 (1)
0
1,79 (1)
0
0
0
7,14 (2)
0
3,57 (2)
Юртобор
N=25
0
4,00 (1)
0
0
0
0
0
0
0
0
0
0
0
0
0
0
Тюменские
Варвара
Суммарно
N=25
0
0
0
2,00 (1)
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
Утузы
N=30
0
0
0
0
3,33 (1)
0
0
0
0
0
0
0
0
0
6,67 (2)
0
Тевризские
Саургачи
N=30
0
0
0
3,33 (1)
3,33 (1)
3,33 (1)
0
0
0
0
0
0
0
0
0
0
0
0
0
1,67 (1)
3,33 (2)
1,67 (1)
0
0
0
0
0
0
0
0
3,33 (2)
0
Суммарно
Заболотные
Ачиры
N=52
0
0
0
0
0
0
0
0
0
7,69 (4)
1,92 (1)
1,92 (1)
0
0
0
0
Примечание. Нумерация гаплотипов соответствует таковой в табл. 6, там же приведена структура гаплотипов. Частота дана в %, в скобках приведено число индивидов,
несущих соответствующий гаплотип.
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
№
п\п
Таблица 11. (окончание)
76
77
Рисунок 16. Медианная сеть гаплотипов мтДНК, выявленных в популяциях тоболо-иртышских татар. Размеры
круга и сектора пропорциональны количеству индивидов, несущих гаплотип. Цифрой обозначено число индивидов, буквой – населенный пункт: А – Ачиры, В – Варвара, К – Кутарбитка, С – Саургачи, Т – Тоболтура,
У – Утузы и Ю – Юртобор. Штриховкой обозначены территориальные группы:
– тевризские,
– тобольские,
– тюменские и
– заболотные татары.
78
Следующие данные о распределении гаплотипов в популяциях и группах
тоболо-иртышских сибирских татар приводятся без сравнительных величин,
ввиду отсутствия материалов, описывающих размах изменчивости мтДНК в
локальных популяциях и субэтнических группах населения.
Из 98-ми гаплотипов мтДНК отмечены:
только в одной деревне 80 гаплотипов, охватывающие 51,8 % частоты;
только в одной территориальной группе – 82 гаплотипа, 54,1 %;
в двух или трех группах – 14 гаплотипов, 32,1 %;
во всех четырех группах – 2 гаплотипа, 13,8 %.
Общими для всех территориальных групп тоболо-иртышских татар ока-
зались гаплотип кластера H, соответствующий стандартной последовательности (Anderson et al., 1981), и базовый гаплотип кластера U4, несущий
транзицию 16356 (табл. 11, рис. 16).
Профиль распределения гаплотипов мтДНК в локальных популяциях и
территориальных группах тоболо-иртышских татар отражен на рис. 17.
Рисунок 17. Распределение отклонений частот гаплотипов мтДНК (σ) от средних для
всего генофонда тоболо-иртышских татар
частот: в территориальных группах (а) и
в локальных популяциях (б);
n – число гаплотипов.
79
Распределения на рис. 17 правосторонние, т.е. в популяциях и группах
сибирских татар численно преобладают гаплотипы, частоты которых проявляют
невысокую изменчивость. Это обусловлено тем, что основное разнообразие
гаплотипов мтДНК – 61 из 98, как отмечалось выше – представлено «уникальными» последовательностями. Тем не менее, ряд гаплотипов, в том числе и наи-
более встречаемые в тотальной выборке тоболо-иртышских татар, проявляют
достаточно высокую изменчивость частоты от популяции к популяции и от тер-
риториальной группы к территориальной группе. Эти гаплотипы перечислены
в таблице 12, мерой для их отбора послужили оценки стандартного отклонения их частот от средних для тотальной выборки величин (σ).
Таблица 12. Гаплотипы мтДНК, проявляющие наиболее высокую изменчивость частоты в популяциях и территориальных группах тоболо-иртышских сибирских татар
Стандарт
Гаплотип ГВС I
362 *
134 356
309 318 *
093 129 172 223 266 311 357 390
148 223 288 298 327
182С 183С 189 217
051 129 140 166 183дел 188 189 213 217 274 335
182С 183С 189 232A 249 304 311 *
Гаплогруппа
Частота,
p
H
2,29
H
Изменчивость частоты
в группах
в популяциях
0 – 9,62
0 – 9,62
8,72
3,57 – 12,00
5,05
0 – 10,71
0 – 14,29
M10
2,75
0 – 9,62
0 – 9,62
B4
2,75
U4
U7
С
B4с
F1b
1,83
0 – 7,69
0 – 23,33
0 – 7,69
6,88
0 – 18,33
0 – 26,67
2,29
0 – 7,14
0 – 14,29
2,29
0 – 7,14
0 – 8,93
0 – 10,71
0 – 17,86
Примечание. Частота дана в %. p – средняя частота в изученной выборке тоболо-иртышских татар. Обозначения, маркирующие гаплотип ГВСI мтДНК, соответствуют приведенным в таблице 6.
* – обозначены гаплотипы, выявленные лишь в одной локальной популяции.
Из перечисленных в таблице 12 некоторые гаплотипы отмечены только
в одной локальной популяции с высокой 8–18 %, вероятно накопленной в данной деревне, частотой – это гаплотипы H (с транзицией в позиции 16362) и U7,
идентифицированные только в д. Ачиры, гаплотип F1b, выявленный в д. Тоболтура. Максимальная величина дисперсии частоты, как в локальных популяциях, так и в территориальных группах, обнаружена для гаплотипа группы C,
маркируемого транзицией в позиции 16148. Его частота изменяется в интер-
вале 0–18,33 % в группах, и 0–26,67 % в локальных популяциях, при средней
80
для тотальной выборки «тоболо-иртышские татары» – 6,88 %. Этот гаплотип
является особенно распространенным в группе тевризских татар, в изученных
деревнях этой группы он отмечается с частотами 10 и 27 %, д. Утузы и д. Саур-
гачи соответственно. Присутствие в генофонде с высокой частотой гаплотипа
M10 отличает группу заболотных, а гаплотипов U4 (с мутацией в позиции
16134), B4 (16182С\ 16183С\16189\16217) и B4c – группу тобольских татар
(табл. 11, рис. 16).
Таким образом, представленные в главе результаты анализа распределе-
ния монголоидных и европеоидных компонентов, основных гаплогрупп и гаплотипов мтДНК в генофондах локальных популяций и территориальных групп
тоболо-иртышских татар свидетельствует о высокой степени гетерогенности
изученного населения. Каков размах изменчивости мтДНК в генофонде тоболоиртышских татар на разных иерархических уровнях популяционной структуры
позволяет оценить анализ варианс частот гаплотипов, с учетом числа мутаций
между гаплотипами (AMOVA). Результаты этого анализа представлены в таблице 13, там же приведены оценки вклада различных компонентов популяционной структуры в межпопуляционное разнообразие народонаселения
Северной Азии, по данным о полиморфизме иммуно-биохимических генетических маркеров (Генофонд …, 2000). Кроме того, к сравнению могут быть
привлечены аналогичные данные о внутри- и межпопуляционной изменчивости
мтДНК у четырех сибирских народов – алтайцев, тувинцев, якутов и бурят (Голубенко и др., 2007).
К сожалению, провести строгое сравнение полученных в работе и при-
влеченных характеристик генетического разнообразия населения не представляется возможным, но сходство этих оценок, описывающих генофонды по
разным (в том числе и по способу наследования) генетическим системам, очевидно. Так, по данным о полиморфизме и митохондриальной ДНК, и иммуно-
биохимических генетических маркеров около 90 % генетического разнообразия
населения приходится на индивидуальную внутрипопуляционную изменчи-
вость: 92,87 % у тоболо-иртышских татар и 95,78 % у вышепечисленных че-
81
тырех сибирских народов (Голубенко и др., 2007) – по данным о разнообразии
мтДНК, 89,21–89,87 % у народов Северной Азии – по данным о разнообразии
классических генетических маркеров (Генофонд…, 2000).
Таблица 13. Вклад локальных популяций и территориальных групп в генетическое
разнообразие тоболо-иртышских сибирских татар по результатам анализа вариаций
частот гаплотипов мтДНК (AMOVA). Сравнительные данные о компонентах межпопуляционного генетического разнообразия народонаселения Северной Азии
Уровень общности
населения
Надэтнический
Этнический
Территориальные группы
Локальные популяции в группе
Внутрипопуляционный
Тотальный
Народонаселение
Северной Азии*
Доля вклада
Доля
в
разнообразие
(%)
Сумма ква- КомпоСтепень
вклада в
дратов от- ненты ваантропологи- лингвистичесвободы
разнообраклонений риансы
ческая клас- ская классизие (%)
сификация
фикация
Тоболо-иртышские татары
–
–
–
–
2,39
5,04
3
37,56
0,0619
1,85
1,68
1,62
3,1369
92,87
–
3
211
217
–
–
24,18
0,1779
723,631
3,3768
661,89
–
5,28
100
4,48
2,24
89,21
100
1,87
1,60
89,87
100
Примечание. Проверка уровня значимости величин вариансы, основанная на 1023 пермутациях гаплотипов
мтДНК между популяциями, показывает значимость полученных величин (P < 0.05), а также указывает на то,
что оценки для первых двух уровней общности (1,85 и 5,28 %) могут являться несколько завышенными, а варианса для внутрипопуляционного уровня общности напротив заниженной.
* – Приведены данные о компонентах межпопуляционного генетического разнообразия (GST), оцененных по
классическим иммуно-биохимическим маркерам, для народонаселения Северной Азии при различных классификациях его этнического разнообразия; приводится по: (Генофонд …, 2000, с. 56).
Оценка вклада межгрупповой генетической изменчивости в генетическое
разнообразие тоболо-иртышских татар (1,85 %) сближается с аналогичной сред-
ней величиной для североазиатских народов (1,62–1,68 %, табл. 13) и ожидаемо
(поскольку население Сибири отличается более высоким уровнем дифференциации (Генофонд…, 2000; 2003) превышает изменчивость мтДНК между эт-
нолингвистическими группами в европейском населении – 0,42 % (по данным
о населении Литвы, Kasperavičiūté et al., 2004; см. гл.. 1, табл. 2). Генетическая
дифференциация локальных популяций в пределах территориальных групп тоболо-иртышских татар представляется также достаточно высокой – доля вклада
в разнообразие этого уровня общности изучаемого населения вдвое превышает
соответствующую среднюю оценку для народов Северной Азии (5,28 % в срав-
82
нении с 1,6–2,24 %, табл. 13). При этом, следует отметить, что полученная ве-
личина – 5,28 % – представляется достаточно близкой к аналогичной субэтнической оценке вариации мтДНК у алтайцев – 3,78 % (Голубенко и др., 2007).
Проявляется ли генетическая гетерогенность территориальнолингвисти-
ческих групп тоболо-иртышских татар на фоне высокой межпопуляционной генетической изменчивости в пределах отдельной группы, и чем эта
гетерогенность может быть обусловлена? В какой-то мере приблизиться к
ответу на этот вопрос позволяют рассуждения, основанные на оценках соответствующих генетических расстояний. Генетические расстояния (Nei, 1985)
для различных пар популяций тоболо-иртышских татар приведены в табл.14.
Таблица 14. Попарные генетические расстояния для локальных популяций и территориальных групп тоболо-иртышских сибирских татар
0,608
1,454
0,116
0,466
0,421
д. Ачиры\ Заболотные
0,199
0,053
1,034
0,107
0,375
0,758
Тобольские
0,097
0,059
0,001
0,032
0,432
0,813
Сибирские татары суммарно 0,057
0,052
0,534
0,046
Тюменские
Тевризские
0,127
0,516
0,114
0,273
0,447
1,140
0,007
0,184
0,267
0,023
0,139
0,727
0,122
0,009
0,460
0,425
0,424
0,107
0,073
0,390
0,002
0,516
0,097
Тевризские
0,856
1,041
Тобольские
0,152
0,577
Тюменские
д. Саургачи
0,391
0,076
д. Ачиры\ Заболотные
д. Утузы
0,486
д. Саургачи
0,071
0,416
д. Утузы
д. Кутарбитка
д. Тоболтура
д. Кутарбитка
0,019
д. Тоболтура
д. Варвара
д. Варвара
д. Юртобор
Популяции и группы
0,175
Примечание. Все значения расстояния значимы при P < 0.05, за исключением выделенных подчеркиванием.
Жирным шрифтом выделены генетические расстояния между территориальными группами тоболо-иртышских татар.
Усредненная оценка расстояния (d) между локальными популяциями в
пределах отдельной группы (0,339 +/– 0,235) ниже, чем среднее d между попу-
ляциями из разных территориальных групп (0,481 +/– 0,393). Ввиду отсутствия
достоверных различий приводимых средних, в данном случае можно говорить
83
лишь о наблюдаемой тенденции к обособлению территориальных групп. Тем не
менее, полученный результат позволяет ожидать совпадений границ районирования митохондриального генофонда и расселения территориально-лингвистических групп тоболо-иртышских татар с увеличением числа изученных
локальных популяций.
Межгрупповые генетические расстояния (табл. 14) отражают относи-
тельную степень близости\удаленности генофондов территориальных групп
тоболо-иртышских татар. Здесь следует отметить следующее. Во-первых, на-
блюдается тесная близость тобольских и тюменских сибирских татар: для этой
пары территориальных групп обнаружено минимальное, на порядок величины
более низкое в ряду сравниваемых значений, генетическое расстояние (d =
0,073). Во-вторых, наблюдается некоторая дистанцированность тевризских
татар: эта группа обнаруживает максимальные генетические расстояния до дру-
гих территориальных групп, и максимально удалена от обобщенной выборки
«тоболо-иртышские татары» (d = 0,175). И, в-третьих, среди рассматриваемых
территориальных групп тоболо-иртышских татар обнаруживается группа, ге-
нофонд которой в высокой степени сходен с генофондом тоболо-иртышских
татар, рассматриваемых в целом – это тюменские татары, которые обнаружи-
вают крайне низкое, близкое к нулю, и не значимое (P>0.05) расстояние (d =
0,002) до обобщенной выборки сибирских татар, и по отношению к которым все
остальные группы – заболотные, тевризские и, в особенности, тобольские, татары проявляют наибольшее генетическое сходство (или наименьшее генетическое расстояние) (табл. 14).
Такое состояние генофонда тюменских татар, когда отдельная группа об-
ладает усредненными для населения региона (в данном случае бассейна Тобола
и Иртыша) генетическими характеристиками, можно объяснить историческим
наследием, последствием формирования в XIV в. Тюменского ханства, с цен-
тром на месте современной Тюмени. В этом случае центр формирования государства может являться центром притяжения и смешения различных входящих
в государство групп населения. Тесная генетическая связь между тюменскими
84
и тобольскими татарами может быть следствием географической близости их
этнических ареалов (см. рис. 4 и 6, врезка), но эта же связь отмечается и в эт-
нографических исследованиях – по наличию общих этнических компонентов,
вошедших в состав этих групп в XVI–XIX вв. (Томилов, 1981).
Таким образом, по результатам анализа полиморфизма мтДНК становится
очевидным, что тоболо-иртышские татары обладают высоким в масштабах на-
селения Северной Азии генетическим разнообразием как внутри-, так и межпопуляционным. Учитывая изложенную в работе логику и полученные в работе
результаты, свидетельствующие о том, что генофонд рассматриваемого населения сложился преимущественно на основе «угорского» и «тюркского» компонентов, логично было бы предположить, что за высоким межгрупповым
разнообразием может стоять разная степень выраженности вышеуказанных генетических компонентов в различных территориальных группах тоболо-ир-
тышских татар. Попытаться ответить на этот вопрос можно, оценив степень
генетической взаимосвязи изученных групп тоболо-иртышских татар с наро-
дами Северной Евразии. Мерой такой взаимосвязи послужили соответствующие генетические расстояния.
Величины генетических расстояний приведены в таблице 15, жирным
шрифтом выделены минимальные для каждой группы татар величины – это
расстояния до семи из ряда привлеченных к сравнению народов. Указанное
ограничение – семь популяций – выбрано произвольно, исходя из принципа максимального различия пулов североевразийских народов близких к разным тер-
риториальным группам тоболо-иртышских татар. Из данных табл. 15 очевидно,
что все без исключения группы тоболо-иртышских татар тесно сближаются с
башкирами, ханты и манси. Согласно величинам генетических расстояний, все
группы сибирских татар, за исключением тевризской, оказываются близки с
коми. Обособленность тевризских татар в ряду рассматриваемых групп насе-
ления Тоболо-Иртышского междуречья проявляется также в тесном их сближении с тюркоязычными народами Южной Сибири – хакасами, тувинцами и
алтайцами. В митохондриальном генофонде тобольских татар выражено влия-
85
ние восточноевропейского населения, это отражается в низких величинах ге-
нетических расстояний до русских и мордвы. По-разному выглядит сближение
различных групп сибирских татар с тюркоязычными среднеазиатскими народами: заболотные татары характеризуются наиболее низким генетическим рас-
стоянием по отношению к узбекам и уйгурам, тобольские – к казахам,
тевризские – к туркменам. Обладающая, как описано выше, усредненными для
изученного тоболо-иртышского населения характеристиками митохондриального генофонда тюменская группа тесно сближается фактически с каждым из
вышеперечисленных среднеазиатских народов – это казахи, уйгуры и туркмены
(табл. 15).
Таблица 15. Генетические расстояния (d) между территориальными группами тоболоиртышских татар и некоторыми народами Северной Евразии
Народы
Северной Евразии
Русские
Мордва
Мари
Коми
Удмурты
Татары
Башкиры
Чуваши
Манси
Ханты
Кеты
Энцы/Нганасаны
Эвенки
Якуты
Буряты
Хакасы
Тувинцы
Алтайцы
Казахи
Киргизы
Туркмены
Узбеки
Уйгуры
Монголы
Китайцы хань
Заболотные
0,232
0,238
0,249
0,190
0,268
0,191
0,155
0,162
0,169
0,172
0,425
0,548
1,045
0,745
0,622
0,415
0,688
0,290
0,211
0,226
0,191
0,110
0,128
0,263
0,411
Тоболо-иртышские татары
Тюменские
Тобольские
Тевризские
0,291
0,434
0,696
0,151
0,161
0,194
0,118
0,211
0,150
0,102
0,149
0,135
0,146
0,214
0,523
1,143
0,869
0,701
0,335
0,733
0,283
0,091
0,234
0,122
0,152
0,105
0,274
0,290
0,229
0,348
0,316
0,373
0,340
0,294
0,331
0,247
0,326
0,364
0,730
1,414
1,179
1,031
0,544
0,993
0,540
0,316
0,518
0,354
0,469
0,363
0,546
0,434
0,418
0,442
0,337
0,424
0,350
0,231
0,431
0,266
0,290
0,640
0,347
0,494
0,444
0,403
0,243
0,272
0,274
0,312
0,313
0,281
0,340
0,435
0,360
Примечание. Жирным шрифтом отмечены семь наиболее низких величин генетических расстояний до каждой группы тоболо-иртышских татар, пояснения даны в тексте.
86
Интегральная характеристика положения генофондов групп тоболо-ир-
тышских татар среди генофондов народов Северной Евразии представлена на
рис. 18. На дендрограмме генетических взаимоотношений популяций выде-
ляются следующие группы: 1) кластер приуральских народов с примыкающей
к нему ветвью обских угров (ханты и манси); 2) тесный кластер народов Средней Азии и сближающиеся с ним башкиры, алтайцы и монголы, хакасы; 3) кластер, включающий в себя народы Восточной и Южной Сибири (эвенки, якуты,
буряты и тувинцы).
Рисунок 18. Дендрограмма генетических взаимоотношений популяций, построенная на основе генетических
дистанций d методом UPGMA.
87
Группы тоболо-иртышских татар в описанной схеме занимают следую-
щее положение. Заболотные татары входят в первую из перечисленных групп,
т.е. особенно сближаются с угорскими народами Западной Сибири и населением Приуралья. С этой же группой народов сближаются тюменские и то-
больские татары, но при этом занимают промежуточное положение между
кластером приуральско-западносибирских народов и кластером народов Сред-
ней Азии и Южной Сибири. Тевризские татары достаточно дистанцируются от
других групп тоболо-иртышских татар и в наибольшей мере сближаются с
пулом тюркоязычных народов Средней Азии и Южной Сибири.
Рассмотренные особенности генетических взаимосвязей различных групп
тоболо-иртышских татар и народов Северной Евразии позволяют сделать не-
сколько заключений. Во-первых, общей составляющей генофондов различных
территориальных групп тоболо-иртышских татар, в первую очередь, является
финно-угорский генетический компонент, а скорее «угорский», учитывая осо-
бенное сближение всех групп тоболо-иртышских татар с ханты и манси. Вовторых, межгрупповая генетическая изменчивость тоболо-иртышских татар
может быть обусловлена разной степенью выраженности «угорского» и «тюркского» генетических компонентов в генофондах различных территориальных
групп тоболо-иртышских татар, что находит свое отражение в положении этих
групп на филогенетическом древе североевразийских популяций. И, в-третьих,
эта же изменчивость может быть обусловлена гетерогенностью собственно
тюркоязычного населения, внесшего свой вклад в формирование генетического
разнообразия различных территориально-лингвистических групп тоболо-иртышских татар.
Следует отметить, что сделанное заключение, в особенности относи-
тельно высокой роли соотношения угорского и тюркского компонентов в формировании разнообразия территориальных групп тоболо-иртышских татар, в
высокой степени воспроизводит результаты этнографических исследований
истории тюркоязычного населения бассейна Тобола и Иртыша (Томилов, 1981).
88
ЗАКЛЮЧЕНИЕ
Территории юга Западной Сибири с древнейших времен являлись зоной
трансгрессии различных по культурному укладу и по своему облику групп на-
селения – таежных западносибирских племен и степных номадов, представителей традиционных сибирских культур и средне- и центральноазиатских
государственных формирований. В результате таких взаимодействий в степной
и лесостепной зонах средневековой Западной Сибири сложилась тюркоязычная этническая общность сибирские татары. В этом контексте изучение гене-
тического разнообразия сибирских татар представляет интерес для
исследований генетических явлений, сопутствующих взаимодействиям народов с разными хозяйственно-культурными укладами и разным уровнем соци-
ально-экономического развития – таежных популяций Северной Азии и
цивилизаций Средней Азии. С позиций этнографических исследований этно-
генез сибирских татар видится как пример смешения угорских, самодийских,
тюркских и отчасти монгольских племен и народов. Эти компоненты в различных соотношениях присущи множеству народов Северной Евразии, поэтому
исследование генофонда сибирских татар представляется значимым для ана-
лиза генетической структуры и генетической истории населения всего североевразийского региона.
В картине изученности генофонда коренного народонаселения Северной
Евразии сибирские татары относятся к той группе, о генетическом разнообра-
зии которой существуют лишь немногочисленные разрозненные данные. Поэтому можно сказать, что эта работа открывает тему исследования генетического
разнообразия и генетической истории сибирских татар. В работе изучалось ге-
нетическое разнообразие в этнолингвистических подгруппах и локальных популяциях тоболо-иртышских татар. Эта группа самая крупная, представлена
наибольшим числом этнолингвистических подгрупп. Она занимает географи-
чески центральное место в этническом ареале сибирских татар, а икже исторически центральное место в консолидации тюркских групп Западной Сибири
в этническую общность «сибирские татары»: в прошлом население Тоболо-Ир-
89
тышского междуречья представляло собой основу населения южносибирских
тюркских государственных формирований – Тюменского и Сибирского ханств.
Всего в работе обследовано 218 сельских жителей из семи татарских де-
ревень в ареалах расселения заболотных, тюменских, тобольских и тевризских
татар.
Объектом исследования являлось разнообразие мтДНК, как системы в
высокой степени информативной для реконструкции филогеографии генетиче-
ских линий в группах населения. В работе приводятся данные о структуре индивидуальных гаплотипов мтДНК у тоболо-иртышских сибирских татар,
идентифицированных по результатам анализа полиморфизма сайтов рестрик-
ции, диагностических для евразийских гаплогрупп мтДНК, и нуклеотидной последовательности ГВСI. На общей выборке 218 человек выявлено 98 таких
гаплотипов. На основании данных об изменчивости нуклеотидной последова-
тельности ГВСI и/или рестрикционного полиморфизма мтДНК установлено,
что гаплотипы принадлежат к 17 монофилетическим линиям мтДНК или гаплогруппам. Т.е. в генофонде тоболо-иртышских татар, за редким исключением,
представлены все идентифицированные в популяциях Северной Евразии гаплогруппы мтДНК как восточноевразийские (монголоидные) – A, B, F, M7, M10,
C, D и G, так и западноевразийские (европеоидные) – N1, H, V, J, T, U, K, I и W.
Согласно соотношению частот этих двух больших классов гаплогрупп 1:1.5,
митохондриальный генофонд тоболо-иртышских татар в высокой степени смешанный. По показателю «соотношение расовых компонентов в генофонде» изученная группа органично располагается в ряду народов, принадлежащих к
западно- и южносибирскому антропологическим типам, в генофондах которых
столь же ярко проявляются процессы метисации.
Рассмотрение в отдельности европеоидного и монголоидного компонен-
тов в составе генофондов североевразийских народов показало достаточно вы-
раженную дифференцированность последнего на северный (североазиатский)
и южный (центральноазиатский) кластеры. В составе европеоидного компонента слабо, но выделяются финно-угорский, тюркские сибирский и среднеа-
90
зиатский кластеры. Положение тоболо-иртышских татар в этой картине свидетельствует о том, что обнаруженная в этой группе европеоидная составляющая
разнообразия мтДНК особенно сближается с соответствующей составляющей
генофондов финно-угорских народов Приуралья и Западной Сибири. Монго-
лоидные линии мтДНК у сибирских татар в большей мере сближаются с таковыми у группы средне-центральноазиатских преимущественно тюркоязычных
народов.
Эти же направления межэтнических взаимосвязей реконструируются и
из результатов подробного анализа филогеографии выявленных у сибирских
татар гаплогрупп и индивидуальных последовательностей мтДНК в евразийском населении. Результаты этого анализа показали, что профиль распределе-
ния гаплогрупп мтДНК в генофонде сибирских татар наиболее сходен с
таковым у обских угров (ханты и манси); в особенности это касается наиболее
распространенных кластеров, суммарная частота которых у сибирских татар
составляет свыше 70%, – это гаплогруппы C, D, H, T и U. Некоторые общие
для сибирских татар и обских угров, и специфичные для последних, гаплотипы
оказались в качестве узловых на филогенетическом древе гаплотипов мтДНК
тоболо-иртышских татар. Сходство сибирских татар с тюркскими группами Сибири и Средней Азии наиболее ярко проявилось в распределении гаплогрупп
восточноазиатского происхождения – B и F. Тот факт, что филогенетически бли-
жайшие выявленным гаплотипы кластеров В и F идентифицируются сегодня
не в Сибирско-Среднеазиатском регионе, а в Китае предположительно связы-
вает их появление в генофонде тоболо-иртышских татар с древними тюрками.
Появление в генофонде сибирских татар гаплотипов, принадлежащих кластерам U2, U3 и U7, учитывая современное их распространение в населении Ев-
разии, следует признать следствием совокупного влияния степных номадов
(ирано- и тюркоязычных племен, на протяжении многих веков населявших североевразийские степи) на изученную группу населения Западной Сибири.
Реконструированное на основе межэтнических генетических расстояний
положение митохондриального генофонда тоболо-иртышских сибирских татар
91
в современном этногенетическом пространстве Северной Евразии характеризуется как промежуточное между западносибирскими угорскими народами
(манси и ханты), среднеазиатскими (туркмены, узбеки, казахи и уйгуры) и
приуральскими (чуваши и татары) тюркскими народами. При этом степень ге-
нетической близости до каждой из перечисленных групп ранжируется в порядке убывания следующим образом: угры Западной Сибири→тюрки Средней
Азии→тюрки Волго-Уральского региона. По данным о разнообразии мтДНК
тоболо-иртышские татары особенно сближаются с тюркоязычными народами,
в формировании которых предполагается значимое участие тюркской кыпчакской общности, достаточно дистанцируются сибирские татары от народов, в
том числе и тюркоязычных, Южной и Восточной Сибири, монголов и самодийской группы. При этом следует отметить, что вес самодийского населения
Западной Сибири в формировании генетического разнообразия тоболо-ир-
тышских татар может быть недооценен, поскольку это население в работе пред-
ставлено лишь северной группой энцы/нганасаны. Картина может измениться
при вовлечении в анализ ныне слабоизученных селькупов.
Выявленная многокомпонентность митохондриального генофонда то-
боло-иртышских татар проявилась в высоком уровне разнообразия мтДНК этой
группы населения. Как показано в работе, все показатели разнообразия – распределение частот гаплотипов в популяции, среднее число нуклеотидных раз-
личий между гаплотипами, и, наконец, интегральный показатель разнообразия
индивидуальных гаплотипов мтДНК в популяции – сближаются с верхней гра-
ницей интервала соответствующих оценок для тюркоязычных народов различ-
ных регионов Северной Евразии – Волго-Уральского региона, Южной Сибири
и Средней Азии.
Высокий уровень тотального разнообразия мтДНК у тоболо-иртышских
татар включает в себя высокую межпопуляционную изменчивость. В работе
был оценен вклад в общее разнообразие различных уровней общности изучае-
мого населения – локальных популяций и этнолингвистических (диалектных)
групп тоболо-иртышских татар. Согласно полученным данным в тотальном раз-
92
нообразии мтДНК тоболо-иртышских татар 92,87 % приходится на долю внутрипопуляционного полиморфизма, 5,28 % – на долю межпопуляционного разнообразия в территориальных группах, и 1,85 % – это вклад межгрупповых
различий в генетическую дифференциацию тоболо-иртышских татар. Оценки,
полученные из данных о разнообразии мтДНК и для тюркского населения То-
боло-Иртышского междуречья, в целом оказались хорошо соотносимыми со
средними аналогичными оценками для высокодифференцированного населения Северной Азии, известными по данным о полиморфизме иммуно-биохимических генетических маркеров.
Освещенное в этнографических исследованиях положение о том, что раз-
нообразие этнолингвистических групп сибирских татар обусловлено различными межэтническими взаимосвязями и разноэтническими компонентами,
вошедшими в состав этих групп, находит свое подтверждение и в генетических
данных. Рассмотрение на основе генетических дистанций степени генетиче-
ской близости\удаленности этнолингвистических групп тоболо-иртышских
татар – тюменских, тобольских, заболотных и тевризских – между собой и с
другими народами Северной Евразии позволило выявить следующее. Прежде
всего, отмечается некоторая обособленность тевризских татар в ряду рассматриваемых групп населения Тоболо-Иртышского междуречья, причиной которой видится особенное их сближение с тюркоязычными народами Южной
Сибири – хакасами, тувинцами и алтайцами. В митохондриальном генофонде
тобольских татар выражено влияние восточноевропейского населения, что отражается в низких величинах генетических расстояний до русских и мордвы.
По-разному выглядит сближение различных групп сибирских татар с тюркоязычными среднеазиатскими народами: заболотные татары характеризуются
наиболее низким генетическим расстоянием по отношению к узбекам и уйгурам, тобольские – к казахам, тевризские – к туркменам.
Примечательно выявленное положение тюменских татар, с которыми осо-
бенно сближаются все остальные рассматриваемые этнолингвистические
группы, и митохондриальный генофонд которых в особенной степени сходен с
93
обобщенным, рассматриваемым недифференцировано генофондом тоболо-иртышских татар. Такое, состояние генофонда тюменских татар, когда отдельная
группа обладает усредненными для населения региона (в данном случае бассейна Тобола и Иртыша) генетическими характеристиками, может быть отча-
сти объяснено историческим наследием, последствием формирования в XIV в.
Тюменского ханства, с центром на месте современной Тюмени. В этом случае
центр формирования государства, по-видимому, мог являться центром притя-
жения и смешения различных входящих в государство групп населения. При
вышеописанных различиях, все без исключения рассматриваемые группы то-
боло-иртышских татар оказались близки к обским уграм (ханты и манси), т.е.
наиболее выраженной общей составляющей генофондов различных территориальных групп тоболо-иртышских татар представляется «угорский» субстратный компонент.
В целом результаты работы свидетельствуют о том, что по данным о раз-
нообразии мтДНК основной вклад в формирование генофонда тоболо-иртыш-
ских сибирских татар принадлежит угорскому генетическому компоненту,
достаточно выраженным представляется генетический вклад тюркских (и в
большей мере, по-видимому, кыпчакских), а менее весомым представляется
вклад самодийских и монгольских племен и народов. При этом, межгрупповая
генетическая изменчивость тоболо-иртышских татар, по-видимому, может быть
отчасти обусловлена разной степенью выраженности «угорского» и «тюркского» генетических компонентов в генофондах различных этнолингвистических групп, а отчасти – гетерогенностью собственно тюркоязычного населения,
внесшего свой вклад в формирование генетического разнообразия различных
территориально-лингвистических групп тоболо-иртышских татар.
Основные результаты исследования разнообразия мтДНК у тоболо-ир-
тышских татар отражены в сделанных на его основе выводах.
94
ВЫВОДЫ
1. Генофонд тоболо-иртышских сибирских татар включает в себя гаплотипы
как монголоидных, так и европеоидных гаплогрупп мтДНК в соотноше-
нии 1:1,5, т.е. является в высокой степени смешанным. При этом степень
метисации митохондриального генофонда тоболо-иртышских татар
сходна с таковой у угорских народов Западной Сибири и тюркских народов Средней Азии.
2. Пул гаплотипов мтДНК, принадлежащих европеоидным гаплогруппам,
особенно сближается с таковым у финно-угорских народов Приуралья и
Западной Сибири, а гаплотипы монголоидных гаплогрупп – с соответ-
ствующим пулом линий мтДНК у тюркоязычных народов Южной Сибири
и, в особенности, Средней Азии.
3. Генофонд тоболо-иртышских татар характеризуется высоким уровнем
разнообразия мтДНК в сравнении с генофондами других, в том числе и
тюркоязычных, народов Северной Евразии. И это разнообразие включает
в себя высокую как внутри- так и межпопуляционную изменчивость
мтДНК.
4. Разнообразие мтДНК тоболо-иртышских татар сформировалось преиму-
щественно на основе угорского, характерного обским уграм, и тюркского,
в наибольшей мере кыпчакского, генетических компонентов.
5. Межгрупповая генетическая изменчивость тоболо-иртышских татар обу-
словлена разной степенью выраженности угорского и тюркского компонентов,
а
также
генетической
гетерогенностью
собственно
тюркоязычного населения, внесшего свой вклад в формирование различных территориально-лингвистических групп тоболо-иртышских татар.
95
СПИСОК ЛИТЕРАТУРЫ
1. Алексеев В.П., Гохман И.И. Антропология азиатской части СССР. М.: Наука,
1984. 208 с.
2. Багашёв А.Н. Новые материалы к антропологии неолитического населения
Западной Сибири // Горизонты Антропологии. Труды международной научной
конференции памяти академика В.П. Алексеева. М.: Наука, 2003. С. 438–443.
3. Багашёв А.Н. Палеоантропология Западной Сибири: лесостепь в эпоху раннего железа. Новосибирск: Наука, 2000. 374 с.
4. Багашёв А.Н. Этническая антропология тоболо-иртышских татар. Новосибирск: ВО «Наука». Сибирская издательская фирма, 1993. 152 с.
5. Батсуурь Ж. Наследственный полиморфизм и геногеография народонаселения Монголии: Дисс. ... д.б.н. М., 1986, 284 с.
6. Батсуурь Ж., Самбуугийн Н., Шнейдер Ю.В. и др. Генетическая структура
монголов по данным о генах локусов AB0, MN, RH, HP, Gc, Tf, C’3, ChE, GLO,
EsD, PGM, ACP, 6-PGD // Генетика. 1991. Т. 26. С. 316–321.
7. Батырова А.А. Анализ полиморфизма ДНК ядерного и митохондриального
геномов в популяциях Среднее Азии // Автореф. дисс. … кбн. Уфа, 2004. 22 с.
8. Бермишева М.А. Генофонд народов Волго-Уральского региона по данным о
полиморфизме митохондриальной ДНК и Y-хромосомы: Дисс. … кбн. Уфа,
2001. 191 с.
9. Бермишева М., Тамбетс К., Виллемс Р., Хуснутдинова Э.К. Разнообразие гаплогрупп митохондриальной ДНК у народов Волго-Уральского региона России
// Мол. биол. 2002. Т. 36. С. 990–1001.
10. Валеев Ф.Т. Алтайские этнические элементы у западносибирских татар //
Этнография народов Алтая и Западной Сибири. Новосибирск, 1978.
11. Гаузе Г. Г. Митохондриальная ДНК. М., 1977. 288 с.
12. Генофонд и геногеография народонаселения Т.I. Генофонд населения России и сопредельных стран / под. ред. Ю.Г. Рычкова. СПб.: Наука, 2000. 612 с.
13. Генофонд и геногеография народонаселения Т.II. Геногеографический атлас
населения России и сопредельных стран / под. ред. Ю.Г. Рычкова. СПб.: Наука,
2003. 672 с.
96
14. Гинзбург В.В., Трофимова Т.А. Палеоантропология Средней Азии. М.: Наука,
1972. 371 с.
15. Грехова Д.В., Балановская Е.В., Рычков Ю.Г. Разработка технологии создания компьютерных региональных атласов: поздний палеолит Северной Евразии
// Гуманитарная наука в России: Соросовские лауреаты, 1996.
Т. 2. С. 286–304.
16. Голубенко М.В., Буйкин С.В., Еремина Е.Р. и др. Характеристика митохондриального генофонда популяций коренных народов Сибири // Генетика человека и патология \ Под ред. В.П. Пузырева. Томск:«Печатная мануфактура»,
2007. С. 5–10.
17. Губина М.А., Осипова Л.П., Виллемс Р. и др. Анализ материнского генофонда
по полиморфизму мтДНК в популяциях хантов и коми Шурышкарского района
ЯНАО // Коренное население Шурышкарского района ЯНАО: демографические, генетические и медицинские аспекты. Новосибирск: ИПП «ART-AVENUE», 2005. 200 с.
18. Гумилев Л.Н. Хунну: Срединная Азия в древние времена. М.: Издательство
восточной литературы, 1960. 291 с.
19. Дербенева О.А. Анализ изменчивости мтДНК коренных жителей нижней
Оби и Енисея // дис. ... кбн. Новосибирск: Институт цитологии и генетики СО
РАН, 2002. 99 с.
20. Деренко М.В. Изменчивость митохондриальной ДНК у коряков, эвенов и
якутов // дис. ... кбн. Магадан: Институт биологических проблем Севера СО
РАН, 1997. 147 с.
21. Деренко М.В., Дамбуева И.К., Малярчук Б.А. и др. Структура и разнообразие митохондриального генофонда коренного населения Тувы и Бурятии по данным о рестрикционном полиморфизме // Генетика. 1999. Т. 35. С. 1706–1712.
22. Деренко М.В., Шилдс Дж. Ф. Полиморфизм региона V митохондриальной
ДНК в популяциях коренных жителей Северной Азии // Генетика. 1998. Т. 34.
С. 411–415.
23. Деренко М.В. Лункина А.В., Малярчук Б.А. и др. Рестрикционный полиморфизм митохондриальной ДНК у корейцев и монголов \\ Генетика. 2004. Т. 40. С.
1562–1570.
97
24. Деренко М.В., Малярчук Б.А., Денисова Г.А. и др. Молекулярно-генетическая дифференциация этнических групп Южной и Восточной Сибири по данным о полиморфизме митохондриальной ДНК // Генетика. 2002. Т. 38. С.
1409–1416.
25. Деренко М.В., Денисова Г.А., Малярчук Б.А. и др. Структура генофондов этнических групп Алтае-Саянского нагорья по данным о полиморфизме митохондриальной ДНК // Генетика. 2002. Т. 38. С. 1409–1416.
26. Евсюков А. Н., Наумова О. Ю., Рычков С. Ю. Компьютерный подход к изучению нуклеиновых кислот // Генетика. 1996. Т. 32. С. 1417–1420.
27. Еремина Е.П. Полиморфизм ДНК у коренного населения республики Бурятия и женщин буряток с аномальным течением беременности // Автореф. дисс.
... кмн. Томск, 1999. 24 с.
28. Закиев М. З. Татары: проблемы истории и языка. Казань, 1995 г.
29. Иванова А.В. Полиморфизм митохондриальной ДНК в популяциях коренных
жителей Чукотки // Автореф. дис... кбн. Новосибирск: ИЦиГ СО РАН, 1993. 16 с.
30. Иванова А.В., Воевода М.И., Казаковцева М.А. и др. Рестикционно-делеционный полиморфизм региона V митохондриальной ДНК в нескольких популяциях коренного населения Сибири и Дальнего Востока // Генетика. 1994. Т.
30. С. 1525–1529.
31. Казаковцева М. А., Воевода М.И., Осипова Л.П. Полиморфизм митохондриальной ДНК у северных селькупов // Генетика. 1998. Т. 34. С. 416–422.
32. Лебедева И.А., Шереметьева В.А., Куликов Е.Е., Полтараус А.Б. Митохондриальный портрет восточных эвенков. Анализ ДНК-полиморфизма по коллекционным материалам волос любого срока хранения // 3-й конгресс
этнографов и антропологов России: Тез. докл. М., 1999. С. 109.
33. Лункина А.В. Денисова Г.А., Деренко М.В., Малярчук Б.А. Изменчивость митохондриальной ДНК в двух популяциях русского населения Новгородской области // Генетика. 2004. Т. 40. С. 975–980.
34. Малярчук Б.А. Изменчивость митохондриального генома человека и генетическая история славян: Дисс. … д.б.н. Москва, 2003. 480 с.
98
35. Малярчук Б.А., Деренко М.В. Полиморфизм региона V митохондриальной
ДНК у коренного и пришлого населения Северо-Восточной Азии // Генетика.
1995. Т. 31.1308–1313.
36. Малярчук Б.А., Деренко М.В., Соловенчук Л.Л. Рестрикционные типы главной некодирующей области митохондриальной ДНК у коренного и пришлого
населения Северо-Восточной Азии // Генетика. 1994. Т. 30. С. 851–857.
37. Маниатис Т., Фрич Э., Сэмбрук Дж. Молекулярное клонирование. М.: Мир,
1984. 479 с.
38. Миллер Г.Ф. История Сибири. Том I. М.:Восточная литература РАН, 1999.
630 с.
39. Минченко А.Г., Дударева Н.А. Митохондриальный геном. Новосибирск:
Наука, 1990. 192 с.
40. Морозова И.Ю. Полиморфизм митохондриальной ДНК у русских европейской части России: Дисс. … кбн. Москва, 2007. 147 с.
41. Морозова И.Ю. Наумова О.Ю., Рычков С.Ю., Жукова О.В. Полиморфизм
митохондриальной ДНК в русском населении пяти областей европейской части
России // Генетика. 2005. Т.41. 1265–1271.
42. Народы Западной и Средней Сибири. Культура и этнические процессы. Новосибирск: Наука, 2002. 325 с.
43. Народы мира. Историко-этнографический справочник / Под ред.
Ю.В. Бромлея М.: Советская энциклопедия, 1988. 624 с.
44. Наумова О.Ю., Рычков С.Ю., Хаят С.Ш. и др. Полиморфизм митохондриальной ДНК у казымских ханты // Генетика. 2008. (в печати).
45. Пузырев В.П., Степанов В.А., Голубенко М.В. Линии мтДНК и Y-хромосомы
в популяции якутов // Генетика. 2003. Т. 39. С. 975–981.
46. Пузырев В.П., Эрдыниева Л.С., Кучер А.Н., Назаренко Л.П. Генетико-эпидемиологическое исследование населения Тувы. Гл. 5. Наследственный полиморфизм тувинцев. Томск: STT, 1999. С. 110–184.
47. Рыбчин В.Н. Основы генетической инженерии. СПб.: Издательство
СПбГТУ, 1999. 521 с.
99
48. Сайкс Р. Семь дочерей Евы. М.: Рипол классик, 2003. 303 с.
49. Салюков В.Б., Пузырев В.П., Голубенко М.В. и др. Полиморфизм некодирующих областей митохондриального генома у коренного населения юго-востока Тувы // Генетика. 1998. Т. 34. С. 1420–1424.
50. Стариковская Е.Б. Изменчивость митохондриальных ДНК коренных жителей Чукотки в связи с генетической историей древней Берингии // Дис. …
к.б.н. Новосибирск, 1999. 85 с.
51. Сукерник Р.И., Щур Т.Г., Стариковская Е.Б. и др., Изменчивость митохондриальной ДНК у коренных жителей Сибири в связи с рекострукцией эволюционной истории американских индейцев. Рестрикционный полиморфизм //
Генетика. 1996. Т. 32. 432–439.
52. Татары. Научное пособие / под ред. Уразмановой Р.К., Чешко С.В. М.: Наука,
2001.
53. Томилов Н.А. Тюркоязычное население Западно-Сибирской равнины в конце
XVI – первой четверти XIX вв. Томск: Издательство томского университета,
1981. 275 с.
54. Тумашева Д. Г. Диалекты сибирских татар в отношении к татарскому и другим тюркским языкам \\ Автореф. дисс. … дфн. М., 1969. 49 с.
55. Тумашева Д.Г., Ахметова Ф.В. Этнические группы сибирских татар по языковым и фольклорным данным // С. 12–25.
55. Тюркские народы Сибири. М.: Наука, 2006. 678 с.
57. Файзрахманов Г.Л. История сибирских татар (с древнейших времен до начала XX века). Казань, Изд-во «Фэн», 2002. 488 с.
58. Харьков В.Н. Структура линий Y-хромосомы в популяциях Сибири \\ Автореф. … кбн. Томск, 2005. 23 с.
59. Чикишева Т.А. К вопросу об антропологическом составе населения южных
районов Западной Сибири в эпохи неолита и бронзы // Горизонты Антропологии. Труды международной научной конференции памяти академика В.П. Алексеева. М.: Наука, 2003. С. 430–437.
60. Anderson S., Bankier A. T., Barrell B.G. et al. Sequence and organization of the
human mitochondrial genome // Nature. 1981. V. 290. P. 457–465.
100
61. Avadalla P., Eyre-Walker A., Smith J.M. Linkage disequilibrium and recombination in hominid mitochondrial DNA // Science. 1999. V. 286. P. 2524–2525.
62. Ballinger S.W., Shurr T.G., Torroni A., et al. Southeast Asian mitochondrial DNA
analysis reveals genetic continuity of ancient mongoloid migrations // Genetics. 1992.
V. 130. P. 139-152.
63. Bandelt H.J., Forster P., Sykes B.C., Richards M.B. Mitochondrial portraits of
human populations using median networks // Genetics. 1995. V. 141. P. 743–753.
64. Bermisheva M.A., Kutuev I.A., Korshunova T.Yu. et al. Phylogeographic analysis of mitochondrial DNA in Nogays: a strong mixture of maternal lineages from Eastern and Western Eurasia // Mol. Biol. 2004. V. 38. P. 317–624.
65. Brown W.M. Polymorphism in mitochondrial DNA of humans as revealed by restriction endonuclease analysis // Proc. Natl. Acad. Sci. USA. 1980. V. 77. P. 3605–
3609.
66. Brown W.M., George M. Jr., Wilson A.C. Rapid evolution of animal mitochondrial
DNA // Proc. Natl. Acad. Sci. USA. 1979. V. 76. P. 1967–1971.
67. Brown W.M., Prager E. M., Wang A., Wilson A. C. Mitochondrial DNA sequences of primates: tempo and mode of evolution // J. Mol. Evol. 1982. Vol. 18. P. 225.
68. Cann R.L., Stoneking M., Wilson A.C. Mitochondrial DNA and human evolution
// Nature. 1987. V. 325. P. 31-36.
69. Chen Yu-S. Torroni A., Excoffer L. et al. Analysis of mtDNA variation in African
populations reveals the most ancient of all human continent-specific haplogroups //
Am. J. Hum. Genet. 1995. V. 57. P. 133–148.
70. Comas D., Calafell F., Mateu E. et al. Trading genes along the Silk Road: mtDNA
sequences and origin of Central Asian populations // Am. J. Hum. Genet. 1998. V. 63.
P. 1824–1838.
71. Comas D., Plaza S., Wells R.S. et al. Admixture, migration and dispersals in Central Asia: evidence from maternal DNA lineages \\ Eur. J. Hum. Genet. 2004. V. 12.
P. 495–504.
72. Derbeneva O.A., Starikovskaya E.B., Volodko N. V. et al. Mitochondrial DNA variation in the Kets and Nganasans and its implications for the initial peopling of Northern Eurasia // Rus. J. Genetics. 2002. V. 38. P. 1316–1321.
101
73. Derbeneva O.A , Starikovskaya E.B., Wallace D.C., Sukernik R. I. Traces of Early
Eurasians in the Mansi of Northwest Siberia Revealed by Mitochondrial DNA Analysis // Am. J. Hum. Genet. 2002. V. 70. P. 1009–1014.
74. Derenko M.V. Grzybowski T., Malyarchuk B.A. et al. Diversity of mitochondrial
DNA lineages in South Siberia // Ann. Hum. Genet. 2003. V. 67. P. 391–411.
75. Derenko M.V., Grzybovski T., Malyarchuk B.A. et al. The presence of mitochondrial haplogroup X in Altaians from south Siberia // Am. J. Hum. Genet. 2001. V. 69.
P. 237-241.
76. Derenko M.V., Malyarchuk B.A., Grzybovski T. et al. Phylogeographic analysis of
mitochondrial DNA in Northern Asian populations \\ Am. J. Hum. Genet. 2007. V.81.
P.1025-1041.
77. Derenko M. V., Malyarchuk B. A., Zakharov I. A. Origin of Caucasoid-specific mitochondrial DNA lineages in the ethnic groups of the Altai–Sayan region // Genetika. 2002. V. 38. P. 1098–1103.
78. Dubut V., Chollet L., Murail P. et al. mtDNA polymorphisms in five French groups: importance of regional sampling \\ Eur. J. Hum. Genet. 2004. V. 12. P. 293–
300.
79. Excoffier L. Patterns of DNA sequences diversity and genetic structure after a
range expansion // Mol. Evol. 2004. V. 13. P. 853–864.
80. Finilla S., Hassinen I., Ala-Kokko L., Majamaa K. Phylogenetic network of the
mtDNA haplogroups U in Nothern Finland based on sequence analysis of the complete coding region by conformation-sensitive gel electrophoresis // Am. J. Hum.
Genet. 2000. V. 66. P. 1017–1026.
81. Finnila S., Majamaa K. Phylogenetic analysis of mtDNA haplogroup TJ in a Finnish population // Am. J. Hum. Genet. 2001. V. 46. P. 64-69.
82. Forster P., Handing R., Torroni A., Bandelt H-J. Origin and evolution of Native
American mtDNA variation: a reappraisal // Am. J. Hum. Genet. 1996. V. 59. P. 935–
945.
83. Hagelberg E., Goldman N., Lio P. et al. Evidence for mitochondrial DNA recombination in a human population of island Melanesia // Proc. R. Soc. Lond. Biol.
Sci. 1999. V. 266. P. 485–492.
102
84. Herrnstadt C., Elson J.L., Fahy E. et al. Reduced-median-network analysis of
complete mitochondrial DNA coding region sequences for the major African, Asian
and European haplogroups \\ Am. J. Hum. Genet. 2002. V. 70. P. 1152–1172.
85. Hill C., Soares P., Mormina M. et al. A mitochondrial stratigraphy for Island Southeast Asia // Am. J. Hum. Genet. 2007. V. 80. P. 29–41.
86. Horai S., Hayasaka K., Kondo R. Recent African origin of modern humans revealed by complete sequences of hominoid mitochondrial DNAs // Proc. Natl. Acad.
Sci. USA. 1995. V. 92. P. 532–536.
87. Ingman M. , Kaessmann H. , Paabo S. and Gyllensten U. Mitochondrial genome
variation and the origin of modern humans // Nature. 2000. V. 408. P. 708–713.
88. Jukes T.H. and Cantor C.R. Evolution of protein molecules // Mammalian Protein Metabolism. New York: 1969. P. 21–132.
89. Kasperavičiūté D., Kučinskas V. Variability of the human mitochondrial DNA
control region sequences in Lithuanian population // J. Appl. Genet. 2002. V. 43. P.
255–260.
90. Kasperavičiūté D., Kučinskas V. and Stoneking M. Y chromosome and mitochondrial DNA variation in Lithuanians // Ann. Hum. Genet. 2004. V. 68. P. 438–452.
91. Kivisild T., Bamshad M.J., Kaldma K. et al. Deep common ancestry of Indian
and western-Eurasian mitochondrial DNA lineages // Curr. Biol. 1999. V. 9. P. 1331–
1334.
92. Kivisild T., Tolk H.-V., Parik J. et al. The emerging limbs and twigs of the East
Asian mtDNA tree // Mol. Biol. Evol. 2002. V. 19. P. 1737–1751.
93. Kivisild T., Rootsi S., Metspalu M. et al. The genetic heritage of the earliest settlers persists both in Indian tribal and caste populations // Am. J. Hum. Genet. 2003.
V. 72. P. 313–332.
94. Kolman C.J., Sambuughin N. and Bermingham E. Mitochondrial DNA analysis
of Mongolian populations and implications for the origin of New World Founders //
Genetics. 1996. V. 142. P. 1321–1334.
95. Kong Q.-P., Bandelt H-J., Sun Ch. et al. Updating the East Asian mt DNA phylogeny: a prerequisite for the identification of pathogenic mutations // Hum. Mol.
Genet. 2006. V. 15. P. 2076–2086.
103
96. Kong Q.-P., Yao Y.-G., Sun Ch. et al. Phylogeny of East Asian mitochondrial DNA
lineages inferred from complete sequences // Am. J. Hum. Genet. 2003. V. 73. P. 671–
676.
97. Lahermo P., Laitinen V., Sistonen P., et al. MtDNA polymorphism in the Hungarians: comparison to three other Finno-Ugric-speaking population // Hereditas. 2000.
V. 132 P. 35–42.
98. Lindahl T. Instability and decay of the primary structure of DNA // Monthly Nature. 1993. V. 1. N. 4. P. 51.
99. Lundstrom R., Tavare S., and Ward R. H. Estimating substitution rates from molecular data using the coalescent // Proc. Natl. Acad. Sci. USA 1992. V. 89. N. 13. P.
5961–5965.
100. Maca-Meyer, Gonzalez A.M., Larruga J.M. Major genomic mitochondrial lineages delineate early human expansions // BMC Genetics. 2001. 2:13.
101. Macaulay V., Hill C., Achilli A. et al. Single, rapid coastal settlement of Asia revealed by analysis of complete mitochondrial genomes // Science. 2005. Vol. 308. P.
1034–1036.
102. Macaulay V., Richards M., Hickey E., et al. The emerging tree of West Eurasian
mtDNAs: a synthesis of control region sequences and RFLPs // Amer. J. Hum. Genet.
1999. V. 64. P. 232.
103. Malyarchuk B., Derenko M., Grzybovski T. et al. Differentiation of mitochondrial
DNA and Y chromosomes in Russian populations \\ Hum Biol. 2004. V. 76. P. 877–
900.
104. Malyarchuk B.A., Grzybowski T., Derenko M.V. et al. Mitochondrial DNA variability in Poles and Russians // Ann. Hum. Genet. 2002. V. 66. P. 261–283.
105. Manica A., Prugnolle F., Balloux F. Geographic is the better determinant of
human genetic differentiation than ethnicity // Hum. Genet. 2005. V. 118. P. 366–
371.
106. Merriwether D.A., Hall W. et al. mtDNA variation indicates Mongolia may have
been the source for the founding population for the New World // Am. J. Hum. Genet.
1996. V. 59. P. 204–212.
104
107. Mishmar D., Ruiz-Pesini E., Golik P. et al. Natural selection shaped regional
mtDNA variation in humans \\ PNAS. 2003. V. 100. P. 171–176.
108. Nei M. Human evolution at the molecular level // Population genetics and molecular evolution. 1985. Japan Sci. Soc. Press. P. 41–64.
109. Nei M. Molecular population genetics and evolution // North-Holland Publishing
Company. Amsterdam, 1975.
110. Nei M and Li W. H. Mathematical model for studying genetic variation in terms
of restriction endonucleases // Proc. Natl. Acad. Sci. USA. 1979. V. 76. P. 5269–5273.
111. Nei M., Tajima F. DNA polymorphism detectable by restriction endonucleases
// Genetics. 1981. V. 97. P. 145–163.
112. Palanichamy Mg., Sun C., Agravwal S. et al. Phylogeny of mitochondrial DNA
macrohaplogroup N in India, based on complete sequencing implications for the
peopling of South Asia \\ Am. J. Hum. Genet. 2004. V. 75. P. 966–978.
113. PCR Protocols. A guide to methods and applications // Acad. Press. INC. San
Diego. California. 1990.
114. Pliss L., Tambets K., Loogväli E.-L. et al. Mitochondrial DNA portrait of Latvians: towards the understanding of the genetic structure of Baltic-speaking populations // Ann. of Hum. Genet. 2005. V. 69. P. 1–20.
115. Questioning evidense for recombination in human mitochondrial DNA // Science. 2000. V. 288:1931a.
116. Quintana-Murci L., Chaix R., Wells R.S. et al. Where West Meets East: The
Complex mtDNA Landscape of the Southwest and Central Asian Corridor // Am. J.
Hum. Genet. 2004. V. 74. P. 827–845.
117. Quintana-Murci L., Semino O., Bandelt H.-J., et al. Genetic evidence for an
early exit of Homo sapiens sapiens from Africa through eastern Africa // Nat. Genet.
1999. V. 23. P. 437–441.
118. Reidla M., Kivisid T., Metsplau E., et al. Origin and diffusion of mtDNA haplogroup X // Am. J. Hum. Genet. 2003. V. 73. P. 1178–1190.
119. Richards M., Corte-Real H., Forster P. et al. Paleolithic and Neolithic lineages
in European mitochondrial gene pool // Am. J. Hum. Genet. 1996. V. 59. P. 185–203.
105
120. Richards M. B., Macaulay V. A., Bandelt H.-J., Sikes B. C. Phylogeography of
mtDNA in Western Europe // Ann. Hum. Genet. 1998. V. 62. P. 241–260.
121. Richards M., Macaulay V., Hickey E. et al. Tracing European founder lineages
in the Near Eastern mtDNA pool // Am. J. Hum. Genet. 2000. V. 67. P. 1251–1276.
122. Richards M., Macaulay V., Torroni A., Bandelt H-J., In search of geographical
patterns in European mitochondrial DNA // Amer. J. Hum. Genet. 2002. Vol. 71. P.
1168–1174.
123. Richter C., Park J.-W., Ames B.N. Normal oxidative damage to mitochondrial
and nuclear DNA is extensive // Proc. Natl. Acad. Sci. USA. 1988. V. 85. P. 6465–
6467.
124. Rogers A.R. and Harpending H. Population growth makes waves in the distribution of pairwise genetic differences \\ Mol. Biol. Evol. 1992. V. 9. P. 552–569.
125. Saccone C., Gadaleta G., De Benedetto C. Mitochondrial genes. New York,
1982. P. 121.
126. Saccone C., Pesole G., Sbisa E. The main regulatory region of mammalian mitochondrial DNA: structure-function model and evolutionary pattern // J. Mol. Evol.
1991. V. 33. P. 83.
127. Saillard J., Evseeva I., Tranebjarg L., Norby S. Mitochondrial DNA diversity
among Nenets // Arhaegenetics: DNA and the population prehistory of Europe.
McDonald Inst. 1999. P. 255–258.
128. Saillard J., Forster P., Lynnerup N. et al. mtDNA variation among Greenland
Eskimos: the edge of the Beringian expantion // Am. J. Hum. Genet. 2000. V. 67. P.
718–726.
129. Schneider S., Roessly D., Excoffer L. Arlequin v. 2.000: A software for population genetics data analysis. Geneva. Switzeland: Genetics and biometry laboratory,
University of Geneva. Geneva, 2000.
130. Schurr T.G., Ballinger S.W., Gan Y.Y. et al. Amerindian mitochondrial DNAs
have rare Asian variants at high frequencies, suggesting they derived from four primary maternal lineages // Am. J. Hum. Genet. 1990. V. 46. P. 613–623.
131. Schurr T.G., Starikovskaya Y.B., Sukernik R. I., Wallace D.C. Coast Chukchi
and Siberian Eskimo mtDNA variation and prehistory of ancient Beringian population // Am. J. Phys. Anthropol. 1996. V. 22. P. 210.
106
132. Schurr T.G., Sukernik R. I., Starikovskaya Y.B. et al. Mitochondrial DNA variation in Koryaks and Itel’men: population replacement in the Okhotsk sea – Bering sea
region during the Neolithic // Am. J. Phys. Anthropol. 1999. V. 108. P. 1–39.
133. Shields G. F., Schmiechen A. M., Frazier B. L. et al. mtDNA sequences suggest
a recent evolutionary divergence for Beringian and Northern North American populations // Am. J. Hum. Genet. 1993. V. 53. P. 549–562.
134. Shoubridge E.A., Wai T. Mitochondrial DNA and mammalian oocyte // Curr.
Top Dev. Biol. 2007. V. 77. P. 87–111.
135. Simoni L., Calafell F., Pettener D. et al. Geographic pattern of mtDNA diversity in Europe // Am. J. Hum. Genet. 2000. V. 66. P. 262–278.
136. Starikovskay E.B., Sukernik R.I., Derbeneva O.A. et al. Mitochondrial DNA diversity in indigenous populations of Siberia, and origins of Native American haplogroups \\ Ann. of Hum. Genet. 2005. V. 69. P. 67–89.
137. Starikovskaya Y.B., Sukernik R. I., Schurr T.G. et al. mtDNA diversity in
Chukchi and Siberian Eskimos: implication for the genetic history of ancient Beringia and the peopling of the New World // Am. J. Hum. Genet. 1998. V. 63. P. 1473–
1491.
138. Sun C., Kong Q.-P., Palanichamy Mg. et al. The dazzling array of basal branches in the mtDNA macrohaplogroup M from India as inferred from complete genomes \\ Mol. Biol. Evol. 2006. V. 23. P. 683–690.
139. Tanaka M., Cabrera V.M., Gonzales A.M. et al. Mitochondrial genome variation
in Eastern Asia and the peopling of Japan \\ Genome Res. 2004. P. 1832–1850.
140. Torroni A. Bandelt H-J., D’Urbano L. et al. mtDNA analysis reveals a major
Late Paleolithic population expantion from Southwestern to Northeastern Europe //
Am. J. Hum. Genet. 1998. V. 62. P. 1137–1152.
141. Torroni A. Bandelt H-J., Macaulay V. et al. A signal from human mtDNA of postglacial re-colonization in Europe // Am. J. Hum. Genet. 2001. V. 69. P. 844–852.
142. Torroni A., Huoponen K., Francalacci P., et al. Classification of European
mtDNAs from an analysis of three European populations // Genetics. 1996.
V. 144. P. 1835–1850.
107
143. Torroni A., Schurr T.G., Cabell M.F. et al. Asian affinities and continental radiation of the four founding native American mtDNAs // Am. J. Hum. Genet. 1993.
V. 53. P. 563–590.
144. Torroni A., Sukernik R. I., Schurr T.G., et al. mtDNA variation of aboriginal Siberians reveals distinct genetic affinities with native Americans // Am. J. Hum. Genet.
1993. V. 53. P. 591–608.
145. Voevoda M.I. and Shkapenko A.L. Mitochondrial sequences in the hypervariable region I of West Siberian Finno-Ugrians // GeneBank. AF214084–AF214093.
146. Wallace D. C. Structure and evolution of organelle genomes // Microbiol. Rev.
1982. P. 208.
147. Wallace D. C., Bunn C.L., Eisenstandt J.M.. Cytoplasmic transfer of chloramphecol resistance in human tissue culture cell // J. Cell Biol. 1975. P. 174.
148. Wallace D. C., Lott M. T., Brown M. D. et al. Report of the committee on human
mitochondrial DNA / Human gene mapping / Ed. A. S. Cuticchia. Baltimore, 1995.
P. 910–954.
148. Ward R.H., Fraizer B.L., Dew K., Paabo S. Extensive mitochondrial diversity
within a single Amerindian tribe // Proc. Natl. Acad. Sci. USA. 1991. V. 88. P. 8720–
8724.
149. Watson E., Forster P., Richards M., Bandelt H.-J. Mitochondrial footprints of
human expansions in Africa // Am. J. Hum. Genet. 1997. V. 61. P. 691–704.
150. Wright S. The interpretation of population structure by F-statistics with special
regard to system of mating // Evolution. 1965. V. 19. P. 395–420.
151. Yao Y.-G., Kong Q.-P., Bandelt H.-J., et al. Phylogenetic differentiation of mitochondrial DNA in Han Chinese // Am. J. Hum. Genet. 2002. V. 70. P. 635–651.
1/--страниц
Пожаловаться на содержимое документа