close

Вход

Забыли?

вход по аккаунту

...очень сложный процесс, в котором динамически... | Форум;doc

код для вставкиСкачать
На правах рукописи
Ликарь Юрий Николаевич
Клиническое значение молекулярной визуализации в диагностике и контроле остаточных
опухолевых клеток, вирусных инфекций и адоптивной клеточной терапии в
гематологии/онкологии
14.01.21 – гематология и переливание крови
14.01.13 – лучевая диагностика, лучевая терапия
Автореферат диссертации на соискание ученой степени
доктора медицинских наук
Москва-2014
1
Робота была выполнена в ФГБУ «Федеральный научно-клинический центр детской гематологии,
онкологии и иммунологии им. Дмитрия Рогачева» Минздрава России и лаборатории
молекулярной визуализации Мемориал Слоан-Кеттеринг Онкологического Центра, США
Научные консультанты:
Академик РАМН, доктор медицинских наук, профессор
Румянцев Александр Григорьевич
Доктор медицинских наук, профессор
Дубровин Михаил Михайлович
Официальные оппоненты:
Афанасьев Борис Владимирович - доктор медицинских наук, профессор, директор клиники «НИИ
детской онкологии, гематологии и трансплантологии им. Р.М. Горбачевой»
Рукавицын Олег Анатольевич - доктор медицинских наук, профессор, начальник
гематологического центра ГВКГ им. акад. Н.Н. Бурденко
Станжевский Андрей Алексеевич - доктор медицинских наук, руководитель научноорганизационного отдела ФГБУ РНЦРХТ Минздрава России
Ведущая организация:
ФГБУ Гематологический Научный Центр Министерства здравоохранения Российской Федерации
Защита диссертации состоится «
»
2014 года в
часов на заседании
диссертационного совета Д 208.050.01 в ФГБУ «Федеральный научно-клинический центр детской
гематологии, онкологии и иммунологии имени Дмитрия Рогачева» Минздрава России, 117997,
ГСП-7, Москва, ул. Саморы Машела, д.1
С диссертацией можно ознакомиться в библиотеке и на сайте ФГБУ «Федеральный научноклинический центр детской гематологии, онкологии и иммунологии имени Дмитрия Рогачева»
Минздрава России, www.fnkc.ru
Автореферат разослан
«
»
2014 года
Ученый секретарь диссертационного совета
доктор медицинских наук, профеор
В.М. Чернов
2
ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ
Актуальность проблемы. За последние десятилетия многообещающие методы лечения
на основе генной и клеточной терапии перешли из лабораторной в клиническую стадию
исследования. Значительную роль во внедрении данных методов в широкую практику
играет прогресс в совершенствовании мониторинга терапевтического эффекта, в
частности с помощью методов неинвазивной молекулярной визуализации. Молекулярная
визуализация как комплекс методов может быть определена как «визуализация процессов
на молекулярном уровне в реальном времени». Выделенная в отдельное направление
около двадцати лет назад, в настоящее время молекулярная визуализация представляет
собой сплав клиники, фармакологии, функциональной диагностики и ядерной медицины
со значительным влиянием клеточной и молекулярной биологии, химии, радиохимии и
физики элементарных частиц (R.Blasberg, 2002). Широкое использование молекулярной
визуализации в лабораторной практике стало одним из основных источников получения
информации о механизмах и путях регуляции практически всех значимых онкогенов и
онкопротеинов (R. Blasberg, 2002), факторов лекарственной устойчивости (H.Bigott, 2005),
неоангиогенеза (R.Rossin, 2007; J.Massague, 2008), пролиферации (D.Solit, 2006) и
метастазирования злокачественных клеток (M.Scholz, 2007), что способствует более
глубокому пониманию биологических процессов гемопоэза и канцерогенеза, и созданию
новых методов диагностики и лечения гематологических и онкологических заболеваний.
Биомаркерная, или «суррогатная», визуализация основана на мониторировании
вторичных молекулярно-генетических мишеней и отражает внутренние молекулярногенетические процессы. Примером подобного подхода является визуализация молекул
фтордезоксиглюкозы меченной
18
F (18F-ФДГ) с помощью позитрон-эмиссионной
томографии (ПЭТ) у пациентов с гематологическими и онкологическими заболеваниями
(C.Hoekstra, 2000). Использование 18F-ФДГ у пациентов с опухолями различного генеза в
том числе и с лимфомами, для инициальной диагностики и оценки ответа на терапию в
настоящее время становится неотъемлемой частью лечебных протоколов. Накопление 18FФДГ в тканях прямо пропорционально метаболизму глюкозы в клетках. Однако,
повышенный
метаболизм
клетки
далеко
не
всегда
свидетельствует
о
ее
злокачественности, что в свою очередь влияет на специфичность данного метода. В ряде
доклинических и клинических исследований была показана зависимость между
накоплением радиофармпрепарата аналога тимидина (3’-дезокси-3’-18F-флуоротимидин
(18F-ФЛТ)) при ПЭТ и пролиферативной активностью клеток, что в отличии от
метаболизма глюкозы можно считать более специфичным маркером для оценки роста
опухоли (M.Wagner, 2003). 18F-ФЛТ являясь производным тимидина и отражая активность
3
клеточной пролиферации, может служить косвенным маркером для оценки механизмов
транспорта и метаболизма целого ряда радиофармпрепаратов производных нуклеозидов
создаваемых для других типов молекулярной визуализации в частности с использованием
репортерных генов.
Поиск высокоспецифичных биологических методов лечения основанных на
естественных механизмах распознавания и удаления чужеродного антигена без
повреждения здоровых тканей организма, привел к разработке методов адоптивной
клеточной иммунотерапии. Адоптивная иммунотерапия (от англ. аdopt - усыновить) – это
метод клеточной терапии, при котором пациенту вводятся иммунные эффекторные клетки
крови, атакующие специфические мишени. Это отличает адоптивную иммунотерапию от
клеточных вакцин, которые предполагают активную иммунизацию и, следовательно,
образование эффекторных клеток in vivo. Примером адоптивной иммунотерапии может
являться терапия лимфоцитами, активированными интерлейкином-2 (IL-2) ex vivo.
Введение адоптивных опухолеспецифических Т-клеток пациентам с онкологическими
заболеваниями является фундаментально новым экспериментальным методом, имеющим
значение для изучения процессов опухолевой иммуно-патофизиологии. Введение
антигенспецифических цитотоксических Т-лимфоцитов оказалось эффективным в
лечении инфекций, вызванных реактивацией
цитомегаловируса (ЦМВ) и вируса
Эпштейна-Барр (ЭБВ) после трансплантации гемопоэтических стволовых клеток (ТГСК)
при ряде онкологических заболеваний (H.Einsele, 2002; M.Dudley, 2003; S.Gottschalk, 2005;
K.Straathof, 2005; Heslop, 2010; Uhlin, 2010; Feuchtinger, 2010; Peggs, 2011).
Необходимым
условием
адоптивной
противоопухолевой
терапии
является
мониторирование распространения, локализации и специфической активации вводимых
пациентам с терапевтическими целями опухолеспецифических Т-клеток, которое
позволяет проводить контроль и коррекцию иммунотерапии в режиме реального времени
в соответствии с наблюдаемым терапевтическим эффектом и предотвращать развитие
возможных нежелательных реакций.
Наиболее
адекватным
методом
для
мониторирования
противоопухолевой
клеточной терапии является неинвазивная молекулярная визуализация в частности с
использованием репортерных генов (A.Jacobs, 2001; M.Iyer, 2005; I.Penuelas, 2005;
P.Acton, 2005; A.Minn, 2005; M.Doubrovin, 2007). Общее научное направление применения
репортерных генов для неинвазивной визуализации с использованием радиоактивно
меченных проб было впервые описано в середине 90-х годов XX века, однако и по сей
день ведется поиск оптимальных пар репортерный ген и репортерная проба для
избирательной
визуализации
молекулярно-биологических
процессов.
Создание
4
оптимальных моделей, в частности с применением репортерных генов, позволит
проводить неинвазивную визуализацию (мониторирование) ген-модифицированных Тклеток в клинических протоколах клеточной терапии у пациентов с гематологическими и
онкологическими заболеваниями в режиме реального времени.
Цель исследования
Контроль эффективности противоопухолевой химио- и иммунотерапии у больных
гематологическими и онкологическими заболеваниями с помощью неинвазивной оценки
биологических процессов онко-, гемо- и иммуно-генеза методами молекулярной
визуализации.
Задачи
1. Определить прогностическую взаимосвязь накопления ПЭТ с
18
F-ФЛТ (маркера
пролиферации) при инициальной диагностике поражений у пациентов с диффузной
В-клеточной крупноклеточной лимфомой и после 1-го курса лечения с
результатами противоопухолевой терапии.
2. Оценить возможность неинвазивного определения пролиферативной активности
опухоли при использовании радиофармпрепаратов – аналогов тимидина для
стандартизации результатов ген-репортерной визуализации у пациентов.
3. Обеспечить повышение чувствительности и специфичности визуализирующих
методов исследования биологии опухолей и противоопухолевого ответа путем
создания комплексных ген-репортерных систем в том числе с генами человеческой
природы, позволяющих осуществлять доклиническую разработку (in vitro, in situ
(флуоресцентная микроскопия и FACS)), и клиническое тестирование in vivo
неинвазивными
методами
радионуклидной
диагностики
с
использованием
позитрон-эмиссионной томографии.
4. Оценить сохранность функциональной активности и специфичности различных
клеточных линий, включая человеческие Т-клетки трансдуцированные созданными
ген-репортерными системами и химерным антиген специфическим рецептором.
5. Провести мониторинг локализации, персистенции и оценку активации генмодифицированных Т-клеток используя созданные ген-репортерные системы с
соответствующим радиофармпрепаратом путем неинвазивной ПЭТ-визуализации.
Оценить
возможность
суицидальной
элиминации
введенных
клеток,
трансдуцированных созданными ген-репортерными системами из организма
пациента при необходимости.
5
Научная новизна
В данной работе впервые:
- была проанализирована эффективность использования ПЭТ с
пролиферативной
активности
клеток
у
пациентов
крупноклеточной лимфомой в сравнении с ПЭТ с
прогностического значения накопления
18
с
18
18
F-ФЛТ для оценки
диффузной
В-клеточной
F-ФДГ и выполнена оценка
F-ФЛТ до начала лечения и после 1-го курса
противоопухолевой терапии у данной группы пациентов.
- разработаны и испытаны ген-репортерные системы, на основе гена тимидин киназы
вируса простого герпеса 1-го типа и гена деоксицитидинкиназы человека, обладающие
специфичностью к радиофарпрепаратам производным пуринов A167Ysr39tk/GFP; и
производным
пиримидинов
R176QYsr39tk/GFP
и
dCKDM
для
динамической,
неинвазивной, оценки различных молекулярно-биологических процессов в пределах
одного организма.
- продемонстрирована возможность стабильной, эффективной трансдукции Т-клеток,
здоровых доноров, ген-репортерными системами A167Ysr39tk/GFP, dCKDM/GFP и
химерным антиген специфическим рецептором; доказано сохранение функциональной
активности ген-модифицированных Т-клеток.
- проведен долгосрочный неинвазивный мониторинг введенных ген-модифицированных
Т-лимфоцитов трансдуцированных dCKDM/GFP ген-репортерной системой и химерным
рецептором.
- создана NFAT-регулируемая двойная ген-репортерная система, позволяющая проводить
неинвазивную оценку активации Т-лимфоцитов в режиме реального времени in vitro и in
vivo при помощи ПЭТ.
- проведена оценка «суицидальной» активности в созданных ген-репортерных системах:
A167Ysr39tk с ганцикловиром и dCKDM с цитарабином, на различных клеточных линиях,
как in vitro, так и in vivo.
Научно-практическая значимость
•
Результаты выполненного анализа дают основания заключить, что использование
ПЭТ/18F-ФЛТ, не уступает по своей диагностической значимости в определении
инициальных очагов поражения при сравнении с ПЭТ/18F-ФДГ, но позволяет в
зависимости
от
интенсивностиего
накопления
проводить
неинвазивную
дифференциальную диагностику различий пролиферативной активности опухолей и
нормальных клеток.
•
Установленная взаимосвязь между значениями инициального накопления
18
F-ФЛТ и
результатом лечения (достижение полной и/или парциальной ремиссии) помогает в
6
стратификации пациентов на группы риска и как следствие, в выборе протокола
лечения. Использование ПЭТ с 18F-ФЛТ дает возможность проводить раннюю оценку
ответа на терапию и показывает взаимосвязь между накоплением
18
F-ФЛТ с
выживаемостью без прогрессии, помогает в определении группы пациентов с плохим
прогнозом на ранних этапах проводимой терапии и дает возможность использования
альтернативной терапии у таких пациентов для достижение лучших результатов
лечения.
•
Использование
разработанных
обладающих
специфичностью
и
протестированных
к
ген-репортерных
радиофармпрепаратам
систем,
производным
ациклогуанозинов и/или пиримидинов, дает возможность изучать различные (два и
более) молекулярно-биологические процессы в пределах одного организма с помощью
ПЭТ. Созданная и апробированная в Т-клетках человека ген-репортерная система, на
основе человеческого гена деоксицитидинкиназы, позволяет использовать ее для
неинвазивного мониторирования Т-клеток при адоптивной Т-клеточной терапии.
•
Наличие «суицидальной активности» в мутированных вариантах гена тимидинкиназы
HSV-1 и деоксицитидинкиназы человека к пролекарствам ганцикловиру и цитарабину,
соответственно, позволяет элиминировать введенные ген-модифицированные Т-клетки
из организма при необходимости.
•
Использование созданной NFAT-индуцированной двойной ген-репортерной системы,
для ПЭТ, позволит осуществлять мониторинг локализации и количественной оценки
CD3- и CAR - зависимой активации ген-модифицированных Т-лимфоцитов, что дает
возможность проводить оценку эффективности Т-клеточной терапии и проводить ее
коррекцию. Дополнительно, использование NFAT-индуцированной двойной генрепортерной системы для визуализации и количественной оценки активации Тлимфоцитов
in
vivo
фундаментальные
в
экспериментальных
исследования
целях
позволяет
молекулярно-биологических
проводить
как
процессов,
происходящих с Т-лимфоцитами in vivo, так и разрабатывать новые подходы к
диагностике и лечению состояний, при которых информация о локализации и
функциональном состоянии Т-клеток может влиять на прогноз и тактику терапии.
Внедрение в практику
1) Начаты клинические испытания репортерных систем для визуализации генмодифицированных цитотоксических Т-лимфоцитов с искуственным рецептором в
онкологическом Центре Мемориал Слоан-Кеттеринг, Нью-Йорк, США.
7
2) ПЭТ с
18
F-ФЛТ предложен для включения в протокол клинических испытаний
визуализации поражений у пациентов с лимфомами в онкологическом центре Мемориал
Слоан-Кетткринг, Нью-Йорк, США.
3) Мультифункциональная репортерная система на основе гена деоксицитидинкиназы
человека
используется
для
неинвазивной
визуализации
и
мониторирования
экспериментальных моделей иммунного ответа в условиях адоптивной клеточной терапии
ген-модифицированными
цитотоксическими
Т-лимфоцитами
в
лаборатории
Молекулярной Визуализации исследовательского центра М. Цукермана, Нью-Йорк, США.
Основные положения выносимые на защиту
1.
Использование ПЭТ с
18
F-ФЛТ, является эффективным методом инициальной
диагностики поражений у пациентов с диффузной В-клеточной крупноклеточной
лимфомой. Оценка интенсивности накопления маркера пролиферации
18
F-ФЛТ в
отличие от оценки метаболической активности опухолевых клеток используя ПЭТ с
18
F-ФДГ позволяет оценить ранний ответ на проводимую химиотерапию у пациентов
с диффузной В-клеточной крупноклеточной лимфомой, что может использоваться
как прогностический фактор для стратификации пациентов на группы риска.
2.
Основываясь на успехе молекулярной визуализации с аналогами нуклеозидов
(ФЛТ), впервые разработаны ген-репортерные системы на основе гена тимидин
киназы вируса простого герпеса (A167Ysr39tk, R176Qsr39tk) и гена человеческой
деоксицитидинкиназы (dCKDM) обладающие специфичностью к клинически
апробированным радиофармпрепаратам производным пуринов (18F-FHBG) и/или
пиримидинов (18F-FEAU), для одновременной неинвазивной визуализации и
изучения нескольких молекулярно-биологических процессов в пределах одного
организма с помощью позитронно-эмиссионной томографии.
3.
Проведенная
оценка
функциональной
активности
и
специфичности
клеток
человеческой природы, экспрессирующих вновь созданные ген-репортерные
системы показала их стабильность и инертность. В результате доклинических
исследований доказана возможность удаления клеток, трансдуцированных вновь
созданными ген-репортерными системами A167Ysr39tk или dCKDM путем введения
низкотоксичных лекарственных веществ (ганцикловира и цитозин-арабинозида,
соответвенно) с возможностью проведения неинвазивного контроля.
4.
Используя
репортерные
гены
человеческой
природы
впервые
методами
молекулярной визуализации in vitro (флоуцитометрия) и in vivo (ПЭТ) осуществлен
неинвазивный мониторинг распределения вирусного вектора, локализации и уровня
активации транскрипционно регулируемых репортерных и терапевтических генов,
8
молекулярно-биологических процессов, вовлеченных в механизм активации Тклеток на субклеточном уровне и перераспределения цитотоксических Тлимфоцитов
в
реальном
времени
в
течение
определенного
периода
их
существования в организме.
Место выполнения работы
Исследование проведено в 2006-2012 г.г. в рамках научного сотрудничества ФГБУ
«ФНКЦ ДГОИ им. Дмитрия Рогачева» Минздрава России и Мемориал Слоан-Кеттеринг
Онкологического Центра, США. Экспериментальная часть исследования выполнена на
базе лаборатории молекулярной визуализации отдела радиологии Мемориал СлоанКеттеринг Онкологического Центра (руководитель отдела Dr. H. Hricak). Клиническая
часть
работы,
включая
гематологических
ретроспективный
пациентов
проводилась
анализ
на
популяций
базе
Мемориал
онкологических
и
Слоан-Кеттеринг
Онкологического Центра, Нью-Йорк, США и ФГБУ «ФНКЦ детской гематологии,
онкологии и иммунологии им. Дмитрия Рогачева». Автор глубоко благодарен за
неоценимый вклад в представленную работу: В.Б. Пономареву, Hedvig Hricak, Steven M.
Larson, Д.Н. Балашову.
Апробация материалов диссертации
Основные результаты работы доложены в виде докладов и стендовых презентаций
на международной конференции Общества Молекулярной Визуализации (Провиденс,
2007; Монреаль, 2009); на межлабораторной конференции Мемориал Слоан-Кеттеринг
онкологического центра (Нью-Йорк, 2007-2009); на 56 и 57 ежегодных съездах Общества
Ядерной Медицины (Торонто, 2009; Солт-Лейк-Сити, 2010); американском обществе
генной и клеточной терапии (Вашингтон, 2010); VI, VII и VIII международных
симпозиумах «Биологические основы терапии онкологических и гематологических
заболеваний». – Москва, 2009; Москва, 2011; Москва, 2013). Результаты исследований
используются в лекциях и семинарах для подготовки гематологов, онкологов и
радиологов на кафедре гематологии, онкологии и лучевой терапии ГБОУ ВПО
Российский
Национальный
Исследовательский
Медицинский
Университет
им.
Н.И.Пирогова Минздрава России.
Материалы диссертации опубликованы в рецензируемых научных журналах, том числе в
изданиях, рекомендованных в перечне ВАК.
Структура и объем диссертации
Диссертация изложена на 158 страницах машинописного текста и состоит из
введения (включающее цели и задачи диссертации, актуальность, практическое значение,
внедрение), обзора литературы (220 источников), методической части (материалы и
9
методы),
шести глав собственных исследований, обсуждения, заключения, выводов,
списка публикаций и списка сокращений. В тексте содержится 47 рисунков и 9 таблиц.
Материалы и методы
Работа
основана
на
экспериментальных
и
клинико-лабораторных
данных
полученных лично автором и ретроспективном анализе данных пациентов.
Характеристика больных включенных в данную работу
Ретроспективно была оценена группа пациентов с диффузной В-клеточной
крупноклеточной
лимфомой
(ДВККЛ)
использовали ПЭТ с радиофармпрепаратом
в
18
диагностическом
протоколе
которых
F-ФЛТ. Ретроспективный анализ включал
данные 39 пациентов с верифицированным диагнозом ДВККЛ, которые были
обследованы,
получали
терапию
и
наблюдались
в
Мемориал
Слоан-Кеттеринг
Онкологическом Центре (Нью-Йорк, США) с апреля 2007 г. по апрель 2010 г. Протокол
исследования был одобрен локальным Этическим Комитетом, все больные подписали
информированное согласие соответственно форме, принятой в данном Центре.
Из 39 больных 21 был мужского пола, 18 женского пола при медиане возраста на
момент диагноза 51,9 (18 – 67) лет. Обследование больных, наряду с комплексом
стандартных клинико-лабораторных исследований включало КТ или ПЭТ/КТ c
18
F-ФДГ
головы, шеи, грудной клетки, брюшной полости и таза. Дополнительно, всем пациентам
выполняли ПЭТ с
18
F-ФЛТ до начала лечения и после 1-го курса противоопухолевой
терапии, между 10 и 12-м днем, выполнялся промежуточный ПЭТ (П-ПЭТ). После
завершения противоопухолевой терапии выполнялся заключительный ПЭТ (З-ПЭТ) с 18FФЛТ только тем пациентам у которых было диагностировано остаточное образование по
данным КТ. Все выполненные биопсии были проанализированы и пересмотрены в центре
двумя независимыми экспертами патологами. Распределение пациентов по возрасту,
оцененным критериям составляющим международный прогностический индекс (МПИ)
(The International Non-Hodgkin's Lymphoma Prognostic Factors Project, 1993) и клинической
стадии ДВККЛ представлены в табл. 1. Какой либо коррекции противоопухолевой
терапии по результатам исследования ПЭТ с 18F-ФЛТ не проводилось.
10
Таблица 1. Клинические характеристики групп пациентов
Критерии
Все
пациенты
П-ПЭТ
П-ПЭТ
(n=39)(%)
Негативные
(n,%)
позитивные
(n,%)
>60 лет
17 (43,6)
14 (35,9)
3 (7,7)
<60 лет
22 (56,4)
18 (46,2)
4 (10,2)
1-2
13 (33,3)
12 (30,8)
1 (2,6)
3-4
26 (66,7)
20 (51,3)
6(15,4)
0-2
24 (61,5)
20 (51,4)
4 (10,1)
>2
15 (38,5)
12 (30,8)
3 (7,7)
Возраст
Стадия
МПИ
ПЭТ и анализ результатов
18
F-ФЛТ был синтезирован по методике описанной раннее (H.Machulla, 2000). ПЭТ
сканирование всего тела выполнялось в режиме максимальной интенсивности с высоким
разрешением на аппарате General Electric Discovery STE-HD, США. Статические
изображения были получены в интервале 45-60 мин после введения приблизительно 300
МБк 18F-ФЛТ (диапазон 270-340 МБк). Была проведена коррекция полученных данных от
случайных совпадений и выполнена коррекция на аттенуацию. Данные были
реконоструированы с использованием фильтра обратного проецирования. Размер матрицы
128 × 128 пикселей, с размером пикселя 4,0 × 4,0 мм. В очагах поражения (зона интереса)
проводилось количественное измерение максимального значения стандартизированного
накопления (Standardized Uptake Value, SUV). Максимальное значение SUV (SUVmax)
было рассчитано в каждой области интереса по формуле: SUV = измеренная концентрация
активности (Бк / г) × масса тела (г) / введенная активность (Бк). Дальнейшая оценка
первично обнаруженных очагов поражения на КТ или ПЭТ/КТ с
18
F-ФДГ проводилась с
помощью КТ исследований после 3-го курса и по завершению всех курсов
противоопухолевой терапии.
Клиническая оценка и наблюдение
Согласно стандартизированным критериям ответа для НХЛ (B.Cheson, 2007)
констатировали: полный ответ (ПО), частичный ответ (ЧО) рецидив или прогрессию
заболевания (ПЗ). Пациентам у которых после окончания терапии по данным КТ
сохранялись увеличенные лимфатические узлы или остаточное образование выполняли
ПЭТ с
18
F-ФЛТ. Дальнейшая оценка ответа на терапию проводилась в соответствии со
стандартными протоколами и включала: клиническое обследование, оценку лабораторных
показателей, УЗИ, рентгенографию грудной клетки и КТ. Дата последнего наблюдения 31
11
марта 2010 г. Медиана наблюдения составила 21 (4-35) мес. Первичной конечной точкой
было определение выживаемости до прогрессирования или рецидива (PFS; progression free
survival). Рассчет проводили от даты начала терапии до даты констатации рецидива или до
даты прогрессирования заболевания. Выживаемость до прогрессирования характеризует
течение заболевания во всей группе больных, начавших лечение. Вероятность
выживаемости до прогрессирования отражает какая часть больных, начавших лечение,
имеет возможность прожить указанный срок без признаков прогрессии заболевания или
рецидива, независимо от того, была ли достигнута полная ремиссия. Вторичной конечной
точкой была оценка общей выживаемости (OS; overal survival), которая рассчитывалась от
даты начала лечения до даты смерти от любой причины или до даты последнего
наблюдения больного.
Для определения и обоснования необходимости разработки и использования новых
методов
лечения
(таких
как
клеточная
терапия)
были
использованы
данные
ретроспективного анализа частоты развития осложнений вызванных цитомегаловирусом
(ЦМВ) и Эпштейн-Барр вирусом (ЭБВ) у пациентов после алло-ТГСК опубликованные в
работе «Факторы риска и контроль вирусных инфекций после трансплантации
гемопоэтических стволовых клеток у детей» Д.Н.Балашовым в 2011 г.
Ретроспективный анализ включал 157 пациентов в возрасте от 1 до 17 лет, получивших
аллогенную ТГСК от родственного или альтернативного донора в период с 2006 г. по 2010
г. в отделении трансплантации костного мозга (зав.отделением – доктор медицинских
наук Скоробогатова Е.В.) ФНКЦ ДГОИ на клинической базе ГУ Российской детской
клинической больницы Минздравсоцразвития России. Всего было проведено 175 ТГСК у
157 пациентов. В связи с тем, что одному из больных, которому проводилась ТГСК от
гаплоидентичного донора, позже была проведена ТГСК от неродственного донора,
существует различие между общим количеством пациентов и количеством пациентов в
группах,
стратифицированных
по
типу
ТГСК
(родственная,
неродственная,
гаплоидентичная) табл. 2. В группу больных, которым была проведена неродственная
ТГСК, включены 87 пациентов, пятерым из которых выполнено 2 ТГСК; в группу
реципиентов родственных ГСК были включены 52 пациента, двоим из которых проведено
2 ТГСК и двоим – 3 ТГСК; в группу пациентов, которым проводилась ТГСК от
гаплоидентичного донора, вошли 19 пациентов, четырем из которых было выполнено по 2
ТГСК, а одному пациенту – три ТГСК.
12
Таблица 2. Характеристика больных в зависимости от типа выполненных ТГСК
ТГСК от
ТГСК от
ТГСК-гапло
Всего
неродственного донора родственного донора
К-во
86+(1)
52
19
157
92
58
25
175
пациентов
Всего ТГСК
У 168 из 175 произведенных аллогенных ТГСК был выполнен анализ частоты
реактивации ЦМВ. Количество пациентов которым была выполнена неродственная ТГСК
- (n= 90); родственная ТГСК – (n=56); гаплоидентичная ТГСК – (n=22). У 87 из 168 ТГСК
(51,8%) была зарегистрирована реактивация ЦМВ. Из которых: при родственной ТГСК
реактивация ЦМВ выявлена у 21 из 56 (37,5%); при неродственной ТГСК у 53 из 90 ТГСК
(58,9%); при гаплоидентичной ТГСК у 13 из 22 (59,1%) (р=0,032) рис. 1.
Гаплоидентичная ТГСК
59.1%
Неродственная ТГСК
58.9%
Родственная ТГСК
37.5%
0
10
20
30
40
50
60
частота реактивации ЦМ В (%)
70
.
Рисунок 1. Частота первой реактивации ЦМВ при различных вариантах ТГСК.
Частота развития ЦМВ-пневмонии и частота летальных исходов ассоциированных с
ЦМВ-пневмонией у пациентов после аллогенной ТГСК также были оценены в данной
работе. Однако, достоверно судить о частоте ЦМВ-пневмонии не представляется
возможным. Это объясняется тем, что в ряде случаев не проводили биопсии и
гистологического исследования пораженных тканей для верификации диагноза в связи с
высоким риском проведения диагностических процедур. Учитывая имеющиеся в
распоряжении достоверные (исследование биопсийного, аутопсийного материала)
данные, было показано, что в группе пациентов после неродственной ТГСК в 7 из 92
случаев (7,6%) имели место признаки ЦМВ-пневмонии. У 5 из этих 7 случаев именно
ЦМВ-пневмония стала причиной летального исхода. У пациентов после проведения
родственной ТГСК ЦМВ-пневмония была подтверждена у 3 из 58 (5,2%), при этом у 2 из
3 пациентов ЦМВ-пневмония и стала причиной летальных исходов. Наибольшая частота
13
развития ЦМВ-пневмонии была отмечена при проведении гаплоидентичной ТГСК (у 3 из
25 (12%)), которая послужила причиной летального исхода у 2 больных. Таким образом,
развившаяся ЦМВ-пневмония стала причиной летального исхода у 9 из 13 пациентов, что
составляет (69%). Частота развития ЦМВ-пневмонии и частота летальных исходов
ассоциированных с ЦМВ-пневмонией в зависимости от вида ТГСК представлена на рис.
2. Следует указать, что в 2 случаях ЦМВ-пневмония стала причиной летального исхода в
сочетании с другими инфекционными осложнениями и признаками полиорганной
недостаточности.
Рисунок
2.
Частота
развития
ЦМВ-пневмонии
и
частота
летальных
исходов
ассоциированных с ЦМВ-пневмонией в зависимости от вида ТГСК.
Анализ частоты реактивации ЭБВ был проведен на основании данных полученных
при проведении 160 аллогенных ТГСК из которых количество реципиентов получивших
ТГСК от неродственного донора составило (n=88); родственная ТГСК (n=53);
гаплоидентичная ТГСК (n=19). Реактивация ЭБВ была зарегистрирована у 43 из 160
случаев, что составило (26,9%). При неродственной ТГСК реактивация ЭБВ была
выявлена у 32 из 88 (36,4%); при родственной ТГСК – у 9 из 53 (17,0%); при
гаплоидентичной ТГСК – у 2 из 19 (10,5%) (р<0,05) рис. 3.
Гаплоидентичная ТГСК
10.5%
Родственная ТГСК
17%
36.4%
Неродственная ТГСК
0
10
20
30
40
частота реактивации ЭБВ (%)
.
Рисунок 3. Частота первичной реактивации ЭБВ при различных вариантах ТГСК.
14
Количество случаев развития ЭБВ-ассоциированного ПТЛЗ также отличалась в
группах с различными видами ТГСК. Так, при неродственной ТГСК, было выявлено
наибольшее количество случаев ЭБВ-ПТЛЗ (7,6%). При этом, у троих пациентов ЭБВПТЛЗ стала причиной летального исхода: в 1-м случае была выявлена генерализованная
крупноклеточная анапластическая лимфома с поражением печени, легких и ЦНС, во 2-м
случае – была диагностирована лимфома ЦНС, в 3-м случае диагностировали
генерализованную лимфому с поражением печени.
При проведении родственной ТГСК только у 2 из 58 реципиентов ТГСК (1,9%) было
зарегистрировано развитие ЭБВ-ПТЛЗ. В дальнейшем у обоих пациентов был отмечен
положительный эффект на проводимую терапию ритуксимабом. У реципиентов после
гаплоидентичной ТГСК ЭБВ-ПТЛЗ выявлено не было.
Частота реактивации ЭБВ и ее соотношение с ЭБВ-ПТЛЗ при различных видах ТГСК
представлена на рис. 4.
40
Реактивация ЭБВ
ЭБВ-Заболевание
36,4%
частота (%)
30
20
17,0%
10,5%
10
7,6%
1,9%
0
Родственная ТГСК
0,0%
Неродственная ТГСК
Гапло- ТГСК
Рисунок 4. Частота реактивации ЭБВ и частота ЭБВ-ПТЛЗ при различных вариантах
ТГСК.
Полученные
данные
продемонстрировали,
что
развитие
осложнений
ассоциированных с реактивацией ЦМВ- и ЭБВ инфекцией в виде ЦМВ-пневмонии и
ПТЛЗ стали основной причиной летального исхода у этих пациентов. Так летальность у
пациентов после ТГСК развивших ЦМВ-пневмонию составила 69%, а при развитии ПТЛЗ
52 %. В настоящее время, помимо разработки новых протоколов по диагностики и
упреждающей терапии данных инфекций немаловажную роль в лечении ЦМВ и ЭБВ
инфекции играют многообещающие методы с использованием Т-клеточной терапии.
Сдерживающим фактором широкого использования данного вида терапии является
сложность данной методики получения специфических Т-лимфоцитов для последующего
клинического рутинного использования и отсутствие возможности неинвазивной
15
визуализации и контроля проводимой терапии. В этой связи использование методов
молекулярной визуализации, в частности с применением репортерных генов, может
существенно повлиять на прогресс Т-клеточной терапии и вывести ее на существенно
новый уровень.
Характеристика методик использованных для выполнения in vitro и in vivo
экспериментов
Ретровирусные векторы
Для доставки необходимого генетического материала в клетки мишени в
настоящей работе использовались ретровирусные векторы. Созданный ранее в нашей
лаборатории
ретровирусный
вектор
SFG-wild-type-HSV1-tk/GFP
(wt-tk),
несущий
репортерный ген HSV1-tk дикого типа (V.Ponomarev, 2003) использовался в качестве
базового. Мутированный вариант гена HSV1-tk (HSV1-sr39tk), любезно предоставленный
доктором S.S Gambhir (Стенфордский университет, Калифорния, США), был клонирован
в SFG-wild-type-HSV1-tk/GFP вектор вместо HSV1-tk дикого типа. В результате была
получена конструкция SFG-HSV1-sr39tk/GFP (sr39tk). При создании ретровирусных
векторов на основе wt-tk и sr39tk, несущих точечную мутацию, полученных в результате
полимеразно цепной реакции (ПЦР) с использованием олигонуклеотидных праймеров, с
заменой аланина на тирозин в 167-м положении (A167Y), были получены векторы SFGHSV1-A167Ytk/GFP
(A167Ytk)
и
SFG-HSV1-A167Ysr39tk/GFP
(A167Ysr39tk)
соответственно, а выполнение мутации в 176-м положении с заменой аргинина на
глутамин (R176Q) на основе wt-tk и sr39tk привело к получению ретровирусных векторов
SFG-HSV1-R176Qtk/GFP (R176Qtk) и SFG-HSV1-R176Qsr39tk/GFP (R176Qsr39tk). На
основе гена деоксицитидинкиназы (dCK) человека был создан его мутированный вариант
(dCKDM), содержащий точечные мутации в положении 104 и 133 с заменой аргинина на
метионин (положение 104, R104M) и аспарагиновой кислоты на аланин (положение 133,
D133A), с помощью полимеразно цепной реакции с использованием олигонуклеотидных
праймеров, а затем был клонирован в SFG-wild-type-HSV1-tk/GFP вектор вместо HSV1-tk
дикого типа. В результате была получена конструкция ретровирусного вектора SFGdCKDM/GFP. Помимо созданных ретровирусных векторов несущих, кроме кДНК
репортерного гена, ряд регуляторных и служебных элементов, обеспечивающих
заданную, постоянную или контролируемую транскрипционными факторами, экспрессию
в клетках эукариот, в работе использовали ретровирусный вектор SFG-PIP, кодирующий
простат-специфический мембранный антиген человека (human prostate membrane specific
antigen (hPSMA)) и ген резистентности к пуромицину, а также ретровирусный вектор,
несущий химерный антигеновый рецептор Pz1, определяющий специфичность к
16
мембранному антигену карциномы простаты (hPSMA-directed chimeric antigen receptor,
CAR), были описаны ранее (M.Gong, 1999). Для создания индуцируемой ген-репортерной
системы использовали искусственный NFAT энхансерный элемент, содержащий четыре
последовательных
повтора
участка
связывания
NFAT
«4
x
(ggaggaaaaactgtttcatacagaaggcgt)» (V.Ponomarev 2001).
Клеточные линии и их культивирование
Для выполнения in vitro и in vivo экспериментов в работе были использованы следующие
клеточные линии:
-Клеточная линия глиомы человека – U87, полученная из ATCC, Роквиль, Мериленд,
США. Культивирование U87 клеток проводили в среде MEM, содержащей 10%
эмбриональной телячьей сыворотки, антибиотики (пенициллин и стрептомицин 10000ЕД),
глутамин (0,292 г/л), при температуре 370С в атмосфере 5% СО2. Для трансдукции
клеточных линий ретровирусными ген-репортерными системами были использованы
супернатанты, полученные из культуры вирус-продуцирующих клеток H29GPG, с
добавлением 8 мкг/мл полибрена («Sigma», США).
Клеточная линия фибробластов (NIH3T3), клетки рака предстательной железы человека
(РС3), ретровирус-продуцирующая клеточная линия (PG13) и клетки-предшественники
лимфоцитов человека (Jurkat) экспрессирующие на поверхности функциональный Тклеточный рецептор (TCR) так же были получены из ATCC, Роквиль, Мериленд, США.
Культивирование клеток проводили в среде DMEM, обогащенной глюкозой и содержащей
10% эмбриональной телячьей сыворотки, пенициллин и стрептомицин (5 мг/мл), глутамин
(0,292 г/л), с добавлением 2 ммоль L-глутамина («Invitrogen», США) при температуре
370С в атмосфере 5% СО2. Для культивирования РС3 клеток вышеописанная среда
дополнительно содержала пируват натрия. NIH3T3 и РС3 клетки были трансдуцированы
вектором SFG-PIP.
Проточная цитофлуометрия и флуоресцентная микроскопия
Для выделения популяций с одинаковой экспрессией ген-репортерных систем
экспериментальные клеточные линии были отобраны по интенсивности свечения зеленого
флюоресцирующего белка (green fluorescent protein – GFP) на аппарате FACSvantage
(Becton Dickinson, Калифорния, США) с источником возбуждения флюоресценции 488 нм
и фильтром эмиссии 510 нм. Внутриклеточную локализацию репортерного протеина в
трансдуцированных клетках определяли с помощью флуоресцентного микроскопа (Nikon
Е2 × 66) с теми же параметрами возбуждения и эмиссии флуоресценции, как и при FACS
анализе.
17
Трансдукция и селекция Т-клеток
Для неинвазивного мониторирования локализации, персистенции и активации
адоптивных опухоль-специфических Т-клеток с использованием репортерных генов
выполнялась трансдукция Т-клеток созданными репортерными генами и химерным
рецептором.
У здорового донора было получено 100 мл периферической крови. Для
трансдукции
Т-клеток
использовали
свежие
супернатанты,
полученные
из
вируспродуцирующих клеток PG13. Через 48 часов после стимуляции Т-клеток с
использованием 22 мкг/мл фитогемагглютинина, проводили трансдукцию Т-лимфоцитов
ретровирусным вектором, кодирующим Pz1, с добавлением IL-2 (20 ед/мл), подробно
данная методика была ранее описана (T.Gade, 2005). На седьмой день выполняли
рестимуляцию Pz1-трансдуцированных Т-клеток путем их совместного культивирования с
клетками-мишенями NIH3T3, экспрессирующими B7.1 и hPSMA, с целью селективной
пролиферации Pz1 позитивных Т-клеток. Через 48 часов после рестимуляции на клетках
мишенях
NIH3T3/B7.1+/hPSMA+-
лимфоциты
трансдуцировали
ретровирусными
векторами dCKDM/GFP или HSV1-tk/GFP по описанной ранее методике (T.Gade, 2005).
Во время экспансии лимфоциты инкубировали в среде с добавлением IL-15 в дозе 10
нг/мл.
После трансдукции для выделения позитивной популяции лимфоцитов с экспрессией генрепортерных систем Т-клетки сортировали по позитивной экспрессии GFP, а отбор Тклеток с позитивной экспрессией CAR Pz1 осуществляли путем инкубации на
антигенпрезентирующих
клетках
РС3
после
иммунофлюоресцентного
анализа
с
использованием фикоэритрин (phycoerythrin, (PE))- меченных антител к IgG мыши
(Calbiochem) и PE-меченных с F(ab’)2 anti-human IgG1 («Southern Biotechnology», США) на
проточном цитофлюориметре FACS Vantage («Becton Dickinson», Калифорния, США).
Для получения позитивной популяции РС3-опухолевых клеток, экспрессирующих
hPSMA, выполняли их селекцию путем добавления 3 мкг/мл пуромицина. Экспрессию
hPSMA на РС3-опухолевых клетках оценивали на аппарате FACS при помощи программы
Cell Quest (BD Biosciences) с использованием антитела J591, любезно предоставленного
доктором N. Bander (Weill Medical College of Cornell University, Нью-Йорк, США).
Анализ цитотоксической функции Т-клеток в отношении специфических клетокмишеней
Оценку цитотоксической активности трансдуцированных Т-клеток проводили с
помощью нерадиоактивного 4-часового метода aCellaTM-TOX («Cell Technology, INC»).
Метод основан на количественном определении глицеральдегид-3-фосфатдегидрогеназы,
18
высвобождающейся из погибших клеток. Антиген-специфическую цитотоксичность
рассчитывали по формуле:
A – B1
D = ----------- ×100,
C – B2
где D – специфический лизис (в %); A – количество высвобождающейся глицеральдегид3-фосфатдегидрогеназы в эксперименте; B1 – количество спонтанно высвобождающейся
глицеральдегид-3-фосфатдегидрогеназы (в клетках-мишенях и клетках эффекторах); B2 –
количество спонтанно высвобождающейся глицеральдегид-3-фосфатдегидрогеназы (в
клетках-мишенях); C – максимальное количество высвобождающейся глицеральдегид-3фосфатдегидрогеназы.
Стимуляция Jurkat клеток in vitro и in vivo
In vitro TCR-специфичная стимуляция Jurkat клеток, в концентрации 0,5х106/мл в 6ти луночных планшетах, осуществлялась анти-CD3 антителами (1мкг/мл) отдельно или в
комбинации с анти-CD28 антителами (1мкг/мл) («Pharmingen», США) или на клетках РС3
трансдуцированых вектором SFG-PIP. Чрез 24-48 часа после начала in vitro стимуляции
выполняли оценку активированных Jurkat клеток с помощью проточной цитофлуориметри
и проводили оценку накопления радиофармпрепаратов. Для стимуляции Jurkat клеток in
vivo анти-CD3 и анти-CD28 антитела (в дозе 250 и 50 мкг/мышь, соответственно)
вводились внутривенно за 48 и 24 часа до момента визуализации с помощью
радиофармпрепаратов 18F-FEAU и 18F-FHBG и ПЭТ.
Оценка
накопления
радиофармпрепаратов:
арабинофуранозил-5-этилурацила
(FEAU)
и
2-флюоро-2’-деокси-1-β-Dпенцикловира
(PCV)
в
трансдуцированных U87 клетках и накопления FEAU трансдуцированными Тклетками in vitro
С целью определения фосфорилирующей активности и выбора лучшей пары
репортерный ген + радиофармпрепарат для проведения in vivo экспериментов выполняли
in vitro оценку накопления радиофарпрепаратов в клетках, трансдуцированных
созданными ген-репортерными системами.
Оценку накопления 3H-FEAU и 3H-PCV выполняли согласно описанной раннее
методике (J.Tjuvajev, 1995). Данные представлены как отношение измеренной активности
в собранных клетках к активности, определяемой в среде по формуле: (дисинтеграция в
минуту (dpm)/г клеток) : (dpm/мл среды). Интенсивность накопления (Ki) для 3H-FEAU и
3
H-PCV определяли путем построения графика отношения (dpm/г клеток) или (dpm/мг
19
белка) : (dpm/мл среды) к времени инкубации и представляли в единицах выведения
радиотрейсера из среды (мл среды/мин/г клеток или мг белка). Дополнительно, с целью
нормализаци используемых клеточных культур по их пролиферативной активности,
проводили оценку накопления тимидина с радиоактивной меткой
14
С (14С-Thymidin)
одновременно с 3H-FEAU и 3H-PCV.
Оценка чувствительности к лекарственным препаратам
Методику определения активности митохондриальной дегидрогеназы ”WST-1 test”
(«Roche», Германия) использовали для оценки цитотоксического эффекта (IC50) GCV
(CYTOVENE-IV; «Roche Laboratories Inc».), бромовенилдеоксиуридина – BVdU (E)-5-(2Bromovinyl)-2’-deoxyuridine
(«Sigma-Aldrich»,
США),
гемцитабина
гидрохлорида
(Гемзар®, «Eli Lilly and Company», США) и цитарабина (Ara-C, «Bedford LaboratoriesTM»,
США) в контрольных и трансдуцированных U87 клетках (GCV, BVdU) и в контрольных и
трансдуцированных Т-клетках (GCV, Гемзар®, Ara-C). Клетки инкубировали с препаратом
в течение 72-96 ч, после чего проводили оценку их жизнеспособности. Диапазон
концентраций препарата составлял от 1 нмоль/л до 10 ммоль/л.
Экспериментальные группы животных
В исследовании использовали мышей линии nude («Taconic», США). Для создания
опухолевой модели U87 клетки, трансдуцированные репортерной конструкцией, были
введены в количестве 5 × 106 подкожно. В качестве негативного контроля использовали
нетрансдуцированные U87 клетки. Рост опухоли у животных мониторировали ежедневно.
Для неинвазивной in vivo оценки миграции Т-клеток использовали иммунодефицитные 68 недельных мышей линии SCID/beige («Taconic», США). Для создания легочной
метостатической опухолевой модели карциномы простаты мышам внутривенно вводили
PC3/hPSMA+-клетки в дозе 4x106. Лимфоциты с двойной трансдукцией Pz1+ и
dCKDM/GFP+ животным вводили внутривенно в дозе 20x106. Группа животных, которым
лимфоциты не вводили, служила негативным контролем. Для создания подкожных Jurkat
инфильтратов клетки вводились подкожно иммунодефицитным 6-8 недельным мышам
линии SCID/beige («Taconic», США) в области плеч в количестве 10х106 Jurkat клеток в
150 мкл матригеля («Becton Dickinson», США) на каждое место инъекции. Анестезию
проводили смесью изофлурана и кислорода (1 : 50).
Компьютерная томография
Для оценки роста опухолей у животных использовали компьютерную томографию.
Для регистрации изображений использовали компьютерный томограф («Gamma Medica»,
США).
Реконструкцию
полученных
изображений
выполняли
с
использованием
програмного обеспечения 3D conebeam (Feldkamp). Для контрастирования сердца и
20
кровеносных сосудов внутривенно вводили контрастный препарат Fenestra™ VC («Alerion
Biomedical Inc.»).
Оценка накопления радиофармпрепаратов, меченных изотопом
18
F, – FEAU и 9-[4-
флюоро-3-(гидроксиметил)бутил]гуанина (FHBG)
Синтез
18
F-FEAU и
18
F-FHBG выполняли по методике, описанной ранее
(I.Serganova, 2004; M.Alauddin, 1998). ПЭТ-визуализацию выполняли с помощью сканера
FOCUS 120 microPETTM scanner («Siemens Preclinical Solutions», США). Для оценки
18
накопления радиофармпрепарата с меткой
F (Т1/2 = 109 мин) использовали
энергетический диапазон 350–750 кэВ и временное окно 6 нс. При исследовании каждого
животного получали как минимум 10 × 106 случайных событий. ПЭТ-визуализацию
проводили через 2 ч после внутривенного введения
после введения
18
18
F-FEAU в дозе 7,4 мБк. Через 24 ч
F-FEAU этим же животным вводили внутривенно
18
F-FHBG в дозе 7,4
мБк с последующей ПЭТ-визуализацией через 2 ч после введения. В экспериментах с Тклетками исследование проводили после определения опухоли с помощью КТ. ПЭТвизуализацию проводили в день введения и на 3-й день после введения лимфоцитов, через
2 часа после внутривенной инъекции
18
F-FEAU в дозе 7,4 мБк. Оценку и анализ
полученного ПЭТ-изображения выполняли с помощью программы AsiPROTM software
(«Siemens Preclinical Solutions», США). Интенсивность накопления радиофармпрепарата в
тканях (%ID/см3 ткани) рассчитывали на основании полученного ПЭТ-изображения с
оценкой максимального накопления радиофармпрепарата в единице объема ткани.
Измерение накопления радиофармпрепарата в образцах тканей
После выполнения ПЭТ с
18
F-FEAU и
18
F-FHBG, образцы опухоли и мышечной
ткани были извлечены, промыты в изотоническом растворе и взвешены. Концентрация
радиоизотопа в образцах опухоли и мышечной ткани была измерена на γ-счетчике (Model
A5550, Packard, «United Technologies», США) и представлена как процент от введенной
дозы на 1 г ткани (%ID/г ткани).
Гистологический анализ
Гистологическое исследование образцов опухолевой ткани было выполнено по
методике описанной ранее (P.Gregor, 2005). Свежевыделенная опухолевая ткань была
заморожена в OCT-реагенте («Sakura Finetek») для иммунофлюоресцентного анализа.
Опухолевые образцы инкубировались с первичными антителами - мышиными антиhPSMA mAbs 7C12, которые были любезно предоставлены доктором P.Gregor, (Memorial
Sloan-Kettering
Cancer
Center,
Нью-Йорк,
США),
и
кроличьими
анти-GFP
поликлональными антителами класса IgG (Invitrogen, cat#A11122) - с последующим
инкубированием со вторичными антимышиными антителами Alexa Fluor® 555 и
21
антикроличьими 488 антителами соответственно (Invitrogen). Для визуализации ядер
использовали 4,6-диамидино-2-фенилиндоле. Оценку иммунофлюоресценции выполняли
на флюоресцентном микроскопе (Axioplan-2, «Carl Zeiss Microimaging Inc.»).
Статистический анализ
Статистическую обработку полученных данных проводили с использованием
программы Graph Prism 4 (GraphPad Software, San Diego, CA, США). Анализ включал
непараметрический Mann-Whitney U тест, а также анализ выживаемости по методу
Каплана-Майера. В каждой группе однородных данных рассчитывали среднее значение и
стандартные отклонения. Сравнение достоверности различий между парными данными в
одних и тех же объектах наблюдения осуществлялись с помощью метода Стьюдента.
Различия между сравниваемыми параметрами считали статистически значимыми при p <
0,05.
РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ И ИХ ОБСУЖДЕНИЕ
1. Прогностическое значение оценки инициального поражения и раннего ответа на
терапию при помощи ПЭТ с 18F-ФЛТ у пациентов с неходжкинскими лимфомами
В выполненном ретроспективном исследовании была проанализирована группа
пациентов с впервые диагностированной ДВККЛ, которым выполняли ПЭТ с
18
F-ФЛТ в
дополнение к рутинным методам визуализации. Из 39 больных 21 был мужского пола, 18
-женского пола при медиане возраста на момент диагноза 51,9 (18 – 67) лет.
Согласно инициальному стадированию 9 пациентов были с 1-стадией заболевания. Стадия
2, 3 и 4 были определены у 4 (10,3%), 4 (10,3%) и 22 (56,4%) пациентов соответственно.
Медиана наблюдения составила 21 (4 - 35) месяц. 28 больных не имели или у них было не
более одного экстранодального очага поражения, у 11 пациентов было выявлено 2 и более
экстранодальных очага. По окончании терапии у 32 пациентов была определена полная
ремиссия (ПО), у 7 частичный ответ (ЧО). Всего пациентам было выполнено 124 ПЭТ, из
них до начала терапии 78 исследований (суммарно ПЭТ с
18
F-ФЛТ и ПЭТ с
18
F-ФДГ).
После 1-го курса противоопухолевой терапии, в среднем на 10-12 день от окончания, всем
39 пациентам выполняли П-ПЭТ с 18F-ФЛТ, по результатам которой 32 пациента (82,1%)
были негативны, у 7 (17,9%)
было отмечено накопление РФП. По завершению
запланированной противоопухолевой терапии пациентам выполняли КТ для определения
остаточного образования. 7 пациентам, у которых по данным КТ было обнаружено
остаточное образование, была выполнена З-ПЭТ с 18F-ФЛТ. У 2 (28,6%) из 7 пациентов у
которых было отмечено накопление 18F-ФЛТ после П-ПЭТ и у 1 из 32 (3,1%) пациента, из
группы негативных по накоплению 18F-ФЛТ после П-ПЭТ, было отмечено накопление 18FФЛТ после З-ПЭТ. За время наблюдения дополнительно у 2-х пациентов из группы
22
негативных и 2-х пациентов из группы позитивных по накоплению 18F-ФЛТ после П-ПЭТ
был в дальнейшем диагностирован рецидив заболевания. Данные по взаимосвязи между
накоплением 18F-ФЛТ после П-ПЭТ и результатами терапии представлены в табл. 3.
Таблица 3. Оценка ответа на терапию у пациентов позитивных и негативных по
накоплению 18F-ФЛТ после П-ПЭТ исследования
Корреляция инициального накопления 18F-ФЛТ с ответом на терапию
На диагностическом этапе ПЭТ с
18
F-ФЛТ был успешно выполнен всем 39 пациентам,
полученные результаты коррелировали с данными КТ и/или ПЭТ/КТ с 18F-ФДГ. Среднее
значение SUVmax у пациентов с
18
F-ФЛТ составило 6,8±2,2 (от 4,5 до 14,1), тогда как
среднее значение SUVmax у пациентов с
18
F-ФДГ было достоверно выше 14,3±3,6 (от 4,9
до 18,8). Для определения прогностической значимости полученных инициальных данных
накопления
18
F-ФЛТ их сравнили с ответом на терапию (ПО или ЧО). Инициальное
среднее значение SUVmax было достоверно ниже у пациентов, достигших полного ответа SUVmax 6,3±1,6, чем у пациентов, не достигших полной ремиссии - SUVmax 9,5±3,2
(р=0,0176).
Для определения взаимосвязи между инициальным накоплением
международного
прогностического
индекса,
последние
18
были
F-ФЛТ и значениями
использованы
для
стратификации пациентов на подгруппы низкого - при значении МПИ ≤ 2 и высокого
риска – при значении МПИ ≥ 2. SUVmax18F-ФЛТ было ниже в подгруппе низкого риска
(SUVmax 6,3±1,6), тогда как для подгруппы высокого риска этот показатель был выше
(SUVmax7,7±2,9,) однако, различия недостоверны (р>0,05).
Прогностическое значение накопления 18F-ФЛТ на результаты лечения и выживаемость
Наблюдению были доступны все 39 пациентов. Медиана наблюдения составила 21 (4 - 35)
месяц. За время наблюдения у 7 (17,9%) пациентов отмечался рецидив или прогрессия
заболевания из которых 4 пациента умерло. Было показано, что инициальное значение
SUVmax было достоверно выше у пациентов, у которых причиной смерти была лимфома,
23
так среднее значение SUVmax у них составило 10,2±3,7 по сравнению с SUVmax 6,3±1,5
(р=0.04) у всех остальных пациентов.
При медиане наблюдения 21 месяц OS составила 78,9% для всей когорты пациентов рис.
5, при этом в группах пациентов, негативных или позитивных по результатам П-ПЭТ с18FFLT общая выживаемость составила 86,5% и 41,6%, соответственно р<0,05 рис. 6.
Рисунок 5. Общая выживаемость для всей группы пациентов.
Рисунок 6. Общая выживаемость в группах негативных и позитивных по накоплению 18FФЛТ по данным П-ПЭТ.
Была выявлена взаимосвязь между PFS и результатами промежуточного ПЭТ
исследования: выживаемость PFS за исследуемый период пациентов с негативным и
позитивным П-ПЭТ с 18F-ФЛТ составила 85,1% и 35,7% соответственно (р<0,05) рис. 7.
24
Рисунок 7. Выживаемость до прогрессии или рецидива в группах негативных и
позитивных по накоплению 18F-ФЛТ по данным П-ПЭТ.
Результаты данного исследования продемонстрировали взаимосвязь между PFS и
отрицательным результатом в накоплении 18F-ФЛТ после П-ПЭТ рис. 7 и рис. 8. Различие
между инициальным накоплением 18F-ФЛТ и накоплением после П-ПЭТ вероятнее всего
отражает наличие взаимосвязи между пролиферативной активностью клеток образования
и ранним ответом на терапию и пролиферативной активностью клеток образования рис. 8.
а
б
Рисунок 8. Накопление
18
F-ФЛТ при ПЭТ до лечения и после первого блока
химиотерапии. Представлены полученные ПЭТ изображения (проекция максимальной
интенсивности) и совмещенные изображения ПЭТ/КТ (аксиальные и фронтальные срезы).
Определяются
множественные
увеличенные
лимфатические
узлы,
образующие
конгломерат, в области шеи слева, в средостении и брюшной полости. а) до лечения
определяется активное накопление
18
F-ФЛТ, б) после первого блока химиотерапии
накопление данного радиофармпрепарата резко уменьшилось и не превышает фонового
накопления в печени.
25
Использование ПЭТ с
18
F-ФЛТ позволяет неинвазивно in vivo определять
пролиферативную активность клеток опухоли и дополнительно позволяет комплексно
оценить активность транспортной и фосфорилирующей системы клетки в организме
пациента. Продемонстрированная высокая чувствительность ПЭТ визуализации на основе
накопления нуклеозидных РФП позволила сформулировать гипотезы использования
данного класса соединений в качестве проб для неинвазивного ПЭТ исследования
биологических процессов.
2. Создание и оценка ген-репортерных систем на основе человеческого гена
деоксицитидинкиназы, для использования в клинических протоколах неинвазивной
визуализации результатов клеточной терапии
В настоящее время разработаны эффективные протоколы терапии лечения
инфекций, вызванных реактивацией цитомегаловируса (ЦМВ) и Эпштейна-Барр вируса
(ЭБВ) ассоциированных с трансплантацией гемопоэтических стволовых клеток (ТГСК),
путем ведения специфических цитотоксических Т-лимфоцитов.
Проанализированые и представленые результаты выполненного ретроспективного
анализа пациентов после аллогеной ТГСК (смотри раздел «Материалы и методы»)
продемонстрировали, что ЦМВ и ЭБВ инфекции и ассоциированные с ними осложнения,
являются причиной заболеваемости и смертности пациентов после аллогенной ТГСК.
В настоящее время, помимо разработки новых протоколов по диагностики и
упреждающей терапии данных инфекций немаловажную роль в лечении ЦМВ и ЭБВ
инфекции играют многообещающие методы с использованием Т-клеточной терапии.
Сдерживающим фактором широкого использования данного вида терапии является
сложность методики получения специфических Т-лимфоцитов для последующего
клинического рутинного использования и отсутствие возможности неинвазивной
визуализации, и контроля проводимой терапии. Применение метода молекулярной
визуализации с использованием репортреных генов позволит проводить неинвазивную
оценку клеточной терапии.
2.1 Создание и in vitro оценка химерных ген-репортерных систем на основе
гена деоксицитидинкиназы человека
Из известных деоксирибонуклеозидкиназ человека, белок деоксицитидинкиназы
(dCK) является ключевым ферментом экзогенного пути синтеза нуклеотидов. dCK
приводит к образованию монофосфатных форм деоксицитидина, деоксиаденозина,
деоксигуанозина, а так же способен фосфорилировать цитотоксические препаратыпроизводные нуклеозидов.
26
Используя методику направленного мутагенеза, были выполнены точечные
мутации
в
гене
деоксицитидинкиназы
человека.
Затем
ген
дикого
варианта
деоксицитидинкиназы человека и его мутированные варианты были клонированы в SFGwild-type-HSV1-tk/GFP вектор вместо HSV1-tk дикого типа. В результате были получены
конструкции ретровирусного вектора SFG-dCK/GFP (dCK/GFP), SFG-dCKDM/GFP
(dCKDM/GFP),
SFG-dCKrTK3/GFP
(dCKrTK3/GFP),
SFG-dCKepTK6A/GFP
(dCKepTK6A/GFP), SFG-dCKepTK16A/GFP (dCKepTK16A/GFP) и SFG-dCKssTK1/GFP
(dCKssTK1/GFP). Подробная структура ретровирусных векторов представлена в таблице
4. Полученные генетические последовательности секвенировали для подтверждения
успешности клонирования.
Таблица
4.
Схематическая
структура
ретровирусных
векторов
и
различия
в
аминокислотной последовательности дикого варианта гена деоксицитидинкиназы и его
мутированных вариантов
Структура
ретровирусных векторов
Аминокислотная последовательность:
1 2 3 4 5 6 7 8 9 …… 100 …… 103 104 105 …… 132 133 134 ……
LTR-dCK/GFP-LTR
M A T P P K R S C …… A …… S
R
I
…… S
D
R
LTR-dCKDM/GFP-LTR
M A T P P K R S C …… A …… S
M
I
…… S
A
R
LTR-dCKrTK3/GFP-LTR
M A T P P K R S C …… V …… S
M
I ……
S
A
R
LTR-dCKepTK6A/GFP-LTR
M A T P P K R S C …… A …… S
Q
I ……
S
G
R
LTR-dCKepTK16A/GFP-LTR
M A T P P K R S C …… A …… S
Q
I ……
S
N
R
LTR-dCKssTK1/GFPLTR
M A T P P K R S C …… A …… S
M
I ……
S
S
R
Для оценки функциональной активности вновь созданных химерных генрепортерных систем клеточные линии глиомы человека U87 были трансдуцированы
ретровирусными векторами, конституционально экспрессирующими химерный ген
деоксицитидинкиназы или его мутированные варианты и GFP, соответственно, под
контролем
5’LTR.
С
помощью
флуоресцентной
микроскопии
были
оценены
внутриклеточная локализация и степень флюоресценции dCK/GFP, dCKDM/GFP,
dCKrTK3/GFP, dCKepTK6A/GFP, dCKepTK16A/GFP и dCKssTK1/GFP.
In vitro ферментативная активность белков, кодированных репортерными генами
dCK, dCKDM, dCKrTK3, dCKepTK6A, dCKepTK16A, dCKssTK1 и wt-tk (клетки
трансдуцированные wt-tk использовались для позитивного контроля), была оценена с
помощью метода определения накопления радиофармпрепаратов 3H-FEAU и 3H-PCV.
Накопление 3H-FEAU было обнаружено во всех трансдуцированных U87 клетках и
результат был статистически значимо выше, чем в нетрансдуцированных клетках
(использовались в качестве отрицательного контроля), (р < 0,05). Небольшое накопление
27
3
H-PCV было получено только в клетках трансдуцированных wt-tk и dCKepTK16A.
Накопления 3H-FEAU и 3H-PCV в нетрансдуцированных U87 клетках была равна фоновой
(Ki: 0,003 мл среды/мин/г клеток и 0,002 мл среды/мин/г клеток, соответственно) (рис. 9).
Кi, мл среды/мин/г клеток
0.75
3
H-FEAU
3
H-PCV
0.50
0.25
TK
1
A
K
ss
dC
K
ep
16
dC
dC
K
rT
dC
K
ep
6A
K
3
M
D
dC
K
dC
K
t-t
k
w
N
/T
0.00
Рисунок 9. Интенсивность накопления радиофармпрепаратов (Ki) в нетрансдуцированных
(N/T) и трансдуцированных U87 клетках.
Чувствительность клеток, трансдуцированных репортерными генам мутированных
вариантов гена человеческой деоксицитидинкиназы и wt-tk, к нуклеозидным аналогам,
используемым в клинической практике (GCV, Ara-C, гемзару и BVdU), была оценена с
использованием метода определения активности митохондриальной дегидрогеназы.
Клетки глиомы человека, трансдуцированные репортерными генами, созданными на
основе гена человеческой деоксицитидинкиназы показали слабую чувствительность к
GCV (IC50 была больше ~ 900 мкмоль/л), при этом чувствительность (IC50) к GCV клеток,
трансдуцированных wt-tk составила ~ 11мкмоль/л. Обратная картина наблюдалась при
оценке чувствительности (IC50) к производным пиримидинов. Чувствительность (IC50) к
Ara-C, гемзару и BVdU клеток, трансдуцированных мутированными вариантами гена
человеческой деоксицитидинкиназы как минимум в 10 раз превышала таковую клеток,
трансдуцированных
wt-tk.
Самая
высокая
чувствительность,
к
вышеуказанным
препаратам, была показана клетками, трансдуцированными репортерными генами
dCKDM и dCKrTk3 (табл. 5).
28
Таблица 5. Оценка чувствительности нетрансдуцированных (N/T) и трансдуцированных
ген-репортерными системами U87 клеток к препаратам
- производным нуклеозидов.
Значения ингибирующей концентрации (IC50) препаратов выражены в мкмоль/л
N/T
Клетки
dCK
dCKDM
dCKrTk3
dCKep6A
dCKep16A
dCKssTk1
HSV1 -tk
Препарат
IC 50 Ara -C
1.000
0.130
0.090
0.098
0.160
0.179
0.834
0.981
(мкмоль/л)
± 0.134
± 0.011
±0.012
±0.012
± 0.013
± 0.015
± 0.019
± 0.147
IC 50 Gemzar
(мкмоль/л)
0.648
0.061
0.048
0.045
0.071
0.053
0.063
±0.071
±0.005
±0.006
±0.006
±0.005
±0.008
±0.008
0.629
±0.078
1.49
±0.011
0.781
0.981
±0.009
±0.013
13.4
±1.771
>1,000
±0.167
883
±0.161
913
±0.152
11.0
±1.771
IC50 BVdU
(мкмоль/л)
>897.0
± 0.144
IC 50 GCV
(мкмоль/л)
>1,000
±0.164
>731.0
0.762
0.682
±0.114
±0.008
±0.024
>1,000
±0.151
>1,000
±0.149
>1,000
±0.103
2.2 In vivo неинвазивная оценка экспрессии химерных ген-репортерных систем на
основе гена деоксицитидинкиназы человека, обладающих специфичностью к РФП
производным пиримидинов в экспериментальных животных с помощью ПЭТ
In vivo оценку ПЭТ-визуализации экспрессии репортерных генов выполняли на
мышах с подкожными опухолями, сформированными из нетрансдуцированных U87
клеток и клеток, трансдуцированных репортерными генами dCK, dCKDM и wt-tk. В
качестве отрицательного контроля в исследовании использовали опухоли, растущие из
нетрансдуцированных U87 клеток, а опухоли, растущие из клеток, трансдуцированных
репортерным
геном
радиофармпрепаратов
wt-tk
18
служили
F-FEAU и
18
для
позитивного
контроля.
Накопление
F-FHBG было отмечено только в опухолях,
экспрессирующих репортерный ген wt-tk. Интенсивность накопления
18
F-FEAU в
опухолях, экспрессирующих репортерные гены dCKDM, была статистически значимо
выше, чем в опухолях, экспрессирующих репортерный ген dCK и N/T (р < 0,05) (рис. 10
А,Б).
29
А
N/T
dCKDM
dCK
dCKDM
wt-tk
dCKDM
18 F-FEAU
10
5.0
а
б
3.0
в
1.5
N/T
dCKDM
dCK
dCKDM
wt-tk
dCKDM
0.5
18 F-FHBG
Корональное сечение
%ID/см 3 ткани
0
г
Б
д
10.0
18
е
F-FEAU
18
F-FHBG
%ID/см3 ткани
7.5
5.0
2.5
0.0
N/T
dCK
dCKDM
wt-tk
Рисунок 10. ПЭТ-визуализация экспрессии репортерных генов dCK, dCKDM и wt-tk после
введения радиофармпрепаратов
18
18
F-FEAU и
F-FHBG. А – поперечные срезы,
полученные при ПЭТ-визуализации в нетрансдуцированных (N/Т) опухолях (а, г) и
опухолях, экспрессирующих репортерные гены dCK (б, д), wt-tk (в, е), dCKDM (а, б, в, г,
д, е). Последовательная ПЭТ-визуализация, выполненная у одних и тех же животных
через 2 ч после внутривенного введения
ряд); Б – оценка накопления
18
F-FEAU и
18
F-FEAU (верхний ряд) и
18
18
F-FHBG (нижний
F-FHBG через 2 ч после их внутривенного
введения у одних и тех же животных; представлена как % от введенной дозы на 1см3
ткани (% ID/см3 ткани).
Полученные данные ПЭТ были подтверждены результатами оценки накопления
18
F-FEAU и
18
F-FHBG в образцах опухолевых тканей (рис. 11). Была подтверждена
специфичность накопления радиофарпрепарата
18
репортерные
18
гены
dCKDM.
Накопление
F-FEAU в опухолях, экспрессирующих
F-FEAU
и
18
F-FHBG
в
опухолях,
экспрессирующих репортерный ген dCK и растущих из нетрансдуцированных клеток, а
также в мышечной ткани не превышало фоновое.
30
а
10.0
18
%ID/г ткани
18
F-FEAU
F-FHBG
7.5
5.0
2.5
0.0
N/T
wt-tk
dCK
Рисунок 11. Оценка накопления радиофарпрепаратов
18
dCKDM
F-FEAU и
18
F-FHBG в образцах
опухолевой ткани через 2-часа после их внутривенного введения (данные представлены
как % от введенной дозы на г/ткани).
3. In vitro оценка и неинвазивное мониторирование распределения и локализации
опухоль-специфических Т-клеток трансдуцированных CAR и ген-репортерной
системой
Мониторирование локализации адоптивных опухоль-специфических Т-клеток,
введенных пациентам в терапевтических целях, позволит выполнять контроль и
коррекцию проводимой Т-клеточной терапии в масштабе реального времени в
соответствии с наблюдаемым терапевтическим эффектом и предвосхищать развитие
возможных побочных реакций. Наиболее адекватным подходом для мониторирования
противоопухолевой
клеточной
терапии
является
неинвазивная
молекулярная
визуализация с использованием репортерных генов. В настоящем эксперименте была
оценена возможность стабильной трансдукции человеческих Т-лимфоцитов двумя
векторами (несущими CAR и репортерный ген dCKDM), влияние данной трансдукции на
жизнеспособность и функциональную активность ген-модифицированных человеческих
Т-клеток.
3.1 In vitro оценка эффективности трансдукции человеческих Т-лимфоцитов генрепортерной системой и CAR, и оценка их функциональной активности
Для in vitro оценки человеческие Т-клетки, полученные от здорового донора, были
трансдуцированы химерным рецептором (Pz1) и ген-репортерной системой dCKDM/GFP
или HSV1-tk/GFP. Т-лимфоциты трансдуцировынные химерным рецептором (Pz1) и генрепортерной
системой
HSV1-tk/GFP
использовались
для
позитивного
контроля.
Схематическая структура ретровирусных векторов химерного рецептора и генрепортерных систем представлена на (рис. 12).
31
а
Химерный рецептор (Pz1)
PSMA specific
J591-­‐scFv
hinge
IC CD3ζ
б
Репортерный ген
SD
Ψ+
SA
5’LTR
SD
5’LTR
Ψ+
dCKDM
GFP
3’LTR
HSV1-­‐tk
GFP
3’LTR
SA
Рисунок 12. Структура экспериментальных ретровирусных векторов, кодирующих (а)
химерный рецептор и (б) ген-репортерные системы.
Экспрессию анти-PSMA химерного антигенного рецептора (Pz1) на поверхности
клеток и флюоресценцию GFP внутри клетки оценивали с помощью проточной
цитофлюориметрии. Было выявлено, что 93% Т-клеток стабильно экспрессировали Pz1
(рис. 13,а), а более 75% Т-клеток с двойной трансдукцией стабильно экспрессировали оба
трансгена - Pz1 и HSV1tk/GFP или Pz1 и dCKDM/GFP - 78% и 76% Т-клеток
соответственно (рис. 13, б, в).
а
Pz1
Pz1 и HSV1-tk/GFP
78%
в
Pz1 и dCKDM/GFP
76%
Pz1
93%
б
GFP
Рисунок 13. Оценка экспрессии химерного рецептора Pz1 в отдельности (а), а также
вместе с ген-репортерными системами HSV1-tk/GFP (б) и dCKDM/GFP (в). Данные
проточной цитофлюориметрии.
Оценка цитолитической активности показала, что дополнительная трансдукция Тклеток, экспрессирующих Pz1, репортерными генами
dCKDM/GFP и HSV1tk/GFP не
повлияла на функциональную активность лимфоцитов в отношении PC3/PSMA+ клетокмишеней (рис. 14).
32
Pz1-HSV1-tk/PC3
80
Pz1-HSV1-tk/PC3 PSM A+
Специфический лизис %
Pz1-dCKDM /PC3
Pz1-dCKDM /PC3 PSM A+
60
40
20
0
100
50
25
12.5
1
Отношение клеток-эффекторов к клеткам-мишеням, х 100%
Цитостатическая активность Т-клеток, трансдуцированных:
Pz1 и HSV1-tk/GFP в отношении PC3/hPSMA+-клеток-мишеней;
Pz1 и dCKDM/GFP в отношении PC3/hPSMA+-клеток-мишеней;
Pz1 и HSV1-tk/GFP в отношении PC3-клеток дикого типа;
Pz1 и dCKDM/GFP в отношении PC3-клеток дикого типа.
Рисунок
14.
In
vitro
оценка
цитотоксичности
Т-клеток,
трансдуцированных
экспериментальными векторами. Т-клетки, трансдуцированные Pz1 и HSV1-tk/GFP и Pz1
и dCKDM/GFP, обладали цитотоксической активностью в отношении PC3-hPSMA+клеток-мишеней и не обладали цитотоксической активностью, в отношении PC3-клетокмишеней дикого типа.
Чувствительность
трансдуцированных
Т-клеток
к
нуклеозидным
аналогам,
используемым в клинической практике (GCV и Ara-C), была оценена с использованием
метода
определения
активности
митохондриальной
дегидрогеназы.
Т-клетки,
трансдуцированные только Pz1, или Т-клетки, экспрессирующие Pz1 и dCKDM/GFP,
оказались малочувствительны к GCV (IC50>100 мкмоль/л), в то время как лимфоциты,
экспрессирующие Pz1 и HSV1tk/GFP, обладали высокой чувствительностью к GCV (IC50 =
9 ± 0,711 мкмоль/л). Однако при определении IC50 к Ara-C лимфоциты, экспрессирующие
Pz1 и dCKDM/GFP, обладали высокой чувствительностью к препарату по сравнению с Тклетками, трансдуцированными только Pz1 или Pz1 и HSV1tk/GFP табл. 6.
Вектор
Pz1
Pz1 и HSV1-tk/GFP
Pz1 и dCKDM/GFP
Препарат
IC50 Ara-C
(мкмоль/л)
5.17±0,132
4,81±0,147
0.39±0,012
IC50 GCV
(мкмоль/л)
>100
9,0±0,711
>100
33
Таблица 6. Чувствительность Т-клеток, трансдуцированных Pz1, Pz1 и HSV1-tk/GFP и Pz1
и dCKDM/GFP, к препаратам - производным нуклеозидов. Значения ингибирующей
концентрации (IC50) препаратов выражены в мкмоль/л
In vitro ферментативная активность белков, кодированных репортерными генами
HSV1-tk/GFP и dCKDM/GFP была оценена с помощью метода определения накопления
радиофармпрепаратов. Накопление 3H-FEAU в лимфоцитах, трансдуцированных Pz1 и
HSV1-tk/GFP или Pz1 и dCKDM/GFP, было статистически значимо (р<0,05) выше по
сравнению с таковым в лимфоцитах, трансдуцированных только Pz1; интенсивность
накопления 3H-FEAU в Т-клетках, трансдуцированных только Pz1 была фоновой рис. 15.
0.0010
0.0008
мл/мг/мин
.
0.0006
0.0004
0.0002
0.0000
Pz1
Pz1/HSV1-tk/GFP Pz1/dCKDM/GFP
Рисунок 15. Интенсивность накопления (Кi) in vitro радиофармпрепарата Т-клетками,
трансдуцированными экспериментальными векторами. Накопление H3-FEAU в клетках,
трансдуцированных Pz1 и HSV-tk/GFP и Pz1 и dCKDM/GFP, было статистически значимо
выше (р<0,05), чем в Т-клетках, трансдуцированных только Pz1.
3.2 ПЭТ/КТ визуализация локализации адоптивных опухоль-специфических Тклеток трансдуцированных ген-репортерной системой и CAR
Т-клетки, трансдуцированные Pz1 и репортерным геном dCKDM/GFP, были
введены через хвостовую вену мышам, у которых развились метастазы рака простаты в
легких (PC3/hPSMA+-опухоли). До введения трансдуцированных лимфоцитов наличие
опухоли определялось с помощью КТ у всех животных (рис. 16, а-в). Группа животных с
PC3/hPSMA+-опухолями, которым не вводили трансдуцированные лимфоциты, служила
негативным контролем (см. рис. 16, в). ПЭТ-визуализацию локализации Т-клеток в
PC3/hPSMA+-опухолях, экспрессирующих Pz1 и dCKDM/GFP, выполнялась через 6 и 72
часа после внутривенного введения трансдуцированных лимфоцитов. Отчетливое
накопление
18
F-FEAU в проекциях опухолей у животных, получивших инъекцию
трансдуцированных Pz1 и dCKDM/GFP Т-клеток, определяли в день введения
34
лимфоцитов и через 72 часа после введения (см. рис. 16, а, б) по сравнению с животными,
не получавшими инъекций Т-клеток (см. рис. 16, в).
КТ
ПЭТ/КТ совмещение
ПЭТ
а
%ID/cm 3 ткани 2.0
1.5
б
1.0
0.5
в
0.0
Рисунок 16. Оценка локализации Т-клеток, экспрессирующих dCKDM/GFP, с помощью
ПЭТ/КТ. Показано соотношение накопления
18
F-FEAU при ПЭТ в области локализации
опухоли, определяемой при выполнении КТ. Представлены две группы животных: ПЭТ
выполнена через 6 (а) и 72 ч (б) с момента введения Т-клеток, трансдуцированных Pz1 и
dCKDM/GFP; в – ПЭТ у контрольной группы животных (негативный контроль).
Таким образом, отношение интенсивности специфического накопления
18
F-FEAU в
исследуемой (опухолевой) области к фоновому излучению у животных, получивших
инъекцию трансдуцированных лимфоцитов, было статистически значимо выше, чем
аналогичный показатель у животных контрольной группы (3,06 ± 0,9 к 1,06 ± 0,07; p<0,05;
рис. 17, а, б).
а
б
2.0
%ID/см3 ткани
нелеченные
1.5
1.0
0.5
0.0
%ID/см3 ткани ИО / %ID/см3 ткани ФИ
леченные
4
3
2
1
0
Леченные
ФИ
ИО
ФИ
Нелеченные
ИО
Рисунок 17. Оценка накопления радиофармпрепарата у леченных и нелеченных
животных: а - интенсивность накопления радиофармпрепарата через 2-часа после ее
внутривенного введения у леченных (через 6 ч после введения трансдуцированных Т35
клеток) и нелеченых животных (данные представлены как % от введенной дозы на 1 см3
ткани - % ID/см3 ткани); б - отношение накопления радиофармпрепарата в исследуемой
области (ИО) к фоновому излучению (ФИ) у леченных и нелеченных животных.
3.3 Гистология и иммунофлюоресцентный анализ образцов опухолевой ткани
Наличие метастазов рака простаты в легких было подтверждено гистологическим
методом при окраске образцов гематоксилином и эозином (рис. 18, а), а экпрессия hPSMA
определялась с помощью иммунофлюоресцентного окрашивания в обеих группах
животных (рис. 18, б, в). Иммунофлюоресцентный анализ подтвердил экспрессию GFP
только
в
образцах
опухолевой
ткани
животных,
получивших
терапию
трансдуцированными Pz1 и dCKDM/GFP лимфоцитами (рис. 18, б), в то время как в
контрольной группе экспрессии GFP не выявлено (рис. 18, в).
а
б
в
Рисунок 18. Гистологический и иммунофлюоресцентный анализ образцов опухолевой
ткани. Для оценки трансдуцированных Т-клеток (зеленая окраска) использовали антиGFP-антитела; наличие опухолевых клеток (красная окраска) подтверждали с помощью
использования анти-hPSMA-антител. Для окраски ядер клеток использовали 4,6диамидино-2-фенилинодол (синий). а - гистологический образец участка легочной ткани,
пораженного опухолью (окраска гематокслином и эозином); б - иммунофлюоресцентный
анализ
образца
легочной
ткани
с
опухолевым
поражением
после
введения
трансдуцированных Pz1 и dCKDM/GFP Т-клеток [трансдуцированные Т-клетки (зеленая
окраска) в легочной ткани, инфильтрированной опухолевыми клетками (красная
окраска)]; в - иммунофлюоресцентный анализ образца легочной ткани с опухолевым
поражением, полученного от животного контрольной группы (накопления Т-клеток в
данном препарате не выявлено, о чем свидетельствует отсутствие зеленого сигнала).
Таким образом, была показана возможность неинвазивной визуализации локадизации
человеческих
Т-клеток,
деоксицитидинкиназы
трансдуцированных
человека,
в
системной
CAR
модели
и
репортерным
карциномы
геном
простаты
с
использованием ПЭТ в режиме реального времени.
36
4. Создание и оценка двойной ген-репортерной системы для визуализации двух
независимых молекулярно биологических процессов в пределах одного организма
(визуализация локализации и активация ген-модифицированных Т-клеток)
Одним из ключевых моментов в процессе активации Т-клетки через Т-клеточный
рецептор (TCR) является активация ядерного фактора активированных лимфоцитов
(nuclear factor of activated lymphocytes - NFAT), являющегося транскрипционным
фактором для различных цитокиновых генов, в том числе для гена интерлейкина-2 (ИЛ-2).
Селективная экспрессия репортерного гена в результате активации NFAT позволяет:
1)
оценить
антигенспецифичность
трансдуцированных
репортерной
исследуемой
системой;
2)
популяции
Т-лимфоцитов,
оценить
эффективность
антигенпрезентации при использовании антигенпрезентирующих клеток для создания
антигенспецифичных цитотоксических Т-лимфоцитов.
Для успешной неинвазивной ПЭТ визуализации двух независимых молекулярнобиологических процессов в пределах одного организма необходимо наличие двух генрепортерных систем, каждая из которых должна обладать специфичностью к
определенному радиофармпрепарату. Дополнительно, репортерный ген используемый для
неинвазивного
мониторинга
локализации
модифицированных
Т-клеток
должен
находиться под контролем постоянного промотера, а репортерный ген позволяющий
неинвазивно визуализировать активацию Т-клеток под индуцируемым-промотером.
4.1 Создание и in vitro оценка химерных ген-репортерных систем обладающих
специфичностью к радиофармпрепаратам производным пуринов
Химерные гены создавались методом молекулярного клонирования. Используя
методику
направленного
генетические
мутагенеза
последовательности
создавали
секвенировали
точечные
для
мутации.
Полученные
подтверждения
успешности
клонирования.
При создании ретровирусных векторов на основе HSV1-tk/GFP (wt-tk) и HSV1sr39tk/GFP (sr39tk), несущих точечную мутацию с заменой аланина на тирозин в 167
положении (A167Y), были получены векторы HSV1-A167Ytk/GFP (A167Ytk) и HSV1A167Ysr39tk/GFP (A167Ysr39tk), соответственно (рис. 19).
37
АК последовательность :159 160 161 167 168 169 176
A
LTR
wild-type -HSV1 -tk
GFP
(wt-tk)
LTR
Амино кислота:
L
I
F
A
A
L
R
Б
LTR
HSV1 -sr39tk
(sr39tk)
GFP
LTR
Амино кислота :
I
F
L A
F
M
LTR
HSV1 -A167Ytk
(A167Ytk)
GFP
LTR
Амино кислота :
L
I
F
Y
A
L
HSV1 -A167Ysr39tk
GFP
(A167Ysr39tk)
LTR
Амино кислота :
I
F
L Y
F
M
R
В
R
Г
LTR
Рисунок
19.
Схематическая
структура
ретровирусных
векторов
и
R
различия
в
аминокислотной последовательности дикого варианта гена HSV1-tk и его мутированных
вариантов.
Для оценки функциональной активности вновь созданных химерных ген-репортерных
систем клеточные линии глиомы человека U87 были трансдуцированы ретровирусными
векторами wt-tk, sr39tk, A167Ytk, A167Ysr39tk, конституционально экспрессирующими
химерный ген тимидинкиназы HSV1 или его мутированного варианта и GFP,
соответственно, под контролем 5’LTR. Трансдуцированные U87 клетки были отобраны по
флуоресцентному сигналу GFP (в среднем ~500 флуоресцентных единиц).
In vitro ферментативная активность белков, кодированных ген-репортерными
системами: wt-tk, sr39tk, A167Ytk и A167Ysr39tk, была оценена с помощью метода
определения накопления радиофарпрепаратов 3H-FEAU и 3H-PCV. Накопление 3H-PCV
было обнаружено во всех трансдуцированных U87 клетках и результат был статистически
значимо выше, чем в нетрансдуцированных U87 клетках (которые использовались в
качестве контроля), (р < 0,05). Интенсивность накопления 3H-PCV в нетрансдуцированных
U87 клетках была равна фоновой (Ki: 0,002 мл среды/мин/г клеток). Накопление 3H-FEAU
было выявлено только в клетках, трансдуцированных репортерными генами wt-tk и sr39tk,
(Ki: 0,43, 0,69, среды/мин/г клеток, соответственно). Накопление 3H-FEAU в клетках,
трансдуцированных репортерными генами A167Ytk и A167Ysr39tk, было сравнимо со
значениями, полученными в нетрансдуцированных клетках (Ki: 0,003 мл среды/мин/г
клеток) (рис. 20).
38
1.00
3
H-FEAU
3
Кi, мл среды/мин/г клеток
0.75
0.50
0.25
0.00
Рисунок
20.
H-PCV
N/T
wt-tk
Интенсивность
A167Ytk
накопления
sr39tk
A167Ysr39tk
радиоактивно
меченных
проб
(Ki)
в
нетрансдуцированных (N/T) и трансдуцированных U87 клетках.
Чувствительность клеток, трансдуцированных wt-tk и его мутированными
вариантами, к нуклеозидным аналогам GCV и BVdU, используемым в клинической
практике,
была
оценена
с
использованием
метода
определения
активности
митохондриальной дегидрогеназы (рис. 21). Клетки, трансдуцированные репортерным
геном sr39tk, имели самую высокую чувствительность к GCV (IC50 составила 0,12
мкмоль/л). Чувствительность (IC50) к GCV клеток, трансдуцированных репортерными
генами wt-tk, A167Ytk и A167Ysr39tk составила: 10, 50 и 6 мкмоль/л соответственно,
тогда как для нетрансдуцированных клеток IC50 была больше 1 ммоль/л. При оценке
чувствительности к BVdU клетки, трансдуцированные репортерными генами wt-tk и
sr39tk, имели сходные значения IC50 (1,3 и 2,1 мкмоль/л соответственно).
Клетки, трансдуцированные репортерными генами A167Ytk и A167Ysr39tk, имели
A
Количество жизнеспособных
клеток, %
сходную с нетрансдуцированными клетками чувствительность к BVdU (IC50 > 1 ммоль/л).
100
80
60
40
20
0
N/T
0
1
2
3
4
5
6
wt-tk
GCV (log[концентрация]нмоль/л)
A167Ytk
sr39tk
Б
Количество жизнеспособных
клеток, %
100
A167Ysr39tk
75
50
25
0
0
1
2
3
4
5
6
BVdU (log[концентрация]нмоль/л)
39
Рисунок 21. Оценка чувствительности нетрансдуцированных (N/T) и трансдуцтрованных
ген-репортерными системами U87 клеток к препаратам - производным нуклеозидов: А –
GCV; Б – BVdU. Значения ингибирующей концентрации (IC50) препаратов выражены в
мкмоль/л и представлены в тексте.
4.2 Неинвазивная визуализация экспрессии ген-репортерных систем обладающих
специфичностью
к
радиофармпрепаратам
производным
пуринов
в
экспериментальных животных с помощью ПЭТ
In vivo оценку ПЭТ-визуализации экспрессии созданных ген-репортерных систем
выполняли
на
мышах
с
подкожными
опухолями,
сформированными
из
трансдуцированных U87 клеток. В качестве отрицательного контроля в исследовании
использовали опухоли, растущие из нетрансдуцированных U87 клеток. Самое высокое
накопление радиофармпрепаратов
18
F-FEAU и
18
F-FHBG было отмечено в опухолях,
18
экспрессирующих репортерный ген sr39tk. Интенсивность накопления
F-FHBG в
опухолях, экспрессирующих репортерный ген A167Ysr39tk, была в 2,5 раза выше по
сравнению с опухолями, экспрессирующими репортерные гены wt-tk и A167Ytk. В
отличие от опухолей, экспрессирующих репортреные гены wt-tk и sr39tk в которых было
отмечено высокое накопление радиофармпрепарата 18F-FEAU, интенсивность накопления
данного радиофармпрепарата в опухолях, экспрессирующих репортерные гены A167Ytk
и A167Ysr39tk не превышала фоновое накопление (рис. 22, А, Б).
А
б
а
в
г
%ID/см 3 ткани
10
18 F-FEAU
5.0
N/T
д
sr39tk
wt-tk
е
A167Ysr39tk
ж
A167Ytk
A167Ysr39tk
з
3.0
1.5
0.5
18 F-FHBG
0
N/T
Б
wt-tk
10.0
sr39tk
18
A167Ysr39tk
A167Ytk
A167Ysr39tk
F-FEAU
18
F-FHBG
%ID/см3 ткани
7.5
5.0
2.5
0.0
N/T
wt-tk
A167Ytk
sr39tk A167Ysr39tk
Рисунок 22. ПЭТ-визуализация экспрессии ген-репортерных систем wt-tk, sr39tk, A167Ytk
и
A167Ysr39tk
после
введения
радиофармпрепаратов
18
F-FEAU
и
18
F-FHBG.
40
Последовательная ПЭТ-визуализация, выполненная у одних и тех же животных через 2 ч
после внутривенного введения
18
F-FEAU (верхний ряд) и
18
F-FHBG (нижний ряд). А –
поперечные срезы, полученные при ПЭТ-визуализации в нетрансдуцированных (N/Т)
опухолях (а, д) и опухолях, экспрессирующих репортерные гены wt-tk (б, е), sr39tk (в, ж),
A167Ytk (г, з), A167Ysr39tk (в, г, ж, з).; Б – оценка накопления
18
F-FEAU и
18
F-FHBG
через 2 ч после их внутривенного введения у одних и тех же животных; представлена как
% от введенной дозы на 1см3 ткани (% ID/см3 ткани).
Полученные данные ПЭТ были подтверждены результатами оценки накопления
18
F-FEAU и
18
F-FHBG в образцах опухолевых тканей (рис. 23). Была подтверждена
специфичность накопления радиофарпрепарата
18
F-FHBG в опухолях, экспрессирующих
репортерные гены A167Ytk и A167Ysr39tk, при этом интенсивность накопления 18F-FHBG
была статистически значимо выше в опухолях, экспрессирующих репортерный ген
A167Ysr39tk.
Накопление
18
F-FEAU
и
18
F-FHBG
в
опухолях,
растущих
из
нетрансдуцированных клеток, и в мышечной ткани не превышало фоновое.
10.0
18
F-FEAU
18
F-FHBG
%ID/г ткани
7.5
5.0
2.5
0.0
N/T
wt-tk
sr39-tk
Рисунок 23. Накопление радиофармпрепаратов
A167Ytk
18
A167Ysr39-tk
F-FEAU и
18
F-FHBG в образцах
опухолевой ткани, выраженное в % от введенной дозы на 1 г ткани (% ID/г ткани).
5.1. In vitro оценка эффективности флюоресцентной визуализации и количественной
оценки CD3 и CAR-зависимой активации Т-лимфоцитов, трансдуцированных NFATрегулируемой ген-репортерной системой
С целью оценки мониторинга CD3- и CAR-зависимой активации in vitro, а в
дальнейшем и для in vivo неинвазивной оценки, клетки предшественники Т-лимфоцитов
человека (Jurkat), были трансдуцированы: 1) химерным антиген специфическим
рецептором (Pz1); 2) ген-репортерной системой A167Ysr39tk/GFP с селективной
экспрессией репортерного гена при активации NFAT (репортерный ген находится в
41
транскрипторной
зависимости
от
искусственного
NFAT-промотора
(NFAT-
A167Ysr39tk/GFP)); 3) химерным репортерным геном dCKDM/RFP, экспрессия которого
находится под контролем LTR (постоянный промотор) (рис. 24, а, б, в).
Химерный рецептор (Pz1)
а
PSMA specific
J591-­‐scFv
hinge
IC CD3ζ
Репортерные гены
б
SD
5’LTR
Ψ+
SA
NFAT
A167Ysr39tk/GFP
sv40
NEO
sv40
NEO
3’LTR
в
SD
5’LTR
Ψ+
SA
dCKDM/RFP
3’LTR
Рисунок 24. Структура экспериментальных векторов, кодирующих а - химерный рецептор
Pz1, б - NFAT-регулируемую ген-репортерную систему NFAT-A167Ysr39tk/GFP; в - генрепортерную систему dCKDM/RFP.
При помощи проточного сортирующего цитофлюориметра (по флюоресцентному
сигналу RFP и APC), и после селекции клеток с использованием неомицина (500мкг/мл)
была получена клеточная популяция с максимальной позитивной трансдукцией. При
контрольной проточной цитофлюометрии более чем 90% Jurkat клеток стабильно
экспрессировали Pz1 (окраска при помощи APC) и ген-репортерную систему dCKDM/RFP
находящуюся под индукцией постоянного LTR промотера. Эффективность трансдукции
Jurkat клеток, векторами несущими Pz1 и dCKDM/RFP, составила > 85%. Следует
отметить, что без проведения специфической стимуляции Jurkat клеток, при контрольной
проточной цитофлуометрии, экспрессия GFP в Jurkat клетках, трансдуцированных генрепортерной системой NFAT-A167Ysr39tk/GFP, не превышала 1%, (рис. 25 б, в).
Чрез 24-48 часа после начала in vitro стимуляция Jurkat клеток анти-CD3
антителами или на PC3 клетках, несущих простат специфический мембранный антиген
(PC3PIP), с помощью проточной цитофлюориметри, выполняли оценку активированных
Jurkat клеток, трансдуцированных индуцируемой ген-репортерной системой NFATA167Ysr39tk/GFP. Нетрансдуцированные Jurkat клетки служили в качестве негативного
контроля. Полученные данные проточной цитофлюориметрии представлены на (рис. 25).
42
а
RFP
в
Pz1
RFP
б
GFP
е
RFP
д
Pz1
Pz1
г
RFP
GFP
Рисунок 25. Оценка экспрессии химерного рецептора Pz1 и ген-репортерных систем
NFAT-A167Ysr39tk/GFP и dCKDM/RFP после in vitro стимуляции Jurkat клеток с PC3
клетками, несущими простат специфический мембранный антиген (PC3PIP).
а –
нетрансдуцированные Jurkat клетки (контроль); б – экспрессия NFAT-A167Ysr39tk/GFP и
Pz1 до стимуляции; в - экспрессия NFAT-A167Ysr39tk/GFP и dCKDM/RFP до стимуляции;
г – экспрессия dCKDM/RFP и Pz1 после стимуляции; д – экспрессия NFATA167Ysr39tk/GFP и Pz1 после стимуляции; е – экспрессия NFAT-A167Ysr39tk/GFP и
dCKDM/RFP после стимуляции. Данные проточной цитофлюориметрии.
С целью предварительной оценки индуцированной экспрессии репортерных генов,
достаточной для проведения ПЭТ-визуализации локализации и активации Jurkat клеток in
vivo, была выполнена оценка накопления в трансдуцированных Jurkat клетках
радиофармпрепаратов 3Н-FEAU и 3Н-PCV in vitro. За 48 ч до оценки накопления
радиофармпрепаратов в Jurkat клетках, трансдуцированных химерным рецептором Pz1 и
репортерными генами NFAT-A167Ysr39tk/GFP и dCKDM/RFP, проводилась стимуляция
Jurkat клеток анти-CD3-антителами. Нетрансдуцированные Jurkat клетки выступали в
качестве отрицательного контроля (рис. 26).
43
400
3
H-FEAU
3
H-PCV
мл/мг
300
200
100
)
/T
(N
/S
)
K
D
M
(S
)
rT
K
+d
C
(N
D
M
7Y
s
16
7Y
s
N
N
FA
TA
FA
TA
16
16
TA
K
rk
at
Ju
)
7Y
s
rT
K
+d
C
+d
C
/T
(N
D
M
K
rT
K
rk
at
+d
C
rT
K
Ju
7Y
s
16
TA
FA
N
N
FA
(N
/S
)
K
D
M
(S
)
0
Рисунок 26. Интенсивность накопления (Кi) in vitro радиофармпрепарата Jurkat клетками,
трансдуцированными экспериментальными векторами до и после их стимуляции антиCD3-антителами. Накопление 3Н-FEAU в Jurkat клетках, трансдуцированных Pz1 NFATA167Ysr39tk/GFP и dCKDM/RFP, мало отличались друг от друга при его оценке в клетках
до и после стимуляции и были статистически значимо выше (р<0,05), чем накопление в
нетрансдуцированных Jurkat клетках. Накопление 3Н-PCV в нестимулированных Jurkat
клетках, трансдуцированных Pz1, NFAT-A167Ysr39tk/GFP и dCKDM/RFP, не отличалось
от накопления в нетрансдуцированных клетках. Однако, после стимуляции, полученные
3
значения накопление
Н-PCV были статистически значимо выше (р<0,05), чем в
трансдуцированных Jurkat клетках до стимуляции и нетрансдуцированных клетках.
5.2. ПЭТ визуализация локализации и CD3-зависимой активации Т-лимфоцитов на
модели Jurkat инфильтратов используя двойную ген-репортерную систему
ПЭТ-визуализация CD3-зависимой активации Jurkat клеток in vivo проводилась как
описано в методах. По достижении инфильтратами размеров 0.5-1.0 см в диаметре, что
было
необходимо
радиофармпрепараты
стимуляции,
в
для
18
их
достаточной
F-FEAU и
Jurkat
18
васкуляризации,
внутривенно
вводили
F-FHBG. Вначале оценивалось накопление РФП, до
инфильтратах
из
клеток,
A167Ysr39tk/GFP и dCKDM/RFP. Первым водили
18
экспрессирующих
Pz1,
NFAT-
F-FEAU, через 24-часа вводили
18
F-
FHBG. ПЭТ исследование выполняли через 2-часа после введения вышеуказанных РФП.
До стимуляции было получено высокое накопление 18F-FEAU (рис. 27, а), в то время как
накопление 18F-FHBG было неотличимо от фонового сигнала (рис. 27, б).
Через 24 и 48 часов от начала стимуляции, анти-CD3-антителами, повторно вводили
18
F-
FHBG и спустя 2 часа выполняли ПЭТ. Было получено достоверное накопление 18F-FHBG
44
в
Jurkat
инфильтратах
из
клеток,
экспрессирующих
NFAT-A167Ysr39tk/GFP
и
dCKDM/RFP ген-репортерные системы (рис. 27, в, г).
18F-FEAU
до стимуляции
18F-FHBG
до стимуляции
%ID/см3 ткани
10
5.0
3.0
24-ч после стимуляции
1.5
0.5
0
48-ч после стимуляции
Рисунок 27. Оценка накопления
18
F-FEAU и
18
F-FHBG при помощи ПЭТ в Jurkat
инфильтратах из клеток, экспрессирующих Pz1, NFAT-A167Ysr39tk/GFP и dCKDM/RFP
ген-репортерные системы до и после стимуляции анти-CD3-антителами. а, б – накопление
18
F-FEAU и
18
F-FHBG до стимуляции; в, г – накопление
18
F-FHBG через 24 и 48 часов
после системного введения анти-CD3-антител.
Выявленное накопление
18
F-FHBG, который является специфическим субстратом для
A167Ysr39tk репортерного гена, позволяет сделать вывод об эффективной TCRспецифической стимуляции анти-CD3-антителами, что в свою очередь приводило к
активации NFAT- и как следствие к экспрессии данного репортерного гена.
Наличие
TCR-специфической
стимуляции
анти-CD3-антителами
в
Jurkat
инфильтратах из клеток, экспрессирующих Pz1, NFAT-A167Ysr39tk/GFP и dCKDM/RFP,
было подтверждено гистологическим методом (рис. 28, а, б, в).
Иммунофлюоресцентный анализ
подтвердил экспрессию GFP только в Jurkat
инфильтратах после стимуляции анти-CD3-антителами (рис. 28, б, в). Без стимуляции
иммунофлюоресцентный анализ отражал только экспрессию RFP (рис. 28, а).
45
Рисунок
28.
Иммунофлюоресцентный
экспрессирующих
Pz1,
иммунофлюоресцентный
анализ
Jurkat
NFAT-A167Ysr39tk/GFP
анализ
Jurkat
инфильтратов
и
инфильтрата
из
dCKDM/RFP.
до
клеток
а
стимуляции;
б
-
иммунофлюоресцентный анализ Jurkat инфильтрата после стимуляции анти-CD3антителами. в - иммуногистохимия Jurkat инфильтрата после стимуляции, данный слайд
показывает наличие NFAT-активации (желтая окраска - это результат взаимодействия
зеленого и красного сигнала) приводящей к экспрессии GFP в Jurkat клетках с постоянной
экспрессией RFP. С помощью анти-GFP-антител оценивали NFAT-активацию; используя
анти-RFP-антитела подтверждалась стабильная экспрессия RFP (красная окраска). Для
окраски ядер клеток использовали 4,6-диамидино-2-фенилинодол (синий).
6. In vivo неинвазивная оценка возможности элиминации опухолевых клеток
экспрессирующих ген-репортерные системы A167Ysr39tk и/или dCKDM
Одним
из
важных
условий
оптимальной
ген-репортерной
системы
для
неинвазивной визуализации следует считать возможность удаления данной системы из
организма при необходимости. Достижение этой цели возможно только в том случае,
когда ген выступающей в роли репортера обладает и «суицидальной активностью» при
взаимодействии с пролекарствами. В настоящей работе in vitro была продемонстрирована
высокая чувствительность к ганцикловиру и цитозару клеток, трансдуцированных
созданными репортерными генами для ядерной визуализации A167Ysr39tk и dCKDM
соответственно (см. рис. 21 и табл. 5,6).
Полученные in vitro результаты были подтверждены и результататами in vivo
экспериментов.
Следует
подчеркнуть,
что
такого
рода
исследования
требуют
многократной оценки и сбора данных в течение всего времени эксперимента. Учитывая
данное обстоятельство и принимая во внимание тот факт, что использование репортерных
генов для оптической визуализации и биолюминесцентной камеры является менее
затратным, все клеточные линии используемые в этом эксперименте были дополнительно
трансдуцированы ретровирусным вектором LTR-RFP/Fluc-LTR несущим репортерный ген
файрфлай люциферазы (Fluc) для оптической визуализации, что позволило проводить
многократную, неинвазивную оценку опухолей растущих из трансдуцированных клеток
репортерными генами для ядерной визуализации A167Ysr39tk и dCKDM. Используя
биолюминесцентную камеру выполняли количественную оценку получаемого сигнала у
животных несущих опухоли растущих из трансдуцированных U87 клеток до и после
лечения ганцикловиром или цитозаром. Дизайн эксперимента представлен на (рис. 29)
46
Рисунок 29. Дизайн in vivo эксперимента определения возможности удаления клеток,
трансдуцированных созданными репортерными генами для ядерной визуализации
A167Ysr39tk и dCKDM обладающими «суицидальной» активностью к пролекарствам
ганцикловиру и цитозару, соответственно. 1-я группа: получала ганцикловир и состояла
из мышей развивших опухоли из U87 клеток экспрессирующих репортерный ген Fluc для
оптической визуализации и ген-репортерные системы для ядерной визуализации:
A167Ysr39tk (левое плечо мыши) и dCKDM (правое плече мыши), и мышей развивших
опухоли из U87 клеток, трансдуцированых только репортерным геном Fluc для
оптической визуализации (правое и левое плечо мыши), которые выступали в качестве
контроля; 2-я группа: получала цитозар и состояла из мышей развивших опухоли из U87
клеток экспрессирующих репортерный ген Fluc для оптической визуализации и генрепортерную систему для ядерной визуализации: dCKDM (левое плечо мыши), и мышей
развивших опухоли из U87 клеток, трансдуцированых только репортерным геном Fluc для
оптической визуализации (правое и левое плечо мыши), которые выступали в качестве
контроля.
Инициально > 95% клеток опухолей экспрессировали репортерный ген Fluc для
биолюминесцентной визуализации.
Мышам 1-й группы, развившим опухоли из U87 клеток экспрессирующих
репортерный ген Fluc и ген-репортерные системы для ядерной визуализации: A167Ysr39tk
(левое плечо мыши) и dCKDM (правое плече мыши), проводили ежедневно,
интраперитонеальное введение ганцикловира в дозе 100мг/кг. Оценка роста опухолей и их
ответ
на
терапию
ганцикловиром
выполнялась,
при
помощи
неинвазивной
биолюминесцентной визуализации, на 1, 6, 12 и 15 день введения препарата. Полученные
результаты представлены на (рис. 30).
47
Рисунок 30. Оценка роста опухолей и их ответ на терапию ганцикловиром при помощи
неинвазивной биолюминесцентной визуализации на 1, 6, 12 и 15 день введения препарата:
а – верхний ряд: мыши, развивших опухоли из U87 клеток, трансдуцированых только
репортерным геном Fluc (правое и левое плечо мыши) выступали в качестве контроля;
нижний ряд: мыши, развивших опухоли из U87 клеток экспрессирующих репортерный ген
Fluc для оптической визуализации и ген-репортерные системы для ядерной визуализации:
A167Ysr39tk (левое плечо мыши) и dCKDM (правое плечо мыши); б – количественная
оценка выделенных фотонов образовавшихся в результате реакции окисления Dлюциферина катализируемой белком файрфлай люциферазы и представлена как
количество пикселей в секунду на см2 (п/сек/см2). L – левое плечо, R – правое плечо.
Мышам 2-й группы, развившим опухоли из U87 клеток экспрессирующих
репортерный ген Fluc и ген-репортерную систему для ядерной визуализации: dCKDM
(левое плечо мыши) проводили ежедневно, интраперитонеальное введение цитозара в
дозе 100 мг/кг. Оценка роста опухолей и их ответ на терапию цитозаром выполнялась, при
помощи неинвазивной биолюминесцентной визуализации, на 1, 6, 12 и 15 день введения
препарата. Полученные результаты представлены на (рис. 31).
48
Рисунок 31.
Оценка роста опухолей и их ответ на терапию цитозаром при помощи
неинвазивной биолюминесцентной визуализации на 1, 6, 12 и 15 день введения препарата:
а – верхний ряд: мыши, развивших опухоли из U87 клеток, трансдуцированых только
репортерным геном Fluc (правое и левое плечо мыши) выступали в качестве контроля;
нижний ряд: мыши, развивших опухоли из U87 клеток экспрессирующих репортерный
ген Fluc для оптической визуализации и ген-репортерную систему для ядерной
визуализации: dCKDM (левое плечо мыши); б – количественная оценка выделенных
фотонов образовавшихся в результате реакции окисления D-люциферина катализируемой
белком файрфлай люциферазы и представлена как количество пикселей в секунду на см2
(п/сек/см2). L – левое плечо.
Обсуждение
Использование ПЭТ с
18
F-ФДГ в онкологии и у пациентов с лимфомами в
частности для инициальной диагностики и оценки ответа на терапию в настоящее время
становится неотъемлемой частью протоколов ведения таких больных и является одним из
наиболее чувствительных и специфичных методов. Накопление
18
F-ФДГ в тканях прямо
пропорционально метаболизму глюкозы в клетках. Однако, повышенный метаболизм
клетки далеко не всегда свидетельствует о ее злокачественности, что в свою очередь
влияет на специфичность данного метода. Тот факт, что специфичность накопления
18
F-
ФДГ далека от идеальной заставляет вести беспрерывный поиск радиофармпрепаратов с
лучшей тропностью к опухолевой ткани. В ряде доклинических и клинических
исследованиях была показана зависимость между накоплением
18
F-ФЛТ при ПЭТ и
пролиферативной активностью клеток, что, в отличии от метаболизма глюкозы, можно
49
считать более специфичным маркером для оценки опухоли (A.Buck, 2003; L.Kenny, 2005;
A.Buck, 2006; F.Eckel, 2009). Однако, прогностическая взаимосвязь накопления 18F-ФЛТ с
результатом лечения и выживаемостью у пациентов с лимфомами высокой степени
злокачественности требует широкого изучения.
Результаты данного исследования показали взаимосвязь между полученными
значениями SUVmax (ПЭТ/18F-ФЛТ) у пациентов до начала терапии и ответом на терапию.
Так, инициальное значение SUVmax было достоверно ниже у пациентов, достигших
полного ответа (6,3±1,6), по сравнению с пациентами, не достигшими полной ремиссии
SUVmax 9,5±3,2 (р<0,05). Таким образом, была показана взаимосвязь между полученными
значениями SUVmax после ПЭТ/18F-ФЛТ, выполненного до начала терапии, и достижением
полной ремиссии, что теоретически может использоваться как прогностический фактор.
Полученные нами данные сопоставимы с данными других авторов, которые также
показали взаимосвязь значений накопления
18
F-ФЛТ у пациентов с лимфомой до начала
лечения и ответа на терапию (K.Herrmann, 2011). Результаты нашего исследования
продемонстрировали взаимосвязь между PFS и отрицательным результатом в накоплении
18
F-ФЛТ после П-ПЭТ (рис.7 и рис.8). Значения SUVmax были достоверно выше у
пациентов с диагностированным рецидивом или прогрессией заболевания чем у
пациентов без рецидива. Было показано, что полученные значения SUVmax 18F-ФЛТ после
П-ПЭТ мало отличались от значений SUVmax полученных после З-ПЭТ у пациентов с
остаточным образованием диагностированном на КТ. Данное наблюдение позволяет
предположить более тесную временную взаимосвязь между снижением пролиферативной
активности опухолевых клеток по сравнению с их метаболической активностью в ответ на
лечение и, как следствие, дает возможность проводить оценку раннего ответа на терапию,
используя ПЭТ с 18F-ФЛТ.
Анализ полученных данных показал, что использование ПЭТ с
18
F-ФЛТ у
пациентов с ДВККЛ высокой степени злокачественности не уступал по своей
диагностической значимости ПЭТ с
18
F-ФДГ на инициальном этапе диагностики и после
окончания терапии. Была установлена взаимосвязь между значениями инициального
накопления
18
F-ФЛТ и результатом лечения: пациенты у которых после окончания
лечения был зарегистрирован ПО, инициально имели значения накопления 18F-ФЛТ ниже
чем пациенты с ЧО. Дополнительно было показано, что использование ПЭТ с
18
F-ФЛТ
дает возможность проводить раннюю оценку ответа на терапию на 10-12 сутки после
окончания первого курса, что как минимум на 6 недель раньше, чем время оценки с ФДГ.
Для получения достоверных диагностических критериев, позволяющих стратифицировать
пациентов по исходу заболевания при лимфомах высокой степени злокачественности на
50
основе накопления
18
F-ФЛТ необходимо дальнейшее изучение на большей группе
пациентов со строгим соблюдением сроков выполнения ПЭТ с
18
F-FLT и интервалов
между курсами противоопухолевой терапии, что позволит систематизировать полученные
данные и определить, может ли данная методика выступать в качестве адекватного
«прогностического маркера». Дополнительно, определение пролиферативной активности
18
клеток опухоли, используя
F-ФЛТ, позволяет комплексно оценить активность
транспортной и фосфорилирующей системы клетки. Такая возможность оценки может
быть использованы для нормализации показателей накопления радиофарпрепаратов
производных нуклеозидов при их количественной оценке у пациентов с помощью ПЭТ в
других методах молекулярной визуализации, в частности с использованием репортерных
генов.
Залогом эффективного, широкого использования клеточной терапии является
возможность ее неинвазивного контроля. В этой связи использование молекулярной
визуализации, в частности с применением репортерных генов, может существенно
повлиять на прогресс Т-клеточной терапии и вывести ее на существенно новый уровень.
Нами были успешно созданы репортерные гены на основе мутированных
вариантов
гена
HSV1-tk
и
гена
деоксицитидинкиназы
человека,
обладающие
специфичностью к радиофармпрепаратам пуриновых и пиримидиновых производных
соответственно, для изучения различных (двух и более) молекулярно-биологических
процессов в пределах одного организма с помощью ПЭТ.
Так, на основе гена человеческой деоксицитидинкиназы был успешно создан и
протестирован репортерный ген dCKDM). Созданный репортерный ген dCKDM в
сочетании с клинически перспективной репортерной пробой может быть использован для
неинвазивной ПЭТ-визуализации трансдуцированных Т-клеток человека. Было показано,
что лимфоциты человека могут быть успешно трансдуцированны репортерным геном
деоксицитидинкиназы человека и химерным антигенным рецептором без изменения
фенотипа и функциональной активности ген-модифицированных Т-клеток (см. рис. 13,
14). Было подтверждено, что репортерный ген dCKDM обладает суицидальной
активностью в сочетании с Ara-C (E.Sabini, 2003; S.Hazra, 2009) (см. табл. 5), что дает
возможность элиминировать генетически модифицированные клетки из организма при
необходимости. Экспрессия dCKDM в трансдуцированных Т-клетках не влияла на
цитотоксическую активность последних в отношении клеток-мишеней (см. рис. 14) и
позволяла проводить многократной неинвазивный мониторинг ген-модифицированных Тклеток используя ПЭТ с
18
F-FEAU (см. рис. 16). Таким образом, созданный нами
репортерный ген dCKDM может быть использован для неинвазивного мониторирования
51
распространения и локализации Т-клеток в зоне опухолей-мишеней с помощью ПЭТ и
радиофармпрепарата 18F-FEAU в клинических протоколах адоптивной иммунотерапии.
Вторым немаловажным фоктором для успешного применения клеточной терапии,
кроме
неинвазивного
мониторинга
ген-модифицированных
Т-клеток,
является
возможность неинвазивной оценки активации Т-клеток. Для выполнения такой задачи
необходимо
наличие
репортерных
генов
обладающих
специфичностью
к
соответствующему радиофармпрепарату и при этом один из репортерных генов должен
находиться под контролем индуцируемого промотора, индукция которого происходит при
активации Т-клеток. Как известно, одним из ключевых моментом в процессе активации Тклетки через Т-клеточный рецептор (TCR) является активация ядерного фактора
активированных лимфоцитов (nuclear factor of activated lymphocytes - NFAT) (C.Chow,
1999). Этот транскрипционный фактор и было решено использовать как индуцируемый
промотор в создаваемой нами ген-репортерной системе.
При
создании
репортерного
гена
обладающего
специфичностью
к
радиофармпрепаратам производным пуринов наше внимание привлекли несколько
мутированных
вариантов
HSV1-tk,
выделенных
у
пациентов,
резистентных
к
противовирусным препаратами (S.Kussmann-Gerber, 1998). На основе мутированного
варианта тимидин киназы-HSV1 (sr39tk), были созданы новые репортерные гены,
обладающие специфичностью в отношении пиримидиновых и ациклогуанозиновых
производных с улучшенной фосфорилирующей активностью. Так, замена аргинина на
глутамин в 176 положении, позволила создать новый репортерный ген R176Qsr39tk, белок
которого
способен
эффективно
фосфорилировать
преимущественно
производные
пиримидинов, а мутация в гене sr39tk с заменой аланина на тирозин в 167 положении
привела
к
созданию
нового
репортерного
гена
A167Ysr39tk,
обладающего
специфичностью в отношении ациклогуанозиновых производных. Результаты ПЭТвизуализации и оценка накопления радиофармпрепаратов в образцах тканей подтвердили
специфичность и высокое содержание
18
F-FHBG в опухолях, экспрессирующих
репортерный ген A167Ysr39tk (см. рис. 22, 23), в опухолях растущих из клеток
трансдуцированных репортерным геном R176Qsr39tk специфичности в отношении
вводимых радиофармпрепаратов получено не было. Таким образом, для ПЭТвизуализации двух независимых молекулярно-биологических процессов или клеточных
популяций в одном организме при последовательном введении радиомеченных проб
FEAU и
18
18
F-
F-FHBG необходимо использовать репортерные гены dCKDM и A167Ysr39tk
соответственно.
52
Для неивазивной визуализации активации ген-модифицированных Т-клеток, Тклеточная линия человека (Jurkat), была успешно трансдуцирована: 1) химерным антиген
специфическим рецептором (Pz1); 2) химерным репортерным геном A167Ysr39tk/GFP с
селективной экспрессией репортерного гена при активации NFAT (репортерный ген
находился в транскрипторной зависимости от искусственного NFAT-промотора (NFATA167Ysr39tk/GFP)); 3) химерным репортерным геном dCKDM/RFP, экспрессия которого
находилась под контролем LTR (постоянный промотор) (см. рис. 24, а, б, в). Результаты
ПЭТ сканирования полученные в in vivo экспериментах до и после проведения
специфической стимуляции, с использованием радиофармпрепаратов обладающих
специфичностью к созданным репортерным генам, продемонстрировали возможность
неинвазивной визуализации активации введенных ген-модифицированных Т-клеток (рис.
27 а, б).
В
настоящей
неинвазивной
работе,
визуализации
была
успешно
локализации
и
продемонстрирована
CD3-зависимой
возможность
активации
ген-
модифицированных Т-лимфоцитов, экспрессирующих двойную ген-репортерную систему
(dCKDM и NFAT/A167Ysr39tk), с использованием специфических радиофармпрепаратов
и ПЭТ. Использование и дальнейшее изучение созданных методов молекулярной
визуализации будет способствовать совершенствованию неинвазивного мониторинга
локализации и активации ген-модифицированных Т-лимфоцитов, что позволит повысить
эффективности адоптивной Т-клеточной терапии.
Одним из важных условий для использования ген-репортерной системы следует считать
наличие возможности удаления данной системы из организма при необходимости. Это
возможно только в том случае, когда ген выступающей в роли репортера обладает и
«суицидальной
активностью»
при
взаимодействии
с
пролекарствами.
Продемонстрирована высокая чувствительность к ганцикловиру и цитозару клеток,
трансдуцированных созданными репортерными генами A167Ysr39tk и dCKDM, позволяет
использовать данные репортерные гены в протоколах клеточнойтерапии и дает
возможность в случае необходимости проводить элиминацию ген-модифицированных Тклетокиспользуя соответствующие пролекарства.
53
Выводы
1. В результате проведенных исследований на группе пациентов с ДВККЛ было
показано, что использование ПЭТ с
18
F-ФЛТ не уступало ПЭТ с
18
F-ФДГ в
инициальной диагностиике очагов поражения (количество выявленных очагов
поражения при ПЭТ с
18
F-ФЛТ соответствовало количеству определенных очагов
при ПЭТ с 18F-ФДГ). На основании экспериментальных данных полученных in vitro
было показано, что использование радиофармпрепарата 3Н-тимидина позволяет
комплексно оценить активность транспортной и фосфорилирующей системы
клетки, необходимых для накопления нуклеозидов. Для нормализации показателей
накопления используемых радиофармпрепаратов производных нуклеозидов у
пациентов, которым введены клетки,
трансдуцированные ген-репортарными
системами, должны быть использованы данные ПЭТ с 18F-ФЛТ.
2. Проведенные исследования доказали, что использование ПЭТ с 18F-ФЛТ сокращает
сроки оценки раннего ответа на проводимую противоопухолевую терапию у
пациентов с ДВККЛ на 6 недель по сравнению с ПЭТ с
18
F-ФДГ. В результате
анализа установлено, что общая выживаемость и выживаемость до прогрессии в
группе пациентов негативных по накоплению
18
F-ФЛТ составила 86,5 и 85,1%
соответственно, и была достоверно выше (p<0,05) при сравнении с общей
выживаемостью и выживаемостью до прогрессии в группе пациентов позитивных
по накоплению радиофармпрепарата после промежуточной ПЭТ 41,6% и 35,7%
соответственно.
3. В результате проведенных исследований созданы и протестированы генрепортерные
системы:
A167Ysr39tk
обладающие
специфичностью
к
радиофармпрепаратам производных пуринов (18F-FHBG) и R176Qsr39tk и dCKDM
обладающие специфичностью к радиофармпрепаратам производных пиримидинов
(18F-FEAU). Установленный в
радиофармпрепаратов
in vitro экспериментах уровень накопления
производных
пуринов
и
пиримидинов
клетками,
трансдуцированными созданными ген-репортерными системами A167Ysr39tk,
R176Qsr39tk и dCKDM
(Кi: 0,41; 0,29; и 0,32 среды/мин/г клеток) является
достаточным для выполнения ПЭТ визуализации. Наличие специфичности к
различающимся радиофармпрепаратам в созданных ген-репортерных системах
позволяет
неинвазивную
оценку
двух
и
более
молекулярно-генетических
процессов в пределах одного организма используя ПЭТ.
4. В проведенных доклинических исследованиях показана возможность высокой,
стабильной
совместной
трансдукции
Т-клеток
человека
человеческим
54
репортерным геном dCKDM вместе с химерным рецептором к антигену рака
простаты.
Выполненные
in
vitro
исследования
показали
неизменную
функциональную активность человеческих Т-лимфоцитов, трансдуцированных
созданными
ген-репортерными
системами.
ПЭТ
исследования
на
экспериментальных моделях животных с системной метастатической опухолью
рака предстательной железы доказали возможность проведения многократной, на
день 1 и день 3 неинвазивной оценки локализации специфических Т-лимфоцитов
человека с помощью созданного репортерного гена dCKDM и 18F-FEAU.
5. Результаты
экспериментов
продемонстрировали
возможность
неинвазивной
оценки активации Т-лимфоцитов как in vitro так и in vivo с помощью ПЭТ и
18
F-
FHBG благодаря созданой NFAT-регулируемой ген-репортерной системе (NFATA167Ysr39tk). Одновременно, была показана возможность ПЭТ визуализации
миграции и распределения системно вводимых ген-модифицированных Т-клеток,
трансдуцированных
второй,
стабильно
экспрессируемой,
ген-репортерной
системой dCKDM с 18F-FEAU.
6. В исследовании суицидальной активности ген-репортерных систем A167Ysr39tk и
dCKDM с соответствующим пролекарствами - ганцикловиром и цитарабином было
показано торможение пролиферации трансгенных клеток в 30 раз (для каждой из
систем) под неинвазивным визуализационным контролем, позволяющее при
необходимости
устранить
побочные
эффекты
и
элиминировать
ген-
модифицированные клетки.
Практические рекомендации
1.
18
F-ФЛТ для ПЭТ следует использовать для достижения более низкого фонового
накопления при исследованиии опухолей, располагающихся в головном мозге,
грудной клетке и периферических тканях конечностей.
2. Визуализация ПЭТ с 18F-ФЛТ, проводимая на сроках (до 2 недель) после окончания
химиотерапии позволяет оценить ранний ответ заболевания на терапию.
3. При проведении визуализации ПЭТ с репортерными генами, специфичными к
пуринам и пиримидинам необходимо использовать ПЭТ с
18
F-ФЛТ в качестве
метода нормализации интенсивности сигнала по отношению к пролиферативной
активности.
4. Репортерный ген dCKDM может быть использован в протоколах Т-клеточной
терапи
для
осуществления
неинвазивной
визуализации
локализации
и
персистенции Т-клеток.
55
5. Репортерные гены – мутированный вариантт тимидинкиназы HSV1 обладающий
специфичностью к радиофармпрепаратам произфодных пуринов и мутированный
вариант гена деоксицитидинкиназы человека обладающий специфичностью к
радиофармпрепаратам производных пиримидинов могут быть использованы для
изучения
двух
молекулярно-биологических
процессов
в
пределах
одного
организма.
6. При возникновении неконтолируемой пролиферации или возниконвнении тяжелых
побочных
эффектов
РТПХ
(в
протоколах
клеточной
терапии)
показано
использование ганцикловира для клеток, трансдуцированных репортерным геном
A167Y39tk или цитозар для клеток, трансдуцированных репортерным геном
dCKDM.
7. Возможность неинвазивной визуализации Т-клеточной терапии с использованием
ген-репортерных системы не только приведет к более широкому пониманию
данного вида терапии, но и позволит проводить коррекцию дозы введенных клеток
в зависимости от терапевтического эффекта, а также контролировать побочные
эффекты и эффективность их устранения при использовании репортерных генов с
«суицидным» эффектом.
56
Список публикаций по теме диссертации
1. Likar Y, Dobrenkov K, Olszewska M, Vider E, Shenker L, Cai S, Hricak H, Ponomarev V. A new
HSV-tk mutant for PET imaging with specificity for purine nucleoside analogs and high phosphorylation
activity. Joint Molecular Imaging Conference - 2007, Providence, Rhode Island, US.
2. Dobrenkov K, Dabrowska M, Likar Y, Vider E, Shenker L, Sadelain M, Ponomarev V. In vivo
Monitoring of Efficacy of Human Genetically Modified PSMA-Specific Lymphocytes. Molecular
Therapy, 2007; Vol. 15, Suppl. 1, S592.
3. Dobrenkov K, Olszewska M, Likar Y, Shenker L, Hricak H, Sadelain M, Ponomarev V. Bicistronic
expression vector design for PET imaging of prostate cancer-targeted genetically modified human Tlymphocytes. Joint Molecular Imaging Conference - 2007, Providence, Rhode Island, US.
4. Likar Y, Dobrenkov K, Olszewska M, Vider E, Shenker L, Cai S, Pillarsetty N, Hricak H, Ponomarev
V. A new acycloguanosine-specific supermutant of herpes simplex virus type 1 thymidine kinase suitable
for PET imaging and suicide gene therapy for potential use in patients treated with pyrimidine-based
cytotoxic drugs. J Nucl Med. 2008 May; 49(5):713-20
5. Dobrenkov K, Olszewska M, Likar Y, Shenker L, Gunset G, Cai S, Pillarsetty N, Hricak H, Sadelain
M, Ponomarev V. Monitoring the Efficacy of Adoptively Transferred Prostate Cancer-Targeted Human T
Lymphocytes with PET and Bioluminescence Imaging. J Nucl Med. 2008 Jul;49(7):1162-70.
6. Dobrenkov K, Olszewska M, Likar Y, Shenker L, Hricak H, Sadelain M, Ponomarev V. PET/CT
imaging of PSMA-targeted human T-cells in systemic prostate cancer model. Molecular Therapy, 2008;
Vol. 16, Suppl. 1, S16.
7. Likar Y, Dobrenkov K, Olszewska M, Vider J, Shenker L, Cai S, Hricak H, Ponomarev V. A new
HSV1-tk acycloguanosine specific mutant for PET imaging for potential use in patients treated with
pyrimidine-based cytotoxic drugs. J Nucl Med. 2008; Vol. 49, Suppl. 1, 331P.
8. Likar Y, Dobrenkov K, Olszewska M, Vider J, Shenker L, Cai S, Hricak H,
Ponomarev V.
Development of HSV1-tk mutants with altered activity towards acycloguanosine analogs. J Nucl Med.
2008; Vol. 49, Suppl. 1, 333P.
9. Dobrenkov K, Olszewska M, Likar Y, Shenker L, Cai S, Burnazi E, Hricak H, Larson S, Ponomarev
V. Imaging androgen dependent signaling pathway using multi-modality reporter genetic system. Joint
World Molecular Imaging Congress - 2008, Nice, France.
10. Ликарь Ю.Н., Добреньков К.В., Пономарев В.Б. Оценка эффективности использования
репортерной пробы FIAU, меченной
124
I или
18
F, для определения экспрессии репортерного гена
HSV1-tk при позитронно-эмиссионной томографии. Материалы VI симпозиума «Биологические
основы терапии онкологических и гематологических заболеваний». Онкогематология 2008; 4: 53.
11. Ликарь Ю.Н., Добреньков К.В., Пономарев В.Б. Создание модифицированных вариантов
репортерного гена HSV1-tk, обладающих высокой специфичностью к нуклеозидным репортерным
пробам, для визуализации различных клеточных линий в пределах одного организма с помощью
57
позитронно-эмиссионной томографии. Материалы VI симпозиума «Биологические основы
терапии онкологических и гематологических заболеваний». Онкогематология 2008; 4: 53–54.
12. Likar Y, Dobrenkov K, Olszewska M, Shenker L, Cai S, Hricak H, Ponomarev V. PET imaging of
HSV1-tk mutants with acquired specificity toward pyrimidine- and acycloguanosine-based radiotracers.
Eur J Nucl Med Mol Imaging (2009) 36:1273–1282.
13. Likar Y, K. Dobrenkov, L. Shenker, J. Zurita, S. Cai, E. Burnazi, H. Hricak, V. Ponomarev. Preclinical evaluation of
124
I-FIAU and
18
F-FIAU for the assessment of the HSV1-tk reporter gene
expression with PET. J Nucl Med. 2009; 50 (Supplement 2):1957.
14. Likar Y, J. Zurita, K. Dobrenkov, L. Shenker, A. Neschadim, J. Medin, L. James, S. Cai, H. Hricak,
V. Ponomarev. A new pyrimidine-specific human-derived reporter gene for PET imaging in humans:
truncated mutant deoxycytidine kinase. World Molecular Imaging Congress -2009, September 23-26,
Montreal, Canada.
15. Ликарь Ю.Н., Мороз М.А., Румянцев А.Г. Применение гена тимидинкиназы вируса простого
герпеса
в
качестве
суицидального
гена
в
протоколах
генной
терапии.
Вопросы
гематологии/онкологии и иммунопатологии в педиатрии. 2009; Том 8; №2; 31-35.
16. М.А. Мороз, Ю.Н. Ликарь, М.М. Дубровин, А.Г. Румянцев. Ген норадреналинового
транспортера человека в качестве мишени для визуализации онкологических заболеваний на
молекулярном уровне. Вопросы гематологии/онкологии и иммунопатологии в педиатрии. 2009;
Том 8; №2; 36-40.
17. Ликарь Ю.Н., Пономарев В.Б. Пиримидин- и ациклогуанозинспецифичные варианты
репортерного гена HSV1-tk как новые маркеры для позитронно-эмисионной томографии. Вопросы
гематологии/онкологии и иммунопатологии в педиатрии. 2009; Том 8; №3; 13-19.
18. Likar Y, J. Zurita, L. Shenker, M. Moroz, S. Cai, A. Neschadim, J. Medin, L. James, H. Hricak, M.
Sadeline, V. Ponomarev. A new human-derived reporter gene suitable for clinical PET imaging of T-cells
trafficking. Molecular Therapy, 2010; Vol. 18, Suppl. 1, S71.
19. Likar Y, J. Zurita, L. Shenker, S. Cai, M. Cantorias, H. Hricak, V. Ponomarev. New pyrimidinespecific human-derived reporter genes suitable for clinical PET imaging. J Nucl Med. May 2010; Vol. 51,
Suppl. 2, 154P.
20. Ликарь Ю.Н., Мороз М.А., Румянцев А.Г. Механизмы развития резистентности к
химиопрепаратам - аналогам нуклеозидов. Вопросы гематологии/онкологии и иммунопатологии в
педиатрии. 2010; Том 9; №2; 32-40.
21. Likar Y, Zurita J, Shenker L, Cai S, Neschadim A, Medin JA, Sadeline M, Hricak H, Ponomarev V.
A new pyrimidine-specific reporter gene: a mutated human deoxycytidine kinase suitable for PET during
treatment with acycloguanosine-based cytotoxic drugs. J Nucl Med. 2010 Sep; 51(9):1395-403.
22. Ликарь Ю.Н., Мороз М.А., Пономарев В.Б., Румянцев А.Г. Тимидинкиназа вируса простого
герпеса
1-го
типа
как
репортерный
ген
для
радионуклидной
диагностики.
Вопросы
гематологии/онкологии и иммунопатологии в педиатрии. 2011; Том 10; №3; 27-34.
58
23. O’Connor AE., Mc Gee MM., Likar Y., Ponomarev V., Callanan JJ., O’shea DF., Byrne AT.,
Gallagher WM. Mechanism of cell death mediated by a BF2-chelated tetraaryl-azadipyrromethene
photodynamic therapeutic: dissection of the apoptotic pathway in vitro and in vivo. Int J Cancer. 2012
Feb 1; 130(3):705-15.
24. Ликарь Ю.Н., Дубровин М.М. Использование позитронно-эмиссионной томографии с
ФДГ и
18
18
F-
F-FLT в диагностике лимфом. Вопросы гематологии/онкологии и иммунопатологии в
педиатрии. 2012; Том 11; №3; 33.
25. Ликарь Ю.Н., Дубровин М.М. Оценка раннего ответа на терапию и мониторинг остаточной
болезни у пациентов с лимфомой с помощью позитронно-эмиссионной томографии с
18
18
F-ФДГ и
F-FLT. Вопросы гематологии/онкологии и иммунопатологии в педиатрии. 2012; Том 11; №3; 34.
26. Ликарь Ю.Н., Мороз М.А., Пономарев В.Б. Использование мутированного варианта
человеческой деоксицитидинкиназы в качестве репортерного гена для оценки адоптивной Тклеточной терапии. Вопросы гематологии/онкологии и иммунопатологии в педиатрии. 2012; Том
11; №2; 24-31.
27. Ликарь Ю.Н., Дубровин М.М. Прогностическое значение оценки инициального поражения и
раннего ответа на терапию при помощи позитронно-эмиссионной томографии с
18
F-FLT у
пациентов с неходжкинскими лимфомами. Онкогематология 2012; №3; 30-37.
28. Дубровин М.М., Дубровина Е.С., Ликарь Ю.Н., Румянцев А.Г. Визуализация эффекта Тклеточной
терапии
с
помощью
позитронно-эмиссионной
томографии
при
лечении
лимфопролиферативных заболеваний, ассоциированных с вирусом Эпштейна–Барр. Вопросы
гематологии/онкологии и иммунопатологии в педиатрии. 2014; Том 13; №1; 32–38.
Сокращения
ТГСК – трансплантация гемопоэтических стволовых клеток
CD3 – комплекс белков на поверхности лимфоцитов, составляющих Тклеточный рецептор.
CMV – сytomegalovirus (цитомегаловирус).
CTL – cytotoxic lymphocyte (цитотоксические лимфоциты).
FACS – flowrescent activated cell sorting (проточная цитофлоуметрия).
GAPDH – glyceraldehyde-3-phosphate dehydrogenase (глицеральдегид-3фосфат дегидрогеназа).
GFP – green fluorescent protein (зеленый флюоресцирующий белок)
RFP – read fluorescent protein (красный флюоресцирующий белок).
LTR – long terminal repeat (длинный терминальный повтор).
NFAT - nuclear factor of activated lymphocytes (ядерного фактора
активированных лимфоцитов).
RT-PCR – reverse transcriptase polymerase chain reaction (обратной
транскриптазы полимеразная цепная реакция).
59
TCR – T-cell receptor (Т-клеточный рецептор).
ИЛ-2 – интерлейкин-2.
мРНК – матричная рибонуклеиновая кислота.
диффузная В-клеточная крупноклеточная лимфома - (ДВККЛ)
ПЭТ – позитрон-эмиссионная томография.
РФП – радиофармпрепарат
значения стандартизированного накопления - (Standardized Uptake Value, SUV)
ГСК – гемопоэтические стволовые клетки
РТПХ – реакция «трансплантат-против-хозяина»
ЦМВ –цитомегаловирус
ЭБВ – Эпштейн-Барр вирус
ПТЛЗ – посттрансплантационное лимфопролиферативное заболевание
ЭБВ–ПТЛЗ – Эпштейн-Барр ассоциированное посттрансплантационное лимфопролиферативное
заболевание
КМ – костный мозг
ПСКК – гемопоэтические стволовые клетки периферической крови
ПК – пуповинная кровь
3’-дезокси-3’-18F-флуоротимидин - (18F-ФЛТ)
фтордезоксиглюкоза меченная 18F - (18F-ФДГ)
химерный антиген специфический рецептор - (CAR)
полный ответ - (ПО)
частичный ответ - (ЧО)
рецидив или прогрессия заболевания - (ПЗ)
общей выживаемости - (OS; overal survival)
выживаемости до прогрессирования или рецидива - (PFS; progression free survival)
люцифераза файрфлай (firefly luciferase (Fluc))
2-флюоро-2’-деокси-1-β-D-арабинофуранозил-5-этилурацил - (FEAU)
пенцикловир - (PCV)
9-[4-флюоро-3-(гидроксиметил)бутил]гуанина (FHBG)
60
1/--страниц
Пожаловаться на содержимое документа